End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

In this study, we present a federated learning approach that combines a multi-branch network and the Oort client selection algorithm to improve the performance of federated learning systems. This method successfully addresses the significant issue of non-iid data, a challenge not adequately tackled by the commonly used MFedAvg method. Additionally, one of the key innovations of this research is the introduction of uniformity, a metric that quantifies the disparity in training time amongst participants in a federated learning setup. This novel concept not only aids in identifying stragglers but also provides valuable insights into assessing the fairness and efficiency of the system. Experimental results underscore the merits of the integrated multi-branch network with the Oort client selection algorithm and highlight the crucial role of uniformity in designing and evaluating federated learning systems.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

Purpose: We evaluated the outcomes of fluid-gas exchange (FGE) for long-term flap closure of idiopathic macular hole (MH) after the inverted internal limiting (ILM) flap technique. Methods: We included eyes showed flap closure without complete MH closure, connection of the apart macular tissue, 1 month postoperatively after the inverted ILM flap technique. The eyes stayed at flap closure at 2 months postoperatively further underwent in-office FGE with 16% C3F8. Results: Among 10 eyes, 5 eyes (50%) showed flap closure at 2 months postoperatively further underwent FGE for complete MH closure while the remaining 5 eyes (50%) progressed directly at 2 months postoperatively. The improvement in vision of all flap closure from baseline was significant (p=0.015), with the mean baseline vision was 1.19 [Snellen equivalent (SE), 20/307] ± 0.52 logMAR and the mean final vision being 0.63 (SE, 20/85) ± 0.38 logMAR. The group that underwent FGE showed a better final vision of 0.45 (SE, 20/75) ± 0.23 logMAR than the group that didn’t undergo FGE (0.81 [SE, 20/128] ±0.44 logMAR). All eyes achieved complete MH closure, including the eyes that underwent FGE in a mean period of 5.60 months (range 3-10 months) after the inverted ILM flap technique. The eyes that underwent FGE achieved higher rate of foveal restoration [complete external limiting membrane (ELM): 80%; complete ellipsoid zone (EZ): 60%] than those that didn’t receive FGE (complete ELM: 40%; complete EZ: 10%). Conclusions: Eyes that underwent FGE accelerated complete MH closure and showed better final vision and fovea l restoration.

With the fast development of the mobile Internet, the online platforms of social networks have rapidly been developing for the purpose of making friends, sharing information, etc. In these online platforms, users being related to each other forms social networks. Literature reviews have shown that social networks have community structure. Through the studies of community structure, the characteristics and functions of networks structure and the dynamical evolution mechanism of networks can be used for predicting user behaviours and controlling information dissemination. Therefore, this study proposes a deep community detection method which includes (1) matrix reconstruction method, (2) spatial feature extraction method and (3) community detection method. The original adjacency matrix in social network is reconstructed based on the opinion leader and nearer neighbors for obtaining spatial proximity matrix. The spatial eigenvector of reconstructed adjacency matrix can be extracted by an auto-encoder based on convolution neural network for the improvement of modularity. In experiments, four open datasets of practical social networks were selected to evaluate the proposed method, and the experimental results show that the proposed deep community detection method obtained higher modularity than other methods. Therefore, the proposed deep community detection method can effectively detect high quality communities in social networks.

This study proposes a mobile positioning method which adopts recurrent neural network algorithms to analyze the received signal strength indications from heterogeneous networks (e.g., cellular networks and Wi-Fi networks) for estimating the locations of mobile statioThis study proposes a mobile positioning method which adopts recurrent neural network algorithms to analyze the received signal strength indications from heterogeneous networks (e.g., cellular networks and Wi-Fi networks) for estimating the locations of mobile stations. The recurrent neural networks with multiple consecutive timestamps can be applied to extract the features of time series data for the improvement of location estimation. In practical experimental environments, there are 4,525 records, 59 different base stations, and 582 different Wi-Fi access points detected in Fuzhou University in China. The lower location errors can be obtained by the recurrent neural networks with multiple consecutive timestamps (e.g., 2 timestamps and 3 timestamps); the experimental results can be observed that the average error of location estimation was 9.19 meters by the proposed mobile positioning method with 2 timestamps.

Cadmium(Cd) is a highly toxic and cumulative environmental pollutant. Siderophores are heavy metal chelators with high tolerance to heavy metals such as Cd. Furthermore, ryegrass (Lolium perenne L.) has potential remediation capacity for soils contaminated by heavy metals. Consequently, using ryegrass alongside beneficial soil microorganisms that produce siderophores may be an effective means to remediate soils contaminated with Cd. In this study, Bacillus strains WL1210 and CD303 that were previously isolated from the rhizospheres of Nitraria tangutorum in Wulan and Peganum harmala L in Dachaidan, respectively, both arid sandy environments, were evaluated for heavy metal pollution mitigation. The results indicate that both strains of Bacillus exhibit favorable biological characteristics and stress resistance, and they are both producers of siderophores, which promote the growth of ryegrass under Cd stress.

Accurate estimation of chlorophyll content in wheat leaves can not only reflect its growth and nutritional status, but also provide a scientific basis for field management. In order to evaluate the potential of hyperspectral data to estimate the chlorophyll content of wheat leaves, this study focused on the leaves of wheat at the flag-picking stage, flowering stage, grain filling stage and maturity stage. Based on the framework of five vegetation indexes, the spectral index was con-structed by using the combination of 400-1000nm bands, and the correlation between the con-structed spectral index and the measured chlorophyll value was analyzed, and the optimal spectral index was screened by the correlation coefficient. Based on the optimal spectral index, polynomial regression, random forest, decision tree and artificial neural network were used to establish the estimation model of chlorophyll value, and the optimal model for estimating the chlorophyll value of wheat leaves was selected through model evaluation. The results showed that the five optimal spectral indices at the four growth stages were mainly composed of red band, red edge band and near-infrared band, and the five optimal spectral indices at the grain filling stage had the highest correlation with the chlorophyll value, and the absolute value of the cor-relation coefficient was greater than 0.73, the accuracy of the estimation model established in the four growth stages was different, and the estimation accuracy of the flag stage was the best, with R² and RMSE of 0.79 and 2.63, respectively. The above results show that hyperspectral data is suitable for estimating the chlorophyll value of wheat leaves, and the PR model of flag picking period can be used as the optimal model for estimating the chlorophyll value of wheat leaves.

To generate a probability density function (PDF) for fitting probability distributions of real data, this study proposes a deep learning method which consists of two stages: (1) a training stage for estimating the cumulative distribution function (CDF) and (2) a performing stage for predicting the corresponding PDF. The CDFs of common probability distributions can be adopted as activation functions in the hidden layers of the proposed deep learning model for learning actual cumulative probabilities, and the differential equation of trained deep learning model can be used to estimate the PDF. To evaluate the proposed method, numerical experiments with single and mixed distributions are performed. The experimental results show that the values of both CDF and PDF can be precisely estimated by the proposed method.

The objective of this study was to synthesize 9-/13-position substituted berberine derivatives and evaluated their cytotoxic and photocytotoxic effects against three human cancer cell lines. Among all the synthesized compounds, 9-O-dodecyl- (5e), 13-dodecyl- (6e) and 13-O-dodecyl-berberine (7e) exhibited stronger growth inhibition against three human cancer cell lines, (HepG2, HT-29 and BFTC905), in compare with structurally related berberine (1). These three compounds also showed the photocytotoxicity in human cancer cells in a concentration-dependent and light dose-dependent manner. Through flow cytometry analysis, we found out a lipophilic group at 9-/13-position of berberine may have facilitated its penetration into test cell and hence enhanced its photocytotoxicity on human liver cancer cell HepG2. Further, in cell cycle analysis, 5e, 6e and 7e induced HepG2 cells to arrest at S phase and caused apoptosis upon irradiation. In addition, photodynamic treatment of berberine (1) and its derivatives 5e, 6e and 7e again showed a significant photocytotoxic effects on HepG2 cells, induced remarkable cell apoptosis, greatly increased intracellular ROS level and the loss of mitochondrial membrane potential. These results over and again confirmed that berberine derivatives 5e, 6e and 7e greatly enhanced photocytotoxicity. Taking together, the test data led us to conclude that berberine derivatives with a dodecyl group at 9-/13-position could be great candidates for the anti-liver cancer medicines developments.

Background: Cancer patients require cross-professional care during the diagnosis and treatment periods. Therefore, methods for effectively carrying out case management are essential to tumor care. Purpose: To investigate the effects of using the community software LINE Official Ac-count on oral cancer case management. Methods: An experimental design was used; 100 patients were randomly divided into two groups by using a computer-generated random number table. The experimental group used LINE Official Account, which gave them self-care information, timely messages, and one-on-one health-care consultations. The control group followed standard healthcare practices. Results: The experimental group was satisfied with the self-care information provided by LINE Official Account (86.9%), patients regularly checked the self-care information (89.4%) and would check the information when receiving a push notification (54.3%). Ten patients used the one-on-one consultation(20.0%). LINE Official Account had a significant effect on the rate of participation in support groups. Generalized estimating equations indicated a significant difference between the two groups regarding the overall quality of life over 7 days (P = 0.023). Conclusion: Community software applications used in oncological case management can improve self-management and empower, also enable tracking of long-term follow-up effectiveness and reinforce the case manager’s role as a family therapist. Therefore, this study recommends that case manager systems be incorporated into mobile applications to increase the sustainable management, accessibility, effectiveness, and satisfaction of oncological management systems. This study also provides the value of Sustainable Development Goals (SDGs) with Good Health and Well-being, and decreased social withdrawal among patients with oral cancer.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

To address the problems of poor recognition, low detection accuracy, a large number of model parameters and computation, complex network structure, and unfavorable portability to embedded devices in traditional tennis ball detection algorithms, this study proposes a lightweight tennis ball detection algorithm YOLOv5s-Z based on Robomater EP. The main work is as follows: Firstly, constructing lightweight G-Backbone and G-Neck network layers to reduce the number of parameters and computation of the network structure. Secondly, the convolutional coordinate attention is incorporated in G-Backbnone to embed the location information into the channel attention, which makes the network obtain the location information in a larger area through multiple convolutions and enhances the expression ability of the mobile network learning features. In addition, the Concat module in the original feature fusion is modified into a weighted bi-directional feature pyramid W-BiFPN with settable learning weights to improve the feature fusion capability and achieve efficient weighted feature fusion and bi-directional cross-scale connectivity. The EIOU loss is introduced to split the influence factor of aspect ratio and calculate the length and width of the target frame and anchor frame respectively, combined with Focal-EIOU Loss to solve the problem of imbalance between difficult and easy samples. The activation function Meta-ACON is introduced to achieve an adaptive selection of whether to activate the neurons and improve the detection accuracy. Finally, the experimental results show that compared with the original algorithm, the YOLOv5s-Z algorithm reduces the number of parameters and computation by 42$\%$ and 44$\%$, the model size by 39$\%$, and 2$\%$ improvement in average accuracy mean value, which verifies the effectiveness of the improved algorithm and the light weight of the model to meet the deployment requirements of embedded devices, and adapts Robomaster EP for accurate detection and real-time recognition of tennis balls.

Autonomous aerial refueling technology is an effective solution to extend flight duration of unmanned aerial vehicles, and also a great challenge due to its high risk. For autonomous probe-and-drogue refueling tasks, relative navigation to provide relative position between the receiver aircraft and the refueling drogue is the first and essential step, and vision-based method is the most frequently used. A new monocular vision navigation sensor with image processing strategy consisting of the drogue detection method and the tracking method is developed for autonomous aerial refueling in this paper. In the drogue detection method, thresholding and mathematical morphology method are adopted to eliminate image interference, and contours extraction method is applied to obtain all contours, which are then subsequently checked to achieve target contour of drogue. In the tracking method, a rectangle of interest (ROI) of current frame image is determined by positioning results of last frame, and then processed by the previous drogue detection method. Finally, the proposed image processing strategy in monocular vision navigation sensor is validated using real flight images, which are captured from an autonomous aerial refueling testbed using a micro six-rotor aircraft as receiver aircraft.

Praeruptorin A(PA), a naturally existing pyranocumarin, is isolated from the dried root of Peucedanum praeruptorum Dunn. So far the anti-cancer effect and molecular mechanism behind Praeruptorin A action in human cervical cancer HeLa cells remain unknown. In the present study, we find that PA reduces cell proliferation and colony formation of human cervical cancer HeLa cells through inducing cell cycle arrest at G0/G1 phase. PA-upregulated p21 and p27 proteins are observed, accompanied with inhibition of cyclin D1 and S-phase kinase-associated protein 2(Skp2) proteins expression. PA could significantly inhibit migration and invasion of human HeLa cells. Meanwhile, PA significantly reduces invasive protein expression of matrix metalloproteinase-2 (MMP-2), and increases protein expression of tissue inhibitor of metalloproteinase-2 (TIMP-2). PA is observed to possess the capacity in suppressing ERK1/2 activation. PD98059 (ERK specific inhibitor) significantly enhances PA-induced downregulation of MMP-2 expression, and upregulation of TIMP-2 expression. Moreover, we found that PA treatment notably inhibits 12-O-tetradecanoylphorbol-13-acetate(TPA)-upregulated ERK1/2 activation, MMP-2 expression, cellular migration and invasion in human HeLa cells. Taken together, these findings are the first to demonstrate the anti-cancer activity of PA, which may act as a promising therapeutic agent for the treatment of human cervical cancer.

Nanoparticle (NP)–surfactants formed by the self-assembly of NPs and end-functionalized polymers at the hydrophilic/hydrophobic interface have a wide range of applications in many fields. In this study, the influence of density of amino groups, NPs dimension and pH on the interaction between end-functionalized polymers and NPs were extensively investigated. Single amino-terminated polystyrene (PS-NH2, Mw ≈ 0.6k, 2.5k, 3.5k, 3.9k) and diamino-terminated polystyrene (H2N-PS-NH2, Mw ≈ 1.1k, 2.8k) were prepared using reversible addition–fragmentation chain transfer polymerization and atom transfer radical polymerization. NPs with different dimensions (zero-dimensional carbon dots with sulfonate groups, one-dimensional cellulose nanocrystals with sulfate groups and two-dimensional graphene with sulfonate groups) in the aqueous phase were added into the toluene phase containing the aminated PS. The influence of pH and the molecular weight of amino-terminated PS on the interfacial tension between two phases were investigated. The results indicate that aminated PS exhibited the strongest interfacial activity after compounding with sulfonated NPs at a pH of 3. Terminating PS with amino groups on both ends leads to better performance in in reducing the water/toluene interfacial tension than modifying the molecular structure of PS on a single end. The dimension of sulfonated NPs also contributed significantly to the reduction of the water/toluene interfacial tension. The minimal interfacial tension was 4.49 mN/m after compounding PS-NH2 with sulfonated zero-dimensional carbon dots. Molecular dynamics simulation on the evolution of the water/toluene interface in the presence of sulfonated carbon dots and H2N-PS-NH2 revealed that these opposite charged substances moved towards the interface in an extreme short time and orderly assembled in a thermodynamic equilibrium.

Pastes containing reduced graphene oxide (rGO) and LiCl-Mn(NO3)2·4H2O are screen-printed on a carbon cloth substrate and then calcined using a nitrogen atmospheric-pressure-plasma jet (APPJ) for conversion into rGO-LiMnOx nanocomposites. The APPJ processing time is within 300 s. RGO-LiMnOx on carbon cloth is used to sandwich H2SO4, LiCl, or Li2SO4 gel electrolytes to form hybrid supercapacitors (HSCs). The areal capacitance, energy density, and cycling stability of the HSCs are evaluated using electrochemical measurement. The Li2SO4 gel electrolyte HSC exhibits the highest areal capacitance and energy density but lower cycling stability. By contrast, the H2SO4 gel electrolyte HSC exhibits better cycling stability but lower areal capacitance and energy density.

Patients with schizophrenia had higher mortality risks and the role of antipsychotic medications remained inconclusive. In an aging society, elderly schizophrenia patients warrant increased attention. In this study, we aimed to explore medication dosage associations with mortality in schizophrenia patients, using Taiwan's national healthcare database from 2010 to 2014, with 102,964 patients with schizophrenia, and a subgroup of 6,433 elderly patients, compared to an age- and gender-matched control group. The findings revealed that schizophrenia patients with no antipsychotic exposure had the highest mortality risk as compared to the control sample—with a 3.61 and 3.37-fold risk for overall and cardiovascular mortality respectively in age and gender-adjusted model, followed by high, low, and moderate exposure groups. A similar pattern was observed in elderly schizophrenia patients but high exposure to antipsychotics was associated with the highest risk in both overall and cardiovascular mortality in elderly patients, with a 3.01, and 2.95-fold risk), respectively. In conclusion, the use of antipsychotics is beneficial to patients with schizophrenia, with recommended exposure levels being low to moderate. In elderly patients, high antipsychotic exposure was associated with the highest mortality risk. We should pay more attention to antipsychotic dosage in elderly schizophrenia patients.

The first appearance of viruses can date back to the late last century. As an effective form of malware, viruses reside in the permanent storage of target hosts. Before a virus can execute, that must load into memory from the persistent storage included in the associated file. Due to the reliable destructive power of viruses, many mechanisms have been developed to defend computer systems against these hazardous threats. Antivirus software is one of the most famous and popular among these mechanisms. Most antivirus software uses static analysis (signature-based) technology on files stored in permanent storage, such as hard disks or USB flashes, to detect viruses hidden in files. Fileless malware was developed to enhance the survivability of malware by circumventing detection. Fileless malware only exists in the target hosts’ memory, not files. Antivirus software cannot even access the fileless malware code, much less analyze it, since it may be performed in memory directly without needing to load it from a disk. As a result, it is difficult for an antivirus engine to defend a system against fileless malware attacks. This paper proposes a kernel-based solution called Check-on-Execution (CoE) to detect fileless malware on a Linux system. When a program is going to execute a piece of code in a writable and executable memory area of a process, CoE suspends the code execution first. Coe retrieves the code from memory, packs the code with an ELF header to create an ELF file, and uses VirusTotal to check the file to prevent a Linux system from executing fileless malware. Experimental results show that CoE noticeably enhances the ability of a Linux system to defend itself again fileless malware. CoE is also suitable for protecting a system from shell code injection attacks, such as buffer and heap overflow attacks. It is capable of handling even packed malware. But in this paper, we only focus on fileless malware.

Abstract: The traditional model of closed circuit ball milling systems has been used for several decades, however, if the classifier of the closed circuit ball mill system performs the duties of both pre-classification and check-classification, the characterization error of the traditional model is large. To address this problem, a new model is obtained by modifying and supplementing the traditional one. The most important feature of the new model compared to the traditional model is that the circulating load is considered to be the fresh feed for the entire system rather than the ball mill. The error between the slurry level height calculated using the traditional model and the actual is 52.31%, which is 13.77 times higher than that of the new model. When the relative capacity varies greatly, that of the ball mill calculated by the traditional model fluctuates between 0.95 and 1.15, while the new model is 0.6 to 1.4. The new model has a higher accuracy than the traditional model in characterizing the production status of the grinding system, which is of some significance for industrial production.

Rapid and accurate detection of road cracks is of great significance for road health monitoring, but currently this work is mainly completed through manual site surveys. Low-altitude UAV remote sensing can obtain images with centimeter or even subcentimeter ground resolution, which provides a new efficient and economical approach for rapid crack detection. Nevertheless, crack detection networks face challenges such as edge blurring and misidentification due to the heterogeneity of road cracks and the complexity of the background. To address these issues, we propose a real-time edge reconstruction crack detection network (ERNet) which adopts multi-level information aggregation to reconstruct crack edges and improve the accuracy of segmentation between the target and background. To capture global dependencies across spatial and channel levels, we propose an efficient bilateral decomposed convolutional attention module (BDAM) that combines depth separable convolution and dilated convolution to capture global dependencies across spatial and channel levels. To enhance the accuracy of crack detection, we use a coordinate-based fusion module that integrates spatial, semantic, and edge reconstruction information. In addition, we propose an automatic measurement of crack information for extracting the crack trunk and its corresponding length and width. Experimental results demonstrate that our network achieves the best balance between accuracy and inference speed.

The sexual reproduction of ascomycetes is controlled by the mating-type(MAT) locus. (Pseudo)homothallic reproduction has been hypothesized based on genetic data from Hirsutella sinensis (Genotype #1 of Ophiocordyceps sinensis). In this study, the differential occurrence of the mating-type genes in the MAT1-1 and MAT1-2 idiomorphs, which constitute the genetic control of O. sinensis reproduction, was analyzed in 237 strains and 5 genomes of H. sinensis. The mating-type genes were differentially transcribed in H. sinensis Strain L0106, and the MAT1-2-1 transcript in H. sinensis Strain 1229 was alternatively spliced, with an unspliced intron I containing stop codons; these findings constitute O. sinensis reproduction controls at the transcriptional and coupled transcriptional-translational levels. The occurrence of the mating-type genes and a-/α-pheromone receptor genes differed among the 5 H. sinensis genomes. The differential occurrence and transcription of these genes are inconsistent with self-fertilization under (pseudo)homothallism but suggest self-sterility of H. sinensis, which therefore needs a mating partner to achieve sexual outcrossing under heterothallism or hybridization. Consistent occurrence and transcription of the mating-type genes of both the MAT1-1 and MAT1-2 idiomorphs have been reported in natural and cultivated Cordyceps sinensis, but these findings are insufficient to determine the reproduction mode(s) because of the co-occurrence of >90 fungal species and multiple genomically independent genotypes of O. sinensis. The mutant MAT1-1-1 and α-pheromone receptor transcripts in natural C. sinensis result in the N-terminus or middle-truncated proteins, with changes in hydrophobicity and secondary structures of the proteins, suggesting heterogeneous fungal source(s) of the proteins and hybridization reproduction.

This study aims to determine the protective effects of red seaweed Eucheuma cottonii (EC) ethanol extract on acute colitis disease in mice. Male BALB/c mice used for acute colitis disease model by induced 2.5% (w/v) of dextran sulfate sodium (DSS) for 7 days for all groups, except control group. The DSS-induced mice then treated by three different doses of EC extracts (0.35, 0.70, 1.75 g/kg body weight), curcumin (as a positive control, 0.10 g/kg), and a group was orally only by water. In 8^th day, the mice sacrificed and collected the blood, then measured the body weight, colon weight, and colon length. Disease activity index (DAI), pro-inflammatory such as tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6, as well as IL-10 as anti-inflammatory were measured. The results showed that after treatment for 7 days, EC extract protected the weight loss and decreased the colon weight per length ratio. In addition, EC extract also decreased the pro-inflammatory cytokines expression in serum and increased the IL-10. Moreover, EC extract protected the colonic tissue damage. According to this results, the EC ethanol extract might be can used for the treatment of colitis disease.

Time-modulated sparse circular array (TMSCA) with elements uniformly excited is designed and synthesized in this paper. By utilizing rotationally symmetric structure, the array geometry and the time modulation of the TMSCA is presented, and the radiation patterns in frequency domain are formulated. In order to achieve the desired radiation pattern at the operating frequency and suppress the sideband radiation, the synthesis problem is established and solved by the proposed harmony search-convex programming (HS-CP) algorithm in two dependent optimizations. Two designs are presented, and the numerical results indicate that the TMSCA with rotationally symmetric structure has the advantages of designing time-modulated sparse arrays with superior performance.

In order to understand the defense response of Sanchezia nobilis to biotic and abiotic stresses, this study investigated the phenomenon of S. nobilis under biotic of feeding by Achatina fulica, and measured the temporal changes of malondialdehyde content, catalase and peroxidase activities under biotic of feeding by Achatina fulica and abiotic stress of garden pruning conditions on S. nobilis. The results showed that: 1) S. nobilis was seriously damaged by A. fulica and the average hourly food intake of A. fulica is 0.22 ± 0.01 g. 2) Leaf cutting stimulation and snail feeding stress significantly affected the content of malondialdehyde, the activities of catalase and peroxidase in the leaves of S. nobilis. 3) Compared with the control group, the snail feeding and leaf cutting stimulated stress could induce the leaf of S. nobilis to synthesize more malondialdehyde under varying durations, and the activities of catalase and peroxidase were significantly enhanced in a short time, and the induction response of snail feeding biological stress was faster than that of leaf cutting stimulated abiotic stress. 4) After the defense enzyme was strengthened, the activities of catalase and peroxidase in the feeding stress group of snails showed a gradual downward trend, while the activities of catalase and peroxidase in the leaf cutting stimulation stress group showed a first upward and then downward trend, indicating that abiotic stress had more lasting effects on plants than biological stress. It can be seen that biotic stress and abiotic stress significantly affect the defense response of plants, and the defense-related substances malondialdehyde, catalase and peroxidase play an important role in plants' response to biotic and abiotic stress. This study has important production guidance significance for carrying out stress resistance breeding or cultivation management of garden plants.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Findings from studies of prenatal exposure to pesticides and adverse birth outcomes have been equivocal so far. We examined prenatal exposure to agricultural pesticides in relation to preterm birth and term low birthweight, respectively, in children born between 1998 and 2010 randomly selected from California birth records. We estimated residential exposures to agriculturally applied pesticides within 2 km of residential addresses at birth by pregnancy trimester for 17 individual pesticides and 3 chemical classes (organophosphates, pyrethroids, and carbamates). Among maternal addresses located within 2 km of any agricultural pesticide application, we identified 24,693 preterm and 220,297 term births, and 4,412 term low birthweight and 194,732 term normal birthweight infants. First or second trimester exposures to individual pesticides (e.g., glyphosates, paraquat, imidacloprid) or exposures to 2+ pesticides in the three chemical classes were associated with small increases (3-7%) in risk for preterm birth; associations were stronger for female offspring. We did not find associations between term low birthweight and exposures to pesticides other than for myclobutanil (OR: 1.11; 95% CI: 1.04-1.20) and possibly pyrethroids as a class. Our improved exposure assessment revealed that first and second trimester exposures to pesticides were associated with preterm delivery but few affected term low birthweight.

Blockchain technology (BCT) has the potential for sustainable development, enhancing business efficiency, reducing costs, and strengthening data security. Despite its potential, adoption among small and medium-sized enterprises (SMEs) is low due to the need for significant changes in technology infrastructure and the challenge of interoperability. A cross-sectional survey was done with 226 Hong Kong SMEs. The PLS-SEM results highlighted favorable transformation conditions as the most critical factor for SMEs considering the adoption of BCT. These conditions address both internal and external readiness for adopting the disruptive strategy. Other contributing factors to BCT adoption include trust in BCT developers, perceived usefulness and ease of use, government support, and perceived security. The research results contributed to the literature on disruptive technology acceptance, adoption, transformation conditions, technology readiness, and SMEs’ technology adoption. Government-supported policies and initiatives can promote BCT adoption, including educational programs, case studies, and resources for readiness. Financial support and regulatory frameworks can further encourage adoption. BCT developers can demonstrate the value of their systems, effectively communicate potential ROI and cost savings, and provide user-friendly interfaces to increase SMEs’ intention to adopt BCT.

A Systemic Lupus Erythematosus (SLE) is a prototypical systemic autoimmune disease characterized by a complex interplay of genetic, molecular, and cellular factors. It is considered a multifactorial disorder influenced by genetic susceptibility, environmental triggers, and dysregulated immune responses. Understanding the molecular and cellular mechanisms driving SLE pathogenesis has been instrumental in developing targeted therapies to manage the disease and improve patient outcomes. In this essay, we will delve into the intricate molecular and cellular processes underlying SLE and examine the key lessons learned from human therapies.

The molecular clusters ((HO)3Si-O-Si(OH)3, and (HO)3Al-O-Si(OH)3 ) representative of aluminosilicate mineral surface were employed to study the dissolution of aluminosilicate in acidic condition via density functional theory with the M06-2X+G(d,p) methodology. The surface termination sites (Si and Al) were both tetra-coordinated and the terminal oxygen was protonated in acidic condition. In the dissolution reaction, the calculated barrier height of the six-membered ring transition state complex containing two water molecules was predicted to be lower than that of four-membered ring transition state complex containing one water molecule. In addition, the calculated barrier heights for Al-terminated sites were predicted to be lower than those for the Si-terminated sites, suggesting that breaking the Al-O bond is easier than Si-O bond in the aluminosilicate mineral surface; the barrier heights of the surface termination sites with protonated terminal oxygen were lower than those without protonated terminal oxygen. With the fracture of Si-O and Al-O bonds, the Si and Al release from the aluminosilicate. These results confirm the experimental conclusions that the acidic condition facilitates the release of Si and Al from the aluminosilicate, and the concentration of Al leaching from aluminosilicate is higher than Si.

Aiming to reveal the kinetic characteristics of ceramic ball grinding of fine magnetite comprehensively, two types of ceramic balls ground with the same filling rate and total weight as steel balls were researched. The results show that the breakage rate of ceramic ball grinding is only half of that of steel ball grinding with the same media filling rate. With the same total media weight and the feed size less than 0.212 mm, the breakage rate of the ceramic ball grinding approaches the steel ball grinding and is 21.43% higher than that of the steel ball grinding. The main crushing form of magnetite changed from impact to abrasion in ceramic ball grinding compared with steel ball grinding, which significantly affected the value of the zero-order output constant a. Consequently, there is a noticeable difference in the variation of the parameter β related to the fines generation rate of the ceramic ball grinding compared with the steel ball grinding.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

Porcine circovirus type 2 (PCV2) is a small non-enveloped DNA virus that causes swine immunosuppression by inducing apoptosis in lymphocytes. The ORF3 protein plays a major role in PCV2-induced apoptosis in porcine kidney cells, but there is little information regarding this protein in PCV2-infected lymphocytes. In this study, hybridoma screening and epitope mapping were determined by using an indirect ELISA. The mAb 7D3 against ORF3 peptide (residues 35–65) of PCV2 were generated in this study. In vivo situation, the mAb 7D3 recognized ORF3 protein existed in PCV2-infected apoptotic porcine PBMCs. It is noteworthy that thimerosal interfered with the binding of mAb 7D3 to epitope and it was diminished by adding cysteine. Additionally, thimerosal interacting with cysteine-containing peptide was demonstrated by the PTI assay. Furthermore, thimerosal specifically interacted with the antigen-binding sites of mAb 7D3. This study suggested that thimerosal blockade the occlusion of the antigen-binding sites of mAb 7D3 to bind ORF3 peptide (residues 35–65) via thimerosal interacting with cysteine residues which should be located within the antigen-binding sites of mAb 7D3. Overall, the mAb 7D3 has been characterized and it will be a valuables tool in future studies of ORF3 function and the wider mechanism of cell apoptosis caused by PCV2 infection. Similarly, these techniques will be useful for applications in detecting thimerosal too.

The mangrove plant Acanthus ilicifolius and its relative, A. mollis, have been previously proved to possess diverse pharmacological effects. Therefore, evaluating the differentially expressed proteins of these species under tidal flooding stress is essential to fully exploit and benefit from their medicinal values. The roots of A. ilicifolius and A. mollis were exposed to 6 h of flooding stress per day for 10 days. The dry weight, hydrogen peroxide (H2O2) content, anatomical characteristics, carbon and energy levels, and two-dimensional electrophoresis coupled with MALDI-TOF/TOF MS technology were used to reveal the divergent flooding resistant strategies. A. ilicifolius performed better under tidal flooding stress, which was reflected in the integrity of the morphological structure, more efficient use of carbon and energy, and a higher percentage of up-regulated proteins associated with carbon and energy metabolism. A. mollis could not survive in flooding conditions for a long time, as revealed by incomplete cell structures of the roots, less efficient use of carbon and energy, and a higher percentage of down-regulated proteins associated with carbon and energy metabolism. Energy provision and flux balance played a role in the flooding tolerance of A. ilicifolius and A. mollis.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

The creep behaviors of TA2 and R60702 at low and intermediate temperature were presented and discussed in this paper. Experimental results indicated that an apparent threshold stress exhibited in the creep deformation of R60702. Meanwhile, the primary creep phase was found as the main pattern in the room temperature creep behavior of TA2. Compared with exponential law, the power law has been proved to be a proper constitutive model in the description of primary creep phase. It also showed that θ projection method had its significant advantage in the evaluation of accelerated creep stage. Thus, a composite model which combined power law with θ projection method was applied in the creep curves evaluation at low and intermediate temperature. Based on the multiaxial creep deformation results, the model was modified and discussed. A linear relationship existed between composite model parameters and applied load. Finally, the creep life could be accurately predicted and the composite model method is suitable for application in low and intermediate temperature creep life analysis.

In response to injury, vascular smooth muscle cells (VSMCs) of the arterial wall dedifferentiate into a proliferative and migratory phenotype, leading to intimal hyperplasia. The ERK1/2 pathway participates in cellular proliferation and migration while dual-specificity phosphatase 6 (DUSP6, also named MKP3) can dephosphorylate activated ERK1/2. We showed that DUSP6 was expressed in low baseline levels in normal arteries; however, arterial injury significantly increased DUSP6 levels in the vessel wall. Compared with wild-type mice, Dusp6-deficient mice had smaller neointima. In vitro, IL-1β induced DUSP6 expression and increased VSMC proliferation and migration. Lack of DUSP6 diminished IL-1β-induced VSMC proliferation and migration. DUSP6 deficiency did not affect IL-1β-stimulated ERK1/2 activation. Instead, ERK1/2 inhibitor U0126 prevented DUSP6 induction by IL-1beta, indicating that ERK1/2 functions upstream of DUSP6 to regulate DUSP6 expression in VSMCs rather than downstream as a DUSP6 substrate. IL-1β decreased levels of cell cycle inhibitor p27 and cell-cell adhesion molecule N-cadherin in VSMCs whereas lack of DUSP6 prevented their downregulation, revealing novel functions of DUSP6 in regulating these two molecules. Taken together, our results indicate that lack of DUSP6 attenuated neointima formation following arterial injury by reducing VSMC proliferation and migration, which were likely mediated via maintaining p27 and N-cadherin levels.

Oral cancer ranks sixth among Taiwan's top 10 cancers, and most patients with poor prognosis acquire metastases. The essential fatty acid alpha-linolenic acid (ALA) has been found to diminish many cancer properties. However, the anti-cancer activity of ALA in oral cancer has yet to be determined. Migration and invasion assays confirmed OSCC cells' EMT capabilities, whereas flow cytometry and Western blotting identified the molecular pathways. ALA dramatically reduced cell growth in a concentration dependent manner, according to the findings. Low concentrations of ALA (100 or 200 μM) inhibit colony formation, expression of Twist and EMT-related proteins, expression of MMP2/-9 proteins and enzyme activity, as well as cell migration and invasion. Treatment with high concentrations of ALA (200 or 400 μM) greatly increases JNK phosphorylation and c-jun nuclear accumulation, then upregulates the FasL/caspase8/caspase3 and Bid/cytochrome c/caspase9/caspase3 pathways, leading to cell death. Low concentrations of ALA inhibit SAS and GNM cell migration and invasion by suppressing Twist and downregulating EMT-related proteins, or by decreasing the protein expression and enzyme activity of MMP-2/-9, whereas high concentrations of ALA promote apoptosis by activating the JNK/FasL/caspase 8/caspase 3-extrinsic pathway and the Bid/cytochrome c/caspase 9 pathway. ALA demonstrates potential as a treatment for OSCC patients.

Pyrethroid pesticides (PYRs) as the third most widely used pesticides, following organophosphorus and carbamate pesticides, which are of significant importance in the analysis and detection of vegetables. However, the current pretreatment technology for PYRs confronts challenges of difficult separation and low enrichment efficiency, resulting in a cumbersome and time-consuming pretreatment process with poor selectivity. Here, a simple and efficient magnetic solid-phase extraction (MSPE) strategy was developed to simultaneously purify and enrich five PYRs in vegetables, with the magnetic covalent organic framework nanomaterial COF-SiO2@Fe3O4 as an adsorbent. The COF-SiO2@Fe3O4 was prepared by a simple solvothermal conditions method, using Fe3O4 as magnetic core, benzidine and 3,3,5,5-tetraaldehyde biphenyl as two building units. COF-SiO2@Fe3O4 could effectively capture the targeted PYRs by virtue of its abundant π-electron system and hydroxyl groups. The impact of various experimental parameters on extraction efficiency was investigated to optimize the MSPE conditions, including adsorbent amount, extraction time, elution solvent type and elution time. Subsequently, method validation was conducted under the optimal conditions in conjunction with gas chromatography-mass spectrometry (GC-MS). Within the range of 5.00–100 μg·kg-1 (1.00–100 μg·kg-1 for bifenthrin and 2.5–100 μg·kg-1 for fenpropathrin), the five PYRs exhibited a strong linear relationship, with determination coefficients ranging from 0.9990 to 0.9997. The limits of detection (LODs) were 0.3–1.5 μg·kg-1, and the limits of quantification (LOQs) were 0.9–4.5 μg·kg-1. The recoveries were 80.2–116.7% with relative standard deviations (RSDs) below 7.0%. Finally, COF-SiO2@Fe3O4, NH2-SiO2@Fe3O4 and Fe3O4 were compared as MSPE adsorbents for PYRs. The results indicated that COF-SiO2@Fe3O4 was an efficient and rapid selective adsorbent for PYRs. This method holds promising prospects for the determination of PYRs in real samples.

The threat of fine particulate matter concentration (PM2.5) is increasing globally, Tackling this issue requires an accurate understanding of its trends and drivers. The article investigates the PM2.5 characteristics of 285 prefecture-level cities in China from 2000-2018 based on multiscale geographically weighted regression(MGWR), and the results show that（1）previous studies based on classical MGWR models may be somewhat unstable, while MGWR can reflect the scale of influence of different variables on the dependent variable, and its regression results are more reliable.（2）PM2.5 is very sensitive to carbon emission(CE) factors, and there is a high degree of spatial heterogeneity, and the influence scale of location is the smallest among all variables, close to the municipal scale.（3）In 2000, the constant term all, IS, OFT, CE, and LT positively affect PM2.5, while GDP (jurisdiction) and UR negatively affect PM2.5; in 2010, the constant term all, GDP (jurisdiction), IS, OFT and LT positively affect PM2.5, while UR and CE negatively affect PM2.5; in 2018 the constant term all, IS, OFT and CE factors positively affect PM2.5, and GDP (jurisdiction), UR and LT negatively affect PM2.5.

Autonomous vehicles (AVs) may not only reduce parking demand, but also free up on-street parking spaces. From the perspective of bus priority, converting on-street parking lots into dedicated bus lanes can both ensure bus priority and accommodate non-bus traffic, helping to reduce congestion and pollution. In order to study the impact of conversion of on-street parking lots to bus lanes on traffic flow, a microscopic simulation framework based on VISSIM is proposed in this paper. Data was collected using the floating car method and video recording method to quantify the factors affecting traffic flow due to the conversion of on-street parking. The VISSIM simulation model was then calibrated. According to the proportion of the on-street parking lots into a bus lane, the on-street parking lots conversion simulation model of different scenarios was established, and the influence of different on-street parking lots conversion ratio on traffic efficiency and pollution emission was quantitatively analyzed. Finally, the optimization method based on bus lane network connectivity is discussed. The results indicate that: When the on-street parking lots conversion ratio is approximately 100%, bus speed increases by 21.03%, bus delays decrease by 14.27%, and bus parking instances decrease by 11.31%. Total emissions are negatively correlated with vehicle speed. As the conversion rate of on-street parking increases, the emissions of road segments and the entire road network gradually decrease. At a conversion ratio of 100%, the average total emissions for road segments have the highest reduction rate, decreasing by 4.12%. At a conversion ratio of 50%, the average emission total for the road network shows the largest reduction, falling by 2.88%.

Background and Objectives: Cancer as the second leading cause of death in the United States poses a huge healthcare burden. Barriers to access to advanced therapies influence the outcome of cancer treatment. In this study, we examined whether insurance types affect the quality of cancer clinical care regarding access to an important monoclonal antibody, ramucirumab. Materials and Methods: Data for 13,340 cancer patients with Purchased or Medicaid insurance from the All of Us Database were collected for this study. The Chi-square test of proportions was employed to determine the significance of patient cohort characteristics and ramucirumab usage between Purchased and Medicaid insurance groups. The independent t-test was utilized to assess the influences of other determinants on insurance types. Results: Cancer patients who are African American, with lower socioeconomic status, or with lower educational attainment are more likely to be insured by Medicaid. Analysis of survey questions demonstrated the relationship between income and education level with insurance type as Medicaid cancer patients were less likely to receive primary care and specialist physician access and more likely to request lower cost medications. In addition, those with Medicaid insurance were identified to have poorer access to expensive therapeutics like ramucirumab compared to those with Purchased insurance.  Conclusions: The inequities of the US healthcare system are observed for cancer patient care; access to physicians and therapeutics are highly varied and dependent on insurance types. Socioeconomic status determines insurance type, which unfortunately generates a significant impact on cancer treatment and disease outcome.

This paper aims the automatic ball balancers (ABBs) used in passive balancing devices for suppressing vibration of the eccentric rotor. The system model describes which equipped with a skew-mounted ABB with angular deviation. The dynamic equilibrium equations of the system are deduced from the perspective of three-dimensional (3D) dynamics. The results obtained are consistent with those derived from the Euler-Lagrange equations. It is exciting that the spatial dynamics method reveals the spatial geometric characteristic of dynamic balance positioning of the balls when the system is balanced with vibration suppression. The spatial property emerges the perpendicular line from each ball to the rotating spindle of the system must pass through the central axis of the orbit perpendicular to the ABB plane. This characteristic is a general rule that can be used to explain the phenomenon of the stable equilibrium positions of the balls in all previously studied cases.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

: Tunnel instability and lining integrity are intimately tied to the creep properties of the surrounding rock. The acquisition of rock mass creep parameters is critical in ascertaining the appropriate timing for lining construction. Nevertheless, creep tests on rock specimens conducted in a controlled setting cannot be straightforwardly extrapolated to rock mass creep analysis. This study performs laboratory-based creep tests on mudstone samples and establishes the corresponding creep constitutive model. Integration of a Mohr-Coulomb element with the Burgers model in series serves to characterise the yield creep behaviour of the rock mass. Additionally, the research outlines a series of 100 orthogonal experiments utilising randomised creep parameters, and formulates a GA-BP neural network inversion model. Employing long-term deformation measurements from the crown and sidewalls of the project site, this study deduces the creep parameters of the mudstone in the investigated tunnel section and examines the prolonged deformation traits of the surrounding rock. Drawing on the deformation traits of the surrounding rock and the forces impacting the primary support and lining structures, this paper evaluates the earliest and latest viable lining casting periods and pinpoints an optimal timing interval for lining implementation. The methodologies employed herein can serve as a benchmark for analogous endeavors internationally.

The external and internal structures of male and female adults of Culicoides grisescens Edwards, were examined with scanning electron microscope (SEM) and tissue section techniques. Specimens were collected from Qilian Mountain National Park in Qinghai Province, China. The ultrastructure and morphology of compound eyes, antenna, maxillary palpus, spermathecae, genitalia and other structural characteristics of both male and female adults of C. grisescens are described. Internal structures of the species are described, including histological sections of the digestive, nervous, respiratory, and reproductive systems. This paper provides visual and descriptive details for the systematic taxonomic study of Ceratopogonidae.

The quality of healthcare services is a very important indicator of social welfare in developed and emerging countries. Good quality levels are critical to ensuring patient safety, improving health outcomes, increasing patient satisfaction, optimizing resource utilization, and meeting regulatory requirements. The stable and sustainable operation of medical institutions urgently requires the establishment of a reliable and effective medical quality performance evaluation platform. However, the complexity of the evaluation process, involving numerous evaluators and the consideration of different subjective and objective criteria, poses significant challenges and essentially constitutes a group multi-criteria decision-making problem. This article uses the overall medical environment of the institution, medical service attitude, medical security, administrative service measures, etc. as measurement standards to deal with this challenge. It proposes a medical service quality measurement model suitable for both qualitative and quantitative analysis. In view of the heterogeneity of information, the two-tuple fuzzy language calculation method is introduced to enable evaluators to skillfully manage diverse information and effectively avoid potential information omission problems in the subjective evaluation integration process. The effectiveness and feasibility of the model were demonstrated by applying it to the operational framework of a medical institution in central Taiwan.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Prevalence of overweight and obesity are escalating globally among the general population. However, there are limited evidence on the trends and prevalence of overweight /obesity in the military setting. Increased rates of injuries, low work productivity, incurred higher healthcare costs and prematurely discharge from service are consequences of overweight/obesity among the military. Therefore, we aimed to systematically describe the trends and prevalence of overweight and obesity in the military population, by regions and military service branches. Databases including PubMed, Scopus, Web of Science and Google Scholar were used. Inclusion criteria were military population (inclusive of all service branches) with BMI reported as the overweight/obesity indicator. Population related to military but not exclusively military personnel such as the retirees, the veterans and their dependents were excluded. From the 27 included studies, 13 were published between year 2010 to 2014 and half were conducted in the United States. Overall, studies showed increasing trend in the prevalence of overweight (30% to 50%) and obesity (2% to 30%); only one study showed a decreasing trend of 0.9% and 0.6% for the prevalence of overweight and obesity respectively. However, the rates of increment differed between countries, where Asian countries demonstrated lower overweight prevalence compared to the United States and the European countries. In conclusion, the military population is not protected from overweight and obesity. Interventions should be implemented to prevent overweight / obesity among the military personnel.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

Silver ion (Ag+) are recognized for their potent antibacterial properties; however, their utilization in food preservation is restricted by factors such as inadequate stability, a transient antibacterial impact, and the potential for human absorption. Hydrogel-based antibacterial agents are capable of exerting their antibacterial effects by establishing appropriate microenvironments, which facilitate the efficient delivery of antimicrobial molecules to the contaminated regions of food. In previous studies, we observed that chitosan (CS) and silver nitrate (AgNO3) were able to reduce Ag+ to silver nanoparticles (AgNPs) with enhanced antibacterial properties. This not only significantly extended the stability of the antibacterial agent but also demonstrated exceptional inhibitory capabilities against pathogenic bacteria, including common grape contaminants such as P. expansum, A. niger, and B. cinerea. Utilizing ultrasound-induced complexation technology, this study has successfully synthesized a chitosan-silver (CS-AgNPs) hydrogel. The efficacy of this hydrogel against the pathogenic fungus responsible for jujube black spot disease has been thoroughly investigated. The morphology structures of CS-AgNPs hydrogels were characterized by TEM, FTIR and UV-vis. The results indicated that AgNPs ranging from 80 to 110 nm were uniformly dispersed within the gel matrix and remained stable for extended periods at room temperature. In vitro antibacterial assays and fractional inhibitory concentration index (FICI) studies revealed that the pronounced antibacterial efficacy of the CS-AgNPs hydrogel was primarily attributed to the additive antibacterial effect of CS and AgNPs. These insights underscore the significant potential of CS-AgNPs hydrogels in combating fungal diseases of jujube, offering innovative strategies and materials for the management of agricultural pathogens.

Proteins, as gifts from nature, provide structure, sequence, and function templates for designing biomaterials. Here, we reported an engineered toolkit derived from a natural block copolymer, RfA1. RfA1 is composed of positively charged polyelectrolyte linker regions interspersed with highly conserved polyampholyte motifs. These linkers and motifs are constructional fragments and ready-to-use building blocks for synthetic design and construction. One functional and editable feature of RfA1 derivatives is their preferential distribution to cytoplasm or nucleoplasm, in a fragment-replication-determined manner. Based on this property, a prices spatiotemporal Tet-on demo was established, which effectively transports cargo peptides into nuclei at selective time points. Moreover, the functional homogeneities of either motifs or linkers were also verified, making them standardized building blocks for synthetic biology. In summary, this study provides a modularized, orthotropic and well-characterized toolkit for precise and spatiotemporal regulation of protein nucleocytoplasmic localization.

China is a traditional agricultural country, and the integration of rural industries has become an essential policy direction for the current strategy of agricultural modernization in China. In recent years, the agricultural industrial chains across various regions of China have consistently expanded and extended. The multifunctionality of agriculture is continuously unearthed, and the principal entities managing agriculture have become increasingly diversified and have grown significantly. New industries and forms in agriculture emerge incessantly. Accurately and profoundly understanding the inherent features of the integration of industries in rural China, establishing a scientific and rational measurement index system in line with the current status and development goals of rural China, and employing appropriate measurement methods to assess its development level and process, is instrumental in comprehending the level of integrated development in various regions. This aids in identifying challenges in the developmental process and proposing targeted developmental strategies. Hence, this paper, rooted in the integration of rural industries, cross-industry, industry extension, industry agglomeration, and industry penetration, sets up an measurement index system. Using provincial panel data from 2011 to 2020, the paper measures the level of integrated development in rural industries across China and its 31 provinces. Based on the measurement results, further techniques such as kernel density estimation and Gini coefficient decomposition have been used to analyze the spatial distribution characteristics and dynamic trends of the integrated development of rural industries in China. Research indicates that during the sample period, the overall level of integrated development in rural industries in various provinces in China has shown an upward trend. Development among the eastern, central, and western regions is highly uneven, but this disparity has been gradually narrowing in recent years. Furthermore, the levels of integrated development in different provinces exhibit significant spatial agglomeration effects. The development level of neighboring regions significantly impacts the province's development status. In the process of integrated development of rural industries in China, there's a trend where "it's easier to downgrade than to upgrade," with very few regions achieving leapfrog development.

Inflammation is the response of the immune system to infection and injury, with complex interactions with the body, tissues and cells, and plays an important role in the initiation and progression of many diseases such as cancer and cardiovascular disease. Traditional excipients functioning as drug delivery systems can reduce the side effects of systemic distribution of inflammatory drugs. Oil phase, a common excipient in nanoemulsions (NEs), has the advantages of assisting the formation of emulsions, loading lipophilic drugs, thermodynamic stability, wide sources, low price and easy availability. In particular, some of them, like linolenic acid and medium chain triglyceride (MCT), also function as inhibitors of systemic inflammation marker and vascular inflammation marker. However, the influences of different oil phases on the construction of NEs and their distribution in vivo have not been fully investigated. Herein, Tween 80 and ethyl alcohol were screened out as emulsifiers and co-emulsifiers, and three different oil phases used in clinical practice widely, including MCT, oleic acid (OA), and ethyl oleate (EO), were selected as the oil phase to prepare NEs delivery platform. Three NEs had consistent size, potential, morphology, excellent stability and mitochondrial localization function. Importantly, they exhibited superior cellular uptake capacity in inflammatory-injuried human umbilical vein endothelial cells and significantly targeted the brain, lung, heart and thoracic aorta in the lipopolysaccharide-induced mouse and zebrafish larvae inflammation models. Meanwhile, the fluorescence intensities of three NEs were different in these organs, suggesting that their differential enrichment might provide alternative delivery platform for disease treatment in the corresponding organs.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Keywords: mHealth; peritoneal dialysis; functionality; usability

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

Oriental lacquer, a natural and renewable polymeric coating, comes from the sap produced by lacquer trees. For practical application, oriental lacquer must be refined to reduce excess water and enhance its quality. In this study, drying oils were blended with oriental lacquer during the refining process to prepare an oil-modified refined lacquer (OMRL). The type and adding amount (0, 10, and 20% by wt.) of drying oils for wood coatings utilization were evaluated. Rhus succedanea oriental lacquer is composed of 54.1% urushiols, 34.3% water, 7.2% plant gum, and 4.4% nitrogenous compounds, and drying oils, including tung oil (TO), linseed oil (LO), and dehydrated castor oil (DCO) were used as materials in this study. The results show that the drying oil acts as a diluent, which reduces the viscosity and enhances the workability and could shorten the touch-free drying time and speed up the hardened drying of the OMRL. The results also indicate that the hardness, mass retention, Tg, tensile strength, abrasion resistance, and lightfastness of OMRL films decrease as more drying oils are blended. Conversely, the bending resistance, elongation at break, impact resistance increase, and particularly, the gloss, is greatly improved through the blending of more drying oils. In conclusion, the LO-modified refined lacquer (RL) has the highest film gloss and the DCO-modified RL has the shortest drying time for coating; otherwise, the film properties are similar among the three types of drying oil.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

With the realization of the Grand Canal's full water supply and the strong pursuit of green and low-carbon transportation in contemporary society, the value of the Grand Canal's water transport has been further affirmed, and its coordinated development with other transportation modes has become inevitable and important. This paper analyzes and combs through the characteristics, development status and existing problems of Grand Canal water transport and other transport modes in depth, and takes Jiangsu as an example. A collaboration model of Grand Canal water transport and other transport modes was built and their collaboration degree has been calculated. It is believed that the coordinated development of Grand Canal water transport and other transport modes can be greatly promoted via four aspects: optimizing the construction and governance of Grand Canal water transport, building an integrated management platform of transport modes, improving the integrated transport network structure, and promoting the deep integration of integrated shipping and tourism.

This work presents emission line flux and kinematic structure mapping based on IFU data of the planetary nebulae Abell 30 (A30). The IFU has a field of view (FoV) of 16" x 12.3" and was used to partially cover knots J1 and J2, and completely cover knots J3 and J4 of A30. Our emission line flux map shows recombination species C II, C III, He I, O II as well as forbidden line species [O III], [Ne III] and [Ne IV] of high excitation level are all distributed in different parts of the knots. The kinematic structure shows considerable variation in both the velocities and spatial locations of these knots with positive and negative velocity excursions from the systematic value. Forbidden line species [O III], [Ne III] are distributed in both knots J3 and J4 but they are travelling at different speeds in opposite directions. Despite variation in distribution of the species, the velocities of [Ne IV] and [O III] are similar and travelling in the same direction while the other species [Ne III], He I, and O II share similar velocity of 200kms−1 up in the opposite direction. The complexity of distribution and kinematic structure of the knots revealed in this work indicates a strong tendency towards the hypothesis of multiple triggering events in the past history of A30.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

Base on building information modeling(BIM) plus with Robotic process automation (RPA) technology is rapid development in smart building operations and maintenance (O&M). RPA is a workflow-based automated execution tool that is particularly well suited for replacing manual execution of simple and repetitive tasks using computer systems. The use of RPA technology can saves man-hours and increases productivity, which is important for the automation of building operations and maintenance operations.. The BIM technology, as an advanced technology in the construction industry, it can provide new ideas and methods for building operation and maintenance based on its visualization characteristics. That’s integrating RPA with BIM technology which will enhance the digitalization and virtualization of smart building operation and management. In this article will first introduce the features of RPA and BIM technology and then discuss the technical roadmap for remote automated operation and maintenance of smart building equipment room to implemention a low-cost and high efficient building equipment room operation and maintenance solution.

We propose a novel protocol to build a maximally entangled state based on controlled-not (CNOT) gates. In particular, we give detailed steps to construct maximally entangled state for 4-, 5-, and 6-qubit systems. The advantage of our method is the simple algebraic structure which can be realized via current experimental technology.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Both fibrosis and cirrhosis of the liver are the end results of most kinds of chronic liver damage and present a common but difficult clinical challenge throughout the world. The inhibition of the fibrogenic, proliferative, and migratory effects of hepatic stellate cells (HSCs) has become an experimental therapy for preventing and even reversing hepatic fibrosis. Furthermore, a complete understanding of the function of non-coding RNA-mediated epigenetic mechanisms in HSC activation may improve our perception of liver fibrosis pathogenesis. This review focuses on an evolving view of molecular mechanisms in which HSC activation by miR-29a signaling may moderate their profibrogenic phenotype, thus supporting the use of miR-29a agonists as a potential therapy for treating liver fibrosis in the future.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

Molecular hydrogen (H2) has been shown to have antioxidant and anti-inflammatory activities that may reduce the development and progression of many diseases. In this study, Hydrogen-rich water (HRW) was obtained by reacting hybrid magnesium-carbon hydrogen storage materials with water. Then the effects of intake of HRW on the activities of xenobiotic-metabolizing enzymes, membrane transporters, and oxidative stress in rats were investigated. Rats were given HRW ad libitum for 4 weeks. Results showed that intake of HRW had no significant effect on the activities of various cytochrome P450 (CYP) enzymes (CYP1A1, 1A2, 2B, 2C, 2D, 2E1, 3A, 4A), glutathione-S-transferase and UDP-glucuronosyltransferase. Except for a slight lower plasma glucose concentration, intake of HRW had no effect on other plasma biochemical parameters in rats. P-Glycoprotein and multidrug resistance-associated protein (Mrp)2 protein expressions in liver were elevated after intake of HRW. However, HRW had no significant effects on glutathione, glutathione peroxidase, or lipid peroxidation in liver. Results from this study suggest that consumption of HRW may not affect xenobiotic metabolism or oxidative stress in liver. However, intake of HRW may increase the efflux of xenobiotics or toxic substances from the liver into bile by enhancing the expression of p-glycoprotein and Mrp2 protein.

The microglia, displaying diverse phenotypes, play a significant regulatory role in the development, progression, and prognosis of Parkinson's disease. Research has established that glycolytic reprogramming serves as a critical regulator of inflammation initiation in pro-inflammatory macrophages. Furthermore, the modulation of glycolytic reprogramming has the potential to reverse the polarized state of these macrophages. Previous studies have shown that levetistilide A (LA), a phthalide component derived from Angelica sinensis, possesses a range of pharmacological effects, including anti-inflammatory, antioxidant, and neuroprotective properties. In our study, we have examined the impact of LA on inflammatory cytokines and glucose metabolism in microglia induced by lipopolysaccharide (LPS). Furthermore, we explored the effects of LA on the AMPK/mTOR pathway and assessed its neuroprotective potential both in vitro and in vivo. The findings revealed that LA notably diminished the expression of M1 pro-inflammatory factors induced by LPS in microglia, while leaving M2 anti-inflammatory factor expression unaltered. Additionally, it reduced ROS production and suppressed IκB-α phosphorylation levels as well as NF-κB p65 nuclear translocation. Notably, LA exhibited the ability to reverse microglial glucose metabolism reprogramming and modulate the phosphorylation levels of AMPK/mTOR. In vivo experiments further corroborated these findings, demonstrating that LA mitigated the death of TH-positive dopaminergic neurons and reduced microglia activation in the ventral SNpc brain region of the midbrain and the striatum. In summary, LA exhibited neuroprotective benefits by modulating the polarization state of microglia and altering glucose metabolism, highlighting its therapeutic potential.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

In this study, we evaluated the effects of Cyclosporine A (CsA) on Lipopolysaccharide (LPS)-induced cytokine production in the genital tract of female rabbits. Twelve sexually mature and healthy female rabbits were randomly divided into four groups (n = 3 each). The rabbits in the LPS group were given an intrauterine infusion of Escherichia coli LPS (4 mg/kg body weight (BW)). Rabbits in the CsA group were given CsA (20 mg/kg BW). Rabbits in the LPS + CsA group were given LPS (4 mg/kg BW) and CsA (20 mg/kg BW). The control group received only LPS and CsA carrier. The gene expression and protein levels of pro- and anti-inflammatory cytokines were observed using qRT-PCR and immuno-histochemical (IHC) assay, respectively. Our study showed that IL-1β, IL-6, IL-8, TNF-α, IFN-γ, IL-4, IL-10, IL-13, and TGF-β were expressed in female genital organs. The LPS challenge increased the mRNA expression of IL-6 and TNF-α in the uterine body and IL-1β in the uterotubal junction compared to the control group. CsA increased the basal mRNA expression of anti-inflammatory cytokines (i.e., IL-4 in the uterine body, uterotubal junction, and oviductal ampulla; IL-10 in the cervix, oviductal isthmus, and ampulla; and TGF-β in the uterotubal junction and oviductal ampulla) and pro-inflammatory cytokines (i.e., IL-6 and IL-8 in the cervix; IL-1β in the oviductal isthmus; TNF-α in the oviductal ampulla; and IFN-γ in the uterine body compared to the control group). In addition, CsA inhibited the mRNA expression of pro-inflammatory cytokines, such as IL-6 in the uterine body, uterotubal junction, and oviductal isthmus; TNF-α in the uterine body; and IFN-γ in the uterotubal junction and oviductal isthmus induced by the LPS challenge. The IHC assay showed the LPS-induced increase in protein production of IL-6 in the uterine body and oviductal isthmus. CsA increased the protein production of IL-10 in the cervix, uterine body, oviductal ampulla, and isthmus. Moreover, CsA decreased the protein production of IL-6 in the uterine body and oviductal isthmus induced by LPS.

Dry eye syndrome (DES) has become increasingly prevalent due to the prolonged use of digital devices in modern society. Individual supplementation with lutein or docosahexaenoic acid (DHA) demonstrated potential benefits for eye health. This study aimed to investigate the effects of lutein plus DHA complex supplementation on DES, visual function, and memory in healthy individuals. Thirty-four participants, aged 40~60 years, received lutein/DHA complex supplements (containing 10 mg free-form lutein, 200 mg DHA, 30 mg red algae extract (astaxanthin), phosphatidylserine, and vitamin A) for 12 weeks. Ophthalmological examinations and memory tests were carried out, and a questionnaire was administered at weeks 0, 6, and 12 of the study. After 12 weeks of the intervention, the tear break-up time had significantly increased, and intraocular pressure (IOP) had significantly decreased. This suggests that lutein/DHA complex supplementation may reduce the IOP and offer potential benefits for DES, as indicated by improved tear stability.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

The plethora of bio-functional compounds present in fermented alcoholic beverages like wine, as well as the valorization of bioactives from their wineries/breweries by-products like grape pomace and grape seed, has gained significant interest in the functional foods sector. Wine has always accompanied humanity, for religion or for health. For example, Christians are using wine in the “Holy Communion”, following what Jesus Christ himself did and said during the Last Supper, while the benefits of the wine consumption in moderation was embedded in all Mediterranean civilizations, as it is mentioned by the wise King-Prophet David in his psalms, but also by Hip-pocrates and other wise men, in a Greek-based philosophy of “All things in Moderation” (Cleobulus of Lindos; 6th century BC). In modern times, and after the outbreak of research on wine benefits since the 90’s, when the term “French Paradox” was introduced in the US public during a CBS show, recent evidence has outlined that these benefits are derived by the synergisms of its bio-functional compounds and their digestion-derived metabolites. Within this article, the proposed health benefits of moderate wine consumption, as a functional component of a balanced diet (i.e. the Mediterra-nean Diet), against inflammation-related chronic disorders, is thoroughly reviewed. The various bio-functional compounds of both wine and wineries’ by-products, such as their bioactive phe-nolics, unsaturated fatty acids, polar lipids, and dietary fibers, and their functional antioxidant, anti-inflammatory and antithrombotic health promoting properties are also thoroughly evaluated. The mechanisms of actions and synergism, by which the health benefits are elicited, are also ex-plored. Functional properties of non-alcoholic wine products are also introduced. Emphasis is also given to applications of wineries’ by-products bioactives, as ingredients of bio-functional foods, supplements and nutraceuticals. Limitations and future perspectives for this popular functional alcoholic beverage (wine) ant its rich in bioactives by-products are also addressed. .

Revealing the multidimensional value of cultivated land resources, improving calculation methods, and exploring their spatial distribution characteristics and influencing factors are crucial for the enhancement of natural resource accounting system and the protection of cultivated land resources. This study take Guangxi, China as an example and construct a comprehensive multidimensional value evaluation system for cultivated land resources at the county scale. The income capitalization method, substitution market method, and value equivalent correction method were applied to calculate the economic, social, and ecological values of cultivated land resources in 111 counties. Furthermore, spatial autocorrelation analysis was employed to study their distribution characteristics and influencing factors. The results show that: (1) The total value of cultivated land resources in Guangxi reach 19,729.2 billion yuan, and the average cultivated land value is 5.3511 million yuan/hm2, of which the ratio of economic, social and ecological values is about 6:1:2; (2) The value of cultivated land has a certain distribution pattern in the global space, and the average economic and social value show the spatial distribution patterns of "low in the west and high in the east" and "low in the northwest and high in the southeast" respectively."(3) There is a significant spatial clustering effect of all values of cultivated land resources in local space, with "high-high" and "low-low" clustering. (4) Economic development level is significantly negatively correlated with the ecological value of cultivated land, while has a significant positive correlation with social value; (5) Natural conditions, economic development and agricultural development approaches are the key factors affecting the value of cultivated land resources.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

The rapid growth of network services, Internet of Things devices and online users on the Internet have led to an increase in the amount of data transmitted daily. As more and more information is stored and transmitted on the Internet, cybercriminals are trying to gain access to the information to achieve their goals, whether it is to sell it on the dark web or for other malicious intent. Through thorough literature study relating to the causes and issues that are brought from the security and privacy segment of wireless networks, it is observed that there are various factors that can cause the networks to be an insecure; especially factors that revolve around cybercriminals with their growing expertise and the lack of preparation and efforts to combat them by relevant bodies. The aim of this paper is to showcase major and frequent security as well as privacy issues in wireless networks along with specialized solutions that can assist the related organizations or the public to fathom how great of an impact these challenges can bring if every related stakeholder took a step in reducing them. Through this paper it is discovered that there are many ways these challenges can be mitigated, however, the lack of implementation of privacy and security solutions is still largely present due to the absence of practical application of these solutions by responsible parties in real world scenarios.

[Introduction]: In the contemporary international financial environment, marked by intricate complexities and increasing uncertainties, the impact of exchange rate fluctuations on national economies has become increasingly significant. In this context, this study uses the Chinese economy as a case study to delve deeply into the interaction effects between macroprudential and monetary policies, analyzing how these policies jointly address economic instability. The aim is to offer new perspectives and strategies for stabilizing the global economic and financial landscape. [Methods]: This paper constructs an open-economy Dynamic Stochastic General Equilibrium (DSGE) model specifically tailored for China, incorporating Bayesian estimation and numerical simulation techniques. The study meticulously examines how macroprudential and monetary policies can be coordinated to achieve economic stability in response to exchange rate shocks. [Results]: The research finds that (1) targeted coordination of macroprudential and monetary policies towards asset prices and price levels can maintain stability under exchange rate shocks; (2) the effective implementation of such coordinated policies not only mitigates the fluctuations in asset prices due to exchange rate shocks but also enhances the level of societal welfare; (3) in terms of choosing an exchange rate regime, a managed floating rate system can prevent policy overlaps and conflicts that might occur in a floating rate system during the coordination of macroprudential and monetary policies, thus offering comparative advantages. [Discussion]: The findings underscore the importance of policy integration in a dynamic and complex global economic environment. They provide policy recommendations for China and other emerging market countries on how to effectively maintain economic stability through the synergistic interplay of macroprudential and monetary policies amid fluctuations in exchange rates and asset prices.

The COVID-19 pandemic was associated with increases in some healthcare-associated infections. We investigated the impact of the pandemic on rates and molecular epidemiology of Clostridioides difficile infection (CDI) within one VA Hospital. We anticipated that the potential widespread use of antibiotics for pneumonia during the pandemic might increase CDI rates given that antibiotics are a major risk for CDI. Hospital data on patients with CDI and recurrent CDI (rCDI) were reviewed pre-COVID-19 pandemic (2015 to 2019) and during the pandemic (2020 - 2021). Restriction endonuclease analysis (REA) strain typing was performed on CD isolates recovered from stool samples collected from 10/2019 – 3/2022. CDI case numbers declined 43.2% in 2020 – 2021 compared to the annual mean over the previous 5 years. Stool test positivity rate was also lower during the COVID-19 pandemic (14.3% vs. 17.2%; P = 0.013). Although inpatient volume declined, rates of CDI among inpatients were reduced by 34.2% in 2020 – 2021. Mean monthly cases of rCDI also declined significantly after 2020 [3.38 (95% CI: 2.89 – 3.87) vs. 1.92 (95% CI: 1.27 – 2.56); P = &lt;0.01]. Prior to the pandemic, REA group Y was the most prevalent CD strain among the major REA groups (27.3%). During the first wave of the pandemic from March 8, 2020, through June 30, 2020, there was an increase in the relative incidence of REA group BI (26.7% vs. 9.1%. After adjusting for CDI risk factors, a multivariable logistic regression model revealed that odds of developing an REA group BI CDI increased during the first pandemic wave (OR 6.41, 95% CI: 1.03 – 39.91) compared to the pre-pandemic period. In conclusion, the incidence of CDI and rCDI decreased significantly during the initial waves of the COVID-19 pandemic. In contrast, REA BI (Ribotype 027), a virulent, previously epidemic CD strain and frequently associated with hospital transmission and outbreaks, reappeared as a prevalent strain during the first wave of the pandemic.

Deficiency of interleukin-1 receptor antagonist (DIRA) is a rare life-threatening autosomal recessive autoinflammatory disease with symptoms including but not limited to osteomyelitis, periostitis, and systemic inflammation. DIRA is developed from the loss-of-function mutations of IL1RN gene that encodes IL-1 receptor antagonist (IL-1RA), leading to the unchecked pro-inflammatory signaling and subsequent systemic inflammation. Thus, Anakinra as the recombinant IL-1RA has become the primary drug to treat DIRA. Although Anakinra has been effective for complete remission of DIRA, it also showed various side effects. To further address its efficacy and safety in treating DIRA, a review of literature was conducted in this study. We have identified 15 papers with 25 patients studied, making it possible to conduct reliable statistical analyses. The literature review found that continual treatment with Anakinra is effective to cause clinical remission of DIRA. Statistical analyses found that after the treatment with Anakinra, patients had improved Hemoglobin, Erythrocyte Sedimentation Rate, and C-reactive Protein levels. All known cytogenetic abnormalities were also analyzed to inform clinicians for genetic screening and rapid diagnosis of DIRA. The results from this study provide a comprehensive view for further improving the treatment of DIRA by Anakinra.

When analyzing user geospatial information through deep learning methods, it is typically necessary to annotate existing geospatial data. Currently, manual annotation methods are commonly employed, suffering from issues related to low efficiency and accuracy. This design is based on the TensorFlow deep learning framework and first realizes the BiLSTM+CRF+AGG deep learning model. Among the models, AGG is the aggregation layer, which is introduced to solve the problem of solid particle size equilibrium. Secondly, based on the characteristics of original data and professional data, an automatic labeling algorithm is proposed. The algorithm first preprocesses the acquired original data set and professional data set, The most valuable unlabeled data set which can make the training model converge quickly is selected from the original data set as the target data set. Sort the target data set based on preset rules and set annotation parameters for the sorted target data set. Based on the set annotation parameters, the corpus is synthesized and used as the annotation result. Thirdly, based on the active learning strategy, a manual annotation auxiliary scheme is proposed, and an Excel generation module that is convenient for manual annotation correction is designed and developed to further improve the efficiency and quality of annotation through iterative processing. The combination of the BiLSTM+CRF+AGG deep learning model and high-quality annotation can accurately identify non-standard, incomplete, or even incorrect geographical information entities. This annotation method has found successful practical application within the context of the research project and has been granted an invention patent.

Abundant of preparatory works have recognized that fluorescent sensors based on 8-aminoquinoline are popular tools to detect Zn2+ ions in environmental and biological applications. Along with these studies, researchers started to introduce a variety of carboxamido group into an 8-aminoquinoline molecule in forming 8-amidoquinoline derivatives. Therefore, this systematic review aims to introduce a general overview of the fluorophore 8-aminoquinoline as Zn2+ receptors and to provide comparisons of collected studies that related to 8-amidoquinoline derivatives as fluorophore probe of the sensor. According to PRISMA systematic searches strategy, 13 articles were analyzed for trends, research designs, results and discussion, subject samples, and remarks or conclusions. We found cross-sectional studies with four aspects in zinc sensing that have been targeted; binding studies via titration, detection's limit, interferences studies, and validation of the study. Hence, this paper also included assessments of those criteria and the trends of development of 8-amidoquinoline derivatives based-zinc fluorescent chemosensor. It also showed that most of the researches conducted in China. In conclusion, this study identified various research designs of fluorescent chemosensors based on 8-amidoquinoline prolong with the effectiveness and potential as a recognition probe to assist the detection of zinc. Hence, elucidation of those derivatives essential to be explored because more studies are needed to improve the sensing criteria of the zinc sensor

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

As e-commerce services and Internet technology have rapidly developed in recent years, many services and applications integrating these technologies can now be completed online. These commercial activities include online auctions, online ticketing and online payments. The client shops from the store online, andthe store delivers the goods to the client. The goods can be divided into digital products without entities, as well as actual entities. If it is a physical product, the store will deliver the package to the client through itslogistics. However, there have been many cases of switched goods purchased by clients in recent years. Earlier, some scholars proposed a security mechanism with a subliminal channel for E-cash and digital content. Only the sender and the receiver would know that the secret information was hidden in the signature. So the privacy of this subliminal message couldbe ensured. We apply this concept to the logistics environment to design secure logistics architecture with subliminal messages. The client can check the subliminal message of the received package, and know whether the package has been switched by malicious people. In addition, the proposed scheme also applies sensor technology;the client can check the GPS location, the temperature and humidity at any time during the delivery process. So intelligent logisticswouldthereby be achieved. This paper proposes an intelligent and secure package sensoring logistics system based on a subliminal channel. The proposed architecture uses the related mechanisms tosolve the problems of a logistics system, including how to achieve mutual authentication, data integrity, anti-switch package, package location and status tracing, resisting replay attacks, forward and backward secrecy, and non-repudiation issues.

The integration of metal nanoparticles and solid carriers can achieve ideal stability, high load and good conductivity. In this work, copper nanoparticles (Cu NPs) were sequentially deposited on a cobalt metal-organic framework (Co-MOF) by bonding with exposed imino groups, followed by a reduction reaction to prepare a new Cu@Co-MOF composite. Cu@Co-MOF acts as a non-enzymatic electrochemical sensor to detect glucose (Glu) in an alkaline medium. The composite working electrode of Cu@Co-MOF/GCE (GCE = glassy carbon electrode) improves the electrocatalytic activity for Glu oxidation. Cu@Co-MOF/GCE shows excellent electrocatalytic performances in Glu concentration ranging 0.005~1.8 mmol∙L⁻¹ (mM): the sensitivities are 282.89 μA∙mM⁻¹∙cm⁻² in 0.005-0.4 mM Glu and 113.15 μA∙mM⁻¹∙cm⁻² in 0.4-1.8 mM Glu respectively with low detection limit of 1.6 μM (S/N = 3) and high selectivity and stability.

Tea (Camellia sinenesis) is a health beneficial beverage and is also a source for extracting bioactive components such as theanine, tea polyphenols (TPP) and tea polysaccharides (TPS). TPS is a group of hetero-polysaccharides bounded with proteins. There were tests showing that TPS had various bioactivities, such as antioxidant, antitumors, antihyperglycemia, anti-inflammation and improving immunity. However, inconsistent results concerning chemical composition and bioactivity of TPS were published in recent years. The advances in chemical composition and bioactivities of TPS were reviewed in the present paper. The inconsistent and controversial results regarding composition and bioactivities of TPS were also discussed.

Innovation is an essential key factor in the technology development history. Past research on innovation focused more on the innovation behavior of technology, but seldom described knowledge assets which also influence innovation behavior greatly. The effect of knowledge assets attribute and result on disruptive innovation is therefore regarded as the research topic in this study, where disruptive innovation is divided into outbound and inbound to combine combination-embeddednessandmajor business specificityof knowledge assets as the research model. Manufacturing enterprises in China are proceeded the questionnaire survey, and 173 valid copies are collected. The empirical analysis shows that combination-embeddedness of knowledge assets presents significantly positive effects on major business specificity and outbound innovationof an enterprise but reveals remarkably negative effects on inbound innovation. Enterprises are suggested to constantly accumulate knowledge assets with low major business specificity before disruptive innovation in order to reduce ineffective inbound innovation.

Wideband signal detection is an important problem in wireless communication. With the rapid development of deep learning (DL) technology, some DL-based methods are applied to wireless technology, and the effect is obvious. In this paper, we propose a novel neural network for multi-type signal detection that can locate signals and recognize signal types in wideband spectrogram. Our network utilizes the key point estimation to locate the rough centerline of signal region and identify class. Then, several regressions are carried out to achieve properties, such as local offset and border offsets of bounding box, which is further synthesized for a more fine location. Experimental results demonstrate that our method performs more accurate than other DL-based object detection methods previously employed for the same detection task. Specifically, our method runs obviously faster than existing methods, and abandons the anchor generation, which makes it more favorable for real-time applications.

Despite the expectation that social media use in the public sector contributes to enhancing government's transparency, few studies have been investigated whether social media use actually leads to more disclosure during environmental incidents in practice and how social media influence local governments and their officials' information disclosure. In this article, we model information disclosure during environmental incidents as an evolutionary game process between the central government and local government in social media context, and examine the internal mechanism that how social media influence the progress of information disclosure during environmental incidents. The findings indicate that social media plays an active constructive role in central-local government game relations. Specific- ally, social media can provides an efficient information channels for the central government supervise regional officials in environmental incidents, and thus improves its supervision efficiency, and it also provides an important means for internet mobilization and online-offline interaction by encouraging the public exchange information and express their views, and in turn forces local governments and their officials tend to disclosure ahead.

Skeletal muscle is a specialized tissue consisting of nondividing and multinucleated muscle fibers. Skeletal muscle-specific myostatin (MSTN) is a secreted protein that acts as a negative regulator of muscle mass by inhibiting proliferation and differentiation of myoblasts. In this study, we established a screening platform to monitor myostatin promoter activity in rat L8 myoblasts. Extract of Glycyrrhiza uralensis (GUE), an oriental herbal medicine, was identified through this screening platform and, the active fractions of GUE were identified by process-scale liquid column chromatography system. For in vivo study, the GUE as a feed additive was investigated in growth-finishing pigs. The results showed that GUE significantly increased body weight, carcass weight and lean content in pigs. Microbiota analysis indicated that GUE did not affect the composition of gut microbiota in pigs. In summary, this established rodent myoblast screening platform was used to identify a myogenesis-related phytogenic, GUE, and further demonstrated that the active fractions inhibited MSTN expression. These finding suggest a novel application for GUE in growth performance enhancement through modulation of MSTN expression. Furthermore, this established screening platform has great potential for identification and evaluation of a wide variety of phytogenics involving in myogenesis.