As major natural disasters in grassland areas, fires and dust events seriously threaten human safety, property, and animal husbandry. Furthermore, these phenomena may be mutually reinforcing, which can lead to more severe cascading disasters. However, few studies have been on the mechanisms of grassland fire and dust events disaster chain. Therefore, we selected Dornod aimag (province), a typical temperate grassland, as the study area and analyzed the spatiotemporal variation patterns of grassland fires and dust weather, as well as the effect of grassland fires on dust weather based on MCD64A1 Burnt Area data and SYNOP dust data. The mechanism of grassland fires on dust weather was further investigated using the MOD13A3 vegetation index product and ERA5 wind speed, wind direction, and precipitation data. The results revealed that grassland fires and dust weather varied spatially across the study area. Furthermore, grassland fires occurred mainly in spring (April to May), summer (June), and autumn (October), while dust weather mainly occurred in spring (March to May). Moreover, autumn, winter, and spring cumulative grassland fires (both days and area) substantially affected the spring total dust weather days and dust storm days, particularly the spring cumulative dust storm days. Additionally, higher precipitation in the summer of 2014 resulted in higher vegetation coverage and more fuel in the autumn and winter of 2014, and even in the spring of 2015. As a result, the cumulative grassland fire days was higher, and the area was larger from September 2014 to April 2015, leading to a considerable increase in the cumulative dust storm days in May 2015. This study has important implications for disaster prevention and mitigation, ecological and environmental protection, and sustainable development in grasslands.

The objective of this study was to synthesize 9-/13-position substituted berberine derivatives and evaluated their cytotoxic and photocytotoxic effects against three human cancer cell lines. Among all the synthesized compounds, 9-O-dodecyl- (5e), 13-dodecyl- (6e) and 13-O-dodecyl-berberine (7e) exhibited stronger growth inhibition against three human cancer cell lines, (HepG2, HT-29 and BFTC905), in compare with structurally related berberine (1). These three compounds also showed the photocytotoxicity in human cancer cells in a concentration-dependent and light dose-dependent manner. Through flow cytometry analysis, we found out a lipophilic group at 9-/13-position of berberine may have facilitated its penetration into test cell and hence enhanced its photocytotoxicity on human liver cancer cell HepG2. Further, in cell cycle analysis, 5e, 6e and 7e induced HepG2 cells to arrest at S phase and caused apoptosis upon irradiation. In addition, photodynamic treatment of berberine (1) and its derivatives 5e, 6e and 7e again showed a significant photocytotoxic effects on HepG2 cells, induced remarkable cell apoptosis, greatly increased intracellular ROS level and the loss of mitochondrial membrane potential. These results over and again confirmed that berberine derivatives 5e, 6e and 7e greatly enhanced photocytotoxicity. Taking together, the test data led us to conclude that berberine derivatives with a dodecyl group at 9-/13-position could be great candidates for the anti-liver cancer medicines developments.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Ostreid herpesvirus 1 (OsHV-1) is one of the most economically important pathogens of Pacific oysters. Understanding the pathogenesis of this virus is critical to developing tools to control outbreaks on shellfish farms. OsHV-1 is genetically related to vertebrate herpesviruses, which have a lytic and a latent stage, with the latent stage capable of being reactivated to the lytic stage. Here, OsHV-1 latency in Pacific oysters was investigated in experimentally and naturally infected oysters. Lytic infection in one-year-old oysters injected with the Tomales Bay strain of OsHV-1 was detectable between 1 and 4 days post-infection (dpi) but was not detectable after 5 dpi. The infected oysters shed 1102 to 1104 DNA copies/ml during the 4-day acute phase. At 21 dpi, the recovered oysters were temperature and chemically stressed and were found to shed 1104 to 1105 DNA copies/ml over a period of 48 h. Lytic shedding was not detectable in two-year-old oysters injected similarly with the same strain of OsHV-1; however, the OsHV-1 genome was detectable by qPCR in the adductor muscle, gill, mantle, and hemocytes within the first 3 dpi, after which it became undetectable. No OsHV-1 was detectable in the adductor muscle, gill, or mantle from experimentally infected oysters on days 15 and 21 post-infection or from oysters sampled 9 months after surviving an OsHV-1 mortality event; however, OsHV-1 DNA could be detected in hemocytes of both experimentally infected oysters at 21 dpi and naturally infected oysters. In addition, lytic viral gene transcription was detectable in hemocytes of experimentally infected oysters between 1 and 21 dpi and in hemocytes of naturally infected oysters.

Ferroptosis is an iron-dependent and lipid peroxidation-driven cell death cascade, occurring when there is an imbalance of redox homeostasis in the cell. Nuclear factor E2 related factor 2 (NFE2L2, also known as NRF2) is key for cellular antioxidant responses, which promotes downstream gene transcription by binding to their antioxidant response elements (AREs). Numerous studies suggest that NRF2 assumes an extremely important role in the regulation of ferroptosis, for its various functions on iron, lipid and amino acid metabolism and so on. Many pathological states are relevant to ferroptosis. In cancer cells, ferroptosis is frequently found abnormal suppression. While during tissue damages, ferroptosis is recurrently promoted, resulting in a large number of cell deaths and ultimately loss of the functions of the corresponding organs. Therefore, targeting NRF2-related signaling pathways, to induce or inhibit ferroptosis, has become a great potential therapy for combating cancers, as well as preventing neurodegenerative and ischemic diseases. In this review, a brief overview of the research process of ferroptosis over the past decade will be presented. In particular, the mechanisms of ferroptosis and a focus on the regulation of ferroptosis by NRF2 will be discussed. Finally, the review will briefly list some clinical applications of targeting the NRF2 signaling pathway in the treatment of diseases.

Patients with schizophrenia had higher mortality risks and the role of antipsychotic medications remained inconclusive. In an aging society, elderly schizophrenia patients warrant increased attention. In this study, we aimed to explore medication dosage associations with mortality in schizophrenia patients, using Taiwan's national healthcare database from 2010 to 2014, with 102,964 patients with schizophrenia, and a subgroup of 6,433 elderly patients, compared to an age- and gender-matched control group. The findings revealed that schizophrenia patients with no antipsychotic exposure had the highest mortality risk as compared to the control sample—with a 3.61 and 3.37-fold risk for overall and cardiovascular mortality respectively in age and gender-adjusted model, followed by high, low, and moderate exposure groups. A similar pattern was observed in elderly schizophrenia patients but high exposure to antipsychotics was associated with the highest risk in both overall and cardiovascular mortality in elderly patients, with a 3.01, and 2.95-fold risk), respectively. In conclusion, the use of antipsychotics is beneficial to patients with schizophrenia, with recommended exposure levels being low to moderate. In elderly patients, high antipsychotic exposure was associated with the highest mortality risk. We should pay more attention to antipsychotic dosage in elderly schizophrenia patients.

Rapid and accurate detection of road cracks is of great significance for road health monitoring, but currently this work is mainly completed through manual site surveys. Low-altitude UAV remote sensing can obtain images with centimeter or even subcentimeter ground resolution, which provides a new efficient and economical approach for rapid crack detection. Nevertheless, crack detection networks face challenges such as edge blurring and misidentification due to the heterogeneity of road cracks and the complexity of the background. To address these issues, we propose a real-time edge reconstruction crack detection network (ERNet) which adopts multi-level information aggregation to reconstruct crack edges and improve the accuracy of segmentation between the target and background. To capture global dependencies across spatial and channel levels, we propose an efficient bilateral decomposed convolutional attention module (BDAM) that combines depth separable convolution and dilated convolution to capture global dependencies across spatial and channel levels. To enhance the accuracy of crack detection, we use a coordinate-based fusion module that integrates spatial, semantic, and edge reconstruction information. In addition, we propose an automatic measurement of crack information for extracting the crack trunk and its corresponding length and width. Experimental results demonstrate that our network achieves the best balance between accuracy and inference speed.

The sexual reproduction of ascomycetes is controlled by the mating-type(MAT) locus. (Pseudo)homothallic reproduction has been hypothesized based on genetic data from Hirsutella sinensis (Genotype #1 of Ophiocordyceps sinensis). In this study, the differential occurrence of the mating-type genes in the MAT1-1 and MAT1-2 idiomorphs, which constitute the genetic control of O. sinensis reproduction, was analyzed in 237 strains and 5 genomes of H. sinensis. The mating-type genes were differentially transcribed in H. sinensis Strain L0106, and the MAT1-2-1 transcript in H. sinensis Strain 1229 was alternatively spliced, with an unspliced intron I containing stop codons; these findings constitute O. sinensis reproduction controls at the transcriptional and coupled transcriptional-translational levels. The occurrence of the mating-type genes and a-/α-pheromone receptor genes differed among the 5 H. sinensis genomes. The differential occurrence and transcription of these genes are inconsistent with self-fertilization under (pseudo)homothallism but suggest self-sterility of H. sinensis, which therefore needs a mating partner to achieve sexual outcrossing under heterothallism or hybridization. Consistent occurrence and transcription of the mating-type genes of both the MAT1-1 and MAT1-2 idiomorphs have been reported in natural and cultivated Cordyceps sinensis, but these findings are insufficient to determine the reproduction mode(s) because of the co-occurrence of >90 fungal species and multiple genomically independent genotypes of O. sinensis. The mutant MAT1-1-1 and α-pheromone receptor transcripts in natural C. sinensis result in the N-terminus or middle-truncated proteins, with changes in hydrophobicity and secondary structures of the proteins, suggesting heterogeneous fungal source(s) of the proteins and hybridization reproduction.

This study aims to determine the protective effects of red seaweed Eucheuma cottonii (EC) ethanol extract on acute colitis disease in mice. Male BALB/c mice used for acute colitis disease model by induced 2.5% (w/v) of dextran sulfate sodium (DSS) for 7 days for all groups, except control group. The DSS-induced mice then treated by three different doses of EC extracts (0.35, 0.70, 1.75 g/kg body weight), curcumin (as a positive control, 0.10 g/kg), and a group was orally only by water. In 8^th day, the mice sacrificed and collected the blood, then measured the body weight, colon weight, and colon length. Disease activity index (DAI), pro-inflammatory such as tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6, as well as IL-10 as anti-inflammatory were measured. The results showed that after treatment for 7 days, EC extract protected the weight loss and decreased the colon weight per length ratio. In addition, EC extract also decreased the pro-inflammatory cytokines expression in serum and increased the IL-10. Moreover, EC extract protected the colonic tissue damage. According to this results, the EC ethanol extract might be can used for the treatment of colitis disease.

Green products have excellent potential for discovering and producing new medicinal products. In recent years, there is a growing interest towards the green synthesis of metal nanoparticles, particularly from plants sources. This eco-friendly approach was used in the recent research to biosynthesize zinc oxide nanoparticles (ZnO NPs) from Cissus antractica plant. The present study aims to examine the cell cytotoxicity, cell death, and pathways of apoptosis in lung cancer cells (A549) and inflammation properties treated with biosynthesized ZnO NPs. Additionally, synthe-sized ZnO nanoparticles were characterized using UV–vis spectroscopy, X-ray diffraction (XRD), Transmission electron microscopy (TEM), Fourier-transform infrared spectroscopy (FT-IR), and Energy-dispersive X-ray spectroscopy (EDS). The XRD and TEM analyses exhibited 31 nm as the size of synthesized nanoparticles, the pure crystal form of ZnO NPs, and the shape of the NPs as nearly spherical and hexagonal quartzite. The MTT assay used for cytotoxicity evaluation de-picted the significant toxic effect of CA-ZnONPs against the A549 lung cancer cells at concentra-tions up to 20 µg/mL than non-cancerous cells. Furthermore, we observed an elevated ROS level in cancer cells. These NPs also demonstrated dose-dependent ability to suppress colony for-mation and cell migration, which increases their potential as a lung cancer treatment. Further-more, The NPs formulation's ability to induce apoptosis in cancer cells was further supported by Hoechst and propidium iodide dye. Further, CA ZnO NPs increased the gene expression of BAX, Cyto-c, Caspase 3 and 9, but decreased the expression of Bcl-2, indicating that the nanoformulation triggered mitochondrial-mediated apoptosis. Besides, this study showed that NPs suppressed in-flammatory responses by subsequently decreasing reactive oxygen species (ROS) generation, downregulating the expression of the pro-inflammatory cytokines TNF-α, iNOS, COX-2, IL-6, IL-8, and NO. Moreover, the study's findings imply that Cissus antractica are a potential source with biosynthesize nanoparticles that can might be further investigated for the progress of an-ti-inflammatory and anti-cancer drugs with further study.

In order to understand the defense response of Sanchezia nobilis to biotic and abiotic stresses, this study investigated the phenomenon of S. nobilis under biotic of feeding by Achatina fulica, and measured the temporal changes of malondialdehyde content, catalase and peroxidase activities under biotic of feeding by Achatina fulica and abiotic stress of garden pruning conditions on S. nobilis. The results showed that: 1) S. nobilis was seriously damaged by A. fulica and the average hourly food intake of A. fulica is 0.22 ± 0.01 g. 2) Leaf cutting stimulation and snail feeding stress significantly affected the content of malondialdehyde, the activities of catalase and peroxidase in the leaves of S. nobilis. 3) Compared with the control group, the snail feeding and leaf cutting stimulated stress could induce the leaf of S. nobilis to synthesize more malondialdehyde under varying durations, and the activities of catalase and peroxidase were significantly enhanced in a short time, and the induction response of snail feeding biological stress was faster than that of leaf cutting stimulated abiotic stress. 4) After the defense enzyme was strengthened, the activities of catalase and peroxidase in the feeding stress group of snails showed a gradual downward trend, while the activities of catalase and peroxidase in the leaf cutting stimulation stress group showed a first upward and then downward trend, indicating that abiotic stress had more lasting effects on plants than biological stress. It can be seen that biotic stress and abiotic stress significantly affect the defense response of plants, and the defense-related substances malondialdehyde, catalase and peroxidase play an important role in plants' response to biotic and abiotic stress. This study has important production guidance significance for carrying out stress resistance breeding or cultivation management of garden plants.

Blockchain technology (BCT) has the potential for sustainable development, enhancing business efficiency, reducing costs, and strengthening data security. Despite its potential, adoption among small and medium-sized enterprises (SMEs) is low due to the need for significant changes in technology infrastructure and the challenge of interoperability. A cross-sectional survey was done with 226 Hong Kong SMEs. The PLS-SEM results highlighted favorable transformation conditions as the most critical factor for SMEs considering the adoption of BCT. These conditions address both internal and external readiness for adopting the disruptive strategy. Other contributing factors to BCT adoption include trust in BCT developers, perceived usefulness and ease of use, government support, and perceived security. The research results contributed to the literature on disruptive technology acceptance, adoption, transformation conditions, technology readiness, and SMEs’ technology adoption. Government-supported policies and initiatives can promote BCT adoption, including educational programs, case studies, and resources for readiness. Financial support and regulatory frameworks can further encourage adoption. BCT developers can demonstrate the value of their systems, effectively communicate potential ROI and cost savings, and provide user-friendly interfaces to increase SMEs’ intention to adopt BCT.

A Systemic Lupus Erythematosus (SLE) is a prototypical systemic autoimmune disease characterized by a complex interplay of genetic, molecular, and cellular factors. It is considered a multifactorial disorder influenced by genetic susceptibility, environmental triggers, and dysregulated immune responses. Understanding the molecular and cellular mechanisms driving SLE pathogenesis has been instrumental in developing targeted therapies to manage the disease and improve patient outcomes. In this essay, we will delve into the intricate molecular and cellular processes underlying SLE and examine the key lessons learned from human therapies.

In this study, we present a federated learning approach that combines a multi-branch network and the Oort client selection algorithm to improve the performance of federated learning systems. This method successfully addresses the significant issue of non-iid data, a challenge not adequately tackled by the commonly used MFedAvg method. Additionally, one of the key innovations of this research is the introduction of uniformity, a metric that quantifies the disparity in training time amongst participants in a federated learning setup. This novel concept not only aids in identifying stragglers but also provides valuable insights into assessing the fairness and efficiency of the system. Experimental results underscore the merits of the integrated multi-branch network with the Oort client selection algorithm and highlight the crucial role of uniformity in designing and evaluating federated learning systems.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

This study investigates the expression and prognostic value of TRIM6 in gliomas, the most prevalent primary brain and spinal cord tumors. Our results show that TRIM6 is predominantly overexpressed in glioma tissues and is associated with reduced overall survival, disease-specific survival, and progression-free interval. Furthermore, TRIM6 expression is correlated with WHO grade and primary treatment outcomes. Functional analysis indicates that interactions between cytokines and their receptors play a critical role in the prognosis of glioma patients. A protein-protein interaction network reveals 10 hub genes closely linked to cytokine-cytokine receptor interaction. In vitro experiments demonstrate that silencing TRIM6 impairs the proliferation, invasion, and migration of glioma cells, while overexpressing TRIM6 enhances these abilities. Additionally, TRIM6 expression is positively associated with the abundance of innate immune cells and negatively associated with the abundance of adaptive immune cells. In summary, TRIM6 is significantly upregulated in gliomas and linked to poor prognosis, making it a potential diagnostic and prognostic biomarker. TRIM6 plays a crucial role in promoting cell viability, clonogenic potential, migration, and invasion in glioma cells. It may regulate glioma progression by modulating cytokine-cytokine receptor interaction, leading to an inflammatory response and an imbalance in immunomodulation, thereby representing a potential therapeutic target.

Porcine circovirus type 2 (PCV2) is a small non-enveloped DNA virus that causes swine immunosuppression by inducing apoptosis in lymphocytes. The ORF3 protein plays a major role in PCV2-induced apoptosis in porcine kidney cells, but there is little information regarding this protein in PCV2-infected lymphocytes. In this study, hybridoma screening and epitope mapping were determined by using an indirect ELISA. The mAb 7D3 against ORF3 peptide (residues 35–65) of PCV2 were generated in this study. In vivo situation, the mAb 7D3 recognized ORF3 protein existed in PCV2-infected apoptotic porcine PBMCs. It is noteworthy that thimerosal interfered with the binding of mAb 7D3 to epitope and it was diminished by adding cysteine. Additionally, thimerosal interacting with cysteine-containing peptide was demonstrated by the PTI assay. Furthermore, thimerosal specifically interacted with the antigen-binding sites of mAb 7D3. This study suggested that thimerosal blockade the occlusion of the antigen-binding sites of mAb 7D3 to bind ORF3 peptide (residues 35–65) via thimerosal interacting with cysteine residues which should be located within the antigen-binding sites of mAb 7D3. Overall, the mAb 7D3 has been characterized and it will be a valuables tool in future studies of ORF3 function and the wider mechanism of cell apoptosis caused by PCV2 infection. Similarly, these techniques will be useful for applications in detecting thimerosal too.

The mangrove plant Acanthus ilicifolius and its relative, A. mollis, have been previously proved to possess diverse pharmacological effects. Therefore, evaluating the differentially expressed proteins of these species under tidal flooding stress is essential to fully exploit and benefit from their medicinal values. The roots of A. ilicifolius and A. mollis were exposed to 6 h of flooding stress per day for 10 days. The dry weight, hydrogen peroxide (H2O2) content, anatomical characteristics, carbon and energy levels, and two-dimensional electrophoresis coupled with MALDI-TOF/TOF MS technology were used to reveal the divergent flooding resistant strategies. A. ilicifolius performed better under tidal flooding stress, which was reflected in the integrity of the morphological structure, more efficient use of carbon and energy, and a higher percentage of up-regulated proteins associated with carbon and energy metabolism. A. mollis could not survive in flooding conditions for a long time, as revealed by incomplete cell structures of the roots, less efficient use of carbon and energy, and a higher percentage of down-regulated proteins associated with carbon and energy metabolism. Energy provision and flux balance played a role in the flooding tolerance of A. ilicifolius and A. mollis.

The creep behaviors of TA2 and R60702 at low and intermediate temperature were presented and discussed in this paper. Experimental results indicated that an apparent threshold stress exhibited in the creep deformation of R60702. Meanwhile, the primary creep phase was found as the main pattern in the room temperature creep behavior of TA2. Compared with exponential law, the power law has been proved to be a proper constitutive model in the description of primary creep phase. It also showed that θ projection method had its significant advantage in the evaluation of accelerated creep stage. Thus, a composite model which combined power law with θ projection method was applied in the creep curves evaluation at low and intermediate temperature. Based on the multiaxial creep deformation results, the model was modified and discussed. A linear relationship existed between composite model parameters and applied load. Finally, the creep life could be accurately predicted and the composite model method is suitable for application in low and intermediate temperature creep life analysis.

Pyrethroid pesticides (PYRs) as the third most widely used pesticides, following organophosphorus and carbamate pesticides, which are of significant importance in the analysis and detection of vegetables. However, the current pretreatment technology for PYRs confronts challenges of difficult separation and low enrichment efficiency, resulting in a cumbersome and time-consuming pretreatment process with poor selectivity. Here, a simple and efficient magnetic solid-phase extraction (MSPE) strategy was developed to simultaneously purify and enrich five PYRs in vegetables, with the magnetic covalent organic framework nanomaterial COF-SiO2@Fe3O4 as an adsorbent. The COF-SiO2@Fe3O4 was prepared by a simple solvothermal conditions method, using Fe3O4 as magnetic core, benzidine and 3,3,5,5-tetraaldehyde biphenyl as two building units. COF-SiO2@Fe3O4 could effectively capture the targeted PYRs by virtue of its abundant π-electron system and hydroxyl groups. The impact of various experimental parameters on extraction efficiency was investigated to optimize the MSPE conditions, including adsorbent amount, extraction time, elution solvent type and elution time. Subsequently, method validation was conducted under the optimal conditions in conjunction with gas chromatography-mass spectrometry (GC-MS). Within the range of 5.00–100 μg·kg-1 (1.00–100 μg·kg-1 for bifenthrin and 2.5–100 μg·kg-1 for fenpropathrin), the five PYRs exhibited a strong linear relationship, with determination coefficients ranging from 0.9990 to 0.9997. The limits of detection (LODs) were 0.3–1.5 μg·kg-1, and the limits of quantification (LOQs) were 0.9–4.5 μg·kg-1. The recoveries were 80.2–116.7% with relative standard deviations (RSDs) below 7.0%. Finally, COF-SiO2@Fe3O4, NH2-SiO2@Fe3O4 and Fe3O4 were compared as MSPE adsorbents for PYRs. The results indicated that COF-SiO2@Fe3O4 was an efficient and rapid selective adsorbent for PYRs. This method holds promising prospects for the determination of PYRs in real samples.

The threat of fine particulate matter concentration (PM2.5) is increasing globally, Tackling this issue requires an accurate understanding of its trends and drivers. The article investigates the PM2.5 characteristics of 285 prefecture-level cities in China from 2000-2018 based on multiscale geographically weighted regression(MGWR), and the results show that（1）previous studies based on classical MGWR models may be somewhat unstable, while MGWR can reflect the scale of influence of different variables on the dependent variable, and its regression results are more reliable.（2）PM2.5 is very sensitive to carbon emission(CE) factors, and there is a high degree of spatial heterogeneity, and the influence scale of location is the smallest among all variables, close to the municipal scale.（3）In 2000, the constant term all, IS, OFT, CE, and LT positively affect PM2.5, while GDP (jurisdiction) and UR negatively affect PM2.5; in 2010, the constant term all, GDP (jurisdiction), IS, OFT and LT positively affect PM2.5, while UR and CE negatively affect PM2.5; in 2018 the constant term all, IS, OFT and CE factors positively affect PM2.5, and GDP (jurisdiction), UR and LT negatively affect PM2.5.

Autonomous vehicles (AVs) may not only reduce parking demand, but also free up on-street parking spaces. From the perspective of bus priority, converting on-street parking lots into dedicated bus lanes can both ensure bus priority and accommodate non-bus traffic, helping to reduce congestion and pollution. In order to study the impact of conversion of on-street parking lots to bus lanes on traffic flow, a microscopic simulation framework based on VISSIM is proposed in this paper. Data was collected using the floating car method and video recording method to quantify the factors affecting traffic flow due to the conversion of on-street parking. The VISSIM simulation model was then calibrated. According to the proportion of the on-street parking lots into a bus lane, the on-street parking lots conversion simulation model of different scenarios was established, and the influence of different on-street parking lots conversion ratio on traffic efficiency and pollution emission was quantitatively analyzed. Finally, the optimization method based on bus lane network connectivity is discussed. The results indicate that: When the on-street parking lots conversion ratio is approximately 100%, bus speed increases by 21.03%, bus delays decrease by 14.27%, and bus parking instances decrease by 11.31%. Total emissions are negatively correlated with vehicle speed. As the conversion rate of on-street parking increases, the emissions of road segments and the entire road network gradually decrease. At a conversion ratio of 100%, the average total emissions for road segments have the highest reduction rate, decreasing by 4.12%. At a conversion ratio of 50%, the average emission total for the road network shows the largest reduction, falling by 2.88%.

Background and Objectives: Cancer as the second leading cause of death in the United States poses a huge healthcare burden. Barriers to access to advanced therapies influence the outcome of cancer treatment. In this study, we examined whether insurance types affect the quality of cancer clinical care regarding access to an important monoclonal antibody, ramucirumab. Materials and Methods: Data for 13,340 cancer patients with Purchased or Medicaid insurance from the All of Us Database were collected for this study. The Chi-square test of proportions was employed to determine the significance of patient cohort characteristics and ramucirumab usage between Purchased and Medicaid insurance groups. The independent t-test was utilized to assess the influences of other determinants on insurance types. Results: Cancer patients who are African American, with lower socioeconomic status, or with lower educational attainment are more likely to be insured by Medicaid. Analysis of survey questions demonstrated the relationship between income and education level with insurance type as Medicaid cancer patients were less likely to receive primary care and specialist physician access and more likely to request lower cost medications. In addition, those with Medicaid insurance were identified to have poorer access to expensive therapeutics like ramucirumab compared to those with Purchased insurance.  Conclusions: The inequities of the US healthcare system are observed for cancer patient care; access to physicians and therapeutics are highly varied and dependent on insurance types. Socioeconomic status determines insurance type, which unfortunately generates a significant impact on cancer treatment and disease outcome.

This paper aims the automatic ball balancers (ABBs) used in passive balancing devices for suppressing vibration of the eccentric rotor. The system model describes which equipped with a skew-mounted ABB with angular deviation. The dynamic equilibrium equations of the system are deduced from the perspective of three-dimensional (3D) dynamics. The results obtained are consistent with those derived from the Euler-Lagrange equations. It is exciting that the spatial dynamics method reveals the spatial geometric characteristic of dynamic balance positioning of the balls when the system is balanced with vibration suppression. The spatial property emerges the perpendicular line from each ball to the rotating spindle of the system must pass through the central axis of the orbit perpendicular to the ABB plane. This characteristic is a general rule that can be used to explain the phenomenon of the stable equilibrium positions of the balls in all previously studied cases.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

: Tunnel instability and lining integrity are intimately tied to the creep properties of the surrounding rock. The acquisition of rock mass creep parameters is critical in ascertaining the appropriate timing for lining construction. Nevertheless, creep tests on rock specimens conducted in a controlled setting cannot be straightforwardly extrapolated to rock mass creep analysis. This study performs laboratory-based creep tests on mudstone samples and establishes the corresponding creep constitutive model. Integration of a Mohr-Coulomb element with the Burgers model in series serves to characterise the yield creep behaviour of the rock mass. Additionally, the research outlines a series of 100 orthogonal experiments utilising randomised creep parameters, and formulates a GA-BP neural network inversion model. Employing long-term deformation measurements from the crown and sidewalls of the project site, this study deduces the creep parameters of the mudstone in the investigated tunnel section and examines the prolonged deformation traits of the surrounding rock. Drawing on the deformation traits of the surrounding rock and the forces impacting the primary support and lining structures, this paper evaluates the earliest and latest viable lining casting periods and pinpoints an optimal timing interval for lining implementation. The methodologies employed herein can serve as a benchmark for analogous endeavors internationally.

The external and internal structures of male and female adults of Culicoides grisescens Edwards, were examined with scanning electron microscope (SEM) and tissue section techniques. Specimens were collected from Qilian Mountain National Park in Qinghai Province, China. The ultrastructure and morphology of compound eyes, antenna, maxillary palpus, spermathecae, genitalia and other structural characteristics of both male and female adults of C. grisescens are described. Internal structures of the species are described, including histological sections of the digestive, nervous, respiratory, and reproductive systems. This paper provides visual and descriptive details for the systematic taxonomic study of Ceratopogonidae.

The quality of healthcare services is a very important indicator of social welfare in developed and emerging countries. Good quality levels are critical to ensuring patient safety, improving health outcomes, increasing patient satisfaction, optimizing resource utilization, and meeting regulatory requirements. The stable and sustainable operation of medical institutions urgently requires the establishment of a reliable and effective medical quality performance evaluation platform. However, the complexity of the evaluation process, involving numerous evaluators and the consideration of different subjective and objective criteria, poses significant challenges and essentially constitutes a group multi-criteria decision-making problem. This article uses the overall medical environment of the institution, medical service attitude, medical security, administrative service measures, etc. as measurement standards to deal with this challenge. It proposes a medical service quality measurement model suitable for both qualitative and quantitative analysis. In view of the heterogeneity of information, the two-tuple fuzzy language calculation method is introduced to enable evaluators to skillfully manage diverse information and effectively avoid potential information omission problems in the subjective evaluation integration process. The effectiveness and feasibility of the model were demonstrated by applying it to the operational framework of a medical institution in central Taiwan.

Effective prediction of wastewater treatment is beneficial for precise control of wastewater treatment processes. The nonlinearity of pollutant indicators such as COD and TP makes the model difficult to fit and has low prediction accuracy. The classical deep learning methods have been shown to perform nonlinear modeling. However, there are enormous numerical differences between multi-dimensional data in the prediction problem of wastewater treatment, such as COD above 3000 mg/L and TP around 30 mg/L. It will make current normalization methods challenging to handle effectively, leading to the training failing to converge and the gradient disappears or exploding. This paper proposes a multi-factor prediction model based on deep learning. The model consists of a combined normalization layer and a codec. The combined normalization layer combines the advantages of three normalization calculation methods: z-score, Interval, and Max, which can realize the adaptive processing of multi-factor data, fully retain the characteristics of the data, and finally cooperate with the codec to learn the data characteristics and output the prediction results. Experiments show that the proposed model can overcome data differences and complex nonlinearity in predicting industrial wastewater pollutant indicators and achieve better prediction accuracy than classical models.

This study was to investigate and assess salivary biomarkers as a means of diagnosing periodontitis. A total of 121 subjects were included: 28 periodontally healthy subjects, 24 with stage I, 24 with stage II, 23 with stage III, and 22 with stage IV periodontitis. Salivary proteins including active matrix metalloproteinase-8 (MMP-8), pro-MMP-8, total MMP-8, C-reactive protein, secretory immunoglobulin A and planktonic bacteria including Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola, Fusobacterium nucleatum, Prevotella intermedia, Porphyromonas nigrescens, Parvimonas micra, Campylobacter rectus, Eubacterium nodatum, Eikenella corrodens, Streptococcus mitis, Streptococcus mutans, Staphylococcus aureus, Enterococcus faecalis, and Actinomyces viscosus were measured from salivary samples. The performance of the diagnostic models was assessed by receiver operating characteristics (ROC) and area under the ROC curve (AUC) analysis. The diagnostic models were constructed based on the subjects’ proteins and/or microbial profiles, resulting in two potential diagnosis models, which achieved better diagnostic powers with an AUC value > 0.750 for the diagnosis of stage II, III, and IV periodontitis (Model PC-I; AUC: 0.796, sensitivity: 0.754, specificity: 0.712) and for the diagnosis of stage III and IV periodontitis (Model PC-II; AUC: 0.796, sensitivity: 0.756, specificity: 0.868). This study can contribute to screening for periodontitis based on salivary biomarkers.

Prevalence of overweight and obesity are escalating globally among the general population. However, there are limited evidence on the trends and prevalence of overweight /obesity in the military setting. Increased rates of injuries, low work productivity, incurred higher healthcare costs and prematurely discharge from service are consequences of overweight/obesity among the military. Therefore, we aimed to systematically describe the trends and prevalence of overweight and obesity in the military population, by regions and military service branches. Databases including PubMed, Scopus, Web of Science and Google Scholar were used. Inclusion criteria were military population (inclusive of all service branches) with BMI reported as the overweight/obesity indicator. Population related to military but not exclusively military personnel such as the retirees, the veterans and their dependents were excluded. From the 27 included studies, 13 were published between year 2010 to 2014 and half were conducted in the United States. Overall, studies showed increasing trend in the prevalence of overweight (30% to 50%) and obesity (2% to 30%); only one study showed a decreasing trend of 0.9% and 0.6% for the prevalence of overweight and obesity respectively. However, the rates of increment differed between countries, where Asian countries demonstrated lower overweight prevalence compared to the United States and the European countries. In conclusion, the military population is not protected from overweight and obesity. Interventions should be implemented to prevent overweight / obesity among the military personnel.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

China is a traditional agricultural country, and the integration of rural industries has become an essential policy direction for the current strategy of agricultural modernization in China. In recent years, the agricultural industrial chains across various regions of China have consistently expanded and extended. The multifunctionality of agriculture is continuously unearthed, and the principal entities managing agriculture have become increasingly diversified and have grown significantly. New industries and forms in agriculture emerge incessantly. Accurately and profoundly understanding the inherent features of the integration of industries in rural China, establishing a scientific and rational measurement index system in line with the current status and development goals of rural China, and employing appropriate measurement methods to assess its development level and process, is instrumental in comprehending the level of integrated development in various regions. This aids in identifying challenges in the developmental process and proposing targeted developmental strategies. Hence, this paper, rooted in the integration of rural industries, cross-industry, industry extension, industry agglomeration, and industry penetration, sets up an measurement index system. Using provincial panel data from 2011 to 2020, the paper measures the level of integrated development in rural industries across China and its 31 provinces. Based on the measurement results, further techniques such as kernel density estimation and Gini coefficient decomposition have been used to analyze the spatial distribution characteristics and dynamic trends of the integrated development of rural industries in China. Research indicates that during the sample period, the overall level of integrated development in rural industries in various provinces in China has shown an upward trend. Development among the eastern, central, and western regions is highly uneven, but this disparity has been gradually narrowing in recent years. Furthermore, the levels of integrated development in different provinces exhibit significant spatial agglomeration effects. The development level of neighboring regions significantly impacts the province's development status. In the process of integrated development of rural industries in China, there's a trend where "it's easier to downgrade than to upgrade," with very few regions achieving leapfrog development.

Keywords: mHealth; peritoneal dialysis; functionality; usability

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Oriental lacquer, a natural and renewable polymeric coating, comes from the sap produced by lacquer trees. For practical application, oriental lacquer must be refined to reduce excess water and enhance its quality. In this study, drying oils were blended with oriental lacquer during the refining process to prepare an oil-modified refined lacquer (OMRL). The type and adding amount (0, 10, and 20% by wt.) of drying oils for wood coatings utilization were evaluated. Rhus succedanea oriental lacquer is composed of 54.1% urushiols, 34.3% water, 7.2% plant gum, and 4.4% nitrogenous compounds, and drying oils, including tung oil (TO), linseed oil (LO), and dehydrated castor oil (DCO) were used as materials in this study. The results show that the drying oil acts as a diluent, which reduces the viscosity and enhances the workability and could shorten the touch-free drying time and speed up the hardened drying of the OMRL. The results also indicate that the hardness, mass retention, Tg, tensile strength, abrasion resistance, and lightfastness of OMRL films decrease as more drying oils are blended. Conversely, the bending resistance, elongation at break, impact resistance increase, and particularly, the gloss, is greatly improved through the blending of more drying oils. In conclusion, the LO-modified refined lacquer (RL) has the highest film gloss and the DCO-modified RL has the shortest drying time for coating; otherwise, the film properties are similar among the three types of drying oil.

With the realization of the Grand Canal's full water supply and the strong pursuit of green and low-carbon transportation in contemporary society, the value of the Grand Canal's water transport has been further affirmed, and its coordinated development with other transportation modes has become inevitable and important. This paper analyzes and combs through the characteristics, development status and existing problems of Grand Canal water transport and other transport modes in depth, and takes Jiangsu as an example. A collaboration model of Grand Canal water transport and other transport modes was built and their collaboration degree has been calculated. It is believed that the coordinated development of Grand Canal water transport and other transport modes can be greatly promoted via four aspects: optimizing the construction and governance of Grand Canal water transport, building an integrated management platform of transport modes, improving the integrated transport network structure, and promoting the deep integration of integrated shipping and tourism.

This work presents emission line flux and kinematic structure mapping based on IFU data of the planetary nebulae Abell 30 (A30). The IFU has a field of view (FoV) of 16" x 12.3" and was used to partially cover knots J1 and J2, and completely cover knots J3 and J4 of A30. Our emission line flux map shows recombination species C II, C III, He I, O II as well as forbidden line species [O III], [Ne III] and [Ne IV] of high excitation level are all distributed in different parts of the knots. The kinematic structure shows considerable variation in both the velocities and spatial locations of these knots with positive and negative velocity excursions from the systematic value. Forbidden line species [O III], [Ne III] are distributed in both knots J3 and J4 but they are travelling at different speeds in opposite directions. Despite variation in distribution of the species, the velocities of [Ne IV] and [O III] are similar and travelling in the same direction while the other species [Ne III], He I, and O II share similar velocity of 200kms−1 up in the opposite direction. The complexity of distribution and kinematic structure of the knots revealed in this work indicates a strong tendency towards the hypothesis of multiple triggering events in the past history of A30.

Base on building information modeling(BIM) plus with Robotic process automation (RPA) technology is rapid development in smart building operations and maintenance (O&M). RPA is a workflow-based automated execution tool that is particularly well suited for replacing manual execution of simple and repetitive tasks using computer systems. The use of RPA technology can saves man-hours and increases productivity, which is important for the automation of building operations and maintenance operations.. The BIM technology, as an advanced technology in the construction industry, it can provide new ideas and methods for building operation and maintenance based on its visualization characteristics. That’s integrating RPA with BIM technology which will enhance the digitalization and virtualization of smart building operation and management. In this article will first introduce the features of RPA and BIM technology and then discuss the technical roadmap for remote automated operation and maintenance of smart building equipment room to implemention a low-cost and high efficient building equipment room operation and maintenance solution.

Purpose: We evaluated the outcomes of fluid-gas exchange (FGE) for long-term flap closure of idiopathic macular hole (MH) after the inverted internal limiting (ILM) flap technique. Methods: We included eyes showed flap closure without complete MH closure, connection of the apart macular tissue, 1 month postoperatively after the inverted ILM flap technique. The eyes stayed at flap closure at 2 months postoperatively further underwent in-office FGE with 16% C3F8. Results: Among 10 eyes, 5 eyes (50%) showed flap closure at 2 months postoperatively further underwent FGE for complete MH closure while the remaining 5 eyes (50%) progressed directly at 2 months postoperatively. The improvement in vision of all flap closure from baseline was significant (p=0.015), with the mean baseline vision was 1.19 [Snellen equivalent (SE), 20/307] ± 0.52 logMAR and the mean final vision being 0.63 (SE, 20/85) ± 0.38 logMAR. The group that underwent FGE showed a better final vision of 0.45 (SE, 20/75) ± 0.23 logMAR than the group that didn’t undergo FGE (0.81 [SE, 20/128] ±0.44 logMAR). All eyes achieved complete MH closure, including the eyes that underwent FGE in a mean period of 5.60 months (range 3-10 months) after the inverted ILM flap technique. The eyes that underwent FGE achieved higher rate of foveal restoration [complete external limiting membrane (ELM): 80%; complete ellipsoid zone (EZ): 60%] than those that didn’t receive FGE (complete ELM: 40%; complete EZ: 10%). Conclusions: Eyes that underwent FGE accelerated complete MH closure and showed better final vision and fovea l restoration.

We propose a novel protocol to build a maximally entangled state based on controlled-not (CNOT) gates. In particular, we give detailed steps to construct maximally entangled state for 4-, 5-, and 6-qubit systems. The advantage of our method is the simple algebraic structure which can be realized via current experimental technology.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Both fibrosis and cirrhosis of the liver are the end results of most kinds of chronic liver damage and present a common but difficult clinical challenge throughout the world. The inhibition of the fibrogenic, proliferative, and migratory effects of hepatic stellate cells (HSCs) has become an experimental therapy for preventing and even reversing hepatic fibrosis. Furthermore, a complete understanding of the function of non-coding RNA-mediated epigenetic mechanisms in HSC activation may improve our perception of liver fibrosis pathogenesis. This review focuses on an evolving view of molecular mechanisms in which HSC activation by miR-29a signaling may moderate their profibrogenic phenotype, thus supporting the use of miR-29a agonists as a potential therapy for treating liver fibrosis in the future.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Sympatric distribution and temporal overlap of cryptic zooplankton species pose a challenge to the framework of the niche differentiation theory and the mechanisms allowing competitor coexistence. We applied the methods of phylogenetic analysis, DNA taxonomy and statistical analysis to study the temporal distribution patterns of cryptic B. calyciflorus species, an excellent model, in three lakes, and to explore the putative mechanisms for their seasonal succession and temporal overlap. The results showed that in the warm-temperate Lake Yunlong, B. fernandoi and B. calyciflorus s.s. underwent a seasonal succession, which was largely attributed to their differential adaptation to water temperature. In the subtropical Lake Jinghu, B. fernandoi, B. calyciflorus s.s. and B. dorcas exhibited both seasonal succession and temporal overlap. Seasonal successions were largely attributed to their differential adaptation to temperature, and temporal overlap resulted from their differential responses to algal food concentration. In the tropical Lake Jinniu, B. calyciflorus s.s. persisted throughout the year, and overlapped with B. dorcas for 5 months. Temporal overlap resulted from their differential responses to copepod predation. These results indicated that the temporal distribution pattern of cryptic B. calyciforus species and the mechanism allowing competitor coexistence vary with different climate zones.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Cadmium(Cd) is a highly toxic and cumulative environmental pollutant. Siderophores are heavy metal chelators with high tolerance to heavy metals such as Cd. Furthermore, ryegrass (Lolium perenne L.) has potential remediation capacity for soils contaminated by heavy metals. Consequently, using ryegrass alongside beneficial soil microorganisms that produce siderophores may be an effective means to remediate soils contaminated with Cd. In this study, Bacillus strains WL1210 and CD303 that were previously isolated from the rhizospheres of Nitraria tangutorum in Wulan and Peganum harmala L in Dachaidan, respectively, both arid sandy environments, were evaluated for heavy metal pollution mitigation. The results indicate that both strains of Bacillus exhibit favorable biological characteristics and stress resistance, and they are both producers of siderophores, which promote the growth of ryegrass under Cd stress.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

Molecular hydrogen (H2) has been shown to have antioxidant and anti-inflammatory activities that may reduce the development and progression of many diseases. In this study, Hydrogen-rich water (HRW) was obtained by reacting hybrid magnesium-carbon hydrogen storage materials with water. Then the effects of intake of HRW on the activities of xenobiotic-metabolizing enzymes, membrane transporters, and oxidative stress in rats were investigated. Rats were given HRW ad libitum for 4 weeks. Results showed that intake of HRW had no significant effect on the activities of various cytochrome P450 (CYP) enzymes (CYP1A1, 1A2, 2B, 2C, 2D, 2E1, 3A, 4A), glutathione-S-transferase and UDP-glucuronosyltransferase. Except for a slight lower plasma glucose concentration, intake of HRW had no effect on other plasma biochemical parameters in rats. P-Glycoprotein and multidrug resistance-associated protein (Mrp)2 protein expressions in liver were elevated after intake of HRW. However, HRW had no significant effects on glutathione, glutathione peroxidase, or lipid peroxidation in liver. Results from this study suggest that consumption of HRW may not affect xenobiotic metabolism or oxidative stress in liver. However, intake of HRW may increase the efflux of xenobiotics or toxic substances from the liver into bile by enhancing the expression of p-glycoprotein and Mrp2 protein.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Dry eye syndrome (DES) has become increasingly prevalent due to the prolonged use of digital devices in modern society. Individual supplementation with lutein or docosahexaenoic acid (DHA) demonstrated potential benefits for eye health. This study aimed to investigate the effects of lutein plus DHA complex supplementation on DES, visual function, and memory in healthy individuals. Thirty-four participants, aged 40~60 years, received lutein/DHA complex supplements (containing 10 mg free-form lutein, 200 mg DHA, 30 mg red algae extract (astaxanthin), phosphatidylserine, and vitamin A) for 12 weeks. Ophthalmological examinations and memory tests were carried out, and a questionnaire was administered at weeks 0, 6, and 12 of the study. After 12 weeks of the intervention, the tear break-up time had significantly increased, and intraocular pressure (IOP) had significantly decreased. This suggests that lutein/DHA complex supplementation may reduce the IOP and offer potential benefits for DES, as indicated by improved tear stability.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

The plethora of bio-functional compounds present in fermented alcoholic beverages like wine, as well as the valorization of bioactives from their wineries/breweries by-products like grape pomace and grape seed, has gained significant interest in the functional foods sector. Wine has always accompanied humanity, for religion or for health. For example, Christians are using wine in the “Holy Communion”, following what Jesus Christ himself did and said during the Last Supper, while the benefits of the wine consumption in moderation was embedded in all Mediterranean civilizations, as it is mentioned by the wise King-Prophet David in his psalms, but also by Hip-pocrates and other wise men, in a Greek-based philosophy of “All things in Moderation” (Cleobulus of Lindos; 6th century BC). In modern times, and after the outbreak of research on wine benefits since the 90’s, when the term “French Paradox” was introduced in the US public during a CBS show, recent evidence has outlined that these benefits are derived by the synergisms of its bio-functional compounds and their digestion-derived metabolites. Within this article, the proposed health benefits of moderate wine consumption, as a functional component of a balanced diet (i.e. the Mediterra-nean Diet), against inflammation-related chronic disorders, is thoroughly reviewed. The various bio-functional compounds of both wine and wineries’ by-products, such as their bioactive phe-nolics, unsaturated fatty acids, polar lipids, and dietary fibers, and their functional antioxidant, anti-inflammatory and antithrombotic health promoting properties are also thoroughly evaluated. The mechanisms of actions and synergism, by which the health benefits are elicited, are also ex-plored. Functional properties of non-alcoholic wine products are also introduced. Emphasis is also given to applications of wineries’ by-products bioactives, as ingredients of bio-functional foods, supplements and nutraceuticals. Limitations and future perspectives for this popular functional alcoholic beverage (wine) ant its rich in bioactives by-products are also addressed. .

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

Revealing the multidimensional value of cultivated land resources, improving calculation methods, and exploring their spatial distribution characteristics and influencing factors are crucial for the enhancement of natural resource accounting system and the protection of cultivated land resources. This study take Guangxi, China as an example and construct a comprehensive multidimensional value evaluation system for cultivated land resources at the county scale. The income capitalization method, substitution market method, and value equivalent correction method were applied to calculate the economic, social, and ecological values of cultivated land resources in 111 counties. Furthermore, spatial autocorrelation analysis was employed to study their distribution characteristics and influencing factors. The results show that: (1) The total value of cultivated land resources in Guangxi reach 19,729.2 billion yuan, and the average cultivated land value is 5.3511 million yuan/hm2, of which the ratio of economic, social and ecological values is about 6:1:2; (2) The value of cultivated land has a certain distribution pattern in the global space, and the average economic and social value show the spatial distribution patterns of "low in the west and high in the east" and "low in the northwest and high in the southeast" respectively."(3) There is a significant spatial clustering effect of all values of cultivated land resources in local space, with "high-high" and "low-low" clustering. (4) Economic development level is significantly negatively correlated with the ecological value of cultivated land, while has a significant positive correlation with social value; (5) Natural conditions, economic development and agricultural development approaches are the key factors affecting the value of cultivated land resources.

The rapid growth of network services, Internet of Things devices and online users on the Internet have led to an increase in the amount of data transmitted daily. As more and more information is stored and transmitted on the Internet, cybercriminals are trying to gain access to the information to achieve their goals, whether it is to sell it on the dark web or for other malicious intent. Through thorough literature study relating to the causes and issues that are brought from the security and privacy segment of wireless networks, it is observed that there are various factors that can cause the networks to be an insecure; especially factors that revolve around cybercriminals with their growing expertise and the lack of preparation and efforts to combat them by relevant bodies. The aim of this paper is to showcase major and frequent security as well as privacy issues in wireless networks along with specialized solutions that can assist the related organizations or the public to fathom how great of an impact these challenges can bring if every related stakeholder took a step in reducing them. Through this paper it is discovered that there are many ways these challenges can be mitigated, however, the lack of implementation of privacy and security solutions is still largely present due to the absence of practical application of these solutions by responsible parties in real world scenarios.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

[Introduction]: In the contemporary international financial environment, marked by intricate complexities and increasing uncertainties, the impact of exchange rate fluctuations on national economies has become increasingly significant. In this context, this study uses the Chinese economy as a case study to delve deeply into the interaction effects between macroprudential and monetary policies, analyzing how these policies jointly address economic instability. The aim is to offer new perspectives and strategies for stabilizing the global economic and financial landscape. [Methods]: This paper constructs an open-economy Dynamic Stochastic General Equilibrium (DSGE) model specifically tailored for China, incorporating Bayesian estimation and numerical simulation techniques. The study meticulously examines how macroprudential and monetary policies can be coordinated to achieve economic stability in response to exchange rate shocks. [Results]: The research finds that (1) targeted coordination of macroprudential and monetary policies towards asset prices and price levels can maintain stability under exchange rate shocks; (2) the effective implementation of such coordinated policies not only mitigates the fluctuations in asset prices due to exchange rate shocks but also enhances the level of societal welfare; (3) in terms of choosing an exchange rate regime, a managed floating rate system can prevent policy overlaps and conflicts that might occur in a floating rate system during the coordination of macroprudential and monetary policies, thus offering comparative advantages. [Discussion]: The findings underscore the importance of policy integration in a dynamic and complex global economic environment. They provide policy recommendations for China and other emerging market countries on how to effectively maintain economic stability through the synergistic interplay of macroprudential and monetary policies amid fluctuations in exchange rates and asset prices.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

The COVID-19 pandemic was associated with increases in some healthcare-associated infections. We investigated the impact of the pandemic on rates and molecular epidemiology of Clostridioides difficile infection (CDI) within one VA Hospital. We anticipated that the potential widespread use of antibiotics for pneumonia during the pandemic might increase CDI rates given that antibiotics are a major risk for CDI. Hospital data on patients with CDI and recurrent CDI (rCDI) were reviewed pre-COVID-19 pandemic (2015 to 2019) and during the pandemic (2020 - 2021). Restriction endonuclease analysis (REA) strain typing was performed on CD isolates recovered from stool samples collected from 10/2019 – 3/2022. CDI case numbers declined 43.2% in 2020 – 2021 compared to the annual mean over the previous 5 years. Stool test positivity rate was also lower during the COVID-19 pandemic (14.3% vs. 17.2%; P = 0.013). Although inpatient volume declined, rates of CDI among inpatients were reduced by 34.2% in 2020 – 2021. Mean monthly cases of rCDI also declined significantly after 2020 [3.38 (95% CI: 2.89 – 3.87) vs. 1.92 (95% CI: 1.27 – 2.56); P = <0.01]. Prior to the pandemic, REA group Y was the most prevalent CD strain among the major REA groups (27.3%). During the first wave of the pandemic from March 8, 2020, through June 30, 2020, there was an increase in the relative incidence of REA group BI (26.7% vs. 9.1%. After adjusting for CDI risk factors, a multivariable logistic regression model revealed that odds of developing an REA group BI CDI increased during the first pandemic wave (OR 6.41, 95% CI: 1.03 – 39.91) compared to the pre-pandemic period. In conclusion, the incidence of CDI and rCDI decreased significantly during the initial waves of the COVID-19 pandemic. In contrast, REA BI (Ribotype 027), a virulent, previously epidemic CD strain and frequently associated with hospital transmission and outbreaks, reappeared as a prevalent strain during the first wave of the pandemic.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

Deficiency of interleukin-1 receptor antagonist (DIRA) is a rare life-threatening autosomal recessive autoinflammatory disease with symptoms including but not limited to osteomyelitis, periostitis, and systemic inflammation. DIRA is developed from the loss-of-function mutations of IL1RN gene that encodes IL-1 receptor antagonist (IL-1RA), leading to the unchecked pro-inflammatory signaling and subsequent systemic inflammation. Thus, Anakinra as the recombinant IL-1RA has become the primary drug to treat DIRA. Although Anakinra has been effective for complete remission of DIRA, it also showed various side effects. To further address its efficacy and safety in treating DIRA, a review of literature was conducted in this study. We have identified 15 papers with 25 patients studied, making it possible to conduct reliable statistical analyses. The literature review found that continual treatment with Anakinra is effective to cause clinical remission of DIRA. Statistical analyses found that after the treatment with Anakinra, patients had improved Hemoglobin, Erythrocyte Sedimentation Rate, and C-reactive Protein levels. All known cytogenetic abnormalities were also analyzed to inform clinicians for genetic screening and rapid diagnosis of DIRA. The results from this study provide a comprehensive view for further improving the treatment of DIRA by Anakinra.

When analyzing user geospatial information through deep learning methods, it is typically necessary to annotate existing geospatial data. Currently, manual annotation methods are commonly employed, suffering from issues related to low efficiency and accuracy. This design is based on the TensorFlow deep learning framework and first realizes the BiLSTM+CRF+AGG deep learning model. Among the models, AGG is the aggregation layer, which is introduced to solve the problem of solid particle size equilibrium. Secondly, based on the characteristics of original data and professional data, an automatic labeling algorithm is proposed. The algorithm first preprocesses the acquired original data set and professional data set, The most valuable unlabeled data set which can make the training model converge quickly is selected from the original data set as the target data set. Sort the target data set based on preset rules and set annotation parameters for the sorted target data set. Based on the set annotation parameters, the corpus is synthesized and used as the annotation result. Thirdly, based on the active learning strategy, a manual annotation auxiliary scheme is proposed, and an Excel generation module that is convenient for manual annotation correction is designed and developed to further improve the efficiency and quality of annotation through iterative processing. The combination of the BiLSTM+CRF+AGG deep learning model and high-quality annotation can accurately identify non-standard, incomplete, or even incorrect geographical information entities. This annotation method has found successful practical application within the context of the research project and has been granted an invention patent.

Abundant of preparatory works have recognized that fluorescent sensors based on 8-aminoquinoline are popular tools to detect Zn2+ ions in environmental and biological applications. Along with these studies, researchers started to introduce a variety of carboxamido group into an 8-aminoquinoline molecule in forming 8-amidoquinoline derivatives. Therefore, this systematic review aims to introduce a general overview of the fluorophore 8-aminoquinoline as Zn2+ receptors and to provide comparisons of collected studies that related to 8-amidoquinoline derivatives as fluorophore probe of the sensor. According to PRISMA systematic searches strategy, 13 articles were analyzed for trends, research designs, results and discussion, subject samples, and remarks or conclusions. We found cross-sectional studies with four aspects in zinc sensing that have been targeted; binding studies via titration, detection's limit, interferences studies, and validation of the study. Hence, this paper also included assessments of those criteria and the trends of development of 8-amidoquinoline derivatives based-zinc fluorescent chemosensor. It also showed that most of the researches conducted in China. In conclusion, this study identified various research designs of fluorescent chemosensors based on 8-amidoquinoline prolong with the effectiveness and potential as a recognition probe to assist the detection of zinc. Hence, elucidation of those derivatives essential to be explored because more studies are needed to improve the sensing criteria of the zinc sensor

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

As e-commerce services and Internet technology have rapidly developed in recent years, many services and applications integrating these technologies can now be completed online. These commercial activities include online auctions, online ticketing and online payments. The client shops from the store online, andthe store delivers the goods to the client. The goods can be divided into digital products without entities, as well as actual entities. If it is a physical product, the store will deliver the package to the client through itslogistics. However, there have been many cases of switched goods purchased by clients in recent years. Earlier, some scholars proposed a security mechanism with a subliminal channel for E-cash and digital content. Only the sender and the receiver would know that the secret information was hidden in the signature. So the privacy of this subliminal message couldbe ensured. We apply this concept to the logistics environment to design secure logistics architecture with subliminal messages. The client can check the subliminal message of the received package, and know whether the package has been switched by malicious people. In addition, the proposed scheme also applies sensor technology;the client can check the GPS location, the temperature and humidity at any time during the delivery process. So intelligent logisticswouldthereby be achieved. This paper proposes an intelligent and secure package sensoring logistics system based on a subliminal channel. The proposed architecture uses the related mechanisms tosolve the problems of a logistics system, including how to achieve mutual authentication, data integrity, anti-switch package, package location and status tracing, resisting replay attacks, forward and backward secrecy, and non-repudiation issues.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

The integration of metal nanoparticles and solid carriers can achieve ideal stability, high load and good conductivity. In this work, copper nanoparticles (Cu NPs) were sequentially deposited on a cobalt metal-organic framework (Co-MOF) by bonding with exposed imino groups, followed by a reduction reaction to prepare a new Cu@Co-MOF composite. Cu@Co-MOF acts as a non-enzymatic electrochemical sensor to detect glucose (Glu) in an alkaline medium. The composite working electrode of Cu@Co-MOF/GCE (GCE = glassy carbon electrode) improves the electrocatalytic activity for Glu oxidation. Cu@Co-MOF/GCE shows excellent electrocatalytic performances in Glu concentration ranging 0.005~1.8 mmol∙L⁻¹ (mM): the sensitivities are 282.89 μA∙mM⁻¹∙cm⁻² in 0.005-0.4 mM Glu and 113.15 μA∙mM⁻¹∙cm⁻² in 0.4-1.8 mM Glu respectively with low detection limit of 1.6 μM (S/N = 3) and high selectivity and stability.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

Tea (Camellia sinenesis) is a health beneficial beverage and is also a source for extracting bioactive components such as theanine, tea polyphenols (TPP) and tea polysaccharides (TPS). TPS is a group of hetero-polysaccharides bounded with proteins. There were tests showing that TPS had various bioactivities, such as antioxidant, antitumors, antihyperglycemia, anti-inflammation and improving immunity. However, inconsistent results concerning chemical composition and bioactivity of TPS were published in recent years. The advances in chemical composition and bioactivities of TPS were reviewed in the present paper. The inconsistent and controversial results regarding composition and bioactivities of TPS were also discussed.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Wideband signal detection is an important problem in wireless communication. With the rapid development of deep learning (DL) technology, some DL-based methods are applied to wireless technology, and the effect is obvious. In this paper, we propose a novel neural network for multi-type signal detection that can locate signals and recognize signal types in wideband spectrogram. Our network utilizes the key point estimation to locate the rough centerline of signal region and identify class. Then, several regressions are carried out to achieve properties, such as local offset and border offsets of bounding box, which is further synthesized for a more fine location. Experimental results demonstrate that our method performs more accurate than other DL-based object detection methods previously employed for the same detection task. Specifically, our method runs obviously faster than existing methods, and abandons the anchor generation, which makes it more favorable for real-time applications.

With the fast development of the mobile Internet, the online platforms of social networks have rapidly been developing for the purpose of making friends, sharing information, etc. In these online platforms, users being related to each other forms social networks. Literature reviews have shown that social networks have community structure. Through the studies of community structure, the characteristics and functions of networks structure and the dynamical evolution mechanism of networks can be used for predicting user behaviours and controlling information dissemination. Therefore, this study proposes a deep community detection method which includes (1) matrix reconstruction method, (2) spatial feature extraction method and (3) community detection method. The original adjacency matrix in social network is reconstructed based on the opinion leader and nearer neighbors for obtaining spatial proximity matrix. The spatial eigenvector of reconstructed adjacency matrix can be extracted by an auto-encoder based on convolution neural network for the improvement of modularity. In experiments, four open datasets of practical social networks were selected to evaluate the proposed method, and the experimental results show that the proposed deep community detection method obtained higher modularity than other methods. Therefore, the proposed deep community detection method can effectively detect high quality communities in social networks.

This study proposes a mobile positioning method which adopts recurrent neural network algorithms to analyze the received signal strength indications from heterogeneous networks (e.g., cellular networks and Wi-Fi networks) for estimating the locations of mobile statioThis study proposes a mobile positioning method which adopts recurrent neural network algorithms to analyze the received signal strength indications from heterogeneous networks (e.g., cellular networks and Wi-Fi networks) for estimating the locations of mobile stations. The recurrent neural networks with multiple consecutive timestamps can be applied to extract the features of time series data for the improvement of location estimation. In practical experimental environments, there are 4,525 records, 59 different base stations, and 582 different Wi-Fi access points detected in Fuzhou University in China. The lower location errors can be obtained by the recurrent neural networks with multiple consecutive timestamps (e.g., 2 timestamps and 3 timestamps); the experimental results can be observed that the average error of location estimation was 9.19 meters by the proposed mobile positioning method with 2 timestamps.

Despite the expectation that social media use in the public sector contributes to enhancing government's transparency, few studies have been investigated whether social media use actually leads to more disclosure during environmental incidents in practice and how social media influence local governments and their officials' information disclosure. In this article, we model information disclosure during environmental incidents as an evolutionary game process between the central government and local government in social media context, and examine the internal mechanism that how social media influence the progress of information disclosure during environmental incidents. The findings indicate that social media plays an active constructive role in central-local government game relations. Specific- ally, social media can provides an efficient information channels for the central government supervise regional officials in environmental incidents, and thus improves its supervision efficiency, and it also provides an important means for internet mobilization and online-offline interaction by encouraging the public exchange information and express their views, and in turn forces local governments and their officials tend to disclosure ahead.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

Osteoarthritis (OA) has become one of the most common disabilities among elders, especially in female. Obesity and mechanical injury causing OA are attributed to joint loading, cartilage disintegration, bone loss and inflammation as well. Several strategies used for treatment OA including non-pharmacological and pharmacological. Fucoidan possesses several bioactivities such as antitumor, antiviral, anticoagulation, anti-obesity, and immunomodulation. This study aims to investigate the effect of fucoidan in surgery-induced OA on diet-induced obesity rats. OA was induced by anterior cruciate ligament transection and partial medial meniscectomy (ACLT+MMx). Male SD rats were fed high-fat diet (HFD) for 4 weeks to induce obesity before ACLT+MMx to induce OA. OA rats were administered with intragastric water or fucoidan in three different concentrations (32 mg/kg, 64 mg/kg, and 320 mg/kg) after the surgeries for 40 days with HFD. We observed that the swelling in knee joint was alleviated and hind paw weight distribution was rectified after feeding fucoidan, with no significant effect on weight gain and feed intake. Fucoidan administration indicated no significant variation on HDL-Cholesterol level, but reduced plasma triglycerides and LDL-Cholesterol level. In addition, weight-bearing tests showed improvement in the fucoidan-treated group. Our results suggested that fucoidan may improve meniscal/ligamentous injury and obesity-induced OA.

Celiac disease is an autoimmune disease triggered by oral ingestion of gluten, with certain gluten residues resistant to digestive tract enzymes. Within the duodenum, the remaining peptides incite immunogenic responses, including the generation of autoantibodies and inflammation, leading to irreversible damage. Our previous exploration unveiled a glutenase called Bga1903 derived from the Gram-negative bacterium Burkholderia gladioli. The cleavage pattern of Bga1903 indicated its moderate ability to mitigate the toxicity of pro-immunogenic peptides. The crystal structure of Bga1903, along with the identification of subsites within its active site, was determined. To improve its substrate specificity toward prevalent motifs like QPQ within gluten peptides, the active site of Bga1903 underwent site-directed mutagenesis according to structural insights and enzymatic kinetics. Among the double-site mutants, E380Q/S387L exhibits an approximately 38-fold increase in its specificity constant toward the QPQ sequence, favoring glutamines at the P1 and P3 positions compared to the wild type. Not only does the heightened specificity of E380Q/S387L improve the hydrolytic activity against pro-immunogenic peptides, but also holds this version of the enzyme as a promising candidate as an oral therapy enzyme for celiac disease.

The proportion of adults aged over 60 years in the world is expected to reach 20% by the year 2050. Ageing is associated with several physiological changes that increase the risk of malnutrition among this population. Malnutrition is characterized by deficiencies or insufficiencies of macro- and micronutrients. Malnutrition has detrimental effects on the health, wellbeing and quality of life of older adults. Nuts are rich in energy, unsaturated fats, protein, as well as other nutrients that provide a range of health benefits. While the effects of nuts on overnutrition have been studied extensively, very few studies have been specifically designed to understand the role of nuts in mitigating undernutrition in the elderly. Therefore, this review explores the potential role of nuts in improving the nutritional status of older adults who are at risk of undernutrition. Several properties of whole nuts, some of which appear important for addressing overnutrition, (e.g. hardness, lower-than-expected nutrient availability, satiety-enhancing effects) may limit their effectiveness as a food to combat undernutrition. However, we propose that modifications such as transforming the physical form of nuts, addressing the timing of nut ingestion, and introducing variety may overcome these barriers. This review also discusses the feasibility of using nuts to prevent and reverse undernutrition among older adults. We conclude with a recommendation to conduct clinical studies in the future to test this conceptual framework.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (<1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

This paper proposes a new approach for multi-focus images fusion based on Region Mosaicing on Contrast Pyramids (REMCP). A density-based region growing method is developed to construct a focused region mask for multi-focus images. The segmented focused region mask is decomposed into a mask pyramid, which is then used for supervised region mosaicking on a contrast pyramid. In this way, the focus measurement and the continuity of focused regions are incorporated and the pixel level pyramid fusion is improved at the region level. Objective and subjective experiments show that the proposed REMCP is more robust to noise than compared algorithms and can fully preserves the focus information of the multi-focus images meanwhile reducing distortions of the fused images.