Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

The ecological background condition of the semi-arid steppe region (SASR) is extremely fragile. It is recognized that the development of coal and electricity power is a kind of strong human interference behavior for regional landscape ecology. Landscape ecological classification (LEC) is the premise of landscape ecology research of the mining area. The current research on the SASR and grassland LEC of coal-power base is relatively less, but still remains uncertainty concerning how to stratify and classify urban mining landscapes into units of ecological significance at spatial scales appropriate for management. This study is based on hierarchy theory, scale theory, landscape process, the patch-corridor-matrix model, the network, the theory of multiple planning integration and the principle of remote sensing. According to the comprehensive principle, principles of the combining of structure and function, principle of the combining human-ominated and natural landscape, principle of emphasis, and principle of combining qualitative analysis with quantitative research of LEC in large-scale coal-power base(LSCPB). On the basis of occurrence method land classification, fully consider the ecological attributes of the land, integration pattern, processes and function theory of the landscape ecology, the LEC system of the LSCPB in the SASR has been constructed by using top-down decomposition classification method. Empirical research of the Victory and Mindong No.1 mining areas of Shenhua Group shows that the classification system constructed in this paper can meet the requirements of LEC and fully reflect the status of landscape ecology of LSCPB in SASR. This study can provide theoretical guidance for the landscape ecology of LSCPB, while also supporting a theoretical reference for the LEC research.

Impervious surface mapping with high-resolution remote sensing imagery has attracted increasing interest as it can provide detailed information for urban structure and distribution. Previous studies have suggested that the combination of LiDAR data and high-resolution imagery for impervious surface mapping performs better than using only high-resolution imagery. However, due to the high cost of the acquisition of LiDAR data, it is difficult to obtain the multi-sensor remote sensing data acquired at the same acquisition time for impervious surface mapping. Consequently, real landscape changes between multi-sensor remote sensing data at different acquisition times would lead to the error of misclassification in impervious surface mapping. This issue has mostly been neglected in previous works. Furthermore, the observation differences generated from multi-sensor data, including the problems of misregistration, missing data in LiDAR data, and shadow in high-resolution images would also challenge the final mapping result in the fusion of LiDAR data and high-resolution images. In order to conquer these problems, we propose an improved impervious surface mapping method incorporating both LiDAR data and high-resolution imagery at different acquisition times in consideration of real landscape changes and observation differences. In the proposed method, a multi-sensor change detection by supervised multivariate alteration detection is employed to obtain changed areas and misregistration areas. The no-data areas in the LiDAR data and the shadow areas in the high-resolution imagery are extracted by independent classification yielded by its corresponding single sensor data. Finally, an object-based post-classification fusion is proposed to take advantage of independent classification results with single-sensor data and the joint classification result with stacked multi-sensor data. Experiments covering the study site in Buffalo, NY, USA demonstrate that our method can accurately detect landscape changes and obviously improve the performance of impervious surface mapping.

Environmentally friendly lead-free K1-xNaxNbO3 (KNN) ceramics possess electromechanical properties comparable to lead-based ferroelectric materials, but cannot meet the needs of device miniaturization, and the corresponding thin films lack of theoretical and experimental studies. To this end, we developed the nonlinear phenomenological theory for ferroelectric materials to study the effects of non-equiaxed misfit strain on the phase structure, electromechanical properties and electrical response of K0.5Na0.5NbO3 epitaxial films and constructed the in-plane misfit strain (u1-u2) phase diagrams. The results show that K0.5Na0.5NbO3 epitaxial film under non-equiaxed in-plane strain can exhibit abundant phase structures, including orthorhombic a1c, a2c and a1a2 phases, tetragonal a1, a2 and c phases, and monoclinic r12 phases. Moreover, in the vicinity of a2c-r12, a1c-c and a1a2-a2 phase boundaries, K0.5Na0.5NbO3 epitaxial films exhibit excellent dielectric constant ε11, while at a2c -r12 and a1c-c phase boundaries large piezoelectric coefficient d15 is observed. It was also found that high permittivity ε33 and piezoelectric coefficients d33 exist near the a2c - a2, r12- a1a2 and a1c-a1 phase boundaries due to the existence of polymorphic phase boundaries (PPB) in the KNN system, which makes it easy to polarize near the phase boundaries, and the polarizability changes suddenly, leading to electromechanical enhancement. In addition, the results show that the K0.5Na0.5NbO3 thin films possess a large electrocaloric response at the phase boundary at the r12-a1a2 and a1c-a1 phase boundaries. And the maximum adiabatic temperature change ∆T is about 3.62 K when the electric field change is 30 MV/m at room temperature, which is significantly enhanced compared with equiaxed strain. This study provides theoretical guidance for obtaining K1-xNaxNbO3 epitaxial thin films with excellent properties.

The primary measure of the quality of sea surface temperature (SST) fields obtained from satellite-borne infrared sensors has been the bias and variance of matchups with co-located in-situ values. Because such matchups tend to be widely separated, these bias and variance estimates are not necessarily a good measure of small scale (several pixels) gradients in these fields because one of the primary contributors to the uncertainty in satellite retrievals is atmospheric contamination, which tends to have large spatial scales compared with the pixel separation of infrared sensors. Hence, there is not a good measure to use in selecting SST fields appropriate for the study of submesoscale processes and, in particular, of processes associated with near-surface fronts, both of which have recently seen a rapid increase in interest. In this study, two methods are examined to address this problem, one based on spectra of the SST data and the other on their variograms. To evaluate the methods, instrument noise was estimated in Level-2 VIIRS and AVHRR SST fields of the Sargasso Sea. The two methods provided very nearly identical results for AVHRR: along-scan values of approximately 0.18 K for both day and night and along-track values of 0.21 K also for day and night. By contrast, the instrument noise estimated for VIIRS varied by method, scan geometry and day-night. Specifically, daytime, along-scan (along-track), spectral estimates were found to be approximately 0.05 K (0.08 K) and the corresponding nighttime values of 0.02 K (0.03 K). Daytime estimates based on the variogram were found to be 0.08 K (0.10 K) with the corresponding nighttime values of 0.04 K (0.06 K). Taken together: AVHRR instrument noise is significantly larger than VIIRS instrument noise, along-track noise is larger than along-scan noise and daytime levels are higher than nighttime levels. Given the similarity of results and the less stringent preprocessing requirements, the variogram is the preferred method although there is a suggestion that this approach overestimates the noise for high quality data in dynamically quiet regions. Finally, simulations of the impact of noise on the determination of SST gradients show that on average the gradient magnitude for typical ocean gradients will be accurately estimated with VIIRS but substantially overestimated with AVHRR.

The utilization of dual-potential mode of integrated array (IDA) electrodes and other two-electrode systems has revolutionized electrochemical detection by enabling the simultaneous and independent detection of two species, accompanied by the exhibition of unique characteristics. In contrast to conventional dual-potential electrodes, the rotating ring disk electrodes (RRDE), IDA electrodes demonstrate analogous yet vastly improved performance metrics, characterized by remarkable collection efficiency and sensitivity. Notably, due to the distinctive microscale structure of IDA electrode, the special “feedback” effect makes IDA a unique signal amplifier. In recent decades, the research surrounding IDA electrodes has garnered escalating interest due to their attractive attributes. This review centers its focus on the fabrication and applications of IDA electrodes. In the realm of fabrication, two critical breakthroughs are poised for realization: the achievement of reduced dimensions and the diversification of materials. Established fabrication methods for IDA electrodes encompass photolithography, inkjet printing, and direct laser writing, each affording distinct advantages in terms of size and precision in IDA construction. Predominantly employed materials for IDA electrodes include gold, platinum, and carbon, with the selection of fabrication methods guided by considerations such as material properties, desired dimensions, cost-efficiency, and specific application requisites. Within the domain of applications, IDA electrodes, capitalizing on their distinctive attributes, have found utility in diverse fields. This review summarizes the applications of IDA electrodes based on their fundamental working principles, encompassing redox cycling, resistance modulation, capacitance variations, and more. The potential for further development of this specialized tool to exhibit enhanced properties holds substantial promise.

Considering that the electric refrigeration temperature range of 0.94BNT-0.06BT ceramic materials is 100~140˚C, the electric refrigeration performance of the 0.94BNT-0.06BT ceramic material system was modified by LiNbO3 doping to reduce the cooling temperature. As a result, the refrigeration temperature range of the 0.94BNT-0.06BT ceramic material system was lowered to 25~80 ˚C, achieving its cooling effect near room temperature, and in this temperature range, the adiabatic temperature changes ∆T>0.6K.

In the face of the current energy and environment problems, the full use of biomass resources instead of fossil energy to produce a series of high-value chemicals has great application prospects. 5-hydroxymethylfurfural (HMF), which can be synthesized from lignocellulose as raw material, is an important biological platform molecule. Its preparation and catalytic oxidation of subsequent products have important research significance and practical value. In the actual production process, porous organic polymer (POPs) catalysts are highly suitable for biomass catalytic conversion due to its high efficiency, low cost, good designability, and environmentally friendly features. Here, we briefly described the application of various types of POPs (including COFs、PAFs、HCPs、CMPs) in the preparation and catalytic conversion of HMF from lignocellulosic biomass, and analyzed the influence of the structural properties of catalysts for the catalytic performance. Finally, we summarized some challenges that POPs catalysts will face in biomass catalytic conversion, and prospected the important research directions in future. This review would provide valuable references for the efficient conversion of biomass resources into high-value chemicals in practical applications.

Both lactic acid and short chain fatty acid (SCFA) play important roles in maintenance of intestinal epithelial structure and function. Trilactic glyceride (TLG) obtains both excellences of lactic acid and SCFA. This study was to investigate the effects of trilactic glyceride on growth performance, blood parameters, liver function, intestinal morphology and intestine function of piglets. Twelve weaned piglets (21±2 d) were randomly allocated to two treatment groups: 1) control group, piglets fed the basal diet; 2) TLG group, piglets fed the basal diet supplemented with 0.5 % TLG. On day 21 of the trial, D-xylose (0.1 g/kg·BW) was orally administrated to all piglets and blood samples were collected 1 h thereafter. Then, all the piglets were sacrificed to examine intestinal mucosal morphology and collect fatty tissue, liver and intestinal mucosa for further analysis. The results showed that: compared with the control group, TLG group decreased blood ALB and GGT on day 10 and 20, TLG group decreased blood TP and increased blood TG on day 20 of the trail (p < 0.05); TLG group decreased blood D-xylose and LDL, increased blood HDL (p < 0.05). These data suggested that supplementing trilactic glyceride had beneficial impacts on promoting nutrients’ metabolism, maintaining intestinal integrity, and alleviating oxidative stress and diarrhoea. Further research of molecular mechanisms showed changing expression levels of related proteins and genes, suggesting that these could be involved in the regulation of the impact. The community composition of the gut microbiota was also found to be altered in several operational taxonomic units within the genus, Prevotella (order Bacteroidales), and the order, Clostridiales.

Background: primary sclerosing cholangitis (PSC) is a chronic cholestatic disease characterized by inflammation and fibrosis of the bile ducts. Cholestasis may lead to hepatic inflammation and fibrosis, and amelioration of cholestasis may allow recovery from inflammatory and fibrotic pathological damage. Prevotella copri (P. copri) intervention have been reported could significantly improve cholestasis and liver fibrosis in DDC-induced PSC mice model. Despite alone P. copri treatment could not recover DDC-induced inflammation, it increased the abundance of Lactobacillus murinus (L. murinus) compared to DDC treatment, which has been reported to have anti-inflammatory effects. The abundance of L. murinus still not recover to normal level may underlie hepatic inflammation in P. copri+DDC mice. Method: alone or in combination interventions of P. copri and L. murinus were used to investigate the molecular mechanism of improvement of PSC inflammation and fibrosis. Results: P. copri and L. murinus significantly reduced the hepatic inflammatory cell aggregation and inflammatory factor expression, as well as the hepatic collagen content and fibrin factor expression in PSC mice. Further analysis of phosphorylation and dephosphorylation levels revealed that P. copri and L. murinus combined intervention in PSC mice inhibited the activity of DDC-activated TGF-β1/Smad pathway, thereby reducing liver inflammation and fibrosis. Conclusion: combination of P. copri and L. murinus inhibits the TGF-β1/Smad pathway and reduces inflammation and fibrosis in PSC.

Smart Internet of Vehicles (IoVs) combined with Artificial Intelligence (AI) will contribute to vehicle decision-making in the Intelligent Transportation System (ITS). Multi-Vehicle Pursuit games (MVP), a multi-vehicle cooperative ability to capture mobile targets, is becoming a hot research topic gradually. Although there are some achievements in the field of MVP in the open space environment, the urban area brings complicated road structures and restricted moving spaces as challenges to the resolution of MVP games. We define an Observation-constrained MVP (OMVP) problem in this paper and propose a Transformer-based Time and Team Reinforcement Learning scheme (T3OMVP) to address the problem. First, a new multi-vehicle pursuit model is constructed based on decentralized partially observed Markov decision processes (Dec-POMDP) to instantiate this problem. Second, by introducing and modifying the transformer-based observation sequence, QMIX is redefined to adapt to the complicated road structure, restricted moving spaces and constrained observations, so as to control vehicles to pursue the target combining the vehicle’s observations. Third, a multi-intersection urban environment is built to verify the proposed scheme. Extensive experimental results demonstrate that the proposed T3OMVP scheme achieves significant improvements relative to state-of-the-art QMIX approaches by 9.66%~106.25%. Code is available at https://github.com/pipihaiziguai/T3OMVP.

Airborne Frequency Diversity Array (FDA) radar operating at a high pulse repetition frequency encounters severe range-ambiguous clutter. The slight frequency increments introduced by the FDA result in angle and range coupling. Under these conditions, conventional space-time adaptive processing (STAP) often exhibits diminished performance or fails, complicating target detection. This paper proposes a method combining elevation oblique subspace projection with azimuth-Doppler STAP to suppress range-ambiguous clutter. By analyzing the relationship between elevation frequency and range, the proposed method compensates for quadratic range dependence. Through the construction of an elevation oblique subspace projection technique, an elevation adaptive filter is used to separate clutter from ambiguous regions. Residual clutter suppression is achieved through azimuth-Doppler STAP, enhancing target detection performance. Simulation results demonstrate that the proposed method effectively addresses range dependence and ambiguity issues, improving target detection performance in complex airborne FDA radar environments.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

Waterlogging induced by rain in urban areas has a potential risk impact on property and safety. This paper focuses on the impact of rain on waterlogging and evaluates the waterlogging risk in the central city of Shanghai. A simplified waterlogging depth model is developed in different areas with different drainage capacity and rainfall in consumption of simplifying the effect of complex terrain characteristics and hydrological situation. Based on urban waterlogging depth and its classification collection, a Rain-induced Urban Waterlogging Risk Model(RUWRM) is further established to evaluate waterlogging risk in the central city. The results show that waterlogging depth is closely linked with rainfall and drainage, with a linear relationship between them. More rainfall leads to higher waterlogging risk, especially in the central city with imperfect drainage facilities. Rain-induced urban waterlogging risk model can rapidly gives the waterlogging rank caused by rainfall with a clear classification collection. The results of waterlogging risk prediction indicate that it is confident to get the urban waterlogging risk rank well and truly in advance with more accurate rainfall prediction. This general study is a contribution that allows the public, policy makers and relevant departments of urban operation to assess the appropriate management to reduce traffic intensity and personal safety or strategy to lead to less waterlogging risk.

The genetic code evolved around the reading of the tRNA anticodon on the primitive ribosome, and tRNA-34 wobble and tRNA-37 modifications coevolved with the code. We posit that EF-Tu, the closing mechanism of the 30S ribosomal subunit, methylation of wobble U34 at the 5-carbon and suppression of wobbling at the tRNA-36 position were partly redundant and overlapping functions that coevolved to establish the code. The genetic code devolved in evolution of mitochondria to reduce the size of the tRNAome (all of the tRNAs of an organism or organelle). “Superwobbling” or four-way wobbling describes a major mechanism for shrinking the mitochondrial tRNAome. In superwobbling, unmodified wobble tRNA-U34 can recognize all four codon wobble bases (A, G, C and U), allowing a single unmodified tRNA-U34 to read a 4-codon box. During code evolution, to suppress superwobbling in 2-codon sectors, U34 modification by methylation at the 5-carbon position appears essential. As expected, at the base of code evolution, tRNA-37 modifications mostly related to the identity of the adjacent tRNA-36 base. TRNA-37 modifications help maintain the translation frame during elongation.

Agriculture is pivotal in national economies, with pest detection significantly influencing food quality and quantity. Pest classification remains challenging in automated agriculture monitoring systems, exacerbated by the non-uniform pest scales and the scarcity of high-quality datasets. In this study, we constructed a pest dataset by acquiring domain-agnostic images from the Internet and resizing them to a standardized 299x299 pixel format. Additionally, we employed diffusion models to generate supplementary data. While Convolutional Neural Networks (CNNs) are prevalent for prediction and classification, they often lack effective global information integration and discriminative feature representation. To address these limitations, we propose the RS Transformer, an innovative model that combines elements like the Region Proposal Network, Swin Transformer, and ROI Align. Additionally, we introduce the Randomly Generated Stable Diffusion Dataset (RGSDD) to augment the availability of high-quality pest datasets. Extensive experimental evaluations demonstrate the superiority of our approach compared to both two-stage models (SSD and Faster R-CNN) and one-stage models (YOLOv3, YOLOv4, YOLOv5m, YOLOv8, and DETR). We rigorously assess performance using metrics such as mean Average Precision (mAP), F1Score, Recall, and mean Detection Time (mDT). Our research contributes to advancing pest detection methodologies in automated agriculture systems, promising improved food production and quality.

The low-altitude quasi-periodic (LQP) E-region echoes observed with the upgraded HCOPAR located in Hainan Island of China (19.5°N, 109.1°E) are presented. With the interferometry technique, the interferometry equations can be developed to investigate the structures of the irregularities. The results show that the plasma structures of the LQP echoes with negative slope mainly drift southwestward almost horizontally, but they also drifted southeastward in some striations. According to the movement of the plasma structures, we find strong wind shear in the region where the LQP echoes are produced. Meanwhile, The periodicity of the LQP echoes may be related to the strength of the wind shear. It is proposed that the plasma structures are most likely produced by the Kelvin-Helmholtz instability.

A simulation test system for the two-dimensional (2D) fuze overload loading process was designed to address the loading issues of recoil overload and centrifugal overload in fuze safety and arming (S&amp;A) devices. By incorporating centrifuge rotation energy storage, impact acceleration simulation, and equivalent centrifugal rotation simulation, a block equipped with a fuze S&amp;A device was accelerated instantly upon being impacted by a centrifuge-driven impact hammer, simulating recoil overload loading. The impact hammer was retracted instantaneously by adopting an electromagnetic brake, which resulted in the centrifugal rotation of the block around its track, to simulate the centrifugal overload loading. The dynamic equations of the simulation test system and the equations of impact hammer motions were established, whereby the rotation speed of the centrifuge and the braking force of the electromagnetic brake were calculated and selected. A dynamic model of the collision between the impact hammer and block was established using ANSYS/LS-DYNA software for simulation analysis. The acceleration curves of the recoil overload and centrifugal overload with variations in the centrifuge speed, cushion material, and buffer thickness were obtained, which verified the feasibility of the proposed loading simulation method. 2D overload loading simulation tests were performed using the developed simulation system, and the acceleration curves of the recoil overload and centrifugal overload were measured. The test results indicated that the proposed system can accomplish 2D overload loading simulations for a recoil overload of several 10000 g and centrifugal overload of several 1000 g.

The genetic code evolved by parallel tracks of chaotic and ordered processes. Liquid-liquid phase separation (hydrogels), a chaotic process, constructs diverse membraneless compartments within cells, resulting in regulated hydration and sequestration and concentration of reaction components. Hydrogels relate to chaotic amyloid fiber production. We propose that polyglycine and related hydrogels (i.e. GADV; G is glycine), phase separations, membraneless droplets and amyloid accretions organized protocell domains to drive the earliest evolution of the genetic code and the pre-life to cellular life transition. By contrast, evolution of tRNA, tRNAomes, aminoacyl-tRNA synthetases and translation systems followed highly ordered and systematic pathways, described by well-defined mechanisms and rules. The pathway of evolution of aminoacyl-tRNA synthetases, which tracked evolution of the genetic code, is clarified. Hydrogels and amyloids form a chaotic component, therefore, that complemented otherwise systematic processes. We describe with detail a pre-life world in which hydrogels and amyloids provided the selections of the first life.

There are no theorems (proven theories) in the biological sciences. We propose that the 3 31 nt minihelix tRNA evolution theorem be universally accepted as one. The 3 31 nt minihelix theorem completely describes evolution of type I and type II tRNAs from ordered precursors (RNA repeats and inverted repeats). Despite diversification of tRNAome sequences, statistical tests overwhelmingly support the theorem. Furthermore, the theorem relates the dominant pathway for the origin of life on Earth, specifically, how tRNAomes and the genetic code may have coevolved. Alternate models for tRNA evolution (i.e., 2 minihelix, convergent and accretion models) are falsified. In the context of the pre-life world, tRNA was a molecule that via mutation could modify anticodon sequences and teach itself to code. We relate the clearest history to date of the chemical evolution of life on Earth. From analysis of tRNA evolution, ribozyme-mediated RNA ligation was a primary driving force in evolution of complexity during the pre-life to life transition on Earth.

In terrain analysis and hydrological modeling, surface depressions (or sinks) in a digital elevation model (DEM) are commonly treated as artifacts and thus filled and removed to create a depressionless DEM. Various algorithms have been developed to identify and fill depressions in DEMs during the past decades. However, few studies have attempted to delineate and quantify the nested hierarchy of actual depressions, which can provide crucial information for characterizing surface hydrologic connectivity and simulating the fill-merge-spill hydrological process. In this paper, we present an innovative and efficient algorithm for delineating and quantifying nested depressions in DEMs using the level-set method based on graph theory. The proposed level-set method emulates water level decreasing from the spill point along the depression boundary to the lowest point at the bottom of a depression. By tracing the dynamic topological changes (i.e., depression splitting/merging) within a compound depression, the level-set method can construct topological graphs and derive geometric properties of the nested depressions. The experimental results of two fine-resolution LiDAR-derived DEMs show that the raster-based level-set algorithm is much more efficient (~150 times faster) than the vector-based contour tree method. The proposed level-set algorithm has great potential for being applied to large-scale ecohydrological analysis and watershed modeling.

The 3 31 nucleotide minihelix tRNA theorem describes evolution of type I and type II tRNAs to the last nucleotide. In databases, type I and type II tRNA V loops (V for variable) were improperly aligned, but alignment based on the theorem is accurate. Type II tRNA V arms were a 3’-acceptor stem (initially CCGCCGC) ligated to a 5’-acceptor stem (initially GCGGCGG). The type II V arm evolved to form a stem-loop-stem. In Archaea, tRNALeu and tRNASer are type II. In Bacteria, tRNALeu, tRNASer and tRNATyr are type II. The positioning of the type II V arm is determined by the number of unpaired bases just 5’ of the Levitt base (Vmax). For Archaea, tRNALeu has 2 unpaired bases, and tRNASer has 1 unpaired base. For Bacteria, tRNATyr has 2 unpaired bases, tRNALeu has 1 unpaired base and tRNASer has 0 unpaired bases. Thus, the number of type II tRNAs is limited by the possible set points of the arm. From analysis of aminoacyl-tRNA synthetase structures, contacts to type II V arms appear to adjust allosteric tension communicated primarily via tRNA to aminoacylating and editing active sites. To enhance allostery, it appears that type II V arm end loop contacts may tend to evolve to V arm stem contacts.

Evolutionary, sequence and structural analyses of tRNA variable (V) loops provides a new understanding. Type I tRNA V loops have a primordial length of 5 nt, and type II tRNA V loops have a primordial length of 14 nt. Sequence-based alignments of type I and type II V loops gave deceptive results. Type II V loops are characterized by the trajectory of the V arm, the size and sequence of the loop and the first and last V loop nucleotides and their known contacts. Depending on the V arm trajectory, type II V stems and loops can be interaction sites for aminoacyl-tRNA synthetases. So, type II V arms for tRNALeu, tRNASer and tRNATyr (found in Bacteria) were coevolved and selected to distinguish determinants to support cognate tRNA charging. The alignment of type I and type II V loops was adjusted based on tRNA evolution. Results are consistent with Archaea being an older and simpler life form than Bacteria. TRNAome sequences were derived from radiation of an ordered tRNAPri (Pri for primordial) sequence comprised of known RNA repeats and inverted repeats. V loop and tRNA sequences, therefore, convey a history of the primary successful pathway in the origin of life.

pH value almost affects the function of cells and organisms in all aspects, so in biology, biochemical and many other research fields, it is necessary to apply simple, intuitive, sensitive, stable detection of pH and base characteristics inside and outside the cell. Therefore, many research groups have explored the design and application of pH probes based on surface enhanced Raman scattering（SERS）. In this review article, we discussed the basic theoretical background of explaining the working mechanism of pH SERS sensors, and also briefly described the significance of cell pH measurement, and simply classified and summarized the factors that affected the performance of pH SERS probes. Some applications of pH probes based on surface enhanced Raman scattering (SERS) in intracellular and extracellular pH imaging and the combination of other analytical detection techniques are described. And finally, the development prospect of this field is prospected.

The chloroplast genome is conservative and stable, which can be employed to resolve genotypes. Currently, published nuclear sequences and molecular markers failed to differentiate the species from taxa robustly, including Machilus leptophylla, Hanceola exserta, Rubus bambusarum, and Rubus henryi. In this study, the four chloroplast genomes were characterized, and then their simple sequence repeats (SSRs) and phylogenetic positions were analyzed. The results demonstrated the four chloroplast genomes consisted of 152.624 kb, 153.296kb, 156.309 kb, and 158.953 kb in length, involving 124, 130, 129, and 131 genes, respectively. Moreover, the chloroplast genomes contained typical four regions. Six classes of SSR were identified from the four chloroplast genomes, in which mononucleotide was the class with the most members. The types of the repeats were various within individual classes of SSR. Phylogenetic trees indicated that M. leptophylla was clustered with M. yunnanensis, and H. exserta was confirmed under family Ocimeae. Additionally, R. bambusarum and R. henryi were clustered together, whereas they did not belong to the same species due to the differing SSR features. This research would provide evidence for resolving the species and contributed new genetic information for further study.

Arctic sea ice prediction holds significant importance for facilitating Arctic route planning, optimizing fisheries management, and advancing the field of sea ice dynamics research. While various deep learning models have been developed for sea ice prediction, they predominantly operate at the seasonal or sub-seasonal scale, often focusing on localized areas, and few cater to full-region daily scale prediction. This study introduces the use of spatiotemporal sequence data prediction models, namely, the convolutional LSTM (ConvLSTM) and predictive recurrent neural network (PredRNN), for the prediction of sea ice concentration (SIC). Our analysis reveals that, when solely utilizing SIC historical data as the input, the ConvLSTM model outperforms the PredRNN model in SIC prediction. To enhance the model's capacity to capture spatiotemporal relationships between multiple variables, we expanded the range of input data types to form the ConvLSTM-multi and PredRNN-multi models. Experimental findings demonstrate that the ConvLSTM-multi model excels in assimilating the influence of reanalysis data on sea ice within the sea ice edge region, thus exhibiting superior performance in predicting daily Arctic SIC over the subsequent 10 days. Furthermore, sensitivity tests on various model parameters highlight the substantial impact of sea surface temperature and prediction date on the accuracy of daily sea ice prediction. Additionally, meteorological and oceanographic parameters primarily affect the prediction accuracy of the thin ice region at the edge of the sea ice.

Time-modulated sparse circular array (TMSCA) with elements uniformly excited is designed and synthesized in this paper. By utilizing rotationally symmetric structure, the array geometry and the time modulation of the TMSCA is presented, and the radiation patterns in frequency domain are formulated. In order to achieve the desired radiation pattern at the operating frequency and suppress the sideband radiation, the synthesis problem is established and solved by the proposed harmony search-convex programming (HS-CP) algorithm in two dependent optimizations. Two designs are presented, and the numerical results indicate that the TMSCA with rotationally symmetric structure has the advantages of designing time-modulated sparse arrays with superior performance.

This paper investigates the dynamic properties of artificial neural networks using differential equations and explores the influence of parameters on stability and neural oscillations. By analyzing the equilibrium point of the differential equations, we identify conditions for asymptotic stability and criteria for oscillation in artificial neural networks. Furthermore, we demonstrate how adjusting synaptic weights between neurons can effectively control stability and oscillation. The proposed model offers potential insights into the malfunctioning mechanisms of biological neural networks implicated in neurological disorders like Parkinson's disease tremors and epilepsy seizures, which are characterized by abnormal oscillations.

With the rapid development of wind power generations, the inertial response of wind turbines (WTs) are widely concerned recently, which is important for grid frequency dynamic and stability. This paper recognizes and understands the inertial response of type-3 and type-4 WTs from the view of equivalent internal voltage, in analogy with typical synchronous generators (SGs). Due to the dynamic of the equivalent inertial voltage different from SGs, the electromechanical inertia of WTs is completely hidden. The rapid power control loop and synchronization control loop is the main reasons that the WT's inertial response is disenabled. On the basis of the equivalent internal voltage's dynamic, the existing inertia control method for WTs are reviewed and summarized as three approaches from the view of WT's control, i.e. optimizing the power control or synchronization control or both. At last, the main challenges and issues of these inertia controls are attempted to explain and address.

The increased global incidence of myopia requires the establishment of therapeutic approaches. Previous studies have suggested that inflammation plays an important role in the development and progression of myopia. We used human retinal pigment epithelial cell to study the molecular mechanisms on how FJE and PVE lowering the inflammation of the eye. The effect of FJE and PVE in MFD induced hamster model and explore the role of inflammation cytokines in myopia. Expression levels of IL-6, IL-8, and TNF-α were upregulated in retinal pigment epithelium (RPE) cells treated with IL-6 and TNF-α. FJ extract (FJE) + PV extract (PVE) reduced IL-6, IL-8, and TNF-α expression in RPE cells. Furthermore, FJE and PVE inhibited inflammation by attenuating the phosphorylation of protein kinase B (AKT), and nuclear factor kappa-light-chain-enhancer of activated B (NF-κB) pathway. In addition, we report two resveratrol + ursolic acid compounds from FJ and PV and their inhibitory activities against IL-6, IL-8, and TNF-α expression levels in RPE cells treated with IL-6 and TNF-α. FJE, PVE, and FJE + PVE were applied to MFD hamsters and their axial length was measured after 21 days. The axial length showed statistically significant differences between phosphate-buffered saline- and FJE-, PVE-, and FJE + PVE-treated MFD eyes. FJE + PVE suppressed expressions of IL-6, IL-8, and TNF-α. They also inhibited myopia-related transforming growth factor-beta (TGF)-β1, matrix metalloproteinase (MMP)-2, and NF-κB expression while increasing type Ⅰ collagen expression. Overall, these results suggest that FJE + PVE may have a therapeutic effect on myopia and be used as a potential treatment option.

High salinity in soil affects the normal growth and development of crop. MicroRNA171 (miR171) plays a momentous role in plant resistance to adversity stress. The functions of Sly-miR171d and Sly-miR171e on growth of tomato and fruit nutritional quality under salt stress were studied. The results showed that the seed germination and seedling growth of tomato that silencing of Sly-miR171d/e by short tandem target mimic (STTM) were better than those of wild-type (WT). Silencing of Sly-miR171d/e seeds maintained a high germination rate, while WT tomato seeds barely germinated under 50 mM NaCl stress. Under 100 mM NaCl stress, silencing of Sly-miR171d/e increased the expression of their target gene SlGRAS24 with increasing duration of salt stress, while they enhanced the antioxidant activity, reduced reactive oxygen species (ROS) accumulation, and enhanced the salt tolerance of tomato plant by regulating gibberellin (GA) level. Moreover, the preharvest and postharvest fruit nutritional quality under salt stress was also studied, and the results showed that silencing of Sly-miR171d/e increased soluble solids, lycopene, total carotenoids, Vitamin C, organic acids and phenolic substances in tomato fruit. The present study demonstrated that silencing of Sly-miR171d/e enhanced plant salt tolerance through the GA pathway, and improved fruit nutritional quality under salt stress.

The high penetration of distributed energy resources poses significant challenges to the dispatch and operation of power systems. Improving the accuracy of short-term load forecasting (STLF) can optimize grid management, leading to increased economic and social benefits. Currently, some simple AI and hybrid models has issues to deal with and struggle with multivariate dependencies, long-term dependencies, and non-linear relationships. This paper proposes a novel hybrid model for short-term load forecasting (STLF) that integrates multiple AI models with Lasso regression using the stacking technique. The base learners include ANN, XgBoost, LSTM, Stacked LSTM, and Bi-LSTM, while Lasso regression serves as the meta-learner. By considering factors such as temperature, rainfall, and daily electricity prices, the model aims to more accurately reflect real-world conditions and enhance predictive accuracy. Empirical analyses on real-world datasets from Australia and Spain show significant improvements in forecasting accuracy, with a substantial reduction in Mean Absolute Percentage Error (MAPE) compared to existing hybrid models and individual AI models. This research highlights the efficiency of the stacking technique in improving STLF accuracy, suggesting potential operational efficiency benefits for the power industry.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

The parallel connection of multiple flexible rings in raceways can significantly improve the electrical conductivity of rolling conductive devices. Multiple flexible rings are generally separated by idlers to form ring-idler rolling pairs. In the present work, alumina (Al2O3), polytetrafluoroethylene (PTFE), polyether ether ketone (PEEK), and polyimide (PI) were used as idler materials. Rolling tests for four types of ring-idler contact pairs were carried out in the air at a rotating speed of 10 rpm and a current of 60 A. It was noticed that the voltage drop was the lowest when Al2O3 was incorporated as the idler material. The energy spectrum analysis indicated material transfer between the organic idlers and the flexible ring. Especially on the flexible ring surface, the transferred organic thin film covered the gold-plated layer of the flexible ring and affected the electrical contact of the flexible ring. The transfer of Al2O3 was not obvious, and the mass fraction of Au on the flexible ring surface after the rolling test was 93.1%. The above results could help in selecting the best idler material for high-power conductive rotary joints.

Elevated indoor CO2 levels might have adverse effects on human health. However, the introduction of outdoor air to lower indoor CO2 concentrations results in significant HVAC energy consumption. Aligning with office hours and the natural light cycle, the utilization of photosynthesis in living walls offers an energy-efficient and sustainable solution for the mitigation of high CO2 levels in office spaces. This study experimentally investigates the impacts of the carbon fixation pathways, light intensity, and substrate moisture content on the CO2 removal rate of living walls at the room scale. Furthermore, the fresh air energy-saving effects of living walls under different scenarios are accurately simulated in EnergyPlus. The results demonstrate that choosing C3 plants over CAM plants in living walls yields higher CO2 removal efficiency. In a 30-m2 office room accommodating 2-3 occupants, living walls can reduce the demand for fresh air by 12.3%-27.8% and decrease fresh air energy consumption by 11.2%-28.2%. The city with the highest energy savings has energy savings that are 4.5 times greater than those of the city with the lowest energy savings. The findings of this research promote the application and development of living walls, thus providing a viable solution for improving indoor air quality.

Innovations and improvements in hydraulic fracturing and horizontal well technologies have contributed to the success of the shale gas industry; however, the industry is also challenged by freshwater use and environmental health issues. Increasing water impact makes precise quantification of water consumption important. The objective in this study was to better understand water sustainability and availability of the projected shale gas from 2018 to 2030 in the Weiyuan play, China. The water footprint framework was used to quantify the potential water use and environmental impacts on different time scales. The results showed that the water use per well ranged from 11351.3 to 60664.73 m3, with a median of 36013.94 m3, totaling ~3.44 Mm3 for 97 wells. Yearly evaluation results showed that the gray water footprint was the main contributor and accounted for 83.82% to 96.76%, which was dependent on different scenarios of treatment percentages. The monthly environmental impact results indicated that the annual streamflow statistics were more likely to prevent water withdrawal. Water quality issues may be alleviated through recycling and retreatment measures that improve current waste water management strategies. Resource regulators should manage their water resources by matching water demand to water availability or replenishment.

In this perspective article, we ponder topographical enhancements of artificial neural networks. In our recent paper in JMLR, we proved a quasi-equivalence between the network width and depth and also discussed the power of intra-links, which can be viewed as network height. In 1982, Hopfield published a network to model human associative memory, which contains many loops for dynamic evolution toward fixed points. Based on noising-denoising loops, diffusion models are recently developed to enable Bayesian modeling and inference with big data. Furthermore, we envision development of multi-AI-agent systems through “netware” engineering as a quantum leap of software engineering for emergent behaviors and autonomous AI at individual and population levels. We believe that the novel use of links and loops in space and time via multi-scale coupling would catalyze the next-generation neural networks.

Evodiamine is a bioactive alkaloid that is specified as a biomarker for the quality assessment of Evodia rutaecarpa and for traditional Chinese medicines containing this plant. We previously reported that quantitative structure-activity modeling indicated that evodiamine may cause cardiotoxicity. However, previous investigations have indicated that evodiamine has beneficial effects in patients with cardiovascular diseases and there are no previous in vitro or in vivo reports of evodiamine-induced cardiotoxicity. The present study investigated the effects of evodiamine on primary cultured neonatal rat cardiomyocytes in vitro, and on zebrafish in vivo. Cell viability was reduced in vitro, where evodiamine had a 24-h 50% inhibitory concentration of 28.44 µg/mL. Cells exposed to evodiamine also showed increased lactate dehydrogenase release and maleic dialdehyde levels, and reduced superoxide dismutase activity. In vivo, evodiamine had a 10% lethal concentration of 354 ng/mL and induced cardiac malfunction, as evidenced by changes in heart rate and circulation, and pericardial malformations. This study indicated that evodiamine could cause cardiovascular side effects involving oxidative stress. These findings suggest that cardiac function should be monitored in patients receiving preparations containing evodiamine.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

Classifying network flow subsequences in an Industrial IoT gateway is an effective method for identifying Industrial IoT faults. This paper proposes a subsequence classification algorithm SSGBUL-IKNN based on unsupervised learning encoding to address the problem of low classification accuracy. Firstly, we built a network module based on unsupervised learning to encode the flow sequence of the Industrial IoT gateway. In the encoding module, a subsequence calibration algorithm controls the increasing error during the coding process. Then, the specific fault type is obtained through an improved KNN classification algorithm based on the indication distance source from the integrated coding sequences converted by multi-dimensional network flow sequences. The test result on three Industrial IoT datasets of a sewage treatment plant shows that the accuracy of SSGBUL-IKNN in this paper exceeds 92%, significantly higher than the algorithm DTW and TSF. It reaches the classification requirements of Industrial IoT fault diagnosis.

Both ricin and R. communis agglutinin (RCA120), belonging to the type II ribosome-inactivating proteins (RIPs-Ⅱ), are derived from the seeds of castor bean plant. They share very similar amino acid sequences, but ricin is much more toxic than RCA120. It is urgently necessary to distinguish ricin and RCA120 in response to public safety. Currently, mass spectrometric assays are well established for unambiguous identification of ricin by accurate analysis of differentiated amino acid residues after trypsin digestion. However, diagnostic peptides are relatively limited for unambiguous identification of trace ricin, especially in complex matrices. Here, we demonstrate a digestion strategy of multiple proteinases to produce novel peptide markers for unambiguous identification of ricin. LC-HRMS was used to verified the resulting peptides, among which only the peptides with uniqueness and good MS response were selected as peptide markers. Seven novel peptide markers were obtained from tandem digestion of trypsin and endoproteinase Glu-C in PBS buffer. From the chymotrypsin digestion under reduction and non-reduction conditions, eight and seven novel peptides were selected respectively. Using pepsin under pH 1~2 and proteinase K digestion, 6 and 5 peptides were selected as novel peptide markers. In conclusion, the obtained novel peptides from the established digestion methods can be recommended for the unambiguous identification of ricin during the investigation of illegal use of the toxin.

Decades of research identified numerous gene biomarkers of cardiac diseases whose restored sequence or/and expression level was hoped to recover the normal cardiac function. However, each human has unique and dynamic pathophysiological characteristics resulting from the unrepeatable combination of favoring factors such are: race, sex, age, medical history, diet, stress, exposure to toxins, habits etc. As such, no treatment fits everybody and finding personalized solutions is a top priority for medicine of 21st century. The Genomic Fabric Paradigm (GFP) provides the most theoretically possible comprehensive characterization of the transcriptome, its alterations in disease and recovery following a treatment. By attaching to each gene the independent average expression level, expression variation and expression coordination with each other gene, GFP delivers thousands times more information than the traditional analysis. This report presents the theoretical bases of the GFP and some applications to our microarray data from mouse models of post ischemic, and constant and intermittent hypoxia-induced heart failure. The GFP analyses revealed novel transcriptomic aspects of the gene expression control and networking under ischemic conditions. Through all-inclusive characterization of the transcriptome and the unrepeatable gene hierarchy in each condition, GFP is an essential avenue towards development of a truly personalized cardiogenomic therapy.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

The intricate relationship between physical and social environments within organizations plays a pivotal role in shaping sustainable innovation endeavors. This paper presents a comprehensive analysis of two key dynamics that have garnered substantial scholarly attention for promoting sustainable innovation: the physical environment and the organizational climate. To elucidate the intricate interplay between these dynamics, we propose a novel three-dimensional framework that guides the modeling of the intricate processes through which the physical environment and innovation climate synergistically influence innovation outcomes. Building on this framework, we delve into an in-depth literature review concerning physical environments that exert a significant impact on innovation. Through this review, we identify and elaborate on four pivotal elements of the physical environment: communality, personalization, comfort, and healthiness. Leveraging insights gleaned from this review, we outline two promising avenues for future research in the realm of the physical environment's interaction with the innovation climate. Furthermore, we underscore the critical importance of adopting an interdisciplinary approach that seamlessly integrates insights from both the physical and social domains to comprehensively understand the sustainable innovation landscape.

The mangrove plant Acanthus ilicifolius and its relative, A. mollis, have been previously proved to possess diverse pharmacological effects. Therefore, evaluating the differentially expressed proteins of these species under tidal flooding stress is essential to fully exploit and benefit from their medicinal values. The roots of A. ilicifolius and A. mollis were exposed to 6 h of flooding stress per day for 10 days. The dry weight, hydrogen peroxide (H2O2) content, anatomical characteristics, carbon and energy levels, and two-dimensional electrophoresis coupled with MALDI-TOF/TOF MS technology were used to reveal the divergent flooding resistant strategies. A. ilicifolius performed better under tidal flooding stress, which was reflected in the integrity of the morphological structure, more efficient use of carbon and energy, and a higher percentage of up-regulated proteins associated with carbon and energy metabolism. A. mollis could not survive in flooding conditions for a long time, as revealed by incomplete cell structures of the roots, less efficient use of carbon and energy, and a higher percentage of down-regulated proteins associated with carbon and energy metabolism. Energy provision and flux balance played a role in the flooding tolerance of A. ilicifolius and A. mollis.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

This paper presents ConF, a novel deep learning model designed for accurate and efficient prediction of non-coding RNA families. NcRNAs are essential functional RNA molecules involved in various cellular processes, including replication, transcription, and gene expression. Identifying ncRNA families is crucial for comprehensive RNA research, as ncRNAs within the same family often exhibit similar functionalities. Traditional experimental methods for identifying ncRNA fam-ilies are time-consuming and labor-intensive. Computational approaches relying on annotated secondary structure data face limitations in handling complex structures like pseudoknots and have restricted applicability, resulting in suboptimal prediction performance. To overcome these chal-lenges, ConF integrates mainstream techniques such as residual networks with dilated convolutions and cross multi-head attention mechanisms. By employing a combination of dual-layer convolu-tional networks and BiLSTM, ConF effectively captures intricate features embedded within RNA sequences. This feature extraction process leads to significantly improved prediction accuracy compared to existing methods. Experimental evaluations conducted on a ten-fold publicly available dataset demonstrate the superiority of ConF in terms of accuracy, sensitivity, and other perfor-mance metrics. Overall, ConF represents a promising solution for accurate and efficient ncRNA family prediction, addressing the limitations of traditional experimental and computational methods.

Gaze tracking of high-speed moving targets is a novel application mode for low Earth orbit microsatellites. In this mode, small satellites are equipped with high-resolution narrow-field-of-view video cameras for stable gaze-tracking imaging of high-speed moving targets. This paper proposes a high-precision attitude adaptive integral sliding mode control method with a feedforward compensation disturbance observer to enhance the capability of a microsatellite attitude control system for gaze tracking of high-speed moving targets. Specifically, first, we present the attitude control system model for microsatellites and the calculation method for the desired attitude of target tracking based on image feedback. Then, an adaptive integral sliding mode attitude control algorithm with a feedforward compensation disturbance observer, which meets the requirements of high-precision tracking control, is designed. The developed algorithm utilizes the disturbance observer to observe the friction torque of the flywheel and compensates for it through feedforward control. It also employs the adaptive integral sliding mode control algorithm to reduce the impact of uncertain disturbances, decrease the steady-state error of the system, and enhance the attitude control precision. Simulation experiments demonstrated that the designed disturbance observer can successfully observe the frictional disturbance torque of the flywheel. The attitude Euler angle control precision for high-speed moving target tracking reached 0.009°, and the angular velocity control precision reached 0.005°/s, validating the effectiveness of the proposed approach.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

High-precision inertial sensors or accelerometers can provide us references of free-falling motions in gravitational field in space, and serve as the key payloads for gravity recovery missions. In this work, a systematic method of electrostatic inertial sensor calibrations for gravity recovery satellites is introduced, which is applied to and verified with the Taiji-1 mission. Taiji-1 is the first technology demonstration satellite of the ``Taiji Program in Space'', which, in its final extended phase in 2022, could be viewed as a gravity recovery satellite operating in the high-low satellite-to-satellite tracking mode. Based on the calibration principles, swing maneuvers with time span about 200 s and rolling maneuvers for 19 days were conducted by Taiji-1 in 2022. The inertial sensor's operating parameters including the scale factors, the center of mass offset vector and the intrinsic biased acceleration are precisely re-calibrated and are updated to the Taiji-1 science team. Data from one of the sensitive axis is re-processed with the updated operating parameters, and the performance is found to be slightly improved compared with former results. This approach could be of high reference value for the accelerometer or inertial sensor calibrations of the GFO, the Chinese GRACE-type mission, and the planned Next Generation Gravity Missions. This could also shed some light on the in-orbit calibrations of the ultra-precision inertial sensors for future GW space antennas because of the technological inheritance between these two generations of inertial sensors.

Types of DNA recombination include homologous recombination and nonhomologous recombination. Homologous DNA recombination is a general term that includes exchange of information between chromatids: (reciprocal) crossing-over, gene conversion, and post-meiotic segregation. Gene conversion is now thought to be a type of non-Mendelian segregation of heterozygous markers near the recombination initiation site. Thus, it includes both gene conversion and post-meiotic segregation previously described. DNA non-HR including transpositional recombination and site-specific recombination. Our understanding of the molecular mechanism by which DNA recombination occurs has significantly increased in the past decades. Currently The synthesis-dependent strand annealing model is now thought to give rise to most or all noncrossovers, with the double-strand-break repair model forming mainly crossovers. The Shapiro model proposed by Dr. J. Shapiro explains the molecular mechanism of transpositional recombination. Site-specific recombination results from another distinct model. We previously proposed a novel theory which can provide a more reasonable and simpler explanation accounting for DNA HR including the 3 classes of recombinogenic events described above. In the new supplementedly molecular model, DNA meiotic recombination can be initiated by a copy choice mechanism, that is, copying part of 1 single-stranded DNA template, followed by DNA polymerase switching to another single-stranded DNA template, and then resuming the following DNA synthesis along the new template. The current review suggests that transpositional recombination and site-specific recombination should be initiated by copy choice during DNA synthesis rather than break/join mechanism. The work indicates that review of DNA nonhomologous recombination are very necessary. The novel theory would challenge earlier models accounting for transpositional recombination and site-specific recombination and would be critical to the understanding of the mechanisms. We hope copy choice initiating DNA nonhomologous recombination will be one of the concepts that are explored. Proper and specific experiments are required to reconstruct the detailed mechanism described here.

Vibration signal analysis is regarded as a fundamental approach in diagnosing faults in rolling bearings, and recent advancements have shown notable progress in this domain. However, the presence of substantial background noise often results in the masking of these fault signals, posing a significant challenge for researchers. In response, an Adaptive Denoising Autoencoder (ADAE) approach is proposed in this paper. The data representations are learned by the encoder through convolutional layers, while the data reconstruction is performed by the decoder using deconvolutional layers. Both the encoder and decoder incorporate adaptive shrinkage units to simulate denoising functions, effectively removing interfering information while preserving sensitive fault features. Additionally, dropout regularization is applied to sparsify the network and prevent overfitting, thereby enhancing the overall expressive power of the model. To further enhance ADAE's noise resistance, shortcut connections are added. Evaluation using publicly available datasets under scenarios with known and unknown noise demonstrates that ADAE effectively enhances the signal-to-noise ratio in strongly noisy backgrounds, facilitating accurate diagnosis of faults in rolling bearings.

With the development of society and the economy, the unified planning of architectural style has become a difficult problem in the competition between urban expansion and the protection of tra-ditional buildings in villages and towns. At the same time, it also allows people to re-examine the appearance and quality of life of traditional village buildings. In this paper, the Conditional Gen-erative Adversarial Network (CGAN) is used to construct a method of building facade generation in villages and towns, so as to gradually realize the governance of the style of villages and towns. At the same time, it has also reduced the restoration of the facades of villages and towns and the graphic design of rural tourism products, showing its application value and potential in the field of planning and design. In the research, taking villages and towns in the Wuyishan area of China as an example, the method is used to carry out model training, image generation, and comparison of the derivation results of different assumed building contours and product contours. The research shows that: (1) CGAN can be used to derive and design the facades of conventional civil buildings in villages and towns. (2) In terms of product graphic design, especially the common tourist cultural products fans and water cups, show significant potential. (3) The construction of this method is not only applicable to villages and towns under the World Heritage City, but can be further promoted and used in the future for cities and villages that have a demand for architectural style consistency.

Polyacetylene phytochemicals are emerging as potentially responsible for the chemoprotective effects of consuming apiaceous vegetables. There is some evidence suggesting that polyacetylenes impact carcinogenesis by influencing a wide variety of signalling pathways, which are important in regulating inflammation, apoptosis, cell cycle regulation, etc. Studies have shown a correlation between human dietary intake of polyacetylene-rich vegetables with reduced risk of inflammation and cancer. Polyacetylene supplementation can influence cell growth, gene expression, and immunological responses, and reduce tumour number in rat and mouse models. Cancer chemoprevention by dietary polyacetylenes involves several mechanisms, including effects on inflammatory cytokines, the NF-κB pathway, antioxidant response elements, UPR pathway, growth factor signalling, cell cycle progression, and apoptosis. This review summarises the published research on falcarinol-type polyacetylene compounds and their mechanisms of action regarding cancer chemoprevention and treatment, and also identifies some gaps in our current understanding of the health benefits of these polyacetylenes.

A fluorescent probe, N'-((3-methyl-5-oxo-1-phenyl-4, 5-dihydro-1H-pyrazol-4-yl) methylene)-2-oxo-2H-chromene-3-carbohydrazide (MPMC), was synthesized and characterized. Characterizations of the synthetic MPMC were conducted by proton nuclear magnetic resonance (1HNMR) spectroscopy and carbon-13 nuclear magnetic resonance spectroscopy (13C NMR). The fluorescence emission behaviors of probe MPMC towards diverse metal ions were detected and the probe exhibited high sensitivity and selectivity towards Cu2+ over other metal ions via quenching of its fluorescence. Furthermore, the existence of other metal actions made no difference on the fluorescence intensity of the MPMC-Cu2+ system apparently, that is, MPMC displayed a good anti-interference ability. Job’s plot of MPMC and copper ions indicated the detection limit was 15.16 nM (R2=0.9612) for the assayed actions, with a stoichiometric ratio of 1:1 for MPMC and Cu2+. Additionally, the color of MPMC probe solution changed from nearly colorless to yellow in the presence of Cu2+ in visible light, which the color change could be observed by the naked eye. Similarly, the color resolved bright yellow into blue in ultraviolet light. Also reusability studies indicated that MPMC probe was reusable. The pH effect of probe MPMC to Cu2+ had a broad range of pH detection 4.0 to 11.0. The response time of MPMC probe for determining Cu2+ was within 1 min. The recognition of Cu2+ by MPMC performed on pre-treated paper under sunlight and UV light both had a distinct colour change. Thus, the solid-state method for detecting Cu2+ with the naked-eye, was both economical and convenient.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

China's cotton production has shown a concentration to the advantageous regions in recent years. Based on the relevant data of cotton production in China, the study measures the cotton production agglomeration levels of 16 major cotton-producing provinces from 1978 to 2020, summarizes the spatiotemporal evolution characteristics of cotton production agglomeration, and analyzes the factors influencing cotton production agglomeration using spatial econometric models. The results indicate that: Firstly, since the opening-up and reform, China's cotton production agglomeration levels have shown an overall upward trend, exhibiting periodic dynamic changes over time, and the spatial pattern reveals a dynamic regional gradient. Secondly, there is spatial correlation among the production scales of cotton in different provinces, with a trend resembling a "U" shape, and the agglomeration form shows a low-level convergence. Thirdly, technological level, policies, substitute industrial products and foreign trade are identified as important factors. The cotton production in each province is spatially correlated through these factors, and there is also a presence of spillover effects. In conclusion, the government should prioritize considerations of various influencing factors to formulate tailored support policies, promote large-scale production to enhance technological levels, and focus on policies aimed at improving the quality of cotton.

Digitized counter-diabatic (CD) optimization algorithms have been proposed and extensively studied to enhance performance in quantum computing by accelerating adiabatic processes while minimizing energy transitions. While adding approximate counter-diabatic terms can initially introduce adiabatic errors that decrease over time, Trotter errors from decomposition approximation persist. On the other hand, increasing the high-order nested commutators for CD terms may improve adiabatic errors but could also introduce additional Trotter errors. In this article, we examine the two-qubit model to explore the interplay between approximate CD, adiabatic errors, Trotter errors, coefficients and commutators. Through these analysis, we aim to gain insights into optimizing these factors for better fidelity, shallower circuit depth, and reduced gate number in near-term gate-based quantum computing.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Disparities between fold amplitude (A) and intrusion thickness (Hsill) are critical in identifying elastic or inelastic deformation in a forced fold. However, accurate measurement of these two parameters is challenging because of the limit in separability and detectability for the seismic data. In the TZ-47 exploring area from the Tarim Basin, Northwest China, we combined wireline data and 3-D seismic data, to accurately constrain the fold amplitude and total thickness of sills that inducing the roof uplift. The measurement results show that the forced fold amplitude is 155 m and the total sill thickness is 148.4 m. When using a magma density of 2.7 g/cm3, and solid rock density of 3 g/cm3, the molten magma thickness at the time of intrusion would be 153.8 m, which is almost no difference from the forced fold amplitude. Therefore, the TZ-47 fold is a pure elastic forced fold induced by emplacement of multiple sills. Measurement solely based on seismic data may not be able to detect some thin interlayers and may result in large errors.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

While being a workaholic supervisor may be viewed as admirable due to their commitment to work, existing findings on its effects on subordinates are mixed. Drawing upon the principle learning perspective and activation theory, we propose a curvilinear relationship between supervisor workaholism and subordinate job performance and investigate the moderating role of subordinate social-related social media usage. Specifically, we suggest that subordinate job performance increases (decreases) as supervisor workaholism increases from low (moderate) to moderate (high) levels and that this inverted U-shaped relationship becomes flatter when subordinates have higher social-related social media usage. The results, based on a multi-source survey collected from 321 supervisor-subordinate dyads, support the predictions. Our research moves beyond linear thinking and suggests that there exists an optimal level of supervisor workaholism that maximizes subordinate job performance. We also provide insights into the ongoing debate and potential ethical concerns surrounding whether employees should use social media at work. Implications for practice and future research are discussed.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

To address the insufficient mechanical properties of calcined phosphogypsum, this research aims to investigate the utilization of basalt fiber and calcium carbonate whiskers as reinforcing agents. The study examines their impact on the flexural and compressive strength, toughness, water resistance, and tensile strength of calcined phosphogypsum. In the individual tests, basalt fibers with different lengths (3 mm, 6 mm, 9 mm, and 18 mm) were added at dosages of 0%, 0.5%, 1.0%, and 1.5% respectively. The findings demonstrate that basalt fiber effectively enhances the flexural and compressive strength, toughness, and tensile strength of calcined phosphogypsum, albeit potentially compromising water resistance. Among the various fiber lengths, the 6 mm fibers exhibit the most advantageous influence on the performance of calcined phosphogypsum. A subsequent test was conducted to investigate the impact of cross-scale fibers on the properties of calcined phosphogypsum by mixing 6 mm basalt fibers and calcium carbonate whiskers. The results illustrate that calcium carbonate whisker refines the pores, thereby improving the flexural strength and toughness of calcined phosphogypsum. Furthermore, it compensates for the water resistance limitations associated with the sole utilization of basalt fiber while further augmenting the tensile strength and strain capacity. However, it should be noted that increasing the dosage of both calcium carbonate whiskers and basalt fibers concurrently leads to increased porosity of phosphogypsum and reduced compressive strength.

This paper systematically discusses the application of reinforcement learning in automatic driving system. Reinforcement learning frameworks show significant advantages in optimizing decision making, predictive perception, path planning, and controller design, exceeding the limitations of traditional supervised learning methods. The paper highlights the critical role of components such as scene understanding, positioning, and map making in autonomous driving systems, which provide reliable environmental awareness through deep learning and sensor fusion technologies to support intelligent decision-making in complex urban environments. In addition, the paper discusses innovative approaches to safety reinforcement learning to reduce risk in autonomous driving and ensure that systems adhere strictly to safety constraints while maximizing expected rewards. These findings provide an important theoretical and practical basis for further improving algorithm robustness, managing multi-agent interactions, and integrating ethical considerations in the future.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

In the construction of shield crossing existing mined tunnel without load, it is imperative to develop corresponding design standards that reflect actual engineering force characteristics to ensure the successful completion of tunnel construction. This research uses The MIDAS-GTS finite element software to facilitate the creation of a numerical model of the shield structure for an air-push-over mine tunnel project in Changsha, China, investigating the stress field’s evolution during shield construction, and calculating the maximum positive and negative bending moments and maximum axial forces for different structures and other force states under various construction conditions. This study's findings informed the design and construction optimisation of the shield tunnelling empty-push method. The outcomes of this numerical simulation led to several key findings: (1) The soil density exerted a significantly greater impact on the internal forces of the initial support structure than both the tunnel depth and soil Poisson's ratio. Additionally, a sudden shift in internal forces occurred within the 300-350 mm range when the lining thickness was altered. (2) Factors such as the tunnel depth, soil density, soil Poisson's ratio μ, and lining thickness have a similarly influenced internal forces of the segment and the initial support. Notably, the backfill layer thickness significantly affected the segment’s maximum axial force causing an abrupt change of approximately 300 mm. (3) Under the shield machine equipment’s weight constraint, it is essential to control the guide rail’s thickness, to prevent it from becoming overly large.

Magnetometric Resistivity(MMR) Method, which can use the power supply method of the traditional apparent resistivity method to measure the magnetic field. At present, the application research abroad is relatively extensive, but the domestic(China) research on the application of the MMR method is very few, and it is not even well-known. This paper is based on the MMR theoretical method under the point source DC condition, combined with the abnormal potential method and the modified Biot-Savart law, and using the three-dimensional numerical calculation method of the finite difference method to calculate the abnormal potential field, electric field, and magnetic field on the matlab2018a platform. Calculate, realize the multi-physics simulation in the electromagnetic field through Matlab platform programming, and verify the correctness of the algorithm by the spherical anomaly model with an analytical solution. Through the visual simulation of the three-dimensional data volume of the multi-physics field in the electromagnetic field, we can better understand the response mechanism of the electromagnetic field under DC conditions and grasp their three-dimensional spatial distribution rules. It is hoped that the research in this article can help the research of MMR Personnel better use this method for exploration.

With the rapid development of network science, Turing pattern on complex networks has attracted extensive attention from researchers. In this paper, we focus on spatial patterns in multiplex ER (Erdös-Rényi) random networks, taking the predator-prey model with Allee effect and hyperbolic mortality as an example. In theory, the threshold condition for generating Turing pattern is given using the Turing instability theory of multiplex networks. Numerically, we design relevant experiments to explore the impact of network topology on Turing pattern. The factors considered include model parameters, diffusion rate, average degree of the network, and differences in the average degree of different layers. The results indicate that the importance of diffusion rate and network average degree for Turing pattern is affirmed on the single-layer network. For multiplex networks, the differentiation of average degrees in different layers controls the generation of Turing pattern, which is not affected by the diffusion rates of the two populations. More interestingly, we observe the switching of Turing pattern and spatiotemporal pattern. We believe that these findings contribute to a better understanding of self-organization on complex networks.

To address the issue of reduced orbit estimation accuracy resulting from discrepancies between in-orbit measured geomagnetic field values and IGRF model values in autonomous orbit estimation of microsatellites based on geomagnetic field measurements, this study introduces an adaptive cubature H-infinity filtering algorithm. Firstly, it presents the low-altitude orbital dynamics model and geomagnetic field measurement model for microsatellites. Subsequently, within the adaptive cubature H-infinity filtering algorithm, a spherical simplex rule and a second-order Gaussian-Legendre quadrature criterion are employed to compute the spherical surface integral and radial integral. Additionally, a spherical simplex-radial quadrature rule is proposed to enhance the approximation accuracy of nonlinear Gaussian weighted integrals. Furthermore, by integrating extended H-infinity filtering based on game theory with the cubature quadrature rule, an inverse proportional relationship between constraint level and filtering innovation is established. This allows for adaptive adjustment of the constraint level to enhance robustness against model errors. Finally, through semi-physical simulation experiments, it is demonstrated that compared with traditional algorithms, the proposed algorithm improves autonomous orbit estimation position accuracy of microsatellites by 7.49%, while also enhancing velocity accuracy by 3.1%, thus validating its effectiveness.

In GNSS/IMU integrated navigation systems, factors such as satellite occlusion and non-line-of-sight conditions can lead to degradation of satellite positioning results, Subsequently affecting the overall accuracy of the integrated navigation system. To address this issue and ef-fectively utilize historical pseudorange information from satellites, this paper proposes a graph optimization-based GNSS/IMU model with virtual constraints. These virtual constraints are con-structed using satellite ‘s position from previous time step, the rate of change of pseudoranges, and ephemeris data. This virtual constraint can serve as an alternative solution for individual satellites in case of signal anomalies, ensuring the integrity and continuity of the graph optimi-zation model. Additionally, this paper conducts an analysis of the graph optimization model constructed using these virtual constraints, comparing it with traditional integrated navigation graph optimization model, and analyzes and reconstructs the marginalization process based on these virtual constraints. The experimental results, compared with tightly coupled Kalman fil-tering and the original graph optimization method on a set of real-world data, demonstrate that the introduction of virtual pseudoranges maintains high positioning accuracy. The RMSE error between it and the original graph optimization remains within 5%, affirming the high feasibility of this approach.

Polymethyl methacrylate (PMMA) polymer is widely used in various fields today. In order to thoroughly reveal the structural impact performance of PMMA materials, this paper is based on the comprehensive Johnson-Cook constitutive model and damage failure model, and accurately confirm the J-C constitutive and damage failure model parameters of PMMA through material test data, The dynamic process of steel bullet impacting PMMA plate structure is analyzed by finite element software ABAQUS. The calculation results show that the numerical simulation results in this paper are in good agreement with the experimental test data. Therefore, the feasibility and accuracy of the impact analysis of PMMA structures based on J-C constitutive and damage failure models in this paper are studied. Finally, based on the J-C constitutive model and damage failure model, the variation of the residual velocity of the bullet with the PMMA plate thickness is analyzed in depth, that is, the results show that the residual velocity of the bullet has a certain linear relationship with the plate thickness.

Sign language recognition is essential in hearing-impaired people’s communication. Sign language recognition is an important concern in computer vision and has been developed with rapid progress in image recognition technology. However, sign language recognition using a general monocular camera has problems with occlusion and recognition accuracy in sign language recognition. In this research, we aim to improve accuracy by using a 2-axis bending sensor as an aid in addition to image recognition. We aim to achieve higher recognition accuracy by acquiring hand keypoint information of sign language actions captured by a monocular RGB camera and adding sensor assist. To improve sign language recognition, we need to propose new AI models. In addition, the amount of dataset is small because it uses the original data set of our laboratory. To learn using sensor data and image data, we used MediaPipe, CNN, and BiLSTM to perform sign language recognition. MediaPipe is a method for estimating the skeleton of the hand and face provided by Google. In addition, CNN is a method that can learn spatial information, and BiLSTM can learn time series data. Combining the CNN and BiLSTM methods yields higher recognition accuracy. We will use these techniques to learn hand skeletal information and sensor data. Additionally, the 2-axis Bending sensor glove data support training AI model. Using these methods, we aim to improve the recognition accuracy of sign language recognition by combining sensor data and hand skeleton data. Our method performed better than using skeletal information, achieving 96.5% accuracy in Top-1.

Due to the rapid development of unmanned aerial vehicles (UAVs) communication technology, UAVs are gradually competing with primary users (PUs) for spectrum resources. Cognitive radio (CR) is a promising solution to meet the needs. Cooperative spectrum sensing (CSS) is considered as an effective method to detect the PU signal and identify available spectrum resources for UAVs in a cognitive UAV network (CUAVN). However, the cooperative mode among multiple UAVs may incur a high overhead, resulting in performance degradation. Therefore, we introduce a differential sequential 1 (DS1), which incorporates a differential mechanism and leverages the sequential idea based on the classical voting rule to enhance cooperative performance and efficiency. In view of this, we formulate three scenarios to characterize the PU activity and introduce a multi-slot cooperative mode within a single UAV to realize cooperative gain. Further, only the information change about the PU status is sequentially calculated in DS1, and combined with a sequential idea, the efficiency of the voting rule is greatly improved. Moreover, the application of support vector machines (SVM) in dynamic selection enables the selection of the most suitable voting rule based on diverse sensing parameters. This dynamic selection process ensures optimal performance and efficiency by adapting the voting rule to the specific characteristics of the given scenario. Finally, simulation results demonstrate that the superiority of our proposal with respect to the detection performance, sample size and the energy efficiency is evident, which proves the high performance of the proposed policy.

Land use is an embodiment of human socioeconomic activities and represents a bridge between these activities and natural systems. Through social activities, humans transform land use to promote social and economic development and improve production, living conditions, and eco-logical functions of land. Rural residential land represents a space for rural residents to reside in and exhibits spatial characteristics that evolve over time, which is proof of rural socioeconomic development. This paper observes rural residential land in 21 cities on the Grand Canal and analyses its spatial differentiation. Then, it explores the driving factors of this land using spatial grid analysis and the geographic detector model. Lastly, it proposes three different forms of rural residential land based on the results. The study found that: (1) the change of rural residential land in the northern part of the Grand Canal was more volatile than that in the southern part. The change of rural residential land from 1990 to 2020 conformed to the pattern of cultivated land - rural residential land - urban construction land; (2) Based on the driving factors of rural residen-tial land, the land is divided into one-dimensional cities, two-dimensional cities and three-dimensional cities. Circular, linear, and scattered cities of different sizes were affected by socioeconomic factors, transportation accessibility, and the natural environment, respectively; and (3) Finally, according to the spatial differentiation characteristics and the driving factors of rural residential land, the study proposes the construction of three types of villages through the strate-gies of constructing large-scale villages, relocating and reconstructing new villages, and con-structing high-quality villages, respectively. Enhancing the scientific planning of rural residential land and its efficiency can offer the protection of agricultural land and the integration of urban and rural areas in the new era.

Failure characteristics induced by unloading disturbance and the corresponding mechanical mechanism of the coal seam floor are important theoretical bases for water-bursting prevention from the floor of the coal seam and rock burst alarm in deep mining. However, the existing two-dimensional ground-pressure-control theory based on shallow mining cannot sufficiently guide deep-mining practices. In this study, the redistribution of mining-induced stress field in rocks surrounding the longwall face and mechanical behaviors of strata in deep mining are investigated through a combination of numerical simulation, physical simulation, and field measurement. Results demonstrate that mining-induced stress fields in the floor of the longwall face differ in space and time. Vertical stress unloading from top to bottom of the floor and horizontal stress unloading are relatively low. A concentration zone of high horizontal stress exists at stope boundaries. The critical yield load of rock stratum in the floor is determined through thin plate yield theory. Under the combined effect of concentrated high horizontal and vertical resilience stresses, strata in the floor fracture from seam to seam if the load increases to the minimum critical buckling value. Fractured strata slide along the fracture surface, which leads to floor heave. The stope floor shows evident time-delay progressive failure characteristics. The stress shell in the stope floor in deep mining is found to be a sensitive mechanical parameter that produces three-dimensional ground-pressure behavior in the floor. This ground-pressure behavior in the stope floor is controlled by the existence of the corresponding stress shell and effects induced by its space–time evolution. This study provides theoretical basis for the dynamic control of a hazard-inducing environment in engineering and minimizing or altering disaster-occurrence conditions during the construction engineering of the coal seam floor.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Intergenerational integration has given rise to a novel aging paradigm known as all-age communities, which is garnering international attention. In China, the aging population and the implementation of the three-child policy have resulted in increased demand for retirement and childcare services among residents in older neighborhoods. Consequently, there is a pressing need to retrofit these older neighborhoods to accommodate all-age living arrangements given the high demand they generate. Therefore, this study undertakes research interviews with residents and constructs an exploratory theoretical model rooted in established theory. To assess the significance of our model, we employ Smart PLS 3.0 based on 297 empirical data points. Our findings indicate that anxiety has a significant negative effect on payment behavior; objective perception, willingness to pay, and government assistance exert significant positive effects on payment behavior. By comprehensively analyzing the mechanisms underlying residents’ payment behavior, this study provides valuable insights to the government for promoting the aging process within communities and formulating effective transformation policies.

Today, the digital economy has pursued the required social and economic development, and enterprises can achieve long-term sustainability by relying on the digital platform ecosystem. However, the development of the digital economy and the rapid growth of platform ecosystems have also generated some problems. To study effective digital platform ecosystem governance, this study used the tripartite evolutionary game method and analyzed the changes and effects of platform regulation under different development stages from the perspectives of government, platforms, and enterprises. The results indicate that in the early stages, digital platforms primarily relied on the government’s obligation to regulate. With the digital platform ecosystem’s evolution, the platform organization and settled enterprises’ governance effects gradually appeared, establishing the three common constraints of governance mode. Finally, when the digital platform ecosystem is in its self-renewal period, the government effect is reduced, with the platform itself and settled enterprises taking primary supervisory roles. This study provides reasonable methods for effective platform governance at different stages and enriches the theoretical basis and management practices of platform ecosystems.

Existing one-shot neural architecture search (NAS) methods have to conduct a search over a giant super-net, which leads to the huge computational cost. To reduce such cost, in this paper, we propose a method, called FTSO, to divide the whole architecture search into two sub-steps. Specifically, in the first step, we only search for the topology, and in the second step, we search for the operators. FTSO not only reduces NAS’s search time from days to 0.68 seconds, but also significantly improves the found architecture's accuracy. Our extensive experiments on ImageNet show that within 18 seconds, FTSO can achieve a 76.4% testing accuracy, 1.5% higher than the SOTA, PC-DARTS. In addition, FTSO can reach a 97.77% testing accuracy, 0.27% higher than the SOTA, with nearly 100% (99.8%) search time saved, when searching on CIFAR10.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

Wear-resistant steel/carbon steel composite plate not only has the double performance advantage of high strength and wear-resistance, but also can reduce energy consumption and production cost. Based on 50% reduction rate, the wear resistance of BTW1/Q345 composite was studied at different annealing temperatures, and the dry friction and wear tests of BTW1/Q345 composite at different annealing temperatures were carried out by using RETC MFT-5000. The macro-micro morphology and wear mechanism of wear marks at different annealing temperatures were analyzed by using white light interference three-dimensional surface profiler, Scanning electron microscope scanning electron microscope (SEM) and backscatter electron diffraction (EBSD) . The results show that with the increase of annealing temperature, the grain size near the scratch of BTW1 in the wear-resistant layer of the composite plate is refined, and the wear-resistant property is higher than that of the original sample.When the annealing temperature is 860℃,the wear resistance is the best.

As the number of end-of-life vehicles continues to grow, the field of separation technology for broken copper and aluminium parts of end-of-life vehicles has emerged as a significant area of research. As a key technology for the separation of non-magnetic non-ferrous metals, such as copper and aluminium, eddy current separation can achieve efficient separation of non-magnetic non-ferrous metals according to their differing conductivity and density. Nevertheless, further research is required in the separation of large-scale broken copper and aluminium parts of end-of-life vehicles. This paper presents a novel magnetic roller model comprising circumferential and axial periodic arrangements of permanent magnets. A single permanent magnet was constructed as an equivalent current model, and the magnetic scalar potential equations were solved using simulation tools. This allowed the distribution of the magnetic field outside the magnetic roller to be studied. The results demonstrate that the novel permanent magnet array magnetic roller can enhance the magnetic field intensity and action distance of the external magnetic field, which is more conducive to the separation of large-scale broken copper and aluminium parts of scrap cars. The findings of this research provide a theoretical foundation for the separation of scrap car broken copper and aluminium parts.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

To predict the remaining useful life (RUL) of proton exchange membrane fuel cell (PEMFC) in advance, a prediction method based on the voltage recovery model and Bayesian optimization of a multi-kernel relevance vector machine (MK-RVM) is proposed in this paper. First, the empirical mode decomposition (EMD) method was used to preprocess the data, and then the MK-RVM was used to train the model. Then, the Bayesian optimization algorithm was used to optimize the weight coefficient of the kernel function to complete the parameter update of the prediction model, and the voltage recovery model was added to the prediction model to realize the rapid and accurate prediction of the RUL of PEMFC. Finally, the method proposed in this paper was applied to the open data set of PEMFC provided by FCLAB, and the prediction accuracy of the RUL of PEMFC was obtained by 95.35%, which showed that the method had good gen-eralization ability and verified the accuracy of the prediction for the RUL of PEMFC.

This research was to investigate beneficial impact and molecular mechanism of B. coagulans on piglets intestine. Twenty-four 21 days old weaned piglets were allotted to three treatments: control group (basal diet), B6 group (basal diet + 2×10⁶ CFU/g B. coagulans), B7 group (basal diet + 2×10⁷ CFU/g B. coagulans). The results showed that compared with control group, B6 and B7 group significantly decreased diarrhea rate and the concent of CHOL, GGT and DAO in plasma; decreased villus height and increase crypt depth in jejunum and ileum; increased the activities of SOD and CAT and decreased the concent of MDA and H₂O₂ in intestine. These data suggested that supplementing B. coagulans had beneficial impacts on promoting nutrients metabolism, maintaining intestinal integrity and alleviating oxidative stress and diarrhea. Futher research of molecular mechanisms showed that, these beneficial impacts were regulated by changing expression levels of related proteins (including HSP70, Caspase-3, Bax, Villin and Occludin), and genes (including RPL4, IFN-α, IFN-β, IFN-γ, MX1, MX2, OAS1, IL-1β, IL-4, CXCL-9, CCL-2, AQP3, SGLT-1, LPL, INSR and b^0,+AT), and altering community composition of gut microbiota (particularly family Clostridiaceae, Enterobacteriaceae, and Veillonellaceae and genus Prevotella, Turicibacter, and Lactobacillus).

This paper presents three approaches to estimating battery parameters of the electrical equivalent circuit model (ECM) based on electrochemical impedance spectroscopy (EIS); these approaches are referred to as (a) least squares (LS), (b) exhaustive search (ES), and (c) nonlinear least squares (NLS). The ES approach is assisted with the LS method for the rough determination of the lower and upper bound of the ECM parameters, and the NLS approach is incorporated with the Monte Carlo run such that different initial guesses can be assigned to improve the goodness of EIS fitting. The proposed approaches are validated using both simulated and real EIS data. Compared to LS approach, the ES and NLS approaches show better fitting accuracy at various noise levels; whereas both in the validation using simulated EIS data and actual EIS data collected from LG 18650 and Molicel 21700 batteries, the NLS approach shows better fitting accuracy than that of LS and ES approaches. In all cases, compared with the ES approach, the computational time of the NLS approach is significantly faster, and compared with the LS approach, the NLS approach shows a minimal difference in computational time and considerably better fitting performance.

Urban planning and transportation policies are vital to creating sustainable and liveable cities. Transit-orientated development (TOD) has emerged as a prominent approach, emphasising the establishment of neighbourhoods with convenient access to public transportation and promoting car-free lifestyles. TOD initiatives aim to improve public transit efficiency, reduce dependence on private vehicles, and encourage walkability and connectivity within communities. By prioritising TOD, cities can effectively address transportation challenges, alleviate congestion, mitigate carbon emissions, and improve residents' overall quality of life. This research paper investigates the connection between proximity to transit stations and local living habits. Specifically, it examines the human mobility of residents living within a 15-minute walk distance of transit stations in Auckland, New Zealand, a car-dependent city striving to transition into a sustainable TOD model. The objective is to determine whether people living near transit stations are more inclined to participate in local activities and exhibit a higher proportion of trips within a radius of 15 minutes. The results illustrate that approximately 54% of the residents show dominant local mobility patterns. However, only about 16 stations out of 34 show their local residents have prominent collective 'local' travel patterns. By understanding the connection between proximity to transit stations and local mobility patterns, urban planners and designers can make informed decisions to improve the built environment and optimise the land use mix. This research offers insights to support the creation of vibrant and people-centric urban environments, facilitating the development of sustainable and liveable cities.

Coronavirus disease 2019 (COVID-19) is caused by infection with the 2019 novel coronavirus 2 (2019-nCoV, now referred to as SARS-CoV-2). COVID-19 has become a global pandemic since its outbreak at the end of Dec 2019. COVID-19 could lead to severe acute respiratory disease, especially to those who have reduced immunity. Binding of the viral Spike protein (S) to its receptor ACE2 (Angiotensin Converting Enzyme 2) on the surface of target cells has been proven to be key for virus entry and infection. Although ACE2 expression in the respiratory system is necessary for pneumonia infection by SARS-CoV-2, the regulation of ACE2 gene expression remains poorly investigated, especially for patients that are in pre-pathological conditions. Here, by analyzing The Gene Expression Omnibus (GEO) database, we investigated the expression regulation of ACE2 in various kinds of primary epithelial cells from the respiratory system after varies of respiratory viruses infection such as influenza A virus (IFV), respiratory syncytial virus (RSV) and human rhinovirus (hRV). Our analyses reveal that infection of multiple kinds of respiratory viruses or influenza vaccines greatly increased ACE2 expression, suggesting that respiratory viruses infection could represent a high risk factor for developing COVID-19. We also found that the regulatory effect of influenza A virus on ACE2 expression is associated with activation of the interferon beta-induced pathway and viral RNA-activated host response. Together, our data provide a theoretical framework for clinical classification for SARS-CoV-2 infection susceptibility and could be used for future prevention and therapy treatment for COVID-19.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Mulberry is an economically significant crop for the sericulture industry worldwide. Stresses such as drought exposure have a significant influence on plant survival. Metabolome directly reflects plant physiological status; thus, a way to assess this impact is to perform a global metabolomic analysis. This study investigated the effect of drought stress on mulberry Yu-711 metabolic balance using a liquid chromatography-mass spectrometry (LC-MS) based on an untargeted metabolomic approach. For this objective, Yu-711 leaves were subjected to two weeks of drought stress treatment and control without drought stress. Multivariate and univariate statistical analyses highlighted numerous differentially-accumulated metabolic elements as a function of time and treatment. Drought stress led to a more differentiated metabolites response than the control. We found that the levels of total lipids and galactolipids, and phospholipids (PC, PA, PE) were significantly altered, producing 48% of the total differentially expressed metabolites. Fatty acyls were the most abundant lipids expressed and decreased considerably by 73.6%. Prenol lipids class of lipids increased in drought leaves. Other classes of metabolites, including polyphenols( flavonoids and cinnamic acid), organic acid (amino acids), carbohydrates, benzenoids, and organoheterocyclic, all had a dynamic trend in response to the drought stress. However, their levels under drought stress generally decreased significantly compared to the control. These results provide an overview of the metabolic profile of the mulberry plant through differentially-accumulated compounds and provide a better understanding of global plant metabolic changes in defense mechanisms.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Using numerical simulation method, combined with the pre-branch material characteristics of the measurement results, based on the LS-DYNA software to simulate the branch crushing process, the analysis found that not only the existence of the cutter cutting in the branch destruction process, there is also the cutting of the opposing surface of the bending fracture, with the increase in the speed of the knife rollers, the cutter cutting resistance increases, the cutting resistance reaches 2690 N when the cutter at 2500 r/min, the cutter cutting resistance is the smallest in the cutting simulation at the blade angle of 55°, the blade angle is more suitable for the cutting of the branch. In the cutting simulation under different cutting edge angles, the cutting resistance of the tool is the smallest when the edge angle is 55°, which is 1860 N. This edge angle is more suitable for branch crushing and cutting. Using Fluent software to analyse the airflow characteristics of the crushing device, it was found that with the increase of the knife roller speed, the inlet flow and negative pressure of the crushing chamber are increasing, the speed of 2500 r/min, the inlet flow and negative pressure were 1.92 kg/s and 37.16 Pa, which will be conducive to the feeding of branches, but the speed is too high and it will also lead to the enhancement of the vortex of part of the area in the crushing device, which will affect the feeding of branches and the throwing of the crushed material. affect the feeding of branches and the throwing out of crushed materials, and finally determined the speed range of the crushing knife roller is 1800 ~ 2220 r/min. Based on ANSYS/Model module modal analysis of the crushing knife roller, the knife roller of the first six orders of the intrinsic frequency and vibration pattern, crushing knife roller of the lowest order of the modal intrinsic frequency of 137.42 Hz, much larger than the crushing knife roller operating frequency of 37 Hz, the machine will not resonate during operation.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

A number of challenging combinatorial optimization problems in logistics, transportations, aeronautics, and astronautics can be modeled as orienteering problems (OPs). To address the classic OP and its real-world variants, a parallel adaptive local-search algorithm based on competition and evolution (Palace) is proposed in this paper. In this algorithm, the parallelism runs proper local-search metaheuristics and operators to obtain the population per generation; then the competition grades those metaheuristics and operators to highlight the outperforming and eliminate the underperforming; also, the evolution explores large solution space and reproduces the best solutions for next generation. In this manner, the parallelism, competition, and evolution are organized in an easy-to-use algorithm and enable the expansibility, adaptivity, and exploration abilities, respectively. The Palace is examined on the classic and real-world Benchmarks about the OP, the time-dependent/independent OP with time windows, and the unmanned aerial vehicle and agile earth observation satellite planning. As a result, the Palace shows good performance in applicability and effectiveness in comparison with the state-of-the-art algorithms.