This study presents an innovative analytical method for the detection and quantification of 14 β-agonists in pork using liquid chromatography-tandem mass spectrometry (LC-MS/MS). The method involves the use of a solid phase microextraction (SPME) probe, consisting of a wooden tip coated with polyacrylonitrile (PAN) and molecularly imprinted polymer (MIP). This probe has been integrated into an automated extraction device, designed in our laboratory to extract the target analytes prior to LC-MS/MS analysis. Compared to the traditional solid-phase extraction (SPE) procedure, the proposed approach significantly reduces the costs related to adsorbent ma-terial and solvent consumption, and shortens purification time, thereby reducing both the tech-nical workload and associated expenses. The methodology has been carefully validated in ac-cordance with the National Standard of the People's Republic of China (GB/T 22286-2008), evalu-ating key parameters including the limit of detection (LOD), limit of quantification (LOQ), matrix effects, linearity, and both intra-day and inter-day precision. The average recovery rates for all β-agonists were observed to lie between 71.6% and 82.2%, with relative standard deviations (RSDs) consistently below 15% for both types of precision. The LOD and LOQ values were found to range from 0.09 to 0.39 μg/kg and 0.27 to 0.99 μg/kg, respectively. In terms of accurate detection of positive samples, the developed method demonstrated a closer approximation to the true value of the sample compared to the National Standard method GB/T 31658.22-2022. Overall, the proposed method exhibits substantial promise for the routine assessment of β-agonists in pork and presents a practical alternative for compliance monitoring in regulatory settings.

Green and low-carbon development has become an important embodiment of China's path to becoming a strong agricultural country. How to enable agricultural enterprises to better adopt green technologies and conduct production and operation with the concept of sustainable development has become a key link. This article utilizes a structural equation model (SEM) to analyze the role paths and mediating effects of organizational learning ability and policy orientation in agricultural enterprises' market orientation and willingness to adopt green technologies[ The definition of green technology in this paper refers to Guo Kesha, Tian Xiaoxiao. Green technology and green transformation of industrial development mode [J]. Tianjin Social Sciences, 2024 (02) :99-107, including green manufacturing (production) technology and green service technology.]. The results show that market orientation, organizational learning ability, and policy effectiveness have significant direct positive impacts on the willingness to adopt; market orientation has a significant positive impact on agricultural enterprises' organizational learning ability, organizational learning ability has a significant positive impact on policy orientation, and market orientation has a significant positive impact on policy effectiveness; the results of mediation analysis also indicate that learning ability has a significant mediating effect between market orientation and willingness to adopt, and policy effectiveness has a significant mediating effect between market orientation and willingness to adopt. Through difference analysis, it is believed that the mediating effects of the three paths are equally important, and organizational learning ability and policy effectiveness play a partial mediating role in agricultural enterprises' willingness to adopt green technologies. Based on this, policy suggestions are proposed to improve enterprises' own organizational learning ability, increase the promotion of policies related to green technologies, improve relevant policies for the application of green technologies, and increase research and development efforts for green technologies.

In past years, lithium-ion batteries (LIBs) can be found in every aspect of life, and batteries, as energy storage systems (ESSs), need to offer electric vehicles (EVs) more competition to be accepted in markets for automobiles. Thick electrode design could reduce the use of non-active materials in batteries that its energy density would be improved and its cost would be cut. However, thick electrodes are limited by their weak mechanical stability and poor electrochemical performance, these limitations could be classified as the critical cracking thickness (CCT) and the limited penetration depth (LPD). The understanding of the CCT and the LPD have been proposed and the recent works on breaking the CCT and improving the LPD are listed in this article. By comprising these attempts, some thick electrodes could not offer higher mass loading or higher accessible areal capacity that would defeat the purpose.

There have been relatively few researches that determine the role of bricolage in mediating the empirical relationship between strategic flexibility and product innovation. However, most of the research has studied strategic flexibility to engage the absorptive capacity and facilitate product innovation. The Bricolage approach emphasizes utilizing existing resources in product innovation and explores the mechanisms behind bricolage. A resource-based approach to product innovation involves combining resources in the development process in a concrete manner. This is a groundbreaking study since it is the first to examine empirically how absorptive capacity affects product innovation through bricolage and the serial mediation of strategic flexibility. As a consequence of presenting our results, we concluded that absorptive capacity positively and significantly influences product innovation through the serial mediation of strategic flexibility and bricolage. For strategic flexibility to play a role in supporting product innovation, bricolage is one of the mechanisms that can be utilized. This study contributes to the literature on strategic flexibility by examining the effect of strategic flexibility on bricolage and product innovation from the standpoint that absorptive capacity enhances the strategic flexibility of high-tech SMEs in China. Furthermore, this research offers new insights into the relationship between absorptive capacity and product innovation. In addition, it also provides insight into the economic opportunities that may result from product innovation in transition economies such as China.

Aquaculture by-products can be compromised an important liming material of increasing soil pH and soil fertility. The aim of this research was to assess the effect of mussel shells on soil pH, on organic matter and on soil nutrients. In this study a pot experiment was carried out at the De-partment of Ichthyology and Aquatic Environment (University of Thessaly, Greece). A acidic soil (pH 4.26) amended with 6 different proportions of mussel shell (0.0, 0.1, 0.3, 0.5, 1, 3 and 6%) in two different grain sizes (Fine powder (>1 mm) and Coarse powder (1-2 mm)), resulting in 13 treatments. According to the results, it was observed that pH, organic matter, Available P and Exchangeable K increased. Specifically, the highest pH values observed at 6% rate. Available P and Exchangeable K achieved the highest content at 6% Fine powder treatment, 46.2 and 190.1 mg kg-1, respectively. Similarly, organic matter had the highest value in 6% Fine powder pots (2.27%). Moreover, Total N concentration varied from 0.11 to 0.14 but no statistically significant different was noticed between the treatments. In conclusion, mussel shells can compose a promising liming material in the agriculture section.

Few studies have examined the role of mediating mechanisms played by bricolage in the relationship between strategic flexibility and new product development, even though most of the studies view strategic flexibility as a capability to cope with environmental turbulence and promote product innovation. The bricolage approach embraces the resource-based understanding of the product development process as a concrete process of recombining resources in the process and exploring the mechanisms behind the bricolage approach. This study is the first of the kind that has examined the empirical effect of environmental turbulence on new product development through serial mediation of strategic flexibility and bricolage. Based on our results, environmental turbulence positively and significantly affects new product development through the serial mediation of strategic flexibility and bricolage. Bricolage is one of the mechanisms by which strategic flexibility may play a part in supporting product innovation. Our contribution to strategic flexibility research comes from examining the effect of strategic flexibility on bricolage and new product development from the point that environmental turbulence compels the high-tech industries to remain strategically flexible for their sustainability and growth. Besides providing new evidence on the relationship between environmental turbulence and product innovation, this research also provides new insight into the economic opportunity of new product development in transition economies such as China.

Plant Factory Transplanter (PFT) is a key component of the plant factory system. Its operation status directly affects the quality and survival rate of planted seedlings, which in turn affects the overall yield and economic efficiency. To monitor the operation status and transplanting quality of a transplanting machine in a timely manner, the primary task is to use a computerized and easy-to-use method to monitor the transplanting units. Inspired by the latest developments in augmented reality and robotics, a DT model-based and data-driven online monitoring method for plant factory transplanting equipment is proposed. First, a data-driven and virtual model approach is combined to construct a multi-domain digital twin of the transplanting equipment. Then, taking the vibration frequency domain signal above the transplanting manipulator and the image features of the transplanting seedling tray as input variables, the evaluation method and configuration method of the PFT digital twin system are proposed. Finally, the effect of the transplanter is evaluated, and the cycle can be repeated to optimize the transplanter to achieve optimal operation parameters. The results show that the digital twin model can effectively use the sensor data to identify the mechanical vibration characteristics and avoid affecting transplanting quality due to mechanical resonance. At a transplanting rate of 3000 plants/h, the transplanting efficiency can be maintained at a high level and the vibration signal of X, Y, Z-axis above the transplanting manipulator is relatively calm. In this case, Combined the optimal threshold method with the traditional Wiener algorithm, the identification rate of healthy potted seedlings can reach 94.3%. Through comprehensively using the optimal threshold method and 3D block matching filtering algorithm for image threshold segmentation and denoising, the recognition rate of healthy seedlings has reached over 96.10%. In addition, the developed digital twin can predict the operational efficiency and optimal timing of the detected transplanter, even if the environmental and sensor data are not included in the training. The proposed digital twin model can be used for damage detection and operational effectiveness assessment of other plant factory equipment structures.

Aedes aegypti (L.) is the primary vector of chikungunya, dengue, yellow fever and Zika viruses. The leucine-rich repeats (LRR)-containing domain is evolutionarily conserved in many proteins associated with innate immunity in invertebrates and vertebrates, as well as plants. We focused on the AaeLRIM1 and AaeAPL1 gene expressions in response to Zika virus (ZIKV) and Chikungunya virus (CHIKV) infection using a time course study, as well as the developmental expressions in the eggs, larvae, pupae, and adults. RNA-seq analysis data provided 60 leucine-rich repeat related transcriptions in Ae. aegypti in response to Zika virus (Accession number: GSE118858, https://www.ncbi.nlm.nih.gov/gds/?term=GSE118858). RNA-seq analysis data showed that AaeLRIM1 (AAEL012086-RA) and AaeAPL1 (AAEL009520-RA) were significantly upregulated 2.5 and 3-fold during infection by ZIKV 7-days post infection (dpi) of an Ae. aegypti Key West strain compared to an Orlando strain. The qPCR data showed that LRR-containing proteins AaeLRIM1, AaeAPL1 and five paralogues were expressed 100-fold lower than other nuclear genes, such as defensin, during all developmental stages examined. Together, these data provide insights into transcription profiles of LRR proteins of Ae. aegypti during its development and in response to infection with emergent arboviruses.

As the increase threat of flood risk and environmental safety due to the urbanization, Sponge city research has been attracting extensive attention both in practical and theoretical research field. To date, there are only scattered studies about Sponge city. Moreover, vary names of Sponge city prevalent in different countries, which leads to disconnection of literature in the same field of Sponge city. In this paper, a thorough systematic literature mining of Sponge city is presented. A literature analysis system is created, which includes literature export from Web of Sciences and systematic analysis via NoteExpress and CiteSpace. Some literature statistical results are derived. Challenges and opportunities for future research are anticipated. Our goals are to promote this promising thought, summarize past research, and identify issues for future research to create impacts on the practice of Sponge city.

In the Northeast of Portugal, like in many parts of the world, most soils are acidic, which may hamper crop productivity. This study presents the findings of a factorial experiment involving three factors: i) soil type [schist (Sch) and granite (Gra)]; ii) cultivars [Cobrançosa (Cob) and Arbequina (Arb)]; and iii) fertilizer treatments [liming (CaCO3) plus Mg (LMg), P application (+P), B application (+B), all fertilizing materials combined (Con+), and an untreated control (Con-)]. Dry matter yield (DMY) did not show significant differences between cultivars, but plants grown in schist soil exhibited significantly higher biomass compared to those in granite soil. Among the treatments, +B and Con+ resulted in the highest DMY (50.8 and 47.2 g pot-1, respectively), followed by +P (34.3 g pot-1) and Con- (28.6 g pot-1). Treatment LMg yielded significantly lower values (15.6 g pot-1) than Con-. LMg raised the pH above 7 (7.36), leading to a severe B deficiency. Although Con+ also raised the pH above 7 (7.48), it ranked among the most productive treatments for providing B. Therefore, when applying lime to B-poor sandy soils, moderate rates are advised to avoid inducing a B deficiency. Additionally, it seems prudent to apply B after lime application.

Immersion in salt-lake solution was adopted to periodically test the concrete chloride-ion diffusion coefficient. The regression analysis was also completed. Also investigated was the time-dependent law of concrete chloride-ion diffusion coefficient with time. The influence of chloride-ion concentration in solution, water-to-cement ratio, and corrosion time on the largeness and accumulation rate of the concrete chloride-ion diffusion coefficient was also analyzed. Test results show that the concrete chloride-ion diffusion coefficient gradually decreased with increasing time and increased with increasing chloride-ion concentration in a salt lake . Taking into account the influence of factors such as water–binder ratio, chloride-ion concentration, and time-varying characteristics, a multi-factor calculation model for the concrete chloride-ion diffusion coefficient was established. Combining the prediction results and the measured data reported in this paper, the effectiveness and applicability of the established concrete chloride-ion diffusion coefficient calculation model were compared and verified, and the durability design and service life of a concrete structure under cool chlorine were compared. The results of analysis provide important boundary conditions.

To effectively estimate airport terminal area capacity and assess the maximum throughput the sector can achieve when the capacity is given, this research proposes an approach to assess the terminal area capacity from the viewpoint of service provision resources. Terminal area capacity is optimized based on the equilibrium of air traffic service resource supply and demand. The supply-demand nexus is examined in consideration of terminal area route structure, traffic flow characteristics, and safety regulations. A flight service probability matrix and a terminal area demand and supply service time model are constructed to quantify resource expenditure at varied capacity levels. A optimization model is then developed to apportion maximal capacity under resource limitations. Model computation and computation results demonstrate the deviation between estimated and amended capacities is under 0.3 flight sorties per hour. The outcomes are congruent with historical statistics, thereby validating the accuracy and reliability of the model proposed in this study. Given capacity parameters, the model can deduce the maximal aircraft quantity served concurrently in terminal areas during peak periods. These revelations indicate the submitted model furnishes theoretical foundation and reference for terminal area sector partition and traffic alerting.

The hospital indoor environment plays a significant role in shaping the microbial exposures that humans encounter. Resistance to antibiotics is one of the mechanisms employed by bacteria to develop resilience against stress in indoor environments. The extensive usage of antibiotics has been a key factor in driving changes in the ecological function of antibiotic resistance genes (ARGs) and their acquisition by pathogenic bacteria. By integrating the 16S rRNA Illumina sequencing and high throughput-qPCR approaches with water and air dust samples across seven departments at Peking University Shenzhen Hospital, China, this study yielded intriguing findings regarding the department-specific variation, transmission, and correlation of bacteria, ARGs and MGEs within the hospital indoor environment. One notable observation was that the seasonal variation played a vital role in shaping the bacterial composition in the overall hospital indoor environment across seven studied departments. Nevertheless, a similar significant seasonal impact was only observed in the blood test room and emergency departments, rather than in the other five departments. Another intriguing finding was the correlation between ARGs and MGEs abundance. This correlation was evident in the overall hospital indoor environment, which was conversely not found in the emergency, pneumology and gynecology departments. Additionally, while there was no significant relationship that occurred between bacterial communities and ARGs/MGEs within the hospital, the gynecology department demonstrated a close link between bacterial communities and the presence of ARGs/MGEs. Notably, the gynecology department also stood out as an important source of bacteria and ARGs/MGEs for other departments. This study underscores the need for careful surveillance and monitoring of antibiotic resistance, particularly in Legionella spp. in man-made water systems. The findings also show the importance of monitoring and understanding the genetic elements such as Tp614 involved in gene transfer and recombination, as well as their impact on antimicrobial treatment efficacy.

Background: Colorectal cancer (CRC) is one of the major causes of cancer-related death worldwide. Aerobic glycolysis precedes obtainment of oncogenic mutations and loss of tumor suppressors, promoting the progress of CRC. Although numerous biomarkers have been identified to be associated with prognosis and survival, a glycolysis-related gene signature in CRC has not been explored. Methods: mRNA expression profiling data in a group of CRC patients (n = 540) was extracted from the Cancer Genome Atlas (TCGA). Gene set enrichment analysis (GESA) was performed to identify gene sets that were significantly different between CRC tissues and normal tissues. Cox proportional hazards regression models were used to identify genes significantly associated with overall survival. Multivariate Cox regression analysis was used to establish a prognostic risk parameter formula. Kaplan–Meier survival estimates and the log-rank test were used to validate the significance of risk parameters for prognosis prediction. Results: Five glycolysis-related genes (ENO3, GPC1, P4HA1, IDUA, ANKZF1) were identified to be significantly associated with overall survival (AUC=0.754). Based on the five‑gene signature, patients with CRC were divided into high and low‑risk subgroups. CRC patients with a low-risk score had better survival benefits than those with a high one (P < 0.001). Conclusions: A five-gene signature associated with glycolysis for predicting the outcome of CRC patients was generated, serving as a valuable prognosis model with high efficiency and potential targeted therapy of CRC patients.

Bridge load testing is crucial in evaluating bridge load-carrying capacity and construction quality. However, conventional techniques have many limitations such as the need for direct contact and low acquisition frequency. This study provides a comprehensive examination of the static and dynamic load tests of a multi-span cable-stayed bridge utilizing a ground-based radar inter-ferometer (GB-radar). The case study was conducted at the Fifth Nanjing Yangtze River Bridge (FNYRB), which is recognized as the world's first lightweight steel-concrete composite cable-stayed bridge, with two spans measuring 600 m. To enhance measurement accuracy, a method was proposed to detect and recover radar phase jumps caused by vehicle motion. Furthermore, precise geometry projection was employed to acquire vertical displacements from GB-radar which were taken along the line-of-sight (LOS) direction. Moreover, during the static load test, a continuous deformation was observed with a maximum pace of 0.31 mm/min, indicating a post-construction settlement caused by soft soil consolidation. This case study highlights the high sampling frequency, high measurement accuracy, and exceptional weatherproof ability of GB-radar, thereby demonstrating its potential to be an alternative to the structural health monitoring (SHM) system.

The genus Flavivirus includes 53 members and poses a big threat to human health among worldwide. Diseases caused by flavivirus infections can be broadly classified into hemorrhagic diseases (Dengue, Yellow fever, etc) and neurological diseases (West Nile disease, Zika disease, etc). Many flaviviruses still lack specific treatments and effective vaccines. In this context, it becomes particularly important to thoroughly characterize the pathogenesis of flavivirus infection and develop animal models. Therefore, animal models that can accurately simulate human diseases are essential for evaluating the effectiveness of therapeutic drugs and preventive vaccines. In this paper, we provide a comprehensive review of the currently available animal models that support flavivirus infection and exhibit clinical manifestations related to flavivirus infection. Additionally, we discuss the strengths and limitations of each animal model, aiming to enhance researchers understanding of the use of animal models in flavivirus research. This insight is intended to facilitate further studies into the pathogenesis of flavivirus, as well as the development of antiviral agents and vaccines.

The accumulation of foam cells in arterial intima and the accompanied chronic inflammation are considered major causes of neoatherosclerosis and restenosis. However, both the underlying mechanism and effective treatment for the disease are yet to be uncovered. In this study, we combined transcriptome profiling of restenosis artery tissue and bioinformatic analysis to reveal that NLRP3 inflammasome is markedly upregulated in restenosis and that several restenosis re-lated DEGs are also targets of mulberry extract, a natural dietary supplement used in traditional Chinese medicine to improve liver vitality. Further pathway enrichment analysis identified MAPK signaling pathway to be involved in the inflammatory response of foam cells. Consistently, immunofluorescence microscopy shows co-localization of NLRP3 with CD68+ macrophages. We then evaluated the efficacy of mulberry extract in inhibiting both the formation of foam cells and their inflammatory response. We demonstrated that mulberry extract suppresses the formation of ox-LDL induced foam cells, possibly by upregulating the cholesterol efflux genes ABCA1 and ABCG1 to inhibit intracellular lipid accumulation. In addition, mulberry extract dampens NLRP3 inflammasome activation by stressing the MAPK signaling pathway. Collectively, our mecha-nistic and functional studies unveil the therapeutic value of mulberry extract in neoatherosclerosis and restenosis treatment by regulating lipid metabolism and inflammatory response of foam cells.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Eddy current sensors can be used to test the characteristics and measure the parameters of the conductive samples. As the main obstacle of the multi-frequency eddy current sensor, the lift-off distance affects the effectiveness and accuracy of the measurement. In this paper, a material-independent algorithm has been proposed for the restoration of the lift-off distance when using the multi-frequency eddy current sensor, which is based on the approximation under the thin-skin effect. Experiment testing on the performance of the proposed method is presented. Results show that from the dual-frequency inductance, the lift-off distance could be restored with a maximum error of 0.24 mm for the distance up to 12 mm. Besides, the derived lift-off distance is used for the inversion of the magnetic permeability. Based on a lift-off insensitive inductance (LII) feature, the magnetic permeability of steels can be inversed in an iterative manner, with an error of less than 0.6 % for the lift-off distance up to 12 mm.

Lift-offs of the sensor could significantly affect the measurement signal and reconstruction of material properties when using the electromagnetic (inductive) eddy current sensor. Previously, various methods (including novel sensor designs, and features like zero-crossing frequency, lift-off point of intercept) have been used for eliminating the measurement error caused by the lift-off distance effect of the sensor. However, these approaches can only be applied for a small range of lift-off variations. In this paper, a linear relationship has been found between the sensor lift-off and ratio of dual-frequency eddy current signals, particularly under the high working dual frequencies. Based on this linear relationship, the lift-off variation can be reconstructed firstly with a small error of 2.5 % when its actual value is up to 10 mm (10.1 % for 20 mm). The reconstructed lift-off is used to further get the property of the material under a low single frequency. Experiments on different ferrous metals have been carried out for the testing of the reconstruction scheme. Since the inductance is more sensitive to the material property (and less sensitive to the lift-off) under low frequencies, the reconstruction error of the material property is much smaller than that of the lift-off, with 1.4 % under 12 mm (and 4.5 % under 20 mm).

Metamorphosis is a critical process for most anurans to transition from water to land. The appearance of air-breathing lungs occurs during the change in oxygen medium from water to air. Revealing the structural construction and molecular switches of lung organogenesis is essential to understand the realization of air-breathing function. In this study, histology and transcriptomics were combinedly conducted to explore these issues in Microhyla fissipes lungs during metamorphosis. During the pro-metamorphic phase, histological structure improving of the alveolar wall was accompanied by robust substrate metabolism and protein turnover. The lungs, at the metamorphic climax phase, are characterized by an increased number of cilia in the alveolar epithelial cells and collagenous fibers in the connective tissues, corresponding to the transcriptional upregulation of cilia and extracellular matrix-related genes. The post-metamorphic lungs strengthen the contracting function, as suggested by the thickened muscle layer and the upregulated expression of genes involved in muscle contraction. The blood–gas barrier is fully developed in adult lungs whose transcriptional features are tissue growth and differentiation regulation and immunity. Importantly, significant transcriptional switches of pulmonary surfactant protein and hemoglobin facilitate air-breathing. Our results illuminated four key steps of lung development for amphibians to transition from water to land.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

We study theoretically the Josephson diode effect (JDE) realized in a system composed of parallel-coupled double quantum dots (DQDs) sandwiched between two semiconductor nanowires deposited on an s-wave superconductor surface. Due to the combined effects of the proximity-caused superconductivity, strong Rashba spin-orbit interaction and Zeeman splitting inside the nanowires, a pair of Majorana bound states (MBSs) may possibly emerge at opposite ends of each nanowire. Different phase factors arisen from the superconductor substrate can be generated in the coupling amplitudes between the DQDs and MBSs prepared at the left and right nanowires, and will result in the Josephson current. We find that the critical Josephson currents in positive and negative directions are different from each other in amplitude within an oscillation period with respective to the magnetic flux penetrating through the system, a phenomenon known as the JDE. It arises from the quantum interference effect in this double-path device, and can hardly occur in system of one QD coupled to MBSs. Our results also show that the diode efficiency can reach up to 50%, and depends on the overlap amplitude between the MBSs and the energy levels of the DQDs adjustable by gate voltages. The present model is realizable within current nanofabitication technologies and may find practical use in interdisciplinary field of Majorana and Josephson physics.

The central coast is one of the importantly livable regions in China, and green land plays a meaningful role in improving human settlements through regulating ecosystem services. However, the research on spatiotemporal heterogeneity of green land in different urbanized areas are still lacking in this region, which limits the timeliness of reporting on the land-surface thermal properties of residential environment from green land perspective. To address this issue, the synergistic methodology of “artificial numerical technology -- urban interior mixed pixel classification -- surface radiation energy balance model” was applied to investigate the green land change and its impact on human settlements in Rizhao region, which is known for its coastal ecology and greenery in China and obtained the United Nations habitat award. Main conclusions of this study are below: (1) Although total green land decreased by 474.05 km2, resulting in a decrease of 9.17% in its share of the entire study area from 2000-2022 during the urbanization process, but the greening levels improved within the built-up area, with the greening proportion of 25.34% in 2000 and 42.98 km2 in 2022. (2) Differences in green land at different urbanized regions were first observed, namely, urban greening rate was 37.78% in the old urban areas of 2022, while it was up to 46.43% in new urban areas. More attention was paid to the construction of urban green space during urban expansion, which will inevitably bring better visual and comfort experience to residents. (3) Thermal comfort indicators for urban residents were evaluated in latent heat flux (0-457.83 W/m2), sensible heat flux (0-645.09 W/m2), total available energy (254.07-659.42 W/m2) and others. (4) The lowered cooling temperature effect in the middle, high green land density region was 1.05 ℃ and 2.12 ℃ compared to the low-density region, and the average air temperature was 25.86 ℃. Also, spatial patterns of hot and cold uncomfortable areas were displayed in this study. Overall, this study provides the meaningfully practical reference for exploring the spatiotemporal heterogeneity of green land and its impact on residents' environments from the perspective of land-surface thermal properties in coastal areas of China and around the world.

Fire behavior of natural rubber latex foam under different thickness conditions(d=1,2and 5cm)were explored though a little of experiments by using the self-built small scale experimental platform. It can be shown that the flame spread law of thermally thin and thermally thickness are different. Natural rubber latex foam with thickness of 2cm show higher fire risk, which value of flame spread rate, maximum flame height, maximum mass loss rate and maximum temperature is 0.00293m/s, 851.875mm, 1.83g/s, 948K,repectively.That may because the thickness of residue formed of thermally thick materials is larger than the thin one, obstructing the contact of the natural rubber latex foam with fresh air .In addition, a special phenomenon is noticed that during the second stage, the bottom unburned zone located in the four edges(thermally thin material) and middle player(thermally thick material).

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Intramuscular fat content (IFC) and meat color are vital indicators affecting pork quality. A significant positive correlation between IFC and redness meat color (a* value) indicates that these two traits are likely to be regulated by shared molecular pathways. To identify candidate genes, hub genes, and signaling pathways that regulate these two traits, we measured the IFC and a* value in 147 hybrid pigs and selected individuls with extreme phenotypes for transcriptome analysis. The results revealed 485 and 394 overlapping differentially expressed genes (DEGs) using DESeq2, limma, and edgeR packages affecting IFC and a* value, respectively. Weighted gene co-expression network analysis (WGCNA) identified four modules significantly correlated with IFC and a* value. Moreover, we integrated functional enrichment analysis results based on DEGs, GSEA, and WGCNA conditions to identify candidate genes, and identified 47 and 53 candidate genes affecting IFC and a* value, respectively. The protein-protein interaction (PPI) network analysis of candidate genes showed that 6 and 14 hub genes affecting IFC and a* value, respectively. These genes mainly participated in various pathways related to lipid metabolism and redox reactions. Notably, four crucial hub genes (MYC, SOX9, CEBPB, and PPAGRC1A) were shared for these two traits. After functional annotation of these four hub genes, we hypothesized that the SOX9/CEBPB/PPARGC1A axis could co-regulate lipid metabolism and myoglobin redox response. Further research on these hub genes, especially the SOX9/CEBPB/PPARGC1A axis, will help to understand the molecular mechanism of the co-regulation of IFC and a* value, which will provide the theoretical basis for improving pork quality.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Unmanned Aerial Vehicles (UAVs) image object detection has great application value in military and civilian fields. However, the objects in the captured images from UAVs have problems of large scale variation, complex backgrounds, and a large proportion of small objects. To resolve these problems, a multi-scale object detector based on coordinate and global information aggregation is proposed, named CGMDet. Firstly, a Coordinate and Global Information Aggregation Module (CGAM) is designed by aggregating local, coordinate, and global information, which can obtain features with richer context information. Secondly, a Multi-Feature Fusion Pyramid Network (MF-FPN) is proposed, which can better fuse features of different scales and obtain features containing more context information through repeated use of feature maps, to better detect multi-scale targets. Moreover, more location information of low-level feature maps is integrated to improve the detection results of small targets. Furthermore, we modified the bounding box regression loss of the model to make the model more accurately regress the bounding box and faster convergence. Finally, the proposed CGMDet was tested on VisDrone and UAVDT datasets and mAP0.5 of 50.9% and 48% was obtained, respectively. At the same time, our detector achieved the best results compared to other detectors.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

Adult neurogenesis involves generation of functional neurons from neural progenitor cells, which have the potential to complement and restore damaged neurons and neural circuits. Therefore, the development of drugs that stimulate neurogenesis represents a promising strategy in stem cell therapy and neural regeneration, greatly facilitating the reconstruction of neural circuits in cases of neurodegeneration and brain injury. Our study reveals that compound A5, previously designed and synthesized by our team, exhibits remarkable neuritogenic activities, effectively inducing neurogenesis in neural stem/progenitor cells (NSPCs). Subsequently, transcriptome analysis using high-throughput Illumina RNA-seq technology was performed to further elucidate the underlying molecular mechanisms by which compound A5 promotes neurogenesis. Notably, comparative transcriptome analysis showed that the up-regulated genes were mainly associated with neurogenesis and the down-regulated genes were mainly concerned with cell cycle progression. Furthermore, we confirmed that compound A5 significantly affected the expression of transcription factors related to neurogenesis and cell cycle regulatory proteins. Collectively, these findings identify a new compound with neurogenic activity and may provide insights into drug discovery for neural repair and regeneration.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

Electromagnetic sensing has been used for diverse applications of non-destructive testing, including the surface inspection, measurement of properties, object characterization. However, the measurement accuracy could be significantly influenced by the lift-off between sensors and samples. To address the issue caused by lift-offs, various strategies have been proposed for the permeability measurement of ferromagnetic steels, which mainly involves different sensor designs and signal features (e.g., the zero-crossing feature). In this paper, a single high-frequency scenario for the permeability retrieval is introduced. By combining the signal of two sensing pairs, the retrieval of magnetic permeability is less affected by the lift-off of sensors. Unlike the previous strategy on reducing the lift-off effect (directly taking the phase term out of the integration) using the Dodd-Deeds analytical method, the proposed method is based on a high-frequency linear feature of the phase term. Therefore, this method has the merit of high accuracy and fast processing for the permeability retrieval (a simplified version of Dodd-Deeds analytical formulas after the integration). Experimental measurement has been carried out on the impedance measurement of designed sensors interrogating ferromagnetic dual-phase steels. For sensor lift-offs of up to 10 mm, the error of the permeability retrieval is controlled within 4 % under the optimal frequency.

Eddy current testing can be used to interrogate steels but it is hampered by the lift-off distance of the sensor. Previously, the lift-off point of intersection (LOI) feature has been found for the pulsed eddy current (PEC) testing. In this paper, a lift-off invariant inductance (LII) feature is proposed for the multi-frequency eddy current (MEC) testing, which merely targets the ferromagnetic steels. That is, at a certain working frequency, the measured inductance signal is found nearly immune to the lift-off distance of the sensor. Such working frequency and inductance are termed as the lift-off invariant frequency (LIF) and LII. Through simulations and experimental measurements of different steels under the multi-frequency manner, the LII has been verified to be merely related to the sensor parameters and independent of different steels. By referring to the LIF of the test piece and using an iterative inverse solver, one of the steel properties (either the electrical conductivity or magnetic permeability) can be reconstructed with a high accuracy.

In many advanced industrial applications, the thickness is a critical index, especially for metallic coatings. However, the variance of lift-off spacing between sensors and test pieces affects the measured voltage or impedance, which leads to unreliable results from the sensor. Massive research works have been proposed to address the lift-off issue, but few of them applies to the thickness measurement of planar metallic films with finite-size circular (disk) geometry. Previously, a peak-frequency feature from the swept-frequency inductance was used to compensate the measurement error caused by lift-offs, which was based on the slow-changing rate of impedance phase term in the Dodd-Deeds formulas. However, the phase of measured impedance is nearly invariant merely on a limited range of sample thicknesses and working frequencies. Besides, the frequency sweeping is time-consuming, where a recalibration is needed for different sensor setups applied to the online real-time measurement. In this paper, a single-frequency algorithm has been proposed, which is embedded in the measurement instrument for the online real-time retrieval of thickness. Owing to the single-frequency measurement strategy, the proposed method does not need to recalibrate for different sensor setups. The thickness retrieval is based on a triple-coil sensor (with one transmitter and two receivers). The thickness of metallic disk foils is retrieved from the measured electrical resistance of two transmitter-receiver sensing pairs. Experiments on materials of different electrical conductivities (from direct current), thicknesses and planar sizes (radii) have been carried out to verify the proposed method. The error for the thickness retrieval of conductive disk foils is controlled within 5 % for lift-offs up to 5 mm.

Previously, various techniques have been proposed for reducing the lift-off effect on the thickness measurement of the non-magnetic films, including the peak-frequency feature and phase feature in the Dodd-Deed analytical formulation. To realise a real-time feedback response on the thickness monitoring, the phase term in the Dodd-Deeds formulation must be taken off the integration. Previous methods were based on the slow change rate of the phase term when compared to the rest of the term – the magnitude term. However, the change rate of the phase term is still considerable for a range of working frequencies. In this paper, a high-frequency feature has been found. That is, the ratio between the imaginary and real part of the phase term is proportional to the integral variable under high frequencies. Based on this proportion relationship, the phase term has been taken out; and a thickness algorithm has been proposed. By combing the measured impedance from the custom-built sensor (three coils), the thickness of the metallic film can be reconstructed. Experiments have been carried out for the verification of the proposed scenario. Results show that the thickness of the metal film can be reconstructed with a small error of less than 2 %, and immune to a reasonable range of lift-offs.

The connected vertex cover (CVC) problem is a variant of the vertex cover problem, which has many important applications, such as wireless network design, routing and wavelength assignment problem, etc. A good algorithm for the problem can help us improve engineering efficiency, cost savings and resources in industrial applications. In this work, we present an efficient algorithm GRASP-CVC (Greedy Randomized Adaptive Search Procedure for Connected Vertex Cover) for CVC in general graphs. The algorithm has two main phases, i.e., construction phase and local search phase. To construct a high quality feasible initial solution, we design a greedy function and a restricted candidate list in the construction phase. The configuration checking strategy is adopted to decrease the cycling problem in the local search phase. The experimental results demonstrate that GRASP-CVC is competitive with the other competitive algorithm, which validate the effectivity and efficiency of our GRASP-CVC solver.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

Neurogenesis in the adult brain plays a major role in the cognitive ability of animals including learning and memory. Poria cocos (Schw.) Wolf (P. cocos) has been known as a traditional Chinese edible medicinal herb with the potential effect to improve learning and memory. However, the effect mechanisms are still elusive. In this study, significant neuronal differentiation-promoting activities of the ethanol extracts of P. cocos (EEPC) were tested in Neuro-2a cells and mouse cortical neural stem/progenitor cells (NSPCs). Subsequently, 97 compounds of EEPC were identified using UHPLC-Q-Exactive-MS/MS. After investigation of neuronal differentiation-promoting activities of 4 major compounds (Ethyl palmitoleate, L-(-)-Arabitol, Choline and Adenosine), only Choline has significant neuronal differentiation-promoting activity. In summary, we investigated the neuronal differentiation-promoting activity and chemical compositions of EEPC, the study of the neuronal differentiation-promoting effect of ether extract of P. cocos indicated P. cocos’s positive effect on learning and memory functions. This is the first investigation of the neuronal differentiation-promoting effect of ether extract of P. cocos based on similar research references.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

A partial aperture onboard calibration method can solve the onboard calibration problems of some large aperture remote sensors, which is of great significance for the development trend of increasingly large apertures in optical remote sensors. In this paper, the solar diffuser reflectance degradation monitor (SDRDM) in the onboard calibration assembly (CA) of the FengYun-4 (FY-4) advanced geostationary radiance imager (AGRI) is used as the reference radiometer for measuring the partial aperture factor (PAF) for the AGRI onboard calibration. First, the linear response count variation relationship between the two is established under the same radiance source input. Then, according to the known bidirectional reflection distribution function (BRDF) of the solar diffuser (SD) in the CA, the relative reflectance ratio coefficient between the AGRI observation direction and the SDRDM observation direction is calculated. On this basis, the response count value of the AGRI and the SDRDM is used to realize the high-precision measurement of the PAF of the AGRI B1 ~ B3 bands by simulating the AGRI onboard calibration measurement under the illumination of a solar simulator in the laboratory. According to the determination process of the relevant parameters of the PAF, the measurement uncertainty of the PAF is analyzed; this uncertainty is better than 2.04% and provides an important reference for the evaluation of the onboard absolute radiometric calibration uncertainty after launch.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (<1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

Transcription factors (TFs) are crucial in modulating gene expression and sculpting cellular and organismal phenotypes. The identification of TF-target gene interactions is pivotal for comprehending molecular pathways and disease etiologies but has been hindered by the demanding nature of traditional experimental approaches. This paper introduces a novel web application, utilizing the R programming language, which predicts TF-target gene relationships and vice versa. Our application integrates the predictive power of various bioinformatic tools, leveraging their combined strengths to provide robust predictions. It merges databases for enhanced precision, incorporates gene expression correlation for accuracy, and employs pan-tissue correlation analysis for context-specific insights. The application also enables the integration of user data with established resources to analyze TF-target gene networks. Despite its current limitation to human data, it provides a platform for exploring gene regulatory mechanisms comprehensively. This integrated, systematic approach offers researchers an invaluable tool for dissecting the complexities of gene regulation, with the potential for future expansions to include a broader range of species.

This paper proposes a new approach for multi-focus images fusion based on Region Mosaicing on Contrast Pyramids (REMCP). A density-based region growing method is developed to construct a focused region mask for multi-focus images. The segmented focused region mask is decomposed into a mask pyramid, which is then used for supervised region mosaicking on a contrast pyramid. In this way, the focus measurement and the continuity of focused regions are incorporated and the pixel level pyramid fusion is improved at the region level. Objective and subjective experiments show that the proposed REMCP is more robust to noise than compared algorithms and can fully preserves the focus information of the multi-focus images meanwhile reducing distortions of the fused images.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

In this paper, we investigate the new degenerate Daehee polynomials and numbers which are called the degenerate Daehee polynomials of the second kind, and derive some new and interesting identities and properties of those polynomials.

Most studies on the association of in utero exposure to cigarette smoking and childhood overweight or obesity (OWO) were based on maternal self-reported smoking data and few were based on objective biomarkers. In this study, we evaluated the associations between self-reported and biomarkers of in utero exposure to cigarette smoking with risk of childhood OWO. We analyzed data from 2351 mother-child pairs in the Boston Birth Cohort, a US low-income minority cohort that enrolled children at birth and followed prospectively up to age 18 years. In utero smoking exposure was measured by maternal self-report and by maternal and cord plasma cotinine and hydroxycotinine metabolites. We assessed the individual and joint associations of each smoking exposure measure and maternal OWO with childhood OWO using multinomial logistic regressions. We used nested logistic regressions to investigate the childhood OWO prediction performance when adding maternal and cord plasma biomarkers as input covariates on top of self-reported data. Our results demonstrated that in utero cigarette smoking exposure defined by self-report and by maternal or cord metabolites were consistently associated with increased risk of long-term child OWO. Adding maternal and cord plasma biomarker information to self-reported data improved the prediction accuracy of long-term child OWO risk.

Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

The Android-based IoT platform just like the existing Android provides an environment that makes it easy to utilize Google's infrastructure services including development tools and APIs through which it helps to control the sensors of IoT devices. Applications running on the Android-based IoT platform are often UI free and are used without the user’s consent to registered permissions. It is difficult to respond to the misuse of permissions as well as to check them when they are registered indiscriminately while updating applications. This paper analyzes the versions of before and after an application the update running on the Android-based IoT platform and the collected permission lists. It aims to identify the same permissions before and after the update, and deleted and newly added permissions after the update were identified, and thereby respond to security threats that can arise from the permissions that is not needed for IoT devices to perform certain functions.

To elucidate the function of the cold resistance regulatory gene FmNAC1 from Fraxinus mandshurica, this study identified the role that the overexpression of the FmNAC1 gene plays in tobacco growth and cold stress regulation. The cloned FmNAC1 gene from F. mandshurica is 891 bp in length and encodes 296 amino acids. Our subcellular localization analysis confirmed that FmNAC1 is primarily located in the nucleus and functions as a transcription factor. FmNAC1 is responsive to cold and NaCl stress, as well as to the induction of IAA, GA, and ABA hormone signals. To further elucidate its function in cold resistance, four transgenic tobacco lines of FmNAC1 overexpression（FmNAC1-OE）were generated through tissue culture after the agrobacterium-mediated transformation of wild-type (WT) tobacco. These FmNAC1-OE plants exhibited accelerated growth after transplantation. When exposed to low-temperature conditions at -5°C for 24 hours, the rates of wilting and yellowing of the FmNAC1-OE plants were significantly lower than those of the WT tobacco plants. Additionally, the membrane integrity, osmotic regulation, and reactive oxygen species (ROS)-scavenging abilities of the FmNAC1-OE tobacco lines were better than those of the WT plants, indicating the potential of the FmNAC1 gene to improve plant cold resistance. The gene expression results further revealed that the FmNAC1 transcription factor exhibits regulatory interactions with growth-related genes such as IAA and AUX1; cold resistance-related genes such as ICE, DREB, and CBF1; and genes involved in the clearance of reactive oxygen species (ROS), such as CAT and SOD. All of this evidence shows that the FmNAC1 transcription factor from F. mandshurica plays a key role in contributing to the enhancement of growth, cold resistance, and ROS clearance in transgenic tobacco plants.

In order to accurately identify the external economic situation in China and analyze the situation of economic development in Northeast China, based on the Strengths, Weaknesses, Opportunities and Threats (SWOT) analysis framework, this article analyses the economy in Northeast China from the four factors of SWOT. To solve the lack of quantitative analysis in SWOT analysis, this article applies Analytic Hierarchy Process (AHP) to the analysis, and finally forms a complete system framework with the combination of qualitative and quantitative factors, through the analysis of the important degree of various factors and the consistency test, the key factors influencing the economic development in Northeast China are analyzed, and constructive countermeasures are proposed.

A new design scheme is proposed for twisting the walls of a microchannel, and its performance is demonstrated numerically. The numerical study was carried out for a T-shaped microchannel with twist angles in the range of 0 to 34π. The Reynolds number range was 0.15 to 6. The T-shaped microchannel consists of two inlet branches and an outlet branch. The mixing performance was analyzed in terms of the degree of mixing and relative mixing cost. All numerical results show that the twisting scheme is an effective way to enhance the mixing in a T-shaped microchannel. The mixing enhancement is realized by the swirling of two fluids in the cross section and is more prominent as the Reynolds number decreases. The twist angle was optimized to maximize the DOM, which increases with the length of the outlet branch. The twist angle was also optimized in terms of the relative mixing. The two optimum twisting angles are generally not coincident. The optimum twist angle shows a dependence on the length of the outlet branch but it is not affected much by the Reynolds number.

In recent years, demand has been increasing for target detection and tracking from aerial imagery via drones using onboard powered sensors and devices. We propose a very effective method for this application based on a deep learning framework. A state-of-art embedded hardware system empowers small flying robots to carry out the real-time onboard computation necessary for object tracking. Two types of embedded modules were developed: one is designed using a Jetson TX or AGX Xavier, and the other is based on an Intel Neural Compute Stick. These are suitable for real-time onboard computing power on small flying drones with limited space. A comparative analysis of current state-of-art deep-learning-based multi-object detection algorithms was carried out utilizing the designated GPU-based embedded computing modules to obtain detailed metric data about frame rates as well as the computation power. We also introduce an effective target tracking approach for moving objects. The algorithm for tracking moving objects is based on the extension of simple online and real-time tracking. It was developed by integrating a deep-learning-based association metric approach (Deep SORT), which uses a hypothesis tracking methodology with Kalman filtering and a deep-learning-based association metric. In addition, a guidance system that tracks the target position using a GPU-based algorithm is introduced. Finally, we demonstrate the effectiveness of the proposed algorithms by real-time experiments with a small multi-rotor drone.

The molecular clusters ((HO)3Si-O-Si(OH)3, and (HO)3Al-O-Si(OH)3 ) representative of aluminosilicate mineral surface were employed to study the dissolution of aluminosilicate in acidic condition via density functional theory with the M06-2X+G(d,p) methodology. The surface termination sites (Si and Al) were both tetra-coordinated and the terminal oxygen was protonated in acidic condition. In the dissolution reaction, the calculated barrier height of the six-membered ring transition state complex containing two water molecules was predicted to be lower than that of four-membered ring transition state complex containing one water molecule. In addition, the calculated barrier heights for Al-terminated sites were predicted to be lower than those for the Si-terminated sites, suggesting that breaking the Al-O bond is easier than Si-O bond in the aluminosilicate mineral surface; the barrier heights of the surface termination sites with protonated terminal oxygen were lower than those without protonated terminal oxygen. With the fracture of Si-O and Al-O bonds, the Si and Al release from the aluminosilicate. These results confirm the experimental conclusions that the acidic condition facilitates the release of Si and Al from the aluminosilicate, and the concentration of Al leaching from aluminosilicate is higher than Si.

Reinforcement Learning (RL) has demonstrated considerable potential in solving challenges across various domains, notably in autonomous driving. Nevertheless, implementing RL in autonomous driving comes with its own set of difficulties, such as the overestimation phenomenon, extensive learning time, and sparse reward problems. Although solutions like Hindsight Experience Replay (HER) have been proposed to alleviate these issues, the direct utilization of RL in autonomous vehicles remains constrained due to the intricate fusion of information and the possibility of system failures during the learning process. In this paper, we present a novel RL-based autonomous driving system technology that combines Obstacle Dependent Gaussian (ODG) RL, Soft Actor-Critic (SAC), and meta-learning algorithms. Our approach addresses key issues in RL, including the overestimation phenomenon and sparse reward problems, by incorporating prior knowledge derived from the ODG algorithm. We evaluated our proposed algorithm on official F1 circuits, using high-fidelity racing simulations with complex dynamics. The results demonstrate exceptional performance, with our method achieving up to 89% faster learning speed compared to existing algorithms in these environments.

As the global demand for clean and sustainable energy sources intensifies, hydrogen emerges as a promising alternative fuel. The widespread adoption of hydrogen, however, is impeded by the lack of efficient systems for storage and transportation. This review aims to summarize the recent advancements and prevailing challenges within the realm of hydrogen storage and transportation, thereby providing guidance and impetus for future research and practical applications in this domain. Through a systematic selection and analysis of the latest literature, this study highlights the strengths, limitations, and technological progress of various hydrogen storage methods, including compressed gaseous hydrogen, cryogenic liquid hydrogen, organic liquids hydrogen, solid materials hydrogen storage, as well as the feasibility, efficiency, and infrastructure requirements of different transportation modes such as pipelines, road and seaborne transportation. The findings reveal that challenges such as low storage density, high costs, and inadequate infrastructure persist despite progress in high-pressure storage and cryogenic liquefaction. The review also underscores the potential of emerging technologies and innovative concepts, including metal-organic frameworks, nanomaterials, and underground storage, along with the potential synergies with renewable energy integration and hydrogen production facilities. In conclusion, interdisciplinary collaboration, policy support, and ongoing research are essential in harnessing hydrogen’s full potential as a clean energy carrier. This review concludes that research in hydrogen storage and transportation is vital to global energy transformation and climate change mitigation.

In Korea, the underground silo structure for low- and intermediate-level radioactive waste disposal facilities has been constructed and operated since 2014. Large-scale earthquakes occurred in 2016 and 2017, respectively, in Gyeongju and Pohang areas near the underground silo structures, and interest in the stability of the underground silo increased significantly. In this paper, one-dimensional free field analyses have been carried out before the three-dimensional silo dynamic analyses subjected to earthquake loadings. As an additional study, a new form of finite element equilibrium equation is derived in terms of relative motions, which is essentially the same equation as that expressed in terms of total motions where the base shear force is applied for earthquake load. The accuracy of conventional finite element solutions is evaluated by directly comparing them with closed-form solutions by frequency domain analysis such as SHAKE91.

As human activities of the countries in the East Asia have been remarkably expanding over recent decades, various problems in relation to ships, such as oil spill and many other coastal marine pollution, are continuously occurring in the coastal region. In order to conserve marine resources and prepare for possible ship accidents in advance, the need for efficient ship management is increasing over time. Multi-satellite, multi-sensor, multi-wavelength or multi-frequency observations make it possible to monitor a variety of vessels in the coastal region. This study presents the results of ship detection methodology applied to multi-spectral satellite images in the seas around Korean Peninsula based on optical, hyperspectral, and microwave remote sensing. To detect ships from hyperspectral images with a few hundreds of spectral channels, spectral matching algorithms are used to investigate similarity between the spectra and in-situ measurements. In the case of SAR (Synthetic Aperture Radar) images, the Constant False Alarm Rate (CFAR) algorithm is used to discriminate the vessels from backscattering coefficients of Sentinel-1 SAR and ALOS-2 PALSAR2 images. The present ship detection methods can be extensively utilized for optical, hyperspectral, and SAR images for comprehensive coastal management purposes toward perpetual sustainability in the future.

This study examines the negative impacts of dark stores on the urban environment from three perspectives: land use, transportation, and streetscape. It is conducted on B-Mart, a representative dark store in South Korea. First, in terms of land use, we find that dark stores that function as logistics facilities conflict with the surrounding land use. Second, by analyzing the location of dark stores and the hourly traffic volume of delivery vehicles, we find that the impact on the surrounding transportation infrastructure and pedestrian traffic is not as significant as previously claimed. However, during the transportation and loading process of the dark store, several problems such as traffic violations, illegal parking, and illegal loading were observed, posing a risk to nearby vehicles and pedestrians. Third, in terms of streetscapes, the location of dark stores on the ground floor of buildings can harm streetscapes. The current urban planning system in South Korea does not clearly define the status and function of dark stores, making it unclear how to manage them. Therefore, it is necessary to clarify their legal definition and introduce urban planning and design guidelines that are consistent with their appropriate location and appearance.

Our previous studies demonstrated that quercetin (Q) could be ingested and metabolized by macrophages and exerted prophylactic immuno-stimulatory activity and therapeutic anti-inflammatory effects on lipopolysaccharide (LPS)-treated macrophages ex vivo. To further clarify its possible anti-inflammatory mechanism, Q was selected to treat mouse peritoneal macrophages that obtained from female BALB/c mice exposed to LPS i.p. for 12 h. Relative gene expression of pro-/anti-inflammatory (TNF-α/IL-10) cytokines and components of inflammation-related intracellular signaling pathways (TLR2, TLR4, NF-κB, JAK2 and STAT3) was analyzed using two-step reverse transcription (RT) and real-time quantitative polymerase chain reaction (qPCR). STAT3 protein phosphorylation was determined using an in-cell ELISA method. As a result, Q and its metabolite quercetin-3-O-β-D-glucuronide (Q3G) decreased TNF-α gene expression amounts and ratios of pro-/anti-inflammatory (TNF-α/IL-10) cytokine gene expressions, but increased IL-10 gene expression amounts in activated inflammatory macrophages, supporting a substantial anti-inflammatory potential of Q and Q3G treatments. However, Q3G had lower effects than those of Q. Importantly, Q inhibited TLR2 gene expression and phosphorylation of STAT3 protein in the inflamed cells. Our results are the first report to suggest that Q inhibits LPS-induced inflammation ex vivo through suppressing TLR2 gene expression and STAT3 protein phosphorylation in activated inflammatory macrophages. Q has potential to further apply for treating inflammation-associated diseases.

Diatomite (DME) consists of natural ordered porous structures that are excellent candidates as microcontainers. However, to the best of our knowledge, the application of DME loaded with corrosion inhibitors in anti-corrosion coatings has not hitherto been reported. In this study, DME has been used as a source of microcontainers to load benzotriazole (BTA) inhibitor by an immersion method. In order to prevent unwanted early release of the small molecule BTA inhibitor from the DME microcontainers, inspired by the adhesion characteristics of catechol and amine in mussel adhesion protein, polydopamine (PDA) was coated on their surfaces to generate BTA@DME/PDA microcapsules. Because of the depolymerization characteristics of PDA at low pH, the synthesize microcapsules showed a controllable release function. The SEM morphology, chemical structure, and loading capacity of the synthesized BTA@DME/PDA microcapsules were characterized. The corrosion resistances of epoxy coatings with different contents of BTA@DME/PDA microcapsules were compared by saline immersion and electrochemical impedance tests. A scratched coating with 5wt.% BTA@DME/PDA microcapsules showed the best anti-corrosion effect.

In the past decade, it has been discovered that intestinal flora can influence various organ-specific cancers by altering the body's energy balance, increasing obesity, synthesizing genetic toxins and small signaling molecules, initiating and modulating immune responses, and metabolizing indigestible dietary components, exogenous substances, and drugs. In this review, we will focus on elucidating the role of gut flora based on its molecular mechanisms and its potential therapeutic implications in head and neck tumors in the near future.

The number of patients with bone metabolic disorders including osteoporosis is increasing worldwide. These disorders often facilitate bone fractures, which seriously impact the patient’s quality of life and could lead to further health complications. Bone homeostasis is tightly regulated to balance bone resorption and formation. However, many anti-osteoporotic agents are broadly categorized as either bone forming or anti-resorptive, and their therapeutic use is often limited due to unwanted side effects. Therefore, safe and effective therapeutic agents are needed for osteoporosis. This study aims to clarify the bone protecting effects of oat bran water extract (OBWE) and its mode of action. OBWE inhibited RANKL-induced osteoclast differentiation by blocking c-Fos/NFATc1 through the alteration of I-κB. Furthermore, we found that OBWE enhanced BMP-2-stimulated osteoblast differentiation by the induction of Runx2 via Smad signaling molecules. In addition, the anti-osteoporotic activity of OBWE was also evaluated using an in vivo model. OBWE significantly restored ovariectomy-induced bone loss. These in vitro and in vivo results showed that OBWE has the potential to combat bone metabolic disorders including osteoporosis

Electromagnetic sensors have been used for inspecting small surface defects of metals. Based on the eddy-current thin-skin regime, a revised algorithm is proposed for a triple-coil drive-pickup eddy-current sensor scanning over long surface crack slots (10 mm) with different rotary angles. The method is validated by the voltage measurement of the designed EC sensor scanning over a benchmark (ferromagnetic) steel with surface defects of different depths and rotary angles. With an additional sensing coil for the designed EC sensor, the defect angle (or orientation) can be measured without spatially and coaxially rotating the excitation coil. By referring to the voltage change (due to the defect) diagram (voltage sum versus voltage different) of two sensing pairs, the rotary angle of the surface crack is retrieved with a maximum residual deviation of 3.5 %.

Intestinal epithelial cell activities during homeostasis and regeneration are well described, but their potential interactions with stromal cells remain unresolved. Exploring the functions of these heterogeneous intestinal mesenchymal stromal cells (iMSCs) remains challenging due to the lack of specific markers for most functionally homogenous subpopulations. In recent years, however, novel clustering techniques such as single-cell RNA sequencing (scRNA-seq), fluorescence-activated cell sorting (FACS), confocal microscope, and computational remodeling of intestinal anatomy have helped identify and characterize some specific iMSC subsets. These methods help researchers learn more about the localization and functions of iMSC populations during intestinal morphogenic and homeostatic conditions. Furthermore, it is imperative to understand their cellular pathways for activation and how they interact with surrounding cellular components, particularly during intestinal epithelial regeneration that follows mucosal injury. This review provides insights into the spatial distribution and functions of some identified iMSC subtypes in intestinal morphogenesis, homeostasis, and regeneration. We reviewed related signaling mechanisms implicated during epithelial and subepithelial stromal cell crosstalk. Future research should focus on elucidating the molecular intermediates of these regulatory pathways to open a new frontier for potential therapeutic targets that can alleviate intestinal mucosa-related injuries.

Spatial crowdsourcing emerges as a new computing paradigm that enables mobile users to accomplish spatio- temporal tasks in order to solve human-intrinsic problems. Existing crowdsourcing systems critically use centralized servers for interacting with workers and making task assignment decisions. These systems are hence susceptible to issues such as the single point of failure and the lack of operational transparency. Prior work, therefore, turns to blockchain-based decentralized crowdsourcing systems, yet still suffers from problems of lacking efficient task assignment scheme, requiring a deposit to an untrusted system, low block generation speed, and high transaction fees. To address these issues, we design a blockchain-based decentralized framework for spatial crowdsourcing, which we call SC-EOS. Our system does not rely on any trusted servers, while providing efficient and user-customizable task assignment, low monetary cost, and fast block generation. More importantly, it frees users from making a deposit into an untrusted system. Our framework can also be extended and applied to generic crowdsourcing systems. We implemented the proposed system on the EOS blockchain. Trace-driven evaluations involving real users show that our system attains the comparable task assignment performance against a clairvoyant scheme. It also achieves 10× cost savings than an Ethereum-based implementation.

Nickel-based Superalloy Inconel 718 is widely used in the aerospace industry for its excellent high-temperature strength and thermal stability. However, milling Inconel 718 presents challenges due to significantly increased cutting force and vibration, which is a typical difficult-to-machine material. This paper focuses on the milling process of Inconel 718, establishing a milling force model to analyze the force trends under various processing parameters. Finite element analysis is employed to study the stress and temperature fields during milling. Dynamic equations for milling Inconel 718 are developed, and stability lobe diagrams are generated based on modal experiments. Milling experiments on Inconel 718 validate the milling force model and finite element analysis results. The fmincon optimization algorithm is utilized to identify the optimal machining parameters for Inconel 718. Through this research, valuable insights into enhancing the efficiency and quality of Inconel 718 machining are provided. This study contributes to a deeper understanding of Inconel 718 milling behavior, offering crucial guidance for more efficient machining processes.