Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

The two-stage direct thermal contact (2sDTC) process is a rapid dewatering approach for fluid fine tailings (FFT) that is integrated into an oil sands bitumen extraction plant to reduce tailings pond storage and freshwater usage. In the first stage, combustion gas directly contacts atomized FFT, vaporizing water and yielding dry solids and steam-rich hot gas. The second stage involves pond effluent water directly contacting the steam-rich hot gas, recovering heat and condensing moisture. Case studies confirm the technical feasibility of the integration. Benefits include producing a dry discharge, reducing tailings water discharge and conserving an equivalent to 0.2 barrels of freshwater per barrel of oil produced. Most importantly, these benefits incur no additional energy cost to the plant as the integration eliminates the energy penalty and CO2 emissions associated with FFT dewatering. Further capacity enhancement can be achieved by using centrifuge-concentrated FFT. The study reveals that FFT concentrated to ~50 wt% solids could still maintain its pump-ability and be accommodated by the 2sDTC process, leading to an integration which could dewater more FFT annually and conserve more freshwater ( 0.58 barrels per barrel of oil produced), with the sole energy requirement being the power to drive the centrifuge machinery.

Background: Exposure to inorganic arsenic (iAs) remains a global public health problem. The liver is the main target organ of arsenic, leading to arsenic-induced liver fibrosis. Autophagy is involved. Phosphatase and tensin homology deleted on chromosome ten (PTEN) may participate in arsenic-induced liver fibrosis by regulating autophagy, but the exact mechanisms remain unclear. We established a mouse model of arsenic poisoning through the drinking water, and a fibrosis model using the huma stellate cell (HSC) line LX-2, which was exposed to NaAsO₂ for 24h. HE and Masson staining was adopted to observe the degree of liver fibrosis. The cells were transfected using PTEN overexpression plasmid. Western blot and qRT-PCR were used to determine the levels of protein/mRNA expression. The in vivo results were confirmed in HSCs exposed to NaAsO₂, with changes suggesting fibrosis as seen in mice. NaAsO₂ upregulated the expression of the autophagic markers microtubule-associated protein light chain A/B (LC3), recombinant human autophagy effector protein (Beclin-1), hairy and enhancer of split homolog-1 (HES1), but downregulated PTEN. α-smooth muscle actin (α-SMA) expression was significantly upregulated in all NaAsO₂ groups. PTEN overexpression altered NaAsO₂-induced autophagy which LC3, Beclin-1 were downregulated. Notch1, HES1, α-SMA, and collagenⅠexpression were all downregulated in the NaAsO₂ groups. In conclusion, PTEN overexpression might decrease autophagy and inhibit fibrosis progression caused by this toxin. The NOTCH1/HES1 pathway is likely to be involved in this process. Most previous studies did not investigate PTEN and arsenic-induced liver fibrosis specifically. The present study highlights the importance of targeting PTEN for the management of arsenic exposure.

The performance analysis of the internal/external flows around a high speed vehicle in near-space is fundamental and critical to the configuration and structure design for high speed aircraft. In this paper, the two-dimensional coupled implicit Reynolds Average Navier-Stokes (RANS) solver and RNG k–ε turbulence model is employed to numerically simulate the flow field of an integrated high speed vehicle. The flow field are divided three parts to solve separately and compared with that solved by integrated simulation. The flow field are decomposed to save computer storage and simulation time. The first part is inlet/isolator, the second part is combustion chamber and the third is nozzle. In the computation process, the outlet condition of isolator is endowed to the inlet boundary of combustion chamber and the outlet boundary of combustion chamber is endowed to the inlet boundary of nozzle, then the whole flow field of integrated high speed vehicle is solved. Aerodynamic characteristic of fragment-computation and integration-computation is comparatively analyzed at different angles of attack, the results show that the maximum deviation of lift coefficient obtained by fragment-computation is less than 3% compared with that by integration, the maximum deviation of drag coefficient fragment-computation is less than 5% compared with that by integration, while pitching moment coefficient deviation less than 12%. However, for simulation time-consumption, the time used by fragment-computation reduces 45% compared with integration-computation. Meanwhile, by components force analysis, it can be concluded that the aerodynamic property of inlet/isolator can been obtained separately and hardly effected by other parts.

Examining the soil microbiome structure has a great significance in exploring the mechanism behind plant growth changes due to maize (Zea mays L.) and soybean (Glycine max Merr.) crop rotation. This study explored the effects of soil microbial community structure after soybean and maize crop rotation by designing nine treatments combining three crop rotations (continuous cropping maize or soybean; and maize after soybean) with three fertility treatments (organic compound fertilizer, chemical fertilizer, or without fertilizer). Soil was sampled to 30 cm depth the second year at approximately the middle of the growing season, and was analyzed for physical, chemical, and phospholipid fatty acid (PLFA) profiles. Bacteria was found to be the predominant component of soil microorganisms, which mainly contain the PLFAs i15:0, 16:1 ω 7c, 16:0, 10Me16:0, and 18:1 ω 7c. The concentration of soil gram-negative bacteria from the soybean and maize rotation was less than in soybean continuous cropping when organic fertilizer was applied to both. Crop rotation reduced the percentage of fungi in the soil, among which the effect of organic compound fertilizer application was significantly reduced 24%. The combined crop rotation with organic fertilizer can reduce maximum the percentage of fungi/bacteria. In addition, the content of soil aggregate and organic matter had great influence on gram-positive bacteria and actinomyces, and soil pH had a greater impact on other fungi.

To accurately and non-destructively monitor the growth of spring wheat in the Hetao Irrigation Area, UAV remote sensing was employed during various fertility stages. Digital image indices from diverse fertilization treatments were calculated and compared with physiological indices to identify the most sensitive digital image indices corresponding to these indices. The study underscored the critical importance of the flowering stage in the growth of spring wheat, thus highlighting the necessity of focusing on this stage. This finding reiterated that the flowering stage was pivotal for spring wheat development in the Hetao Irrigation Area. Several digital image indices, such as GLA, R, G, INT, g, GRVI, MGRVI, RGBVI, EXG, and GRRI, exhibited a high frequency of significant correlations with physiological indices during the four primary reproductive stages of wheat. Consequently, these sensitive digital image indices during the flowering stage can more effectively characterize the physiological indices of spring wheat.

The largest gene families in plants were found to be Glutathione transferase (GSTs), which played significant roles in regulating plant growth, development, and stress response. Within the GSTs gene family, members were found to play a crucial role in the low-temperature response process of plants. A comprehensive study identified a total of 70 BraGSTs genes. Cluster analysis results demonstrated that the BraGSTs in Brassica rapa(B.rapa) could be categorized into eight sub-families and were unevenly distributed across ten chromosomes. The 39 BraGSTs genes were found to be organized into 15 tandem gene clusters, with the promoters containing multiple cis-elements associated with low-temperature response. Cold stress was observed to stimulate the expression of 15 genes, with the BraGSTF2 gene exhibiting the highest level of expression, sug-gesting its significant involvement in winter B.rapa's response to low-temperature stress. Sub-cellular localization analysis of the BraGSTF2 protein indicated its potential expression in both the cell membrane and nucleus. The analysis of stress resistance in BraGSTF2 transgenic Arabidopsis thaliana lines emon-strated that the over-expression of this gene resulted in significantly elevated levels of SOD, POD activity, and SP content compared to the wild type following exposure to low temperatures. These levels reached their peak after 24 hours of treatment. Conversely, the MDA content was lower in the transgenic plants compared to the wild type. Additionally, the survival rate of BraGSTF2 transgenic Arabidopsis thaliana was higher than that of the wild type, suggesting that the BraG-STF2 gene may play a crucial role in enhancing the cold stress tolerance of winter B. rapa. This study lay a foundation for further study on the role of BraGSTs gene in the molecular regulation of cold resistance in winter B.rapa.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

A series of novel indole Schiff base derivatives (2a–2t) containing a 1,3,4-thiadiazole scaffold modified with a thioether group were synthesized, and their structures were confirmed using FT-IR, ¹H NMR, ¹³C NMR, andHR-MS. In addition, the antifungal activity of synthesized indole derivatives was investigated against Fusarium graminearum (F. graminearum), Fusarium oxysporum (F. oxysporum), Fusarium moniliforme (F. moniliforme), Curvularia lunata (C. lunata), and Phytophthora parasitica var. nicotiana (P. p. var. nicotianae) using the mycelium growth rate method. Among the synthesized indole derivatives, compound 2j showed the highest inhibition rates of 100%, 95.7%, 89%, and 76.5% at a concentration of 500 μg/mL against F. graminearum, F. oxysporum, F. moniliforme, and P. p. var. nicotianae, respectively. Similarly, compounds 2j and 2q exhibited higher inhibition rates of 81.9% and 83.7% at a concentration of 500 μg/mL against C. lunata. In addition, compound 2j has been recognized as a potential compound for further investigation in the field of fungicides.

Carton detection is an important technique in the automatic logistics system and can be applied to many applications such as the stacking and unstacking of cartons, the unloading of cartons in the containers. However, there is no public large-scale carton dataset for the research community to train and evaluate the carton detection models up to now, which hinders the development of carton detection. In this paper, we present a large-scale carton dataset named Stacked Carton Dataset (SCD) with the goal of advancing the state-of-the-art in carton detection. Images are collected from the Internet and several warehouses, and objects are labeled using per-instance segmentation for precise localization. There are total of 250,000 instance masks from 16,136 images. Naturelly, a suite of benchmarks are established with several popular detectors. In addition, we design a carton detector based on RetinaNet by embedding our proposed Offset Prediction between Classification and Localization module (OPCL) and Boundary Guided Supervision module (BGS). OPCL alleviates the imbalance problem between classification and localization quality which boosts AP by 3.1%∼4.7% on SCD at the model level while BGS guides the detector to pay more attention to boundary information of cartons and decouple repeated carton textures at the task level. To demonstrate the generalization of OPCL to other datasets, we conduct extensive experiments on MS COCO and PASCAL VOC. The improvements of AP on MS COCO and PASCAL VOC are 1.8%∼2.2% and 3.4%∼4.3% respectively. Source dataset is available here.

Benzimidazole fungicides are a class of highly effective, low-toxicity, systemic broad-spectrum fungicides developed in the 1960s and 1970s, based on the fungicidal activity of the benzimidazole ring structure. They exhibit biological activities including anticancer, antibacterial, and antiparasitic effects. Due to their particularly outstanding antibacterial properties, they are widely used in agriculture to prevent and control various plant diseases caused by fungi. The main products of benzimidazole fungicides include benomyl, carbendazim, thiabendazole, albendazole, thiophanate, thiophanate-methyl, fuberidazole, carbamic acid, and carbendazim salicylate. This article mainly reviews the physicochemical properties, toxicological properties, and disease control efficacy, and pesticide residue and detection technologies of the aforementioned nine benzimidazole fungicides and their main metabolite (2-aminobenzimidazole). On this basis, a brief outlook on the future research directions of benzimidazole fungicides is presented.

In recent years, the individualized demand of customers brings small batches and diversification of orders towards enterprises. The application of enabling technologies in factory, such as the Industrial Internet of Things (IIoT) and Cloud Manufacturing (CMfg), enhances the ability of customer requirement automatic elicitation and the manufacturing process control. The job shop scheduling problem with random job arrival time dramatically increases the difficulty in process management. Thus, how to collaboratively schedule the production and logistics resources in the shop floor is very challenging, and it has a fundamental and practical significance of achieving the competitiveness for an enterprise. To address this issue, the real-time model of production and logistics resources is built firstly. Then, the task entropy model is built based on the task information. Finally, the real-time self-adaption collaboration of production and logistics resources is realized. The proposed algorithm is carried out based on a practical case to evaluate its effectiveness. Experimental results show that our proposed algorithm outperforms three existing algorithms.

Since the water-borne iodine excessive goiter was firstly found and reported in 19 in Hebei Province, it was confirmed successively. The national water-borne investigation carried out in 2005 demarcated the water-borne iodine excess areas and water-borne iodine excess endemial areas. The high iodine water well was found In 129 counties of 11 provinces, about 30.98 million people of threatened population lived in water-borne iodine excess areas and water borne iodine excess endemial areas. In these areas, the measures of prevention and control was effectively implemented. In 2016, the new standard of iodine excess area was issued, the iodine excess areas redrawed, and in these areas, non-iodized salt should be supplied and the drinking water should be gradually improved of water, and to control the damage of water-borne iodine excess at an early date

The plate fin heat exchanger is the compact heat exchanger applied in many industries because of its high thermal performance. To enhance the heat transfer of plate fin heat exchanger in further, three new kinds of wavy plate fins, namely perforated wavy fin, staggered wavy fin and discontinuous wavy fin are proposed and investigated by CFD simulations. The effects of key design parameters, including that of waviness aspect ratios, perforation diameters, stagger ratios and breaking distance are investigated, respectively, with the Reynolds number changes from 500 to 4500. It is found that due to the swirl flow and efficient mixing of fluid, the perforation, serration and breaking techniques are beneficial for the enhancement of heat transfer compared to the traditional wavy fin. At the same time, serration is beneficial to reduce the friction factor, and the breaking technique can reduce heat transfer area as well as enhance heat transfer performance. Through the performance evaluation criteria, the staggered wavy fin has an advantage over the small waviness aspect ratio compared to the perforated wavy fin. The maximum performance evaluation criteria (PEC), as high as 1.24, can be obtained for the perforated wavy fin at the largest waviness aspect ratio.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

A multi-strand composite welding wire was applied to join high nitrogen austenitic stainless steel, and microstructures and mechanical properties were investigated. The electrical signals demonstrate that the welding process using a multi-strand composite welding wire is highly stable. The welded joints are composed of columnar austenite and dendritic ferrite and welded joints obtained under high heat input and cooling rate have a noticeable coarse-grained heat-affected zone and larger columnar austenite in weld seam. Compared with welded joints obtained under the high heat input and cooling rate, welded joints have the higher fractions of deformed grains, high angle grain boundaries, Schmid factor and the lower dislocation density under the low heat input and cooling rate, which indicate a lower tensile strength and higher yield strength. The rotated goss (G_RD) orientation of a thin plate and the cube (C) orientation of a thick plate are obvious after welding, but the S orientation at 65° sections of Euler’s space is weak. The δ-ferrite was studied based on the primary ferrite solidification mode. It is observed that low heat input and high cooing rate result in the increasing of δ-ferrite and high dislocation density was obtained in grain boundaries of δ-ferrite. M₂₃C₆ precipitates due to low cooling rate and heat input in weld seam and deteriorates the elongation of welded joints. The engineering stress-strain curves also show the low elongation and tensile strength of welded joints under low heat input and cooling rate, which is mainly caused by the high fraction of δ-ferrite and the precipitation of M₂₃C₆.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

The effects of mixing orders of tannic acid (TA), starch and α-amylase on the enzyme inhibition of TA were studied, including mixing TA with α-amylase before starch addition (order 1), mixing TA with pre-gelatinized starch before α-amylase addition (order 2) and co-gelatinizing TA with starch before α-amylase addition (order 3). It was found that the enzyme inhibition was always highest for order 1 because TA could bind with the enzyme active site thoroughly before digestion occurred. Both order 2 and 3 reduced α-amylase inhibition through decreasing binding of TA with the enzyme, which resulted from the non-covalent physical adsorption of TA with gelatinized starch. Interestingly, at low TA concentration, α-amylase inhibition for order 2 was higher than order 3, while at high TA concentration, the inhibition was shown with opposite trend, which arose from the difference in the adsorption property between the pre-gelatinized and co-gelatinized starch at the corresponding TA concentrations. Besides, both the crystalline structures and apparent morphology of starch were not significantly altered by TA addition for order 2 and 3. Conclusively, although a polyphenol may have an acceptable inhibitory activity in vitro, the actual effect may not reach the expected one when taking processing procedures into account.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

In northern Canada where permafrost is prevalent, a shortage of accessible, affordable, and high-quality housing has been ongoing for decades. Design of foundations in permafrost presents unique engineering challenges due to permafrost soil mechanics and climate change. There is no specific design code for pile or shallow foundations in northern Canada. Consequently, the design process heavily relies on the expertise and experience of Arctic geotechnical engineers who have specialized knowledge in this field. Therefore, a comprehensive review of the practice or literature in foundation design in the Arctic would be necessary. The main objective of this review paper is to provide an overview of the common foundations in permafrost and the techniques adopted to counteract the effects of frozen soils. This study conducted a literature review of state-of-the-art practices on deep and shallow foundations used in northern Canada, including common steel pipe piles and thermosyphons. The review summarized the current principles, including adfreeze strength, creep settlement, and frost heave, used in the foundation design in permafrost. Then this paper summarized the findings from interviewing several engineers or professionals who have experiences in the design of foundations in permafrost. The interviews revealed the technical and non-technical aspects of foundation design practice in northern Canada. Lastly, in order to demonstrate the design methods, the paper presented two examples where screw piles and steel pipe piles were designed to support a residential building in northern Canada, according to the state-of-practice criteria for adfreeze strength, long term settlement and frost heave.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

It’s well known that existing horizontal well drilling and hydraulic fracturing technology that is used to achieve large-scale cost-effective production from immature to low-moderate maturity continental shale in China, where the organic matter mainly exists in the solid form is fairly ineffective. To overcome the obstacles, in-situ conversion technology seems feasible, while implementing it in the target layer along with estimating the amount of expected recoverable hydrocarbon in such shale formations seems difficult. This is because there is no guideline to choose the most appropriate method and select relevant key parameters for this purpose. Hence, based on thermal simulation experiments during the in-situ conversion of crude oil from the Triassic Chang 73 Formation in the Ordos Basin and the Cretaceous Nenjiang Formation in the Songliao Basin, this deficiency in knowledge was addressed. First, relationships between the in-situ converted total organic carbon (TOC) content and the vitrinite reflectance (Ro) of the shales and between the residual oil volume and the hydrocarbon yield was established. Second, the yields of residual oil and in-situ converted hydrocarbon were measured, revealing their sensitivity to fluid pressure and crude oil density. In addition, a model was proposed to estimate the amount of in-situ converted hydrocarbon based on the TOC, hydrocarbon generation potential, Ro, residual oil volume, fluid pressure, and crude oil density. Finally, a method was established to determine key parameters on the final hydrocarbon yield from immature to low-moderate maturity organic material during in-situ conversion in shales. Following the procedure outlined in this paper, estimated recoverable in-situ converted oil in the shales of the Nenjiang Formation in the Songliao Basin was estimated to be approximately 292×108 tons, along with 18.5×1012 cubic meters of natural gas, in an area of approximately 8×104 square kilometers. Collectively, the method developed in this study is independent from the organic matter type and other geological and/or petrophysical properties of the formation and can be applied to other areas globally where there isn’t any available in-situ conversion thermal simulation experimental data.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Transposable elements (TEs) are mobile genetic elements capable of rapidly altering the genome through their movements. The importance of TE activity has been documented in many biological processes, such as introducing genetic instability, altering patterns of gene expression, and accelerating genome evolution. Increasing appreciation of TEs results in the growing number of bioinformatics software to identify insertion events. However, the application of existing TE finding tools is limited by either narrow-focused design of the package, too many dependencies on other tools, or prior knowledge required as input files that may not be readily available to all users. Here, we report a simple pipeline, TEfinder, developed for the detection of new TE insertions with minimal software dependencies using four inputs that can be easily generated with popular variant calling pipelines. The external software requirements are BEDTools, SAMtools, and Picard. Necessary inputs include TEs present in the reference genome, binary paired-end alignment, reference genome index, and a list of TE names. We tested TEfinder pipeline among several evolving populations of Fusarium oxysporum generated through a short-term adaptation study. Our results demonstrate that this easy-to-use tool can effectively detect new TE insertion events, making it accessible and practical for TE analysis.

The underground complicated testing environment and the fan operation instability cause large random errors and outliers of the wind speed signals. The outliers and large random errors result in distortion of mine wind speed monitoring, which possesses safety hazards in mine ventilation system. Application of Kalman filter in velocity monitoring can improve the accuracy of velocity measurement and eliminate the outliers. Adaptive Kalman Filter was built by automatically adjusting process noise covariance and measurement noise covariance depending on the differences between measured and expected speed signals. We analyzed the fluctuation of airflow flow using data of wind speed flow and distribution characteristics of the tunnel obtained by the Laser Doppler Velocimetry system (LDV) studies. A state-space model was built based on the tunnel airflow fluctuations and wind speed signal distribution. The adaptive Kalman Filter was calculated according to the actual measurement data and the Expectation Maximization (EM) algorithm. The adaptive Kalman filter was used to shield fluid pulsation while preserving system-induced fluctuations. Using the Kalman filter to treat offline wind speed signal acquired by LDV, the reliability of Kalman filter wind speed state model and the characteristics of adaptive Kalman Filter were investigated. Results showed that the adaptive Kalman filter effectively eliminated the outliers and reduced the root-mean-squares error (RMSE), and the adaptive Kalman filter had better performance than the traditional Kalman filter in eliminating outliers and reducing RMSE. Field experiments in online wind speed monitoring were conducted using the optimized adaptive Kalman Filter. Results showed that adaptive Kalman filter treatment could monitor the wind speed with smaller RMSE compared with LVD monitor. The study data demonstrated that the adaptive Kalman filter is reliable and suitable for online signal processing of mine wind speed monitor.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Large scale cropland erosion rates mapping and dynamic monitoring are critical for agricultural planning but extremely challenging. In this study, by using field investigation data collected from 20,155 land parcels in 2,781 sample units in the National Soil Erosion Survey, land use change data for two decades from the National Land Use/Cover Database of China (NLUD-C), we proposed a new point to surface approach to quantitatively assess long-term cropland erosion based on the CSLE model and non-homogeneous voting. The results show that cropland in Yunnan suffers from serious problem with unsustainable mean soil erosion rate of 40.47t/(ha·a) and erosion ratio of 70.11%, which are significantly higher than those of other land types. Engineering control measures (ECMS) have a profound impact on reducing soil erosion, soil erosion rate of cropland with and without ESMs differs by more than five times. Over the past two decades, the cropland area in Yunnan continues to decrease, with a net reduction of 7461.83 km2 and a ratio of −10.55%, which causes corresponding 0.32×108 t (12.12% ) decrease in cropland soil loss. We also quantified the impact of different LUCC scenarios on cropland erosion, and extraordinarily high variability was found in soil loss in different basins and periods. Conversion from cropland to forest contributes the most to cropland erosion reduction, while conversion from grassland to cropland contributes 56.18% of the increase in soil erosion. Considering the current speed of cropland regulation, it is the sharp reduction in land area that leads to cropland erosion reduction rather than treatments. The dilemma between the Grain for Green Policy and Cropland Protecting Strategy in mountainous areas should be treated carefully with shared understanding and collaborations from different roles.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

The microstructure evolution of SCM435 cold heading steel at different cooling rates was investigated by means of scanning electron microscopy, TEM, XRD, and electron backscatter diffraction. The results show that the cooling rate has a significant effect on the microstructure of the experimental steel. With an acceleration of the cooling, the microstructure of the steel gradually changed from ferrite and pearlite to ferrite, pearlite, and granular bainite; finally, the pearlite disappeared, and the microstructure changed to acicular ferrite, bainite, and martensite. With an increase in the cooling rate, the morphology of the carbide underwent an evolution from sheet carbide to short-rod carbide, granular carbide, and ultimately thin-strip carbide. With the acceleration of cooling, the proportion of large-angle grain boundaries gradually decreased, and the area of small-angle grain boundaries gradually increased. When the cooling rate was 0.1℃/s, the proportion of large-angle grain boundaries was as high as 52.8%, and the dislocation density was only 1.91 × 1012 cm−2. When the cooling rate was 2.0℃/s, the proportion of large-angle grain boundaries was only 27.1%, and dislocation density increased to 5.38 × 1012 cm−2. With the increase in the cooling rate, the depth of the decarbonization layer and the thickness of the scale oxide gradually decreased, the proportion of FeO phase in the scale phase gradually decreased, and the proportion of Fe3O4 phase and Fe2O3 phase gradually increased. The tensile strength increased monotonously with the increase in cooling rate, whereas the elongation and shrinkage first decreased, then increased, and then decreased. When the cooling rate was 1.0 m/s, the short rod and granular bainite in the material structure endowed the SCM435 steel with excellent strength and toughness matching, and the tensile strength and elongation of the steel reached 895 MPa and 24%, respectively.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

Knee Osteoarthritis (KOA) is a chronic disease characterized by progressive disability and joint pain. Meniscus chondrocytes apoptosis is the main cause of reduced chondrocyte number and self-repair function. The purpose of this study was to investigate the role of miR-27b-3p in KOA.In this study, we found that the expression of miR-27b-3p was downregulated in cultured IL-1β treated chondrocyte and cartilage tissues in KOA. KOA overexpression evidently reduced IL-1β induced chondrocyte apoptosis and caspase-3 and caspase-9 expression.The upregulated iNOS and COX-2 mRNA and proteins expression was also inhibited by miR-27b-3p mimics. The expression of nitric oxide, PGE2, TNF-α and IL-6 was also inhibited by miR-27b-3p mimics. The target gene of miR-27b-3p was confirmed to be BDNF. TrkB/CREB pathway was proved to be the downstream pathway of miR-27b-3p/BDNF axis.The apoptotic cell percentage and nitric oxide, PGE2, TNF-α and IL-6 expression was induced by BDNF+IL-1β. This induction was inhibited by miR-27b-3p mimics. The cartilage tissues stained with safranin O results showed miR-27b-3p greatly decreased KOA induced cartilage degradation. The expression of BDNF、TrkB and p-CREB was inhibited by len-miR-27b-3p. MiR-27b-3p also reduced the expression of TNF-α、IL-6 and Bax, and increased Bcl-2 expression. These results indicated miR-27b-3p could applied to inhibit the development of KOA and miR-27b-3p/BDNF/TrkB/CREB pathway could serve as novel treatment target to handle KOA.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

Purpose: The purpose of this study was to evaluate the dosimetric impact of multiple channels compared to a single channel in high dose rate (HDR) vaginal cuff brachytherapy (VCBT). Methods and materials: Sample plans of HDR VCBT from both single and multiple channel cylinders at 2.5, 3.0 and 3.5 cm in diameter were created and analyzed. The doses were prescribed either at the 0.5 cm depth with 5.5 Gy for 4 fractions or at the cylinder surface with 8.8 Gy for 4 frac¬tions, in various treatment lengths ranging from 3 to 8 cm. A 0.5 cm ring target volume called PTV_Eval was contoured for each plan and served as the target volume for dosimetric evaluation. Mean doses and the doses covering 90% (D90), 10% (D10), and 5% (D5) of PTV_Eval were calculated and compared. The same treatment lengths, same prescription regimens, same target volume contouring and same plan evaluation methods were repeated for the similar size single channel and multiple channel cylinders. Results: The mean doses of both regimens with the multi-channel cases (6.3 to 7.1 Gy) were comparable to single channel ones (6.4 and 7.5 Gy). The ranges of D90, D10 and D5 were from 3.654 to 5.04 Gy, 8.44 to 10.08 Gy and 8.84 to 10.86 Gy in the multi-channel cases, but from 5.36 to 5.76 Gy, 7.40 to 9.97 Gy and 8.16 to 11.93 Gy in the single channel cases, respectively. Conclusion: The single channel and multiple-channel cylinder deliver a similar mean dose, but with marked heterogeneity in D90, D5 and D10 for the same prescription dose and target volume. Multi-channel cylinders adequately cover the target volume, but given the heterogeneity, increased treatment time and cost are best suited for asymmetric target volumes.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

In this paper, a sensitivity sensor of dual-core photonic crystal fiber (DC-PCF) filled with magnetic liquid is introduced and investigated by the finite element method (FEM). To regulate the energy coupling involving the two cores, the magnetic fluid is filled into the pore between the two cores. To adjust the coupling between the supermodes in the DC-PCF, the refractive index of the magnetic fluid-filled air hole may change due to the external magnetic field. This specifically created a magnetic fluid-filled DC-PCF, the magnetic fluid-filled hole is not used as the core for energy transmission, thus avoiding transmission loss. The dip wavelength and the magnetic field displayed an excellent linear connection between 80 and 260 Oe, depending on the numerical data. The detection sensitivity of the magnetic field reached 515.75 pm/Oe at a short fiber length of 482 m. The designed magnetic fluid-filled DC-PCF has high sensitivity and small volume and has great application prospects in medical and industrial field magnetic field detection.

This paper investigates the cooperative anti-jamming distributed channel selection problem in UAV communication networks. Considering the existence of malicious jamming and co-channel interference, a location-aware cooperative anti-jamming scheme is designed for the purpose of maximizing the users' utilities. Users in the UAV group cooperate with each other via location information sharing. When the received interference energy is lower than mutual interference threshold, users conduct channel selection strategies independently. Otherwise, users take joint actions with a cooperative anti-jamming pattern under the impact of mutual interference. Aimed at the independent anti-jamming channel selection problem under no mutual interference, a Markov Decision Process framework is introduced, whereas for the cooperative anti-jamming channel selection case under the influence of co-channel mutual interference, a Markov game framework is employed. Furthermore, motivated by reinforcement learning with a ``Cooperation-Decision-Feedback-Adjustment" idea, we design a location-aware cooperative anti-jamming distributed channel selection algorithm (LCADCSA) to obtain the optimal anti-jamming channel strategies for the users with a distributed way. In addition, the channel switching cost and cooperation cost, which have great impact on the users' utilities, are introduced. Finally, simulation results show that the proposed algorithm converges to a stable solution with which the UAV group can avoid the malicious jamming as well as co-channel interference effectively.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

The meniscus is a meniscus-shaped fibrocartilage tissue located between the femur and tibia，it is mainly composed of meniscus cells and related extracellular matrix.The synovial limbus area of the knee joint capsule near the meniscus is divided into red areas with rich blood vessels and white areas with less blood supply according to the distribution of blood vessels,there is a transition zone called the red and white zone between the two;Red zone has better self-repair ability,The injury in this area can be treated by conservative treatment or surgical suture;Once the white area of the meniscus is torn and involves the free edge area,It is often necessary to partially remove the damaged meniscus.When most of the entire meniscus is severely torn and involved,not only the course of the disease is very long, but it cannot be repaired by sutures,Often a subtotal or total meniscus resection is required,whether it is a partial meniscus resection, a subtotal meniscus resection or a complete resection.In the later period, it may cause quadriceps atrophy and osteoarthritis (OA）.OA is a refractory multi-system disease,involve the patient’s peripheral joints,it has high disability and teratogenicity, and is very harmful to human health.Chondrocyte pyrolysis, degradation, and inflammation play a vital role in the destruction of OA articular cartilage and chondrocyte apoptosis.Meniscus stem cells have strong proliferation and differentiation ability,has become one of the hot spots in the field of meniscus repair,this article studies the role of meniscal stem cells in the development of OA.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Innovation is an essential key factor in the technology development history. Past research on innovation focused more on the innovation behavior of technology, but seldom described knowledge assets which also influence innovation behavior greatly. The effect of knowledge assets attribute and result on disruptive innovation is therefore regarded as the research topic in this study, where disruptive innovation is divided into outbound and inbound to combine combination-embeddednessandmajor business specificityof knowledge assets as the research model. Manufacturing enterprises in China are proceeded the questionnaire survey, and 173 valid copies are collected. The empirical analysis shows that combination-embeddedness of knowledge assets presents significantly positive effects on major business specificity and outbound innovationof an enterprise but reveals remarkably negative effects on inbound innovation. Enterprises are suggested to constantly accumulate knowledge assets with low major business specificity before disruptive innovation in order to reduce ineffective inbound innovation.

Magnetosomes of magnetotactic bacteria consist of magnetic nanocrystals with defined morphologies enclosed in vesicles originated from cytoplasmic membrane invaginations. Although many proteins are involved in creating magnetosomes, a single magnetosome protein, Mms6, can direct the crystallization of magnetite nanoparticles in vitro. The in vivo role of Mms6 in magnetosome formation is debated and the observation that Mms6 binds ferric and not ferrous iron raises the question of how Mms6 could promote the crystallization of magnetite, which contains both ferric and ferrous iron. Here we show that Mms6 is a ferric reductase that reduces ferric to ferrous iron using NADH and FAD as electron donor and cofactor, respectively. Reductase activity is elevated when Mms6 is integrated into either liposomes or bicelles. Analysis of Mms6 mutants suggests that the C-terminal domain binds iron and the N-terminal domain contains the catalytic site. Although Mms6 forms multimers that involve C-terminal and N-terminal domain interactions, a fusion protein with Mms6, which remains a monomer, displays reductase activity, which suggests that the catalytic site is fully in the monomer. These results are consistent with a hypothesis that Mms6, a membrane protein, promotes the formation of magnetite by a mechanism that involves reducing iron.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

Abstract：This paper uses the balanced panel data from 29 provinces (autonomous regions and municipalities) in China for a total of 17 years from 2000 to 2016 as a research sample, and establishes an empirical model to examine the impact of environmental regulations and technological innovation on the quality of economic growth. Then this paper test technological innovation as a threshold variable, in which play a regulatory role. Taking the provincial balanced panel data as a research sample, a fixed effect model, a system GMM model, and a panel threshold model were established for empirical testing and the robustness test. Based on the empirical results, this article draws the following conclusions: from a national perspective, environmental regulations and technological innovation can significantly promote the quality of economic growth; from a regional perspective, there are regional differences in impact effects. Under the constraints of environmental regulations, the promotion effect of technological innovation on the quality of economic growth will be reduced; the impact of environmental regulation on the quality of economic growth will have a "threshold effect", and environmental regulation can significantly promote the quality of economic growth only after crossing the threshold and the threshold of technological innovation.

COX II containing a dual core CuA active site is one of the three core subunits of mitochondrial Cco, which plays a significant role in the physiological process. In this report, the full-length cDNA of COXⅡ gene was cloned from Sitophilus zeamais, which had an ORF of 684 bp encoding 227 amino acids residues. The predicted COXⅡ protein had a molecular mass of 26.2 kDa with pI value of 6.37, and multiple sequence alignment and phylogenetic analysis indicated that Sitophilus zeamais COXⅡ had high sequence identity 78.51% with the COXⅡ of other insect species, especially similarity to sitophilus oryzae. This gene was subcloned into the prokaryotic expression vector pET-32a, and induced by IPTG in E.coli Transetta (DE3) expression system. Finally the COXⅡ with 6-His tag was purified using affinity chromatography with Ni²⁺-NTA agarose. WB showed the recombinant COXⅡ was about 44 kD, and the concentration of fusion protein was 50μg/mL. UV-spectrophotometer and infrared spectrometer analysis showed that recombinant COXⅡ could catalyze the oxidation of substrate Cytc, and influenced by AITC. It was found that AITC could form a hydrophobic region with COXⅡ protein via molecular docking, besides, a sulfur atom of AITC structure could form a length of 2.9 Å hydrogen bond with Leu-31. These results will provide valuable information for elucidating the role of COXⅡ in Sitophilus zeamais responses to AITC, meanwhile, it will helpful to carry out a point mutation in AITC binding sites for the future research.

The research fills the policy research gap for the women entrepreneurship and sustainability performance for examining key successful factors. Previous women entrepreneurship research fails to offer policy recommendations. The research purpose is to investigate these factors affect women entrepreneurship capabilities and sustainability performance by using SEM analysis and making policy recommendation. This research employs online and mail survey and obtains 175 women entrepreneur sample. The study finds that family support and motivation have positive effect on women entrepreneurship capabilities and sustainability performance. Barriers have no effect on performance. Hopefully, the research can provide the guidance to contribute to women’s entrepreneurship opportunities for achieving SDGs. Policy recommendation and managerial implication are discussed in the article.

Antibiotic resistance (ABR) is concerning issue due to its direct and indirect repercusions on public health, since decreased therapeutic effect of certain antibiotic to treatment complications that can cause death. There are several mechanism as to how ABR can be transferred from one microoorganisms to another, and many of them are dependant many environmental factors. The food supply chain is a environment in which ABR gene transfer can occur is multiple pathways, which generate concerns regarding food safety. Here, we summarize relevant mechanisms which are implied in ABR in food supply chain but also we are addressing routes of transmission and prevalence of ABR, implications on public health, and the application of new alternatives to antibiotics such as antimicrobial peptides, mainly bacteriocins, in order to countermeasure ABR.

Economic development and advancements in information technology contributed to the shift on accounting objective from commission responsibility view to decision-making useful view. The decision-making useful view claims that the accounting measurement methods should be changed to improve the usefulness of accounting information, to enable information users to make correct decisions. In addition, the development of financial instruments leads to the birth of fair value accounting. In recent years, fair value has been one of the most important measurement methods in the International Accounting Standard and US Generally Accepted Accounting Principles. However, China has been quite cautious when it comes to applying fair value full time, especially after the global financial crisis happened in 2008, wherein fair value accounting was exposed to strong suspicion. Hence, studying the value relevance of fair value is of great significance to exploring the accounting profession and reforming accounting standards. This paper attempts to investigate the value-relevance of fair value based on the data of listed financial companies and manufacturing companies in China. The results indicate that the fair value information in the financial industry has a strong explanatory influence to corporate share price. In contrast, the fair value information shows limited relevance in the manufacturing industry. Finally, consulting with the results of normative analysis and empirical study, this paper suggests several rational advices for the application of fair value in China.

Trichothecene mycotoxin T-2 toxin is an important environmental pollutant and poses a global threat to human and animal health. T-2 toxin could induce nephrotoxicity, however, the precise molecular mechanism remains unclear. In this study, the mice were intraperitoneally administrated with a single dose of 2 mg/kg T-2 toxin. The kidney function and ultrastructural observation were also assessed and found T-2 toxin exposure could cause kidney damage. Transmission electron microscopy showed a significant swelling and vacuolization of the mitochondria of renal cell. A total of 1122, 58, and 391 differential expression genes (DEGs) that were predominantly expressed in kidney tissues at 1 d, 3 d, and 7 d after T-2 toxin exposure, respectively. Early transcriptomic changes at 1 d after exposure were down-regulation of DEGs involved in the cell cycle, p53 signaling pathway, and cellular senescence, while up-regulation of DEGs referred to the ribosome pathway. The temporal variations in gene expression pattern in T-2 toxin exposure in mice kidney were presented and cellular metabolism was disturbed at the exposure recovery period with 7 d. In conclusion, this study, for the first time, provided a comprehensive comparative transcriptomic analysis of gene regulation in T-2 toxin exposure-induced nephrotoxicity at different temporal periods and explored the nephrotoxicity mechanism of T-2 toxin at the mRNA level.

Atopic dermatitis (AD) is a chronic inflammatory skin disease, which can cause skin barrier function damaged. Although co-incubation with docosahexaenoic acid (DHA) exerts a positive effect in deficient skin model, there is no study to investigate the effects of topical treatment with DHA in inflammatory reconstructed human epidermis (RHE) model. The effects of DHA on monolayer normal human epidermal keratinocyte (NHEK) cells were evaluated via CCK-8, qPCR and ELISA. The skin related barrier function was assessed by hematoxylin-eosin (HE) staining, western blot (WB), Immunohistofluorescence (IF) and ELISA in normal and inflammatory RHE models. DHA upregulated filaggrin and loricrin expression at mRNA levels in addition to suppress overexpression of TNF-α，IL-1α and IL-6 stimulated by poly I:C plus LPS (stimulation cocktail) in cultured NHEK cells. After topical treatment with DHA, cocktail induced inflammatory characteristics of skin diseases including barrier morphological, differentiation proteins and TSLP secretion, which were alleviated in RHE models. Supplementation with DHA can improved related barrier function and have anti-inflammation effects in monolayer keratinocytes and RHE models, which indicated that DHA may have a potential value for the treatment of inflammation-associate skin diseases.

Technology can be seen everywhere and has been integrated into our lives.We are always using technology and enjoying the convenience brought by technology. However, physical retailers and e-commerce companies are also gradually adopting advanced technologies. Technology improves the purchasing environment and purchasing experience. Virtual reality and augmented reality have been hotly discussed in recent years. Technology, although virtual reality and augmented reality technology have not yet matured, it can be said that they will in the future It has great development potential. Virtual reality and augmented reality are also beginning to sprout in the retail industry. However, research on the acceptance of the use of virtual reality and augmented reality in the apparel shopping process is still lacking because This study explores how usefulness, ease of use, hedonicity, customer experience, customer engagement and satisfaction. To influence customer loyalty, this study adopted questionnaire survey and convenience sampling methods, and collected a total of 308 valid questionnaires. The analysis method used confirmatory factor analysis and structural equation model to verify the research hypothesis relationship. The results of this study found. Hedonic has a significant impact on customer loyalty, while usefulness, ease of use, customer experience, customer engagement and satisfaction Satisfaction does not have a significant impact on customer loyalty. This study explains the academic contribution of the research results. The practical implications in marketing are put forward, and specific suggestions and directions for future research are given.

Rhododendron chrysanthum Pall., live in Changbai Mountain being exposed to chilling temperature, high light intensities and water scarcity condition. To adapt to the harsh environment, the cold resistance mechanisms of R. chrysanthum have been successfully evolved in the long-term adaptive process. In our present work, the methods of proteomics combined with physiological and biochemical analyses were used to investigate the effects of cold stress on the photosynthesis and antioxidant system of Rhododendron chrysanthum Pall. and the molecular mechanisms involved in cold resistance of plants. A total of 153 photosynthesis related proteins were identified in present work, of which 7 proteins including Rubisco large subunit (rbcL) were up-regulated in experiment group (EG) compared with control group (CG). Simultaneously, four chlorophyll fluorescence parameters were measured in present study. The results showed that the maximum photochemical efficiency of photosystem II (Fv/Fm), actual quantum yield of PSII (Y(II)) and photochemical quenching (qP) were significantly higher in EG, whereas the non-photochemical quenching (NPQ) was notably decreased. Cold stress could lead to a significant reduction in electron transport rate (ETR) accompanied with an increase in excitation pressure (1-qP). The abundance of PetE which involved in the plants photosynthetic electron transfer was also significantly influenced by cold stress. Moreover, the up-regulated expressions and higher levels of enzymatic activities of Glutathione peroxidase (GPX) and Ascorbate peroxidases (APXs) were detected in EG. All these changes which can help plants to survive in low temperature are considered as the crucial parts of cold tolerance mechanisms. These results revealed that photosynthesis and redox adjustment play significant roles in the defense of cold-induced damage.

Epitranscriptomic RNA modifications play a crucial role in the posttranscriptional regulation of gene expression. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic RNA and plays a pivotal role in RNA fate. RNA m6A modification is regulated by a group of cellular proteins, methyltransferases (writers) and demethylases (erasers), which add and remove the methyl group from adenosine, respectively. m6A modification is recognized by a group of cellular RNA-binding proteins (readers) that specifically bind to m6A-modified RNA, mediating effects on RNA stability, splicing, transport, and translation. The functional significance of m6A modification of viral and cellular RNA is an active area of virology research. In this review, we summarize and analyze current literature on m6A modification of HIV-1 RNA, the multifaceted functions of m6A in regulating HIV-1 replication, and the role of viral RNA m6A modification in evading the innate immune responses to infection. Furthermore, we briefly discuss future directions and therapeutic implications of mechanistic studies of HIV-1 epitranscriptomic modifications.

Threshing device is the core component of grain combine harvester, and its working performance determines the working quality and production efficiency of the harvester to a great extent. The straw guide plate plays an important role in the threshing device to dredge the threshing matter and control the threshing time of the combine harvester matter in the threshing chamber. In the past, the guiding structure of threshing device could not optimize the working performance of the machine by adjusting the spiral angle, that is, most cereal combine harvester may not be fed smoothly or even clogged when operating under different crop types, yield differences and operating environments, a kind of threshing device with adjustable guide straw board was studied. In this study, the movement model of the straw on the straw guide plate was analyzed, and it was found that the spiral angle “α”of the straw guide was 0<α<58°.Three-factor and three-level response surface method was used to carry out field experiment on drum speed, working speed and guide grass plate spiral angle, and the experimental data were analyzed by quadratic polynomial regression.The results show that the drum speed, working speed and the spiral angle of the guide grass plate have significant effects on the loss rate (PLR) , impurity content (PIR) and breakage rate (PBR) , the drum speed and working speed have an interactive effect on the impurity ratio (PIR) , and the working speed and the helical angle of the guide grass plate have an interactive effect on the loss ratio (PLR) and breakage ratio (PBR) , there is an interaction between the rotary speed of the roller and the helical angle of the guide grass plate on the crushing rate (PBR) .Further optimization analysis showed that the predicted value was PLR = 1.18% , PIR = 0.72% , PBR = 0.53% , the experimental verification value was PLR = 1.26% , PIR = 0.73% , PBR = 0.61% . The absolute error between the experimental value and the predicted value was very small, however, the optimized field test verified value decreased by 8.31% , 50.04% and 60.30% respectively, which indicated that the optimized harvester had better operation quality, in particular, PIR, PBR and other two indicators have a greater increase in the effect.

Due to the long-term deformation settlement of foundations, issues such as damage and functional failure of buildings and structures have long been of concern in the engineering field. The creep of soil is one of the primary causes leading to long-term deformation of foundations. In this paper, the consolidation deformation, creep characteristics, and creep model of reconstituted saturated silty clay were studied by isotropic compression test and triaxial shear creep test. The results show that for the isotropic compression test, although the applied load adopts different stages of loading, as long as the final applied confining pressure is the same, the number of stages applied by the confining pressure has little effect on the final isotropic consolidation deformation of the sample and the triaxial undrained shear strength after creep. However, for the triaxial shear creep test, it is found that under the same final deviatoric stress, the final deviatoric strain of the sample is closely related to the number of loading stages of deviatoric stress. It shows that the more loading stages of the sample loaded with the same deviatoric stress, the smaller the final deviatoric strain, and the triaxial undrained shear strength of the sample after creep will increase. In addition, it is reasonable to determine the pore pressure dissipation of the sample to 95%((u0-u0)/u0=95%) as the main consolidation end time (tEOP) of the sample. The isotropic consolidation creep curves and the triaxial shear creep curves show certain nonlinearity. Then the logarithmic model and the hyperbolic model were used to fit the creep curves of the samples. It is found that the hyperbolic model has a better fitting effect than the logarithmic model, but for the triaxial shear creep test, the creep parameters of the sample change greatly. Therefore, studying the creep characteristics of soil under different pre-loading steps is of significant engineering importance for evaluating the long-term deformation of underground structures.

Background: The COVID-19 outbreak has accelerated the huge difference between medical care and disease prevention in Chinese medical institutions. This study aimed to investigated the relationship between the symbiotic units, environments, models, and effects of the integration of medical and disease prevention. Methods: This cross-sectional study involved 762 employees of public hospitals in 11 cities in Zhejiang Province by random stratified sampling. We analyzed the influence paths of elements in the mechanism of integration of medical and disease prevention and the mediating effect of symbiotic models among symbiotic units, symbiotic environments, and effects for on this integration. Results: The path coefficient of symbiotic unit on the symbiosis model was 0.46 (p&lt;.001), the path coefficient of symbiotic environment on symbiosis model was 0.52 (p&lt;.001). The path coefficient of the symbiotic unit and environment was 0.91 (p&lt;.001). The symbiotic models exhibited a partial mediation effect between symbiotic units and the effect of this integration. Sobel test = 3.27, β = 0.152, and the mediating effect accounted for 34.6%. Conclusions: It is suggested that Health policy-makers and public hospital managers should provide sufficient symbiotic units, establish collaborative symbiotic models, and improve the effects of integration of medical and disease prevention in public hospitals.

To understand lung damage caused by COVID-19, we deduced two-phase lung damage mechanisms. After the lungs are infected with SARS-CoV-2 virus, the affected lung tissue swells and surface properties of pulmonary capillaries change, resulting in an increased flow resistance of affected capillaries. If a sufficient number of capillaries are affected by the infection, the swelling and increased cell wall adhesion collectively raise pulmonary vascular resistance. The increased vascular resistance further increases the dwell times of WBCs in affected capillaries and nearly capillaries. When pulmonary pressure is sufficiently higher, WBCs are forced to squeeze into interstitial spaces or alveolar spaces when local pressures are higher than what the capillaries can withstand. When more and more WBCs are dynamically retained, the flow resistance of more capillaries rises, pulmonary vascular resistance rises, and pulmonary pressure rises. The rise in the pulmonary pressure in turn results in elevated capillary pressures. When capillary pressures around the alveoli are sufficiently high, they cause interstitial pressures to change from normally negative values to positive values. The positive pressures cause fluid leakage to the alveolar space and thus degrade lung function. Tissue swelling, and occupation of WBCs in interstitial spaces and alveolar spaces further reduce compressible volume, and thus cause further rise in the pulmonary vascular resistance and pulmonary pressure. When the pulmonary pressure has reached a critical point as in the second phase, the blood breaks capillary walls and squeezes through interstitial spaces to reach alveolar spaces, resulting in irreversible lung damages. The available free volume in the thorax cage, organ usable capacities, temperature and humid are expected to have great impacts on degree of lung damages. The free volume in the thorax cage, lung usable surplus capacity, and other organ usable capacities determine the arrival time of last-phase irreversible damage. The mechanisms imply that the top priority for protecting lungs is maintaining pulmonary micro-circulation and preserving organ functions in the entire disease course while controlling viral reproduction should be stressed in the earliest time possible. The mechanisms also explain leukecytes are recruited and migrated into inflamed tissues by increasing their dwell times caused by increased local flow resistance.

In this study, we investigated the effects of three surface treatment techniques on 316L stainless steel, low-temperature immersion corrosion, shot peening followed by immersion corrosion, and electrochemical corrosion. Surface alterations were analyzed using scanning electron microscopy, Raman spectroscopy, and α-step thin-film thickness profiling. Human osteoblast adhesion was evaluated using Liu’s stain and metallographic optical microscopy. The results revealed weak cell adhesion after low-temperature immersion and shot peening followed by immersion corrosion. By contrast, electrochemical corrosion, particularly with a high current density and low corrosive solution concentration, resulted in a uniformly corroded surface, thus promoting dense cell adhesion. All three techniques resulted in porous oxide layers. Overall, our experimental findings highlighted shot peening (1 kg/cm2 for 20 s) and electrochemical corrosion (0.5 M HCl) as effective processes. Electrochemical corrosion produced uniformly dense corrosion pits, whereas shot peening produced semicircular grooves with small corrosion pits, both favorable for cell adhesion. Electrochemical corrosion also yielded excellent cell adhesion, emphasizing its suitability for biomedical activity. We developed a process for creating a porous surface layer and thereby enhancing the cell adhesion to 316L stainless steel for potential biomedical implant applications.

After reviewing cancer theories, cancer treatment development histories, randomized clinical trial's performance, cancer treatment strategy, trial follow-up times, and conducting numerous simulations using existing data, the authors found: (1) medical treatments come with three to four lethal factors: treatment side-effects, emotional distress and chronic dress, lack of exercises or physical inactivity, and excessive nutrition in some cases; (2) clinical trial exaggerates the benefits of fast-acting treatments and underestimates the slow-delivering adverse side effects as a result of statistical averaging, interfering effects of personal lifestyle factors, and insufficient follow-up times; (3) the benefits of medical treatments are limited by chain comparison, where surgery sets up a negative standard relative to the best way for resolving cancer; (4) the strategy of destroying the tumor is unworkable; (5) medical treatments can turn natural cancer growth curve into approximately doubly exponential curve; (6) multiple factor non-medical measures are much more powerful than medical treatments in controlling cancer growth and metastasis rates; and (7) cancer early diagnosis and over treatments are bad strategies that have great adverse impacts on cancer patients. Based on huge increases in cancer growth rate constants, substantial of loss of organ functional capacity, and severe systemic aging-like cellular damages, the authors concluded that medical treatments promote cancer growth and metastasis rates and shorten patient lives in most cases, and the claimed benefits are caused by triple biases of clinical trials. The authors believe that the better strategy for ending the global cancer epidemic is abandoning clinical trails as the research model, changing caner treatment strategy from killing cancer cells to slowing down cancer growth rates by using multiple factors optimization approach in personalized medicine.

This paper studies the contemporaneous relationship between S&P 500 index returns and log-increments of the market volatility index (VIX) via a nonparametric copula method. Specifically, we propose a conditional dependence index to investigate how the dependence between the two series varies across different segments of the market return distribution. We find that: (a) the two series exhibit strong, negative, extreme tail dependence; (b) the negative dependence is stronger in extreme bearish markets than in extreme bullish markets; (c) the dependence gradually weakens as the market return moves toward the center of its distribution, or in quiet markets. The unique dependence structure supports the VIX as a barometer of markets' mood in general. Moreover, applying the proposed method to the S&P 500 returns and the implied variance (VIX²), we find that the nonparametric leverage effect is much stronger than the nonparametric volatility feedback effect, although, in general, both effects are weaker than the dependence relation between the market returns and the log-increments of the VIX.

We aimed to evaluate the protective effects of acetyl-xylogalactan on the activity of RAW264.7 macrophages against heat stress. To this end, we assessed cell survival, phagocytic activity, in-tracellular Ca2+ level, mitochondria potential exchange, apoptotic assay findings, galactosidase activity and the RNA-seq by NGS and real-time polymerase chain reaction (PCR) expression. In our evaluation of macrophage morphology at 37°C and 41°C, the macrophages showed an oval shape at 41°C , unlike the spindle shape at 37°C. Therefore, 41°C was chosen as the heat stress condition. Subsequently, we designed an experiment to evaluate changes in the RAW264.7 macrophages after acetyl-xylogalactan treatment under heat stress. The survival of RAW264.7 macrophages treated with acetyl-xylogalactan was higher than that of controls that were not treated with acetyl-xylogalactan. Moreover, on the basis of the results of the annexin-V detection assay, the apoptotic activity of macrophages appeared to have reduced after treatment with ac-etyl-xylogalactan. Moreover, treatment with acetyl-xylogalactan resulted in a stronger recovery trend in the intracellular Ca2+ and mitochondrial membrane potential after heat stress. RNA sequencing and real-time polymerase chain reaction (PCR) illustrated that Sarcodia suieae acetyl-xylogalactan could upregulate the expression of the anti-apoptosis Cflar gene and down-regulate the expression of the apoptosis factors Ddit3, and Hyou1 to protect macrophages under heat stress.

The fatigue delamination damage is one of the most important fatigue failure modes of laminated composite structures. However, the developments of the theoretical framework, mathematical/physical model and numerical simulation of fatigue delamination are still challenging issues, and there is a lack of systematic classification. This article reviews the experimental phenomena of the onset and propagation stage of delamination under fatigue loading, and summarizes the commonly used phenomenological models for laminated composite structures. The research methods, general modeling formulas and development prospects of the phenomenological models are presented in detail. In the light of the analysis of finite element model (FEM) for the laminated composite structures, a number of simulation methods of fatigue delamination crack propagation damage model are carefully classified. Furthermore, within the theoretical framework of strength theory model (SM), fracture mechanics model (FM), damage mechanics model (DM) and hybrid model (HM), the complete procedure, application, capability assessment, advantages and limitations of the models are also discussed in detail. Finally, several valuable suggestions are given for the research interests, and challenging technical problems that need to be overcome on the fatigue delamination prediction of laminated composite structures in the future.

For the last two decades, an increasing demand for low-cost adsorbents for drinking water treatment has been challenged in the rural areas of developing countries that have problems with arsenic (As) contamination. In this work, spent bleaching earth (SBE), a residual material that is formed during the process of refining vegetable oil, has been utilized to prepare the new magnetic adsorbent Fe-SBE/C by modifying its surface area through calcination and co-precipitation with iron. The experimental results demonstrate that Fe-SBE/C exhibits a substantial adsorption capacity towards both arsenite (As(III)) and arsenate (As(V)). Optimal pH conditions were found to be pH 10 for As(III) and pH 3 for As(V), resulting in adsorption percentages of 76.7% and 94.1%, respectively. Other experimental parameters such as calcination conditions, adsorbent dosage, iron-loading ratio, and the presence of co-existing ions were thoroughly investigated. The kinetic study revealed that the adsorption processes follow the Elovich and intraparticle diffusion models, suggesting a combined adsorption mechanism of boundary layer control and chemisorption. Furthermore, the isotherm followed the Langmuir model with a maximum adsorption capacity of 202.61 μg g-1 for As(III) and 187.61 μg g-1 for As(V). Through thermodynamic analysis and reinforcement by activation energy data, this research validates that the observed adsorption process is indicative through chemisorption. The regeneration study revealed the potential for multiple cycles of arsenic removal, highlighting the practical applicability of Fe-SBE/C in environmental contexts. In conclusion, the findings of this study underscore the efficacy of Fe-SBE/C in arsenic removal and present it as a promising and environmentally friendly solution for mitigating arsenic pollution.

Many types of banana (Musa spp.)—one of the most economically important horticultural crops—exist, and their ploidy (diploid, triploid, and tetraploid, usually) and genome types (containing A or/and B genome in most cases) differ. At present, observation and genome type detection are commonly used to identify banana germplasm resources. However, the former is tedious, while the latter cannot distinguish categories below genome types. It is therefore urgent that a simple and effective method for identifying banana germplasm resources is established. We sequenced and analyzed the ribosomal DNA internal transcribed spacer (ITS) sequences of 62 banana germplasm and found that the sequencing peaks, especially the 20 bp region near the 420 bp position (referred to as the “420 bp region”), exhibited relatively recognizable and repeatable polymorphism characteristics. Using the “420 bp region” as a marker, we were able to quickly distinguish bananas belonging to different genome type groups (comprising the AA, AB, AAA, ABB, AAB, ABBB, AAAB, and AAAA groups) or different subgroups in the same genome type group (for example, the Cavendish, Gros Michel, Red, Lakatan, and Ibota Bota subgroups in the AAA group; and the Pisang Raja, Plantain, Pome and Silk subgroups in the AAB group). Moreover, it appeared that Sanger sequencing of ITS could be used for identifying banana hybrid offspring. These results demonstrated that the banana ITS region contains rich genetic information that is useful for genotyping. In general, ITS sequencing simplifies the classification of banana germplasm resources and has potential application in several areas of Musa improvement.

Under the dual background of underemployment and health inequality, this paper empirically analyzes the impact of education level on underemployed workers’ health based on CLDS2016 data. The results show that underemployment is significantly related to the decline of self-rated health, increased depression tendency, and morbidity in a certain period. The results indicate that underemployment can significantly reduce the health level of workers in the low education level group and the high education level group. However, it has no significant impact on workers’ health in the middle education level group; even if we change the measurement method of indicators and consider endogeneity, the research conclusion is still robust. Moreover, this kind of health inequality mainly comes from the difference in economic effect and leisure effect of underemployment to workers with different educational levels. This paper provides empirical support for increasing the labor protection mechanism of underemployed people and reducing the health inequality caused by educational level differences.

Leucokinins (LKs) constitute a neuropeptide family first discovered in a cockroach and later identified in numerous insects and several other invertebrates. The LK receptors are only distantly related to other known receptors. Among insects, there are many examples of species where genes encoding LKs and their receptors are absent. Furthermore, genomics has revealed that LK signaling is lacking in several of the invertebrate phyla and in vertebrates. In insects, the number and complexity of LK expressing neurons vary, from the simple pattern in the larva of Drosophila where the entire CNS has 20 neurons of three main types, to cockroaches with about 250 of many different types. Common to all studied insects is the presence or 1-3 pairs of LK-expressing neurosecretory cells in each abdominal neuromere of the ventral nerve cord, that, at least in some insects, regulate secretion in Malpighian tubules. This review summarizes the diverse functional roles of LK signaling in insects, as well as other arthropods and mollusks. These functions include regulation of ion and water homeostasis, feeding, sleep-metabolism interactions, state-dependent memory formation, as well as modulation of gustatory sensitivity and nociception. Other functions are implied by the neuronal distribution of LK, but remain to be investigated.

Cancer/testis (CT) antigens exhibit selective expression predominantly in immunoprivileged tissues in non-pathological contexts but are aberrantly expressed in diverse cancers. Because of their expression pattern, they have historically been attractive targets for immunotherapies. The investigation of mechanistic roles of CT antigens in promoting oncogenesis has historically been a prominent research question, and a growing number of studies implicate CT antigens in promoting almost all the hallmarks of cancer. This suggests that CT antigens may act as cancer drivers. CT antigens are expressed in head and neck squamous cell carcinomas, although their role in the pathogenesis, prognostication, and treatment for this family of cancers remains poorly studied. Given that CT antigens hold intriguing potential as therapeutic targets and as biomarkers for prognosis and therapeutic response and that they can provide novel insights into oncogenic mechanisms, their further study in the context of head and squamous cell carcinoma is warranted.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a positive sense single stranded RNA genome containing virus which has infected millions of people all over the world particularly China. The virus has been mutating rapidly enough resulting in the emergence of new variants and sub-variants which have reportedly been spread from Wuhan city of China, the epicenter of the virus, to the rest of China and all over the world. The occurrence of mutations in the viral genome especially in the viral spike protein region has resulted in the evolution of multiple variants and sub-variants which gives the virus benefit of host immune evasion and render the modern-day vaccines and therapeutics ineffective. Therefore, there is a continuous need to study the genetic characteristics and evolutionary dynamics of the SARS-CoV-2 variants. Hence, in this study, a total of 833 complete genomes of SARS-CoV-2 variants (including the wild-type or reference sequence) from Taiyuan and Wuhan cities of China were genetically characterized and studies their phylogenetic and evolutionary dynamics using phylogenetics, genetic similarity, and phylogenetic network analysis. Our results show a lot of useful information regarding the evolutionary dynamics of the viral variants, their genetic similarities/dissimilarities, and their phylogenetic relationships. It has been reported in this study that the SARS-CoV-2 variants have nine recombinant events which suggest very important information regarding the viral evolution. In addition, the phylogenetic network analysis shows the number of mutations resulting in emergence and clustering of the viral variants of both cities which reveal significant information regarding the phylodynamics of the virus. This study, to the best of our knowledge, is the first ever genetic comparative study of Taiyuan and Wuhan cities. This study will help better understand the virus, cope with the emergence, and spread of new variants at local level as well as at international level and inform the public health authorities to make better informed decisions in designing new viral vaccines and therapeutics.

Ecological stoichiometry is an important index to reflect ecological interaction and the balance of various elements in ecological processes. At present, the stoichiometric spatial distribution of soil carbon (C), nitrogen (N), phosphorus (P) and potassium (K) in farmland and grassland of Inner Mongolia and its influencing factors are still unclear. In this study, the spatial distribution of soil nutrient content and stoichiometry and the effects of environmental factors on soil C:N:P:K stoichiometry were analyzed under different land use patterns in four agro-pastoral areas. The results showed that there was a geographical gradient in the ecological stoichiometric relationship between farmland and grassland. RCN, RCP, RCK, RNP and RNK showed an "N" distribution from west to east, while RPK showed a "V" distribution. The difference in spatial distribution was more significant than the difference in land use pattern. The ecological stoichiometric relationship of grassland was mainly affected by the content of C and N, and was related to the similarity of soil properties. The field ecological stoichiometry was mainly affected by the content of nitrogen and phosphorus, and had a great relationship with fertilization. The effects of MAT and MAP on soil ecological stoichiometry were related to the inter-regional environmental heterogeneity. The influence of MAP on farmland and MAT on grassland was more significant. It was of great significance for field management according to local conditions, rational utilization of land resources and sustainable development of agriculture to clarify the ecological stoichiometric characteristics of farmland and grassland in agro-pastoral ecotone.

In recent years, video anomaly detection technology , which can intelligently analyze massive video and quickly find abnormal phenomena, has attracted extensive attention with the wide application of video surveillance technology . To address the complex and diverse problem of abnormal human behavior detection in surveillance videos, a surveillance video abnormal behavior detection and localization supervised method based on the deep network model and the traditional method is proposed. Specifically, we combined AGMM and YOLACT methods to obtain more accurate foreground information by fusing the foreground maps extracted by each technique. To further improve the accuracy , we use the PWC-Net technique to extract features of the foreground images and input them into an anomaly classification model for classification. The proposed method effectively detects and locates the abnormal behavior in the monitoring scene. In addition to the aforementioned methods, this paper also employs YOLOV5 and DeepSORT networks for object detection and tracking in the video, which allows us to track the detected objects for better understanding of the scene in the video. Experiments on the UCSD benchmark dataset and the comparison with state-of-the-art schemes prove the advantages of our method.

The cuttlebone-like structure is a complex porous bionic structure with asymmetric sinusoidal S-shaped wall structure connecting laminar septa, and studies have shown that the cuttlebone-like structure has light weight, high strength and excellent energy absorption capability. It has become an important research to investigate the mechanical mechanism of cuttlebone-like structure and to design a bionic structure beyond nature structure based on it. In order to investigate the mechanical properties of the static compression and shearing processes of the cuttlebone-like structure, this paper establishes theoretical formulas and analyzes the influence of dimensionless parameters such as height-to-thickness ratio $\lambda$, period-to-thickness ratio $\xi$ and amplitude to period ratio $\eta$ on the compression and shearing processes with the help of ABAQUS finite element software.The parameter sensitivity analysis method was used to compare the important influence degree of each dimensionless parameter on the mechanical properties of the structure and to determine the relative optimal parameters of the structural mechanical properties under compression and shearing. Based on the relatively optimal parameter of the cuttlebone-like structure, the cross-sectional geometry of the structure is improved to build a new cuttlebone-like structure.The experimental results showed that the new cuttlebone-like structure with revised cross-section improved the mechanical properties of the cuttlebone-like structure.The study results are of theoretical guidance to enhance the mechanical properties and geometric design of cuttlebone-like structures.

As the adoption of renewable energy sources grows, ensuring a stable power balance across various time frames has become a central challenge for modern power systems. In line with the "dual carbon" objectives and the seamless integration of renewable energy sources, harnessing the advantages of various energy storage resources and coordinating the operation of long-term and short-term storage have become pivotal directions for future energy storage deployment. To address the complexities arising from the coupling of different time scales in optimizing energy storage capacity, this paper proposes a method for energy storage planning that accounts for power imbalance risks across multiple time scales. Initially, the Seasonal and Trend decomposition using the Loess (STL) decomposition method is utilized to temporally decouple actual operational data. Subsequently, power balance computations are performed based on the obtained data at various time scales to optimize the allocation of different types of energy storage capacities and assess the associated imbalance risks. Finally, the effectiveness of the proposed approach is validated through hourly applications using real-world data from a province in China over recent years.

The vegetation types on the Qinghai-Tibet Plateau are complex and diverse, and the ecological environment is fragile and sensitive. It is very important to study the dynamic changes in vegetation and the main factors related to these changes to grasp the present state of the regional ecosystem, maintain the balance of the ecosystem and promote the sustainable development of the ecosystem. Therefore, this paper is based on SPOT/VEG NDVI (normalized difference vegetation index) data, land use data, topographic data and meteorological data from 1999 to 2019. The spatiotemporal variation in the NDVI over the Tibetan Plateau in the last 21 years and its response to different driving factors were investigated by using the Sen slope method, Mann–Kendall mutation test, partial correlation analysis and geographical detector method. The results showed that (1) the vegetation coverage on the Qinghai-Tibet Plateau showed an increasing trend from 1999 to 2019, with increases in approximately 67.00% of the plateau area. (2) The spatial differences in vegetation coverage were large; notably, low-density vegetation areas decreased obviously, moderate-density vegetation areas accounted for approximately 50% of the total area, high-density vegetation areas were the least common, and the overall growth rate was significant. (3) The NDVI was positively correlated with temperature and precipitation, and a positive correlation was observed in more than 66% of the region. (4) The order of the influence of single driving factors on the NDVI was as follows: precipitation > soil type > altitude > temperature > gradient > slope > population density > GDP. (5) The effect of multiple factors was significantly higher than that of single driving factors, with a notable nonlinear influence. The interactions between meteorological factors, such as precipitation, and topographic factors, such as altitude, were important, with a q value over 0.79.

This study aimed at exploring what role artificial intelligence techniques could play in the futural numerical analysis. In this paper, a convolutional neural network techniques based on modified loss function is proposed as a surrogate of finite element method(FEM). Several surrogate-based physics-informed neural networks(PINNs) are developed to solve representative boundary value problems based on elliptic partial differential equations (PDEs). Results from the proposed surrogate-based approach are in good agreement with ones from conventional FEM. It is found that modification of the loss function could improve the prediction accuracy of the neural network. It is indicated that to some extent the artificial intelligence technique could replace conventional numerical analysis as a great surrogate model.

Nowadays the relationship between planning land use and actual land use is not so clear in general. A lot of efforts have been put in the failures of regulation for the expansion of construction land. However, it still lacks an integrated approach to study the effectiveness of land use regulation in terms of different land use types. Furthermore, the existing evaluation of land use plan mainly focuses on a general level, a detailed research on the regulation effectiveness of each construction land use type is absent. Therefore, this research tries to evaluate regulation effectiveness of land use plan, which takes Cangwu country, Guangxi Province as an example. The finding by analysis is that the total area of construction land expansion was about 3494.73 ha, nearly 1.1 times of the plan quota. Moreover, the effectiveness differs greatly in various construction land use types. Town, industrial/mining sites can be well regulated through the quota of land use plan. While, the quota regulation system is not as effective for other type of construction land. Thus, we suggest to improve the regulation effectiveness of construction land through different plan instruments.

GaN ultraviolet photodetector with metal-semiconductor-metal structure is achieved by growing on a periodic trapezoid column-shape patterned sapphire substrate using metalorganic chemical vapor deposition. Under 5-V reverse bias, the photodetector fabricated on such patterned sapphire substrate exhibits a lower dark current, a higher photocurrent, and a 476 % enhancement in the maximum responsivity as compare with those of the photodetector fabricated on conventional flat sapphire substrate. It is also found that the much larger UV-to-visible rejection ratio and the fact that responsivity drops in a smaller cut-off region are observed from photodetector fabricated by using a periodic trapezoid column-shape patterned sapphire substrate. These phenomena may all be attributed to the reduction of threading dislocation density and the improved quality of GaN film, as well as the internal reflection and/or scattering effect on the interface between GaN film and the periodic trapezoid column-shape pattern of the substrate.

In this study, we present a federated learning approach that combines a multi-branch network and the Oort client selection algorithm to improve the performance of federated learning systems. This method successfully addresses the significant issue of non-iid data, a challenge not adequately tackled by the commonly used MFedAvg method. Additionally, one of the key innovations of this research is the introduction of uniformity, a metric that quantifies the disparity in training time amongst participants in a federated learning setup. This novel concept not only aids in identifying stragglers but also provides valuable insights into assessing the fairness and efficiency of the system. Experimental results underscore the merits of the integrated multi-branch network with the Oort client selection algorithm and highlight the crucial role of uniformity in designing and evaluating federated learning systems.

We conducted many model simulations to understand the causes of the damages of coronavirus (COVID-19) to lung tissue and constructed a diagram showing apparent viral reproduction, immune response and damage accumulation curves. We found that lung damages include virus-caused damage, tissue damage caused by immune responses and tissue damage caused by accumulated wastes. The virus-caused damage is proportional to the phase lag between the viral reproduction curve and the delayed adaptive immune response curve, while waste-induced damage is attributed to imbalance in removing viral, cellular and metabolic by-products. We found that treatment strategies should slow down viral reproduction and speed up immune response, and improve blood micro-circulation in the lungs. Consistent with the strategies, measures are taken to void direct lung infection, strengthen innate responses, promote immune responses, dilute viral concentration in lung tissue, maintain waste removal balance, protect heart and kidneys, control other infections, avoid allergic reactions and other inflammation, etc. We show that medical, dietary, emotional, lifestyle, environmental, mechanical factors, etc. may be simultaneously used to mitigate lung damages and prove that multiple factor health optimization method is magnitudes more powerful than a single factor treatment. Such a method does not depend on molecular specificity and can be used in parallel to antiviral drugs.

To understand great disparities in disease outcomes between CIVID-19 patients, we explore infection and host responses in kinetics. From existing data, we deduced a model that the lungs are damaged by rapidly rising flow resistance as a result of retaining white blood cells in lung tissues. The retention of white blood cells is initially triggered by viral infection but aggravated by injuries caused by low temperature. Lungs are initially damaged by fluid leakage, rapidly followed by extruding blood into alveolar spaces. The step of blood extruding is predicted to take place in a very short time. Our simulations show that as little as 0.1% retention of white blood cells in the lungs can lead to their failure in 5 to 10 days. The small degrees of imbalance implies that this imbalance could be corrected by a large number of factors that are known to reduce flow resistance. The model implies that the top priority is maintaining blood micro-circulation and preserving organ functions in the entire disease course, especially after the virus has spread the whole lungs. From exploring a large number of hypothetical infection modes, we propose preventive, mitigating and treatment strategies for ultimately ending the pandemic. The first strategy is avoiding exposures that could result in widespread damages to lungs and taking post exposure mitigating measures that would reduce disease severity. The second strategy is reducing death rate and disability rate from the current levels to one tenth for infected patients by using multiple factors health optimization method. The double reduction strategies are expected to generate a series of chain reactions that favor mitigating or ending the pandemic. Some reactions include a big reduction of the amount of viral discharges from infected patients into the air, the avoidance of panic, chronic stress and emotional distress, and cross-infections which are expected in quarantines. The double reductions would have a final effect of ending the pandemic.

This paper examines certain implications from the literature on Tiebout’s model of local gov-ernment service provision, particularly Hamilton’s extension of the model to include local control of land use and property taxation. Our empirical analysis focuses on the use of fiscal zoning to lower property tax rates, a topic that has not been addressed in the extensive Tiebout literature. Using data for over 100 municipalities in the Miami, Florida, metropolitan area, we specify property tax rates as a function of fiscal zoning measures, other municipal characteristics, and tax mimicking. We conclude that single-family zoning is by far the most important variable ex-plaining municipal property tax rates.

Modern medicine adopted four presumptions when it evolved from ancient experienced-based mind-body medicine. To understand its failure in finding cures for chronic diseases, we examined four presumptions, and found that statistical population of health properties does not exist for most research purposes, mathematical models are misused to model intensive properties, synthetic drugs are inherently more dangerous than nature-made medicines under their respective application conditions, and reductionist treatments are inferior and inherently dangerous. We found that clinical trials are valid only for research where treatment effect is much stronger than the total effects of all interfering or co-causal factors or errors introduced by misused mathematical models can be tolerated. In all other situations, clinical trials introduce excessive errors and fail to detect treatment effects, or produce biased, incorrect or wrong results. We further found that chronic diseases are manifestation of small departures in multiple process attributes in distinctive personal biological pathways networks, that modern medicine lacks required accuracy for accurately characterizing chronic diseases, and that reductionist treatments are good at controlling symptoms and safe for short term uses. For all stated reasons, as long as modern medicine continues relying on the flawed presumptions, it can never find predictable cures for chronic diseases. By implication, predictable cures to chronic diseases are adjustments to lifestyle, dietary, emotional, and environmental factors to slowly correct departures in process attributes responsible for chronic diseases.