HIV early detection (CD4 counts ≥350 cells/μL) is correlated with higher life expectancy among people living with HIV (PLHIV). Several factors including physical, cultural, structural, and financial barriers have contributed to HIV late detection. This is the first-of-its-kind study on the regional differences in early detection of HIV within Tajikistan and any country in the Central Asia region. Utilizing Tajikistan Ministry of Health's national HIV data (N=10,700) spanning 2010 to 2023, we developed median regression models with median CD4 cell count as the outcome and as predictors: time (years), region, age, gender, and area (urban/rural status). Individuals younger than 19 years old are more likely to be detected early for HIV, whereas those older than 39 years are more prone to late detection. Given their active engagement in age-related and sexual activities, those older than 39 years face a higher risk of HIV transmission to others if diagnosed late. Therefore, they require further attention and targeted interventions. Females are detected earlier compared to their male counterparts, regardless of region of residence. Rural populations are detected earlier in most years compared to their urban counterparts. The COVID-19 pandemic accelerated HIV early detection in 2021 but most regions have returned to near pre-pandemic levels of detection in 2022 and 2023. These fluctuations in early detection may signify a shift in attention and resource allocation, potentially affecting efforts to address access gaps during the initial year of the COVID-19 pandemic. There are significant health inequities among different demographic and geographic groups which warrant further attention.

There is a confusion in the original design concept for the tensioning of longitudinally connected reinforcement of CRTSII slab ballastless track. In order to clarify the effect of tension value of longitudinal reinforcement on mechanical characteristics of ballastless track, a three dimensional finite element model considering the nonlinear interaction between the track slab and CA mortar of CRTSII slab ballastless track was established. The mechanical characteristics of the track structure under longitudinal tension load and temperature gradient load of the longitudinal joint were calculated. A method of applying pre-stress to post-pouring concrete was proposed according to the concept of pre-stress loss of pretensioning pre-stressed concrete, reasonable tensile force value was proposed after the crack width and the reinforcement stress of the ballastless track in the operation stage were checked and calculated according to the concrete design principle. When the tension force is greater than 300 kN, it’s harmful to the bonding between the slab and mortar layer, which is prone to interlayer damage. In order to adding pre-stress to concrete of wide joints to ensure the longitudinal stability of ballastless track and the reinforcement stress and crack width to meet the design requirements. It is suggested that the tension force value should be 230 kN, and the temperature difference between reinforcement and concrete should be 30 °C before the initial curdle of wide joint concrete.

The field of fluorescence sensing, leveraging various supramolecular self-assembled architectures constructed from macrocyclic pillar[n]arenes, has seen significant advancement in recent decades. This review comprehensively discusses, for the first time, the recent innovations in the synthesis and self-assembly of pillar[n]arene-based supramolecular architectures (PSAs) containing metal coordination sites, along with their practical applications and prospects in fluorescence sensing. Integrating hydrophobic and electron-rich cavities of pillar[n]arenes into these supramolecular structures endow the entire system with self-assembly behavior and stimulus responsiveness. Employing the host–guest interaction strategy coupled with complementary coordination forces, PSAs exhibiting both intelligent and controllable properties are successfully constructed. This provides a broad horizon for advancing fluorescence sensors capable of detecting environmental pollutants. This review aims to establish a solid foundation for the future development of fluorescence sensing applications utilizing PSAs. Additionally, current challenges and future perspectives in this field are discussed.

To prepare an edible coating with a good preservative effect on sweet cherries, carboxymethyl chitosan (CMCS) and gelatin (GL) were selected as the film-forming matrix in this experiment, and CaCl2 and ascorbic acid (AA) were added as crosslinking agents and antioxidants, respectively. First, the film was prepared by the casting method, and the film formula with better mechanical and barrier performance was filtered out by one-factor and response surface optimization test, and the differences in the preservation effect of different film formulations (CMCS-GL, CaCl2- CMCS-GL, AA -CaCl2- CMCS-GL) on sweet cherries were compared. and then the different film formulations were compared. The difference in film formulation on the preservation effect of sweet cherries was investigated. The results showed that the optimal formulation for an edible film based on CMCS-GL with good performance was CMCS: GL (w:w)=2:1, with the additional amount of 1% glycerol, 2% CaCl2, 0.1% Tween-20, 2% AA, the tensile strength, elongation at break, oxygen permeability and water vapor permeability of the film obtained with this formula were: 16.28 MPa, 71.46%, 1.39×10-12 g- cm/(cm2-s-Pa), 5.10×10-11 cm3-cm/(m2-s-Pa), respectively. In the preservation of sweet cherries, all three film formulations effectively reduced the rotting rate and weight loss during storage while preserving the high hardness and skin color of the fruit. Among them, the formulation AA -CaCl2- CMCS-GL showed the best preservation effect and can be used as a new method for postharvest preservation of sweet cherries.

The allosteric SERCA (Sarcoplasmic/Endoplasmic Reticulum Ca2+-ATPase) activator CDN1163 has been recently added to the group of pharmacological tools for probing SERCA function. We chose to investigate the effects of the compound on T lymphocyte Ca2+ stores, using the well-described Jurkat T lymphocyte as a reliable cell system for Ca2+ signaling pathways. Our study identified the lowest concentrations of the SERCA inhibitors thapsigargin (TG) and 2,5-di-(tert butyl)-1,4-benzohydroquinone (tBHQ) capable of releasing Ca2+, permitting the differentiation of the TG-sensitive SERCA 2b Ca2+ store from the tBHQ-sensitive SERCA 3 Ca2+ store. We proceeded to test the effects of CDN1163 on Ca2+ stores, examining specific actions on the SERCA 2b and SERCA 3 Ca2+ pools using our low dose SERCA blocker regimen. In contrast to previous work, we find CDN1163 exerts complex time-sensitive and SERCA isoform-specific actions on Ca2+ stores. Surprisingly, short-term exposure (0-30 minutes) to CDN1163 perturbs T cell Ca2+ stores by suppressing Ca2+ uptake with diminished Ca2+ release from the SERCA 2b-controlled store. Concomitantly, we find evidence for a SERCA-activating effect of CDN1163 on the SERCA 3 regulated store, given the observation of increased Ca2+ release inducible by low dose tBHQ. Intriguingly, longer-term (>12 hours) CDN1163 exposure reversed this pattern, with increased Ca2+ release from SERCA 2b-regulated pools, yet decreased Ca2+ release responses from tBHQ-sensitive SERCA 3 pool. Our results reveal differential effects of CDN1163 on Ca2+ stores regulated by distinct SERCA isoforms, prompting the need for careful interpretation of the compound’s effects, particularly in cells expressing multiple SERCA isoforms.

Background: Post-acute sequelae of SARS-CoV-2 infection (PASC) is a complicated disease that affects millions of people all over the world. Previous studies have shown that PASC impacts 10% of SARS-CoV-2 infected patients of which 50-70% are hospitalized. It has also been shown that 10-12% of those vaccinated against COVID-19 were affected with PASC and its complications. The severity and the later development of PASC symptoms is positively associated with the early intensity of the infection. Results: The generated health complications caused by PASC involve a vast variety of organ systems. Patients affected by PASC have been diagnosed with neuropsychiatric and neurological symptoms. Cardiovascular system also has been involved and several diseases such as myocarditis, pericarditis, and coronary artery diseases were reported. Chronic hematological problems such as thrombotic endothelialitis and hypercoagulability were described as a condition that could increase the risk of clotting disorders and coagulopathy in PASC patients. Chest pain, breathlessness, and cough in PASC patients were associated with respiratory system in long COVID-19 causing respiratory distress syndrome. The observed immune complications were notable, involving several diseases. Renal system also was impacted and result in raising the risk of diseases such as thrombotic issues, fibrosis, and sepsis. Endocrine gland malfunction can lead to diabetes, thyroiditis, and male infertility. Symptoms such as diarrhea, nausea, loss of appetite and taste were also among reported observations due to several gastrointestinal disorders. Skin abnormalities might be an indication of infection and long-term implications such as persistent cutaneous complaints were linked to PASC. Conclusions: Long COVID is a multidimensional syndrome with considerable public health implications, affecting several physiological systems and demanding thorough medical therapy as well as more study to address its underlying causes and long-term effects.

The properties of the annual, semiannual and triennial oscillations (AO, SAO and TO) in the middle atmosphere have been investigated using the TIMED/SABER temperature data. The Lomb-Scargle and wavelet spectra were used to determine the dominant oscillations in the background temperature field. The AO is prominent at the mid-latitudes. The AO amplitudes present an asymmetry between the two Hemispheres, being larger in the mesosphere than in the stratosphere. The SAO dominates the tropical regions, with three amplitude maxima at altitudes of 45, 75, and 85 km. The SAOs in the upper mesosphere (75 km) are out of phase with those in the mesopause (85 km) in the tropical regions, which can generate an enhancement of 11 K at each equinox, contributing to the lower mesospheric inversion layer. The TO is significant in the tropical region, with amplitude being maximum at 35, 45 and 85 km. Result shows that there may be potential interaction by the TO with SAO at 85km at the equator. The relation between ENSO and TO has also been discussed. The ENSO signal may modulate the amplitude of the TO, mainly in the lower stratosphere. The real origin of the TO may lie in the wave-mean-flow interaction.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

The paper presents the prediction of hydrodynamic characteristics of different rudder -plane configurations behind a submarine in deep water through the Reynolds-Averaged Navier-Stokes method in Ansys Fluent Solver. The hydrodynamic force and moment acting on the Cross-plane, X-plane, and Y-plane rudder configurations are analyzed for estimating hydrodynamic coefficientsfor predicting the advantages of each configuration to control the ship. The obtained results show that X-force of the X-plane rudder configuration is larger than the force acting on the Cross-plane rudder and Y-plane rudder configurations. However, Y-force, and Z-force of the X-plane rudder configuration are significantly greater than the Y-force of the left configurations. The same tendency can be seen in the moment of the X-plane rudder about the y-axis and z-axis. The roll moment induced by the Y-plane and Cross-plane rudder configurations is significantly larger than the case of the X-plane rudder configuration.

While the COVID-19 outbreak was reported to first originate from Wuhan, China, it has been declared as a Public Health Emergency of International Concern (PHEIC) on 30 January 2020 by WHO, and it has spread to over 180 countries by the time of this paper was being composed. As the disease spreads around the globe, it has evolved into a worldwide pandemic, endangering the state of global public health and becoming a serious threat to the global community. To combat and prevent the spread of the disease, all individuals should be well-informed of the rapidly changing state of COVID-19. In the endeavor of accomplishing this objective, a COVID-19 real-time analytical tracker has been built to provide the latest status of the disease and relevant analytical insights. The real-time tracker is designed to cater to the general audience without advanced statistical aptitude. It aims to communicate insights through various straightforward and concise data visualizations that are supported by sound statistical foundations and reliable data sources. This paper aims to discuss the major methodologies which are utilized to generate the insights displayed on the real-time tracker, which include real-time data retrieval, normalization techniques, ARIMA time-series forecasting, and logistic regression models. In addition to introducing the details and motivations of the utilized methodologies, the paper additionally features some key discoveries that have been derived in regard to COVID-19 using the methodologies.

Background: Angiogenesis is essential for various physiological and pathological processes, such as embryonic development and cancer cell proliferation, migration, and invasion. Long noncoding RNAs (lncRNAs) play pivotal roles in normal homeostasis and disease processes by regulating gene expression through various mechanisms, including as competing endogenous RNAs (ceRNAs) of target microRNAs (miRNAs). The lncRNA MYU is known to promote prostate cancer proliferation via the miR-184/c-Myc regulatory axis, and to be upregulated in vascular endothelial cells under hypoxic conditions, which often occurs in solid tumors. In the present study, we investigated whether MYU might affect cancer growth by regulating angiogenesis in vascular endothelial cells under hypoxia. Methods: The expression of MYU-regulated miR-23a-3p and interleukin-8 (IL-8) in HUVEC cell lines was examined using qRT-PCR. CCK-8 assay, EdU assay, Wound-healing assay and Tube-formation assay were used to assess the effect of MYU on cell proliferation, migration and tube formation of HUVEC cells in vitro. Dual-luciferase reporter assay was performed to examine the effect of miR-23a-3p on MYU and IL-8 expression. Results: We found that overexpression of MYU and knockdown of miR-23a-3p in human umbilical vein endothelial cells (HUVECs) under hypoxia promoted cell proliferation, migration, and tube formation. Mechanistically, MYU was shown to bind competitively to miR-23a-3p, thereby preventing miR-23a-3p binding to the 3′ untranslated region of IL-8 mRNA. In turn, increased production of pro-angiogenic IL-8 promoted HUVEC proliferation, migration, and tube formation under hypoxia. Conclusion: This study identified a new role for lncRNA MYU as a ceRNA for miR-23a-3p, and uncovered a novel MYU–miR-23a-3p–IL-8 regulatory axis for angiogenesis. MYU and/or miR-23a-3p may thus represent new targets for the treatment of hypoxia-related diseases by promoting angiogenesis.

Ozonated sunflower oil (OSO) is well known functional oil with its antioxidant, antimi-crobial, anti-allergic, and skin-moisturizing properties. However, studies on the effects of OSO on high-cholesterol diet (HCD)-induced metabolic disorders have been scarce. In the current study, we aimed to determine the anti-inflammatory effects of OSO on lipid me-tabolism in adult hypercholesterolemic zebrafish and its embryo. Microinjection of OSO (final 2%, 10 nL) into zebrafish embryos under presence of carboxymethyllysine (CML, 500 ng) protected acute embryo death upto 61% survival, while sunflower oil (final 2%) showed much less protection around 42% survival. The microinjection of OSO was more effective than SO to inhibit reactive oxygen species (ROS) production and apoptosis in the CML induced embryo toxicity. Intraperitoneal injection of OSO under presence of CML protected acute death from CML-induced neurotoxicity with improved hepatic inflamma-tion, less detection of ROS and interleukin (IL)-6, and lowering blood total cholesterol (TC) and triglyceride (TG), while SO-injected group did not protect the CML-toxicity. Long-term supplementation of OSO (final 20%, wt/wt) with HCD for 6 months resulted higher sur-vivability than HCD alone group or HCD+SO group (final 20%, wt/wt) with significant lowering of plasma TC and TG levels. The HCD+OSO group showed the least hepatic in-flammation, fatty liver change, ROS, and IL-6 production. In conclusion, short-term treat-ment of OSO by injection exhibited potent anti-inflammatory activity against acute neuro-toxicity of CML in zebrafish and its embryo. Long-term supplementation of OSO in diet also revealed the highest survivability and blood lipid-lowering effect through potent an-ti-oxidant and anti-inflammatory activity.

The electronic structure of 7/9-AGNR superlattices with up to eight unit cells has been studied by means of state of the art Density Functional Theory (DFT) and also by two model Hamiltonians, the first one including only local interactions (Hubbard model, Hu) while the second one is extended to allow long-range Coulomb interactions (Pariser, Parr and Pople model, PPP). Both are solved within mean field approximation. At this approximation level, our calculations show that 7/9 interfaces are better described by spin non-polarized solutions than by spin-polarized wavefunctions. Consequently, both Hu and PPP Hamiltonians lead to electronic structures characterized by a gap at the Fermi level that diminishes as the size of the system increases. DFT results show similar trends although a detailed analysis of the density of states around the Fermi level shows quantitative differences with both Hu and PPP models. Before improving model Hamiltonians, we interpret the electronic structure obtained by DFT in terms of bands of topological states: topological states localized at the system edges and extended bulk topological states which interact between them due to the long-range Coulomb terms of Hamiltonian. After careful analysis of the interaction among topological sates, we find that the discrepancy between ab initio and model Hamiltonians can be resolved considering a screened long-range interaction that is implemented adding an exponential cutoff to the interaction term of PPP model. In this way, an adjusted cutoff distance λ = 2 allows a good recovery of DFT results. In view of this, we conclude that the correct description of the density of states around the Fermi level (Dirac point) needs the inclusion of long-range interactions well beyond Hubbard model but not completely unscreened as is the case for the PPP model.

Long-term safety of a nutraceutical combination based on agnus castus and magnolia extracts combined with soy isoflavones (SI) and lactobacilli, and effectiveness on vasomotor symptoms and sleep disorders in postmenopausal women, were assessed. A controlled study was carried-out in menopausal women comparing this nutraceutical combination (ESP group) with formulation containing isoflavones alone (C group), at the dosage recommended. Kuppermann index, PSQI, and SF-36 were determined at baseline, 3, 6 and 12 months. Endometrial thickness, mammary density and liver function were evaluated at baseline and after 12 months. 180 women (100 in ESP group and 80 in C group, mean age 55.5 years, in menopause for about 36 months) were enrolled in the study. At the treatment end, mammary density, endometrial thickness, and hepatic function did not show substantial differences between groups. Kuppermann index, and particularly hot flushes, were progressively and significantly decreased in frequency and severity during ESP versus C treatment. No adverse events were observed. Agnus castus and magnolia, combined with SI + lactobacilli, can effectively and safely be used in symptomatic postmenopausal women, mainly when quality of sleep is the most disturbing complaint. Endometrium, mammary glands and liver function, were unaffected after 12 months treatment.

The basic oxygen furnace slag (BOF) was wide used in road construction, but there was a lack of characteristics in different asphalt mixtures. This study investigates the properties of hot-mixed asphalt (HMA) containing stone mastic asphalt (SMA), porous asphalt (PA) and dense-graded BOF as a partial substitution for natural aggregates. The purpose of this study is to evaluate various BOF slag contents in the asphalt mixtures would affect the cooling behavior after compaction. Asphalt mixture specimens contained 0%, 20%, 40% and 60% BOF slag, respectively, as coarse aggregate. Test results showed that BOF slag has a lipophilic property, so it can be adsorbed by asphalt cement, thereby reducing the cost of asphalt. The stability value of all asphalt mixtures increases with the proportion of BOF slag replacement. In addition, the voids in the mineral aggregate (VMA) value variable exhibited significant differences among asphalt mixtures, and could determine the deviation of the cooling trend of asphalt mixtures. Furthermore; it was found that the cooling procedure of the BOF slag used in dense-graded asphalt mixture takes about 100 min, and that the temperature tends to be moderate; however, it took about 120 min of cooling the SMA and PA mixture with BOF slag. In addition, the voids distribution of dense asphalt mixture was not uniform. It would result in various locations of thermal energy temperature on asphalt mixtures that were inconsistent.

Background: The validation of laser usage during laparoscopic procedures, notably by Camran Nezhat in the late 1980s, has been significant. Lasers offer precision and depth control in tissue vaporization without bleeding. Surgical intervention remains central in managing endometrio-sis-associated pain and infertility, especially for patients unresponsive to hormonal therapy. Methods: This retrospective cohort study included 200 patients with SPE who underwent laparo-scopic laser vaporization. Surgery was performed using a CO2 laser, and histological confirma-tion of endometriosis was obtained for all cases. Pain scores and SF-36 questionnaire domains were assessed preoperatively and postoperatively. Fertility outcomes were evaluated among pa-tients desiring pregnancy. Results: Significant improvements in pain score and SF-36 questionnaire domains were ob-served postoperatively (p-value

Urban rail transit hub platform is the most important area for passenger flow distribution. In order to calculate passenger flow volume in platform and evaluate platform service level during rush hours, this paper presents a method for modeling and simulation of passenger flow distribution in platform. Passenger flow distribution model (PFDM) is proposed based on the basic analysis and the superposition principle of passenger flow. Simulation design for PFDM is proposed by Anylogic, which contains simulation process and simulation model. Experiment results show that PFDM and simulation design are effective and accordant with the reality scenario, and the simulation precision is comparatively ideal. This research could provide a beneficial reference for train scheduling and operation management under the viewpoint of traffic safety and service level.

With the rapid development of earth observation, satellite navigation, mobile communication and other technologies, the order of magnitude of the spatial data we acquire and accumulate is increasing, and higher requirements are put forward for the application and storage of spatial data. Under this circumstance, a new form of spatial data organization emerged-the global discrete grid. This form of data management can be used for the efficient storage and application of large-scale global spatial data, which is a digital multi-resolution the geo-reference model that helps to establish a new model of data association and fusion. It is expected to make up for the shortcomings in the organization, processing and application of current spatial data. There are different types of grid system according to the grid division form, including global discrete grids with equal latitude and longitude, global discrete grids with variable latitude and longitude, and global discrete grids based on regular polyhedrons. However, there is no accuracy evaluation index system for remote sensing images expressed on the global discrete grid to solve this problem. This paper is dedicated to finding a suitable way to express remote sensing data on discrete grids, and establishing a suitable accuracy evaluation system for modeling remote sensing data based on hexagonal grids to evaluate modeling accuracy. The results show that this accuracy evaluation method can evaluate and analyze remote sensing data based on hexagonal grids from multiple levels, and the comprehensive similarity coefficient of the images before and after conversion is greater than 98%, which further proves that the availability hexagonal grid-based remote sensing data of remote sensing images. And among the three sampling methods, the image obtained by the nearest interpolation sampling method has the highest correlation with the original image.

The purpose of this study was to evaluate the outcomes of implants placed in horizontally augmented alveolar ridges using porcine bone grafts and to investigate the long-term stability of the porcine bone grafts. A retrospective analysis was conducted on 55 sites that underwent horizontal ridge augmentation using porcine bone grafts and implant placement with a follow-up period longer than 5 years. Furthermore, additional analysis was conducted on 24 sites where porcine bone grafts were used exclusively and implants were placed simultaneously with horizontal ridge augmentation. The mean follow-up period after prosthesis loading was 67.3 months, with a mean marginal bone loss of 0.18 mm at 1 year and a cumulative mean marginal bone loss of 0.37 mm over the entire follow-up period. Of the 55 implants, 2 were lost and 4 did not meet the success criteria, resulting in a survival rate of 96.4% and a success rate of 89.1%. In 24 sites, the mean marginal bone loss was 0.22 mm at 1 year and 0.40 mm at 65.8 months, with 100% survival and success rates. Porcine bone grafts can be successfully used in horizontal ridge augmentation for implant placement in cases of ridges with insufficient horizontal width.

Background/Objectives: Vitamin B12 deficiency can cause variable symptoms, which may be irreversible if not diagnosed and treated in a timely manner. We aimed to develop a widely accepted expert consensus to guide the practice of diagnosing and treating B12 deficiency. Methods: We conducted a scoping review of the literature published in PubMed since January 2003. Data were used to design a two-round Delphi survey to study the level of consensus among 42 experts. Results: The panelists agreed on the need for educational and organizational changes in the current medical practices for diagnosing and treating B12 deficiency. Recognition of clinical symptoms should receive the highest priority in establishing the diagnosis. There is agreement that the serum B12 concentration is useful as a screening marker, whereas methylmalonic acid or homocysteine can support the diagnosis. Patient lifestyle, disease history and medications can provide clues to the cause of B12 deficiency. Regardless of the cause of the deficiency, initial treatment with parenteral B12 was regarded as the first choice for patients with acute and severe manifestations of B12 deficiency. The use of high-dose oral B12 at different frequencies may be considered for long-term treatment. Prophylactic B12 supplementation should be considered for specific high-risk groups. Conclusions: There is a consensus that clinical symptoms need to receive more attention in establishing a diagnosis. B12 laboratory markers can support the diagnosis. The severity of clinical symptoms, the causes of B12 deficiency and the treatment goals govern decisions regarding the route and dose of B12 therapy.

The need for cross-modal retrieval (CMR) among users is growing because of the swift advancements in computer vision and natural language processing. Promoting home operating systems is greatly aided by the openKylin home operating system. It is focused on enhancing the functionality of the operating system with safe and dependable operating technologies. Practical implications abound for integrating computer vision research into home operating systems. A multimodal retrieval approach based on openKylin is presented to improve the usability of text search graphs, audio, and video. The overview of pertinent domestic and international research is the main topic of this article. This technological advancement. It then offers details on the design, implementation procedure, and final implementation outcomes for demonstration. The works of natural operations show that this strategy has excellent accuracy and performance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

(1) Background: Sleep disordered breathing represent a growing public health concern, especially among children and adolescents. Full-night polysomnography is considered the gold standard for diagnosing obstructive sleep apnea. Our goals are to identify personal and environmental risk factors for the onset and persistence of sleep respiratory disorders. We also want to investigate the differences in neuropsychological profiles; (2) Methods: This is an observational, retrospective cohort study. We collected information on adenoidectomy or adenotonsillectomy. We reviewed the clinical history and preoperative visits and collected data through a telephone questionnaire. Pediatric Sleep Questionnaire (PSQ) and the Pediatric Quality of Life Inventory (PedsQL) are questionnaires used for screening sleep respiratory disorders in children. The data were statistically analyzed it using SPSS version 22.0 for Windows (SPSS Inc., Chicago, IL); (3) Results: The study involved 138 patients, but only 100 parents participated. A higher percentage of patients with sleep disordered breathing were observed to have mothers who smoked during pregnancy. A smaller proportion of patients with sleep disordered breathing had a habit of using a pacifier. A rise in physical results is associated with a reduction in the PSQ at follow-up (p=0.051). An increase of overall academic achievement is associated with an average decrease in the PSQ at follow-up (p<0.0001). A more significant proportion of patients undergoing adenotonsillectomy were observed to have a history of prematurity and cesarean birth (4) Conclusions: These results provide essential information on the effectiveness and effects of adenotonsillectomy intervention compared to adenoidectomy intervention and the factors associated with SDB in children undergoing these interventions.

Pruning is one of the most important tree fruit production activities, which is highly dependent on human labor. Skilled labor is in short supply, and the increasing cost of labor is becoming a big issue for the tree fruit industry. Growers are motivated to seek mechanical or robotic solutions for reducing the amount of hand labor required for pruning. This paper reviews the research and development of sensing and automated systems for branch pruning for tree fruit production. Horticultural advancements, pruning strategies, 3D structure reconstruction of tree branches, as well as practice mechanisms or robotics are some of the developments that need to be addressed for an effective tree branch pruning system. Our study summarizes the potential opportunities for automatic pruning with machine-friendly modern tree architectures, previous studies on sensor development, and efforts to develop and deploy mechanical/robotic systems for automated branch pruning. We also describe two examples of qualified pruning strategies that could potentially simplify the automated pruning decision and pruning end-effector design. Finally, the limitations of current pruning technologies and other challenges for automated branch pruning are described, and possible solutions are discussed.

Accurate and reliable mid-long runoff prediction (MLTRP) is of great importance in water re-sources management. However the MLTRP is not suitable in each basin and how to evaluate the applicability of MLTRP is still a question. Therefore, the total mutual information (TMI) index is developed in this study based on the predictor selection method using mutual information (MI) and partial MI (PMI). The relationship between the TMI and the predictive performance of five models is analyzed by applying five models in 222 forecasting scenarios in Australia. The results over 222 forecasting scenarios demonstrate that, compared with the MI, the developed TMI index can better represent the available information in the predictors, and has more significant negative correlation with the RRMSE with the correlation coefficient between -0.62 and -0.85. This means the model's predictive performance will become better along with the increase of TMI, and there-fore the developed TMI index can be used to evaluate the applicability of MLTRP. When TMI is more than 0.1, the available information in the predictors can support the construction of MLTRP models. In addition, the TMI is used to partly explain the difference of predictive performance among five models. In general, the complex models, which can better utilize the contained infor-mation, are more sensitive to the TMI, and have more significant improvement in terms of predic-tive performance along with the increase of TMI. This research can provide support for the study of MLTRP.

This study investigates the expression and prognostic value of TRIM6 in gliomas, the most prevalent primary brain and spinal cord tumors. Our results show that TRIM6 is predominantly overexpressed in glioma tissues and is associated with reduced overall survival, disease-specific survival, and progression-free interval. Furthermore, TRIM6 expression is correlated with WHO grade and primary treatment outcomes. Functional analysis indicates that interactions between cytokines and their receptors play a critical role in the prognosis of glioma patients. A protein-protein interaction network reveals 10 hub genes closely linked to cytokine-cytokine receptor interaction. In vitro experiments demonstrate that silencing TRIM6 impairs the proliferation, invasion, and migration of glioma cells, while overexpressing TRIM6 enhances these abilities. Additionally, TRIM6 expression is positively associated with the abundance of innate immune cells and negatively associated with the abundance of adaptive immune cells. In summary, TRIM6 is significantly upregulated in gliomas and linked to poor prognosis, making it a potential diagnostic and prognostic biomarker. TRIM6 plays a crucial role in promoting cell viability, clonogenic potential, migration, and invasion in glioma cells. It may regulate glioma progression by modulating cytokine-cytokine receptor interaction, leading to an inflammatory response and an imbalance in immunomodulation, thereby representing a potential therapeutic target.

Background: The effect of COVID-19 infection, versus the indirect effect of the pandemic on body composition remains unclear. This study investigates long-term changes in body composition in COVID–19 survivors compared to a contemporary control group. Method: This is a prospective study involving adults who had a pre-pandemic whole-body DXA scan (DXA#1) performed between 2017 and 2019. Participants were asked to return for a repeat whole-body DXA scan (DXA#2) after the pandemic. Detailed data were collected including medical and COVID history. Inflammation markers and fasting lipids were measured. For those participants who had a COVID-19 infection between the 2 DXAs, DXA#2 was acquired at least one year after COVID-19 infection. Results: Overall, 160 adults were enrolled; 32.5% females, 51.8% non-white, with mean age of 43.2 years. Half (n=80) of the participants had documented COVID infection between their 2 DXA scans (COVID+ group), and the other half never had COVID. COVID-negative participants had an increase in annualized trunk fat (g) [922.5 vs. 159.7; P=0.01], total fat (g) [1564.3 vs. 199.9; P=0.2], and LBM (g) [974.9 vs. -64.5; P=0.0002], when compared to COVID+ group. However, among the COVID+ group, no differences were seen in annualized trunk fat, total fat mass, or LBM between those with PASC and without (p>0.05). Conclusion: During the pandemic, both COVID-19-survivors and COVID-negative groups exhibited increases in weight, and total and trunk fat, likely associated with pandemic-linked lifestyle modifications. However, only COVID-19-survivors had a decline in lean body mass over the same period, regardless of PASC symptoms.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

COVID-19 patients can recover with a median SARS-CoV-2 clearance of 20 days post initial symptoms (PIS). However, we observed some COVID-19 patients with existing SARS-CoV-2 for more than 50 days PIS. This study aimed to investigate the cause of viral clearance delay and the infectivity in these patients. Demographic data and clinical characteristics of 22 long-term COVID-19 patients were collected. SARS-CoV-2 nucleic acid, peripheral lymphocyte count, and functionality were assessed. SARS-CoV-2-specific and neutralization antibodies were detected, followed by virus isolation and genome sequencing. The median age of the studied cohort was 59.83±12.94 years. All patients were clinically cured after long-term SARS-CoV-2 infection ranging from 53 to 112 days PIS. Peripheral lymphocytes counts were normal. Interferon gamma (IFN-ƴ)-generated CD4+ and CD8+ cells were normal as 24.68±9.60% and 66.41±14.87%. However, the number of IFN-ƴ-generated NK cells diminished (58.03±11.78%). All patients presented detectable IgG, which positively correlated with mild neutralizing activity (ID50=157.2, P=0.05). SARS-CoV-2 was not isolated, and a cytopathic effect was lacking. Only three synonymous variants were identified in spike protein coding regions. In conclusion, decreased IFN-γ production by NK cells and low neutralizing antibodies might favor SARS-CoV-2 long-term existence. Further, low viral load and weak viral pathogenicity was observed in COVID-19 patients with long-term SARS-CoV-2 infection.

In all forms of folk beliefs, ancestor worship is a universal traditional belief form of the Vietnamese people. As a Vietnamese people, “everyone worships their ancestors, everyone worships their parents and grandparent”. Ancestor worship is a common belief in the whole country. It is a belief that expresses the deeply humanistic spirit of the Vietnamese people and has great values in human life. So, what is the nature of ancestor worship? What is the values of ancestor worship in life? And in the context of globalization, how has this the belief changed? This study focuses on analyzing the above contents, thereby highlighting the value of this belief in the spiritual life of Vietnamese people; to point out the positive and negative changes of this belief in the current period; from that, take the right measures to bring into play the positive and limit the negative side of those changes in the spiritual life of Vietnamese people.

The pursuit of Artificial Intelligence (AI) that emulates human cognitive processes is a cornerstone of ethical AI development, ensuring that emerging technologies can integrate seamlessly into societal frameworks requiring nuanced understanding and decision-making. Zero-Shot Instance Retrieval (ZSIR) stands at the forefront of this endeavour, potentially providing a robust platform for AI systems, particularly large visual language models, to demonstrate and refine cognition-aligned learning without the need for direct experience. In this paper, we critically evaluate current cognition alignment methodologies within traditional zero-shot learning paradigms, using visual attributes and word embedding generated by large AI models. We propose a unified similarity function that quantifies the cognitive alignment level, bridging the gap between AI processes and human-like understanding. Through extensive experimentation, our findings illustrate that this similarity function can effectively mirror the visual-semantic gap, steering the model towards enhanced performance in zero-shot instance retrieval. This work not only benchmarks the cognition alignment of AI, but also sets a new precedent for the development of visual language models attuned to the complexities of human cognition.}

Button batteries pose a significant threat to young children and are found in many household items and children’s toys. Along with product manufacturers and retailers, parents and caregivers have a role in button battery ingestion prevention through vigilance regarding items containing button batteries in the home, and knowledge of button battery ingestion symptoms. There is limited information available about parent and caregiver perspectives towards button battery safety. Identifying the areas where increased education is required is important for informing safety campaigns and delivering targeted education. This study aimed to examine parent and caregiver elemental perspectives on button battery safety. One hundred and seventy-four parents and caregivers of children aged 0 to 5 completed a cross-sectional online survey. Distribution occurred via social media. The survey contained multiple-choice questions pertaining to button battery perspectives, and one open-ended question. Respondents recognized the dangers of button battery ingestion, yet only 37% reported being familiar with button battery ingestion symptoms. While 68% knew of household items containing button batteries, only 21% were aware of product recall information sources. Approximately 64% understood immediate post-ingestion steps and 17% found current safety labels unsatisfactory. In an open-ended question, parents and caregivers provided comments about button battery safety that revealed five broad themes; supervision and education; safe storage of button batteries in the home; ensuring children cannot access button batteries; disposing of button batteries safely; and avoiding purchasing items containing button batteries. This study provides a foundation for ongoing investigation of parent and caregiver perspectives on button battery home safety.

Both in lung adenocarcinoma (LUAD) and severe acute respiratory syndromes (SARS) uncontrolled inflammation could be detected in lung tissue. Whether the similarity mechanism exists is still unknown. PDZ-binding motif (PBM) in SARS-CoV E protein has been demonstrated as virulence factor induce inflammation storm. Study function of PBM in LUAD is significant for mechanism exploration of carcinogenesis mediated by SARS-CoV. To identify gene expression fluctuation induced by PBM, a microarray sequencing data of lung tissue infected by wild type (SARS-CoV-E-wt) and recombinant virus (SARS-CoV-E-mutPBM) was analysis followed by functional enrichment analysis. To understand the role of screened specific genes in LUAD, overall survival and immune correlation were calculated. A total of 12 genes (MAPK1, PRKCA, FGFR4, KDR, PTPRD, BCL2L15, UBD, MAMDC2, LTBP4, PTPRB, LGI3 and ITGA8) might participate in initial and development stage of LUAD through expression variation and mutation. Meanwhile, a total of 12 genes (CARHSP1, EIF4E2, HMGA1, IL1R2, MAGOHB, PVR, ADCY9, ELF5, ESYT3, SCML4, SECL14L4 and THRA) could lead to poorer prognosis via dysregulation. In addition, MAMDC2 and ITGA8 down-regulated by PBM could also alter prognosis. Though the conservative PBM (-D-L-L-V-) could be found at the end of carboxyl terminal in multi E proteins of coronaviruses, the specific function of each one depend on the whole amino acid sequence simultaneously. In conclusion, PBM of SARS-CoV E protein could promote carcinogenesis of LUAD by dysregulating important gene expression profiles followed by influence immune response and overall prognosis. The results in present study also provided reference for the therapy of SARS-CoV-2 in LUAD patients.

Mutations of PKD1 coding for polycystin-1 (PC1) account for most of the autosomal dominant polycystic kidney disease (ADPKD). The extracellular region of PC1 contains many evolutionarily conserved domains for ligand interactions. Among these is the leucine-rich repeats (LRR) in the far N-terminus of PC1. Using zebrafish (Danio rerio) as an in vivo model system, we explored the role of LRR in the function of PC1. Zebrafish expresses two human PKD1 paralogs, pkd1a and pkd1b. Knockdown of both genes in zebrafish by morpholino antisense oligonucleotides produced phenotypes of dorsal axis curvature and pronephric cyst formation. We found that overexpression of LRR suppressed both phenotypes in pkd1-morphant zebrafish. Purified recombinant LRR domain inhibited proliferation of HEK cells in culture and interacted with the heterotrimeric basement membrane protein laminin-511 (α5β1γ1) in vitro. Mutations of amino acid residues in LRR structurally predicted to bind laminin-511 disrupted LRR-laminin interaction in vitro and neutralized the ability of LRR to inhibit cell proliferation and cystogenesis. Our data support the hypothesis that the extracellular region of PC1 plays a role in modulating PC1 interaction with the extracellular matrix and contributes to cystogenesis of PC1-deficiency.

Urea cycle disorders (UCDs) are common inborn errors of metabolism, with an incidence of one in 30,000 births. They are caused by deficiencies in any of six enzymes and two carrier proteins, the most common being Ornithine Transcarbamylase Deficiency (OTCD). OTCD results in impairment to excrete nitrogen, causing toxic buildup of ammonia with resultant encephalopathy. Hyperammonemia (HA) induces the conversion of glutamate to glutamine in the brain. Excess glutamine in the brain causes osmotic changes cerebral edema, changes in astrocyte morphology, and cell death. Acute symptoms of HA include vomiting, hyperventilation, seizures, and irritability. Long-term neurological changes include deficits in working memory and executive function. To date, there are no predictors of prognosis of infants with neonatal onset OTCD outside of plasma ammonia level at presentation and duration of hyperammonemic coma. We provide a comprehensive analysis of a 16-year-old male with neonatal onset of OTCD as an example of how brain biomarkers may be useful to monitor disease course and outcome. This male presented at 8 days post natal with plasma ammonia and glutamine of 677 and 4024 micromol/L and had a missense mutation in Exon 4 (p.R129H). Treatment included protein restriction, sodium benzoate, and citrulline, arginine, and iron. He suffered recurrent acute hyperammonemic episodes despite compliance, triggered by infections or catabolic stressors. We discuss the long-term effects of the hyperammonemic episodes by following MRI based disease biomarkers.

Recently, the awareness of energy conservation, carbon emission reduction, and environmental protection in Taiwan has begun to gradually improve, and bicycles have become an important vehicle for residents. In 2009, Kaohsiung began promoting public bicycle sharing. The number of users in that year amounted to 140,000. By 2015, the accumulated number of users reached nine million. This study adopted the Theory of Planned Behavior (TPB) to explore the factors influencing the behavioral intentions of public bicycle users, including the three dimensions of attitude, subjective norm, and perceived behavioral control, and probed into the relationship between the factors influencing the behavioral intentions of public bicycle users in Kaohsiung City and the dimensions. This study used a questionnaire to collect data and SPSS & AMOS for statistical analysis. The empirical results demonstrated that the most prominent factors influencing the behavioral intentions of public bicycle users in Kaohsiung City included perceived behavioral control, attitude, and subjective norm, in order. Among the influencing factors in the three dimensions, personal interests, main groups, and self-competence had a positive and significant correlation. Administrators should provide more incentives related to the three influencing factors to encourage the public in Kaohsiung City to use public bicycles more frequently as their short-distance travel mode, so as to achieve the purposes of saving energy, reducing carbon emissions, and protecting the urban environment.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

This study explored the effects of cryogenic treatment on the microstructure, hardness, and wear-resistance of diamond-like carbon (DLC) by cryogenically treating NAK 80 mold steel coated with DLC. Raman spectroscopy analyzed the structure of the DLC film. Nanoindenter analyzed the hardness and Young’s modulus of the film, and their relationship determined the wear resistance. Wear test assessed the wear rate and friction coefficient of the DLC film. The results showed that cryogenic treatment increased the rate of carbide precipitation and refined the grain structure. Raman spectroscopy indicated that the Raman intensity rate (I_D/I_G) of treated DLC films was smaller than those without cryogenic treatment. When the sp3 bond increased, the hardness and wear-resistance of the DLC film also increased.

The microstructure evolution during the cold rolling and subsequent annealing of Alloy 800H was investigated. Two distinct rolling methods, unidirectional rolling and cross-rolling, were intro-duced. Results show that better ductility was observed in the unidirectional rolling than in cross-rolling, whilst a higher volume fraction of large deformed grains was observed in the cross-rolled plates than in the unidirectionally rolled plates. Recrystallization occurred faster in plates from unidirectional rolling than from cross-rolling.

In this tutorial review, we compare and contrast the chemical mechanisms of electrophile/oxidant sensing, and the molecular mechanisms of signal propagation. We critically analyze biological systems in which these different pathways are believed to be manifest and what the data really mean. Finally, we discuss applications of this knowledge to disease treatment and drug development.

Static standing postural stability has been measured by multiscale entropy (MSE), which is used to measure complexity. In this study, we used the average entropy (AE) to measure the static standing postural stability, as AE is a good measure of disorder. The center of pressure (COP) trajectories were collected from 11 subjects under four kinds of balance situation, from stable to unstable: bipedal with open eyes, bipedal with closed eyes, unipedal with open eyes, and unipedal with closed eyes. The AE, entropy of entropy (EoE), and MSE methods were used to analyze these COP data, and EoE was found to be a good measure of complexity. The AE of the 11 subjects sequentially increased by 100%as the balance situations progressed from stable to unstable, but the results of EoE and MSE did not follow this trend. Therefore, AE, rather than EoE or MSE, is a good measure of static standing postural stability. Furthermore, the comparison of EoE and AE plots exhibited an inverted U curve, which is another example of a complexity versus disorder inverted U curve.

As the application of cyber-physical systems (CPSs) becomes more and more widespread, its security is becoming a focus of attention. Currently, there has been much research on the security defense of the physical layer of the CPS. However, most of the research only focuses on one of the aspects, for example, attack detection, security state estimation or recovery control. Obviously, the effectiveness of security defense targeting only one aspect is limited. Therefore, in this paper, a set of security defense processes is proposed for the case that a CPS containing multiple sensors is subject to three kinds of stealthy attacks (i.e., zero-dynamics attack, covert attack, and replay attack). Firstly, the existing attack detection method based on improved residuals is used to detect stealthy attacks. Secondly, based on the detection results, an optimal state estimation method based on improved Kalman filtering is proposed to estimate the actual state of the system. Then, based on the optimal state, internal model control (IMC) is introduced to complete the recovery control of the system. Finally, the proposed methods are integrated to give a complete security defense process, and the simulation is verified for three kinds of stealthy attacks. The simulation results show that the proposed methods are effective.

For several years, drugs bearing reactive electrophilic appendages have been developed. These units typically confer prolonged residence time of the drugs on their protein targets, and may assist targeting shallow binding sites and/or improving drug-protein target spectrum. Studies on natural electrophilic molecules have indicated that in many instances natural electrophiles use similar mechanisms to alter signaling pathways. However, natural reactive species are also endowed with other important mechanisms to hone signaling properties that are uncommon in drug design. These include ability to be active at low occupancy and elevated inhibitor kinetics. Here we discuss how we have begun to harness these properties in inhibitor design.

Li₂MnO₃ is critical component in the well-studied Li-excess cathode materials xLi₂MnO₃•(1- x)LiMO₂ for achieving high lithium storage capacity. In this article, the diffusion of Li ions in Li₂MnO₃ is studied using molecular dynamics (MD) simulation with well-behaved empirical force fields obtained by fitting against the crystal structure from experiment and phonons calculated using Density Function Theory (DFT). We have found two possible tetrahedral hopping channels, 0-TM and 1-TM(Mn⁴⁺) channel, which are differentiated by the face sharing octahedral cations. Simulation results show that the 0-TM channel is active for Li hopping, while 1-TM(Mn4+) channel is inactive. During the delithiation process, the Li ions in the TM layered are firstly removed, then those in the Li layer. However, the Li ions will be trapped in the tetrahedral 0-TM channels as long as the four face sharing octahedral sites are cleared. Up to x=1.0 for Li₂-xMnO₃, almost all the Li ions are located at the tetrahedral sites, forming a regular array along a axis. The de-intercalation of tetrahedral Li ions requires a high voltage (>5.2 V vs. Li/Li+), limiting the practical capacities measured in lab. The diffusion of Mn ions into the Li layers is observed in a deeper delithiated structure (x=1.2 for Li₂-xMnO₃), indicating an initial phase transformation to a spinel-like structure. However, the Mn ions are mainly trapped in the tetrahedral sites in the Li layer, instead of the octahedral sites fin spinel-like structure. A few of Mn ions diffusing into the octahedral sites in Li layers have no face sharing tetrahedral Li ions, revealing a further Li de-intercalation is imperative for the complete phase transformation. Our model is not stable for x≥1.4 in Li₂-xMnO₃. Other charge compensation mechanism should be considered in this high delithiation stage, eg. oxygen release.

The long-term use of fertilizers and pesticides in conventional cultivation has resulted in a decrease in soil productivity and vegetable yields in greenhouses. However, only a limited number of studies have explored the impacts of organic cultivation on greenhouse soil. Specifically, there is a scarcity of research examining the alterations in soil aggregate mediated organic carbon and microbial communities, which are known to enhance soil productivity. This study investigated the properties of soil aggregates, including the levels of organic carbon fractions, microbial community, and enzyme activity with the three aggregate classes microaggregates (<0.25 mm), small macroaggregates (2-0.25 mm) and large macroaggregates (>2 mm). These investigations were conducted under three different cultivation methods in a greenhouse: conventional cultivation (CC), integrated cultivation (IC), and organic cultivation (OC) in greenhouse. The results showed that (1) OC and IC promoted the formation of small macro-aggregates and enhanced aggregate stability compared to CC, (2) SOC in the three size fractions of OC increased by 98.99%-92.06% compared to CC; EOC increased by 98.47%-117.59%; POC increased by 138.59%-208.70%; MBC increased by 104.71%-230.61%; DOC increased by 21.93%-40.90%, respectively; (3) Organic cultivation significantly increased enzyme activity in all three particle size aggregates and increased the relative abundance of bacteria in micro-aggregates as well as the relative abundance of fungi in small macro-aggregates. Structural equation model (SEM) analysis revealed that organic farming practices fostered the development of smaller macro-aggregates, elevated microbial and enzyme activities within soil aggregates, and facilitated the conversion of soil nutrients and carbon sequestration. consequently, this led to an increase in soil organic carbon content and improved vegetable yield in greenhouse environments. In conclusion, the soil carbon content and vegetable yield are enhanced through long-term organic cultivation in greenhouses, primarily by increasing the proportion of small macro-aggregates.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

This study investigates the effect of perceived discrimination on the mental health of Afghan refugees, and secondly, tests the distress moderating effects of pre-migration traumatic experiences and post-resettlement adjustment factors. In a cross-sectional design, 259 Afghans completed surveys assessing perceived discrimination and a number of other factors using scales developed through inductive techniques. Multivariate analyses consisted of a series of hierarchical regressions testing the effect of perceived discrimination on distress, followed by a sequential analysis of moderator variables. Perceived discrimination was significantly associated with higher distress, and this relationship was stronger among those with a strong intra-ethnic identity, high civic engagement, and high pre-resettlement traumatic experiences. Discrimination is a significant source of stress for Afghan refugees, which may exacerbate stresses associated with other post-migration stressors. Future research is needed to tailor interventions that can help mitigate the stress associated with discrimination among this highly vulnerable group.

The NP method was used to elucidate the contributions of vehicles and coal combustion to seasonal and long-term atmospheric PM-bound Pyr and 1-NP concentrations in Kanazawa, Kitakyushu, Shenyang, and Shanghai in the Western Pacific region from 1997 to 2021. Among the four cities, Kanazawa demonstrated the lowest Pyr concentration. The contribution of vehicles to Pyr before and after 2010 were 35% and 5%, respectively. The 1-NP concentration reduced by a factor of more than 1/10. These changes can be attributed to the emission control from vehicles. Kitakyushu revealed the second lowest Pyr and the lowest 1-NP concentrations. Coal combustion was found to be the main contributor to Pyr, while its contribution to 1-NP increased from 9% to 19%. The large contribution of coal combustion is attributed to iron manufactures. Shenyang demonstrated the highest atmospheric Pyr concentration with its largest seasonal change. Vehicles are the largest contributors to 1-NP. However, coal combustion, including winter coal heating, contributed 97% or more to Pyr and more than 14% to 1-NP. Shanghai revealed the second highest Pyr and 1-NP concentrations, but the former was substantially lower than in Shenyang. Coal combustion was the major contributor, but the contribution of vehicles to Pyr was larger before 2010 similar to Kanazawa.

Management of chronic inflammation and wounds has always been a key issue in the pharmaceutical and healthcare sector. Curcumin (CCM) is an active ingredient extracted from turmeric rhizomes that has antioxidant, anti-inflammatory, and antibacterial activities, thus showing significant effectiveness toward wound healing. However, its shortcomings such as poor water solubility, poor chemical stability and fast metabolic rate limit its bioavailability and long-term use. In this context, hydrogels appear to be a versatile matrix for carrying and stabilizing drugs due to the biomimetic structure, soft porous microarchitecture, and pleasant biomechanical properties. The drug loading/releasing efficiencies can also be controlled by use of highly crystalline and porous metal organic frameworks (MOFs). Here, a flexible hydrogel composed of sodium alginate (SA) matrix and CCM-loaded MOFs was constructed for long-term drug release and antibacterial activity. The morphology and physicochemical properties of composite hydrogels were analyzed by scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FT-IR), X-ray diffraction (XRD), ultraviolet visible spectroscopy (UV-Vis), Raman spectroscopy and mechanical property tests. The results showed that the composite hydrogel was highly twistable and bendable to mechanically comply with human skin. The as-prepared hydrogel could capture efficient CCM for slow drug release as well as effective killing of bacteria. Therefore, such composite hydrogel is expected to provide a new management system for chronic wound dressings.

Long Covid has many symptoms that overlap with ME(myalgic encephalomyelitis)/CFS(chronic fatigue syndrome), FM(fibromyalgia), EBV(Epstein-Barr virus), CMV(cytomegalovirus), CIRS (chronic inflammatory response syndrome), MCAS(mast cell activation syndrome), POTS(postural orthostatic tachycardia syndrome), and post viral fatigue syndrome. They all portend a “long haul” with an antioxidant shortfall and elevated Ca:Mg. Oxidative stress is the root cause. Linkage between TGF(transforming growth factor)-β, IFN(interferon)-γ, the RAS(renin angiotensin system), and the KKS(kallikrein kinin system) is discussed. Technical explanations for the renin aldosterone paradox in POTS, the betrayal of TGF-β, and the commonality of markers for the Warburg effect are offered. The etiology of the common Long Covid symptoms of post exertional malaise, fatigue, and brain fog as well as anosmia, hair loss, and GI symptoms is technically discussed. Ca:Mg is critical to the glutamate/GABA balance. The role of GABA and butyrates from the “good” intestinal bacteria in the gut-brain axis and its correlation with chronic fatigue diseases are explored. The crosstalk between the ENS(enteric nervous system) and the ANS(autonomic nervous system) and the role of the vagus in both are emphasized. HRV(heart rate variability), the fifth vital sign, points to an expanded gut-brain-heart/lung axis. A suggested approach to all of these - Long Covid, chronic fatigue diseases, post viral fatigue syndrome, and general health - is presented.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The present study aims to develop an efficient numerical method for computing the diffraction and radiation of water waves with horizontal long cylindrical structures, such as floating breakwaters. A higher-order scheme is used to discretize geometry of the structure as well as the relevant physical quantities. As the kernel of this method, Wehausen’s free-surface Green function is calculated by a newly-developed Gauss-Kronrod adaptive quadrature algorithm after elimination of its Cauchy-type singularities. To improve computational efficiency, a Chebyshev approximation approach is applied to a fast calculation of the Green function that needs evaluation thousands of times. In addition, OpenMP parallel technique is used to the formation of influence coefficient matrix, which significantly reduces CPU time. Finally, computations are performed on wave exciting forces and hydrodynamic coefficients for the long cylindrical structures, either floating or submerged. Comparison with other numerical and analytical methods demonstrates good performance of the present method.

Palmitoylethanolamide (PEA) has been prescribed for neuropathic pain for several years. This study is mainly addressed to summarize what has been published on the topic in the last decades, and how appropriate the numerous prescriptions are. Among others, it examines the innovative EquiPEA^® patent, which aims to address obstacles encountered with conventional PEA formulations. EquiPEA^® seems to partially ameliorate the bioavailability and the targeted distribution. It seems to introduce novel advancements that have the potential to enhance the therapeutic effectiveness of PEA in terms of its anti-inflammatory, antioxidant, and analgesic properties. The deep literature analysis aims to examine the potential advantages of this innovative formulation, in the context of several pathological conditions that may benefit from this molecule. In particular, it investigates the potential enhanced bioavailability and targeted delivery system of EquiPEA^®. Also, it tries to understand if it can modernize the field of therapy based on PEA, thus offering a better treatment option for individuals with long-term inflammation, oxidative stress, and neuropathic or mixed pain with a neuropathic component. The study examines the possible impact of EquiPEA^® on personalized medicine strategies and its potential for translation into clinical practice. It analyses the possibilities that EquiPEA^® has in enhancing patient outcomes in a range of central nervous system and inflammatory conditions. This narrative review makes a valuable contribution to the ongoing comprehension of PEA therapy. It establishes a foundation for further exploration in research and potential uses in clinical settings.

Transition metal alloys have emerged as promising electrocatalysts due to their ability to modulate key parameters such as d-band electron filling, Fermi level energy, and interatomic spacing, thereby influencing their affinity towards reaction intermediates. However, the structural stability of alloy electrocatalysts during alkaline hydrogen evolution reaction (HER) remains a subject of debate. In this study, we systematically investigate the structural evolution and catalytic activity of the c-Co/Co3Mo electrocatalyst under alkaline HER conditions. We reveal that the instability of the Co3Mo alloy and H0.9MoO3 during alkaline HER leads to the destruction of the crystal structure, resulting in the formation of hexagonal cobalt (h-Co) from hexagonal Co(OH)2 as an intermediate species. Furthermore, we explore the re-adsorption and surface coordination of the Mo element, which enhances the catalytic activity for alkaline HER. This work provides valuable insights into the dynamic behavior of alloy-based electrocatalysts, shedding light on their structural stability and catalytic activity during electrochemical reduction processes

(1) Background: Sudden Infant Death Syndrome (SIDS) represents unexplained and sudden deaths during the sleep of infants under one year of age, despite thorough investigation. Screening for prolonged QTc or Long QT Syndrome (LQTS) should be conducted on all newborns to reduce the incidence of SIDS. Neonatal electrocardiogram (ECG) could identify congenital heart defects (CHD) early, especially those not detected at birth. Infants with prolonged QT intervals typically undergo genetic analysis for Long QT Syndrome; (2) Methods: The study involved infants aged 20-40 days, born clinically healthy, with initial ECG screening. Infants with prenatal diagnoses or signs/symptoms of CHD identified immediately after birth, as well as those who underwent ECG or echocardiogram for other clinical or historical indications, were excluded from the study. The data were analyzed using SPSS version 22.0; (3) Results: Of the 42,200 infants involved, 2,245 were enrolled, with 39.9% being males. Subsequently, 164 children (37.8% males) with prolonged QT intervals underwent further diagnostic investigations. Genetic mutations were identified in 11 out of 18 tested children. The most common mutations were LQT1 (54.5%), LQT2 (36.4%), and LQT3 (1 patient). Medications used included propranolol (39.8%), nadolol (22.2%), inderal (11.1%), metoprolol (11.1%), and no treatment (16.7%). The most common abnormalities were focal right bundle branch block (54.5%), left axis deviation (9.2%), and nonspecific ventricular repolarization abnormalities (7.1%). Multiple anomalies were found in 0.47% of children with focal right bundle branch block. Structural abnormalities were associated with specific features in 267 patients (11.9%), primarily isolated patent foramen ovale (PFO) at 61.4%; (4) Conclusions: The screening has proven effective in early diagnosing Long QT Syndrome and other cardiac rhythm anomalies, with additional benefits in detecting mutations and/or QTc prolongations in family members. Identifying other ECG abnormalities and congenital heart malformations further enhances the benefits of the screening.

In these days of information overload and high-throughput analysis, it is easy to lose focus on the study of individual proteins. It is our conjecture that such investigations are still crucially important and offer uniquely penetrative insights. We thus present a discussion of biophysical methods to allow readers to get to know their protein of interest better. Although this perspective is not written with the expert in mind, we hope that for interdisciplinary scientists, or researchers who do not routinely perform biophysical analyses, the content will be helpful and inspiring.

Here we draw insights from the latest serendipitous findings made on the opposing roles of a validated drug-target protein Keap1. We weigh up how natural reactive electrophiles and electrophilic small-molecule drugs in clinical use directly impinge on seemingly conflicting, yet both Keap1-electrophile-modification-dependent, cell-survival- vs. cell-death-promoting behaviors. In the process, we convey how understanding reactive chemical-signal regulation at a single-protein-specific level is an enabling necessity in deconstructing otherwise intricate reactive-small-molecule-responsive cellular pathways. We hope this opinion piece further spurs the broader interests of basic and pharmaceutical research communities toward better understanding of molecular mechanisms underpinning reactive small-molecule-regulated signaling subsystems.

CoVID-19 is a multi-symptomatic disease which has made a global impact due to its ability to spread rapidly, and its relatively high mortality rate. Beyond the heroic efforts to develop vaccines, which we will not discuss, the response of scientists and clinicians to this complex problem has reflected the need to detect CoVID-19 rapidly, to diagnose patients likely to show adverse symptoms, and to treat severe and critical CoVID-19. Here we aim to encapsulate these varied and sometimes conflicting approaches and the resulting data in terms of chemistry and biology. In the process we highlight emerging concepts, and potential future applications that may arise out of this immense effort.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Based on functional magnetic resonance imaging and multilayer dynamic network model, the quantified temporal stability of brain network has shown potentials in predicting altered brain functions. The present review focuses on summarizing current knowledge on the commonly-used measures of brain network’s temporal stability and the clinical research progress on them. There are a variety of widely used measures of temporal stability such as the variance/standard deviation of dynamic functional connectivity strengths, the temporal variability, the flexibility (switching rate), and the temporal clustering coefficient, while there is no consensus to date that which measure is the best. The temporal stability of human brain networks may be associated with several factors such as sex, age, cognitive functions, head motion, and data preprocessing/analyzing strategies, which should be considered in the clinical studies. Multiple common psychiatric diseases such as schizophrenia, major depressive disorder, and bipolar disorder have been found to be related to altered temporal stability, especially during the resting state; generally, both excessively decreased and increased temporal stabilities were thought to reflect disease-related brain dysfunctions. However, the measures of temporal stability are still far from applications in clinical diagnoses for neuropsychiatric diseases partly because of the divergent results, and further studies are warranted.

Pericytes are increasingly recognized as being important in the control of blood-brain barrier permeability and vascular flow. Research on this important cell type has been hindered by widespread confusion regarding the phenotypic identity and nomenclature of pericytes and other perivascular cell types. In addition, pericyte heterogeneity and mouse-human species differences have contributed to confusion. Herein we summarize our present knowledge on the identification of pericytes and pericyte subsets in humans, primarily focusing on recent findings in humans and nonhuman primates. Precise identification and definition of pericytes and pericyte subsets in humans may help us to better understand pericyte biology and develop new therapeutic approaches specifically targeting disease-associated pericyte subsets.

This study utilises NaOH to treat composite cementitious materials containing aeolian sand and zeolite powders, which were used to replace 50% of the cement in aeolian-sand concrete (ASC). The mechanical properties of treated ASC considerably improved, especially when the NaOH dosage was 4% by mass. After curing this sample (denoted as AAZC-4) for 28 d, its compressive strength improved by 17.2% and its split tensile was increased by 16.3%. Potassium feldspar and montmorillonite in zeolite powder and SiO2 in the sand were decomposed by OH− and combined with other elements to generate various silicate gels and A-type potassium zeolite crystals inside the concrete. Microscopic examination showed that the gels and crystals intertwined to fill the pores, decreasing (increasing) the percentage of large (small) pores, thus optimising the pore structure. This substantially improved the mechanical properties of ASC. Freeze–thaw salt-intrusion tests showed that the extent of mass loss, degree of damage and loss of compressive strength of AAZC-4 were similar to those of ordinary concrete but were reduced by 36.8%, 19% and 52.1%, respectively, compared with those of ASC. Therefore, AAZC-4 has sustainable working performance in the chloride ion permeable environment in cold and arid areas.

Keywords: mHealth; peritoneal dialysis; functionality; usability

Direct and indirect effects after mine operations cease must ideally be subject to perpetual monitoring routines in order to detect possible risks or avoid adverse effects on the surrounding ecosystems at an early stage. In this contribution, mining subsidence lakes created inside the nature reserve Kirchheller Heide and Hilsfeld Forest are subjected to analysis for a long-term monitoring scheme. For this purpose, we employ high-resolution unmanned aerial system (UAS)-based multispectral and thermal mapping tools to provide a fast, non-invasive and multitemporal environmental monitoring method. Specifically, we propose to monitor vegetation evolution through multispectral analysis, biotypes identification using machine learning algorithms, and water surface extent detection, together with their thermal behavior. The aim of this contribution is to present the proposed workflow and first results to establish a baseline for future analyses and subsequent surveys for longterm multi-temporal monitoring

This study investigates the influence of expectations and trust on farmers' decisions regarding contractual choices in land transfer. The dataset used for analysis consists of 1101 households in Guizhou Province. The research focuses on two aspects: the selection between written and oral contracts, and the decision to continue the contractual relationship. The findings reveal that farmers' choices are significantly affected by their expectations and levels of trust.Specifically, when farmers' expectations regarding the land transfer process are not met, they tend to prefer written contracts over oral ones. This preference can be attributed to the greater clarity and risk reduction offered by written contracts. On the other hand, higher levels of trust increase the likelihood of farmers continuing the land transfer contract, as trust fosters a sense of confidence and security in the ongoing relationship.Interestingly, trust also plays a moderating role. Farmers who have aligned expectations and high levels of trust are more inclined to opt for oral contracts. This preference for oral contracts can be attributed to their flexibility and emphasis on interpersonal relationships, allowing for better adaptation to the changing dynamics of land transfer.These findings contribute to a deeper understanding of the factors influencing farmers' decision-making processes regarding contractual choices in land transfer. They provide valuable insights for policymakers involved in land transfer, enabling them to optimize policies and facilitate farmers' decision-making processes.

In this review paper, we discuss the use of BERT, one of the most well-liked deep learning-based language models. The model's operation mechanism, key areas of applicability to text analytics tasks, comparisons with related models for each activity, and a description of certain proprietary models are all covered in this work. The data from several dozen original scientific studies that have been published in the last few years and have garnered the greatest interest from the scientific community were systematized in order to prepare this review. All researchers and students who wish to learn about the most recent developments in the field of natural language text analysis may find this survey helpful. Bidirectional Encoder Representations from Transformers, or BERT for short, is the subject of a thorough investigation that we present. The area of natural language processing holds significant importance in the creation of intelligent systems. To do a variety of activities, one must comprehend the sentence's correct meaning in order to produce the desired result. Computers have a hard time understanding languages because of how context constantly changes. The main challenge in natural language processing tasks is getting computers to understand text context, and BERT is seen as a revolution in this regard. It picks up the language and its meaning in a manner that is quite similar to how the human brain processes meaning from sentences. Its capacity to identify a word from both the left and right contexts of a sentence makes it special. A new era in the perception and comprehension of natural languages has been ushered in with the development of BERT, which could help computers understand natural languages more fully. This study aims to provide readers with a deeper knowledge of the BERT language model and how it is applied to different NLP tasks.

The Covid‐19 pandemic, evolving needs of students & mentors, and the drive for global educational equality are collectively shifting how courses are packaged/distributed, ushering a more holistic approach and blending of fields. We recently created interdisciplinary courses in chemical biology aimed at massive open online and small private levels. These courses cover biology, chemistry, & physics, and concepts underlying modern chemical‐biology tools. We discuss what we learned while creating/overseeing these courses: content optimization and maintaining material freshness while fostering a stimulating learning environment. We outline mechanisms that help sustain student attention throughout rapidly‐moving courses, how to integrate adaptability to students’ needs in the short & long term, and speculate how we could have improved. We believe this will be an important guide for anyone wanting to develop online learning formats ideal for nurturing interdisciplinary scientists of tomorrow.

Both lung adenocarcinoma and SARS-CoV-2 infection could cause pulmonary inflammation. Angiotensin-converting enzyme 2, not only as the functional receptor of SARS-CoV-2 but also play key role in lung adenocarcinoma. To study the risk of SARS-CoV-2 infection in lung adenocarcinoma patients, mRNA and miRNA profiles were obtained from TCGA and GEO databases followed by bioinformatics analysis. A regulatory network which regards angiotensin-converting enzyme 2 as the center would be structured. In addition, via immunological analysis about key factors in lung adenocarcinoma patients, to explore the essential reasons for the susceptibility of SARS-CoV-2. Compared with normal tissue, angiotensin-converting enzyme 2 was increased in lung adenocarcinoma patients. Furthermore, a total of 7 differently expressed correlated mRNAs (ACE2, CXCL9, MMP12, IL6, AZU1, FCN3, HYAL1 and IRAK3) and 5 differently expressed correlated miRNAs (miR-125b-5p, miR-9-5p, miR-130b-5p, miR-381-3p and miR-421) were screened followed by enrichment analysis. Interestingly, toll-like receptor signaling pathway with the most frequent occurrence was enriched by mRNA (IL6) and miRNA (miR-125b-5p) sets simultaneously. Finally through comprehensive analysis, it was assumed that miR-125b-5p-ACE2-IL6 axis in the structured regulatory network could alter risk of SARS-CoV-2 infection in lung adenocarcinoma patients.

One of the most important pieces of equipment used in labs in culturing populations of fruit flies (Drosophila sp.) is that of the “CO₂ gas plate”, which is used to anesthesize individuals during “fly-pushing”. This piece of equipment consists of a box with a porous top into which carbon-dioxide is pumped. Flies placed on its surface are left immobilized, permitting the sorting, categorizing and/or counting of flies during population culturing and experimental assays. Unfortunately, commercially available gas plates are typically expensive. Here, we describe a new design for a gas plate that can be easily produced using a 3D printer and a laser cutter, which we are making freely available to the fly community.

Brine-dependent recovery process has seen much global research efforts in the past two decades because of their benefits over other oil recovery methods. The process involves the tweaking of the ionic composition and strength of the injected water to improve oil production. In recent years, several studies ranging from laboratory coreflood experiments by many researchers to field trials by several companies admit to the potential of recovering additional oil in sandstone and carbonate reservoirs. Sandstone and carbonate rocks are composed of completely different minerals, with varying degree of complexity and heterogeneity, but wettability alteration has been widely considered as the consequence rather than the cause of brine-dependent recovery. However, there is no consensus on the cause as several mechanisms have been proposed to relate the wettability changes to the improved recovery. This review paper aims to provide a state-of-the-art development in published research and various efforts of the industry. This review outlines an overview of laboratory and field observations, descriptions of underlying mechanisms and their validity, the complexity of the oil-brine-rock interactions, modelling works, and comparison between sandstone and carbonate rocks. The provided information is intended to provide the reader with up-to-date information, point to relevant studies for those who are new and those implementing either laboratory- or field-scale projects to speed up the process of further investigations in this research area. Overall, the outcome of this review would potentially be of immense benefit to the oil industry.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

In the paper, by the Faά di Bruno formula, several identities for the Bell polynomials of the second kind, and an inversion theorem, the authors simplify coefficients of two families of nonlinear ordinary differential equations for the generating function of the Catalan numbers and discover inverses of fifteen closely related lower triangular integer matrices.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Brain fog with compromised ability to concentrate has been the most frequent Long Covid (LC) complaint. This is due to an increased transforming growth factor (TGF) β/interferon (IFN)-γ ratio with consequently increased bradykinin (BKN), especially in Caucasian females. Brain and lung blood vessels “leak.” This same ratio is increased in Alzheimer’s disease (AD), but decreased in Parkinson’s disease (PD), because CD4⁺ and CD8⁺ T cells are differentially affected by the invading associated viruses, e.g., SARS CoV2, HIV, Varicella Zoster (VZV) aka Human Herpesvirus 3 (HHV3), HBV, HCV, …. In Covid-19 CD147 receptors on immune cells are critical in generating the increased TGF-β/IFN-γ and those on endothelial cells, platelets, and erythrocytes are critical to the abnormal microvascular blood flow. ACE2 receptors on pneumocytes and enterocytes enable pulmonary and GI entry, initiating gut dysbiosis. Epigenetics, methylation, magnesium, vitamin D, the B vitamins, and antioxidants suggest that these issues can be surmounted. Biochemical, physiologic, and epidemiologic data are analyzed to answer these questions. An LC model is presented and discussed in the context of the most recent research. Suggestions to avoid these and other worrisome concerns are included. Other topics discussed include estrogen, the gut microbiome, type 2 diabetes (T2D), and homocysteine.

Leading and lagging Key performance indicators (KPIs) provide a means for assurance that risk control systems, to prevent or limit major hazards. The relative importance degree of KPIs provides a theorical guidance for monitoring, inspection and maintenance of structural integrity. In this paper, structural integrity KPIs are classified into leading and lagging KPIs based on Bowtie methodology and the importance degree of the KPIs are evaluated by weight calculation on the basis of Fuzzy analytical hierarchy process (FAHP).

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

The article delves into the intricate phase transitions of 1-Octadecanol and n-Nonadecane within a binary system, unveiling dynamic structural changes under varying conditions. Through Fouri-er-transform infrared (FTIR) analysis, specific molecular vibrations were identified, shedding light on the molecular composition and interactions. The study highlights the challenges in detecting subtle phase transitions and emphasizes the individuality of molecular behaviours in closely related compounds. The findings underscore the complexity of phase transitions in binary systems and advocate for a nuanced approach to studying molecular structures and behaviours. Addi-tionally, the research contributes valuable insights into the molecular dynamics of Organic Polymer Functional Adsorption Materials, offering implications for synthetic waxy layers in plant epidermis.

Thin film transistors (TFTs) using In-Ga-Zn Oxide (IGZO) as active layer and the gate insulator was treated with NH3 plasma and N2O plasma, respectively, which is fabricated on flexible PI substrate in this work. The performance of IGZO TFTs with different plasma species and treatment time are investigated and compared. The experiment results show that the plasma species and treatment time play an important role in the threshold voltage, field-effect mobility, Ion/Ioff ratio, sub-threshold swing (SS) and bias stress stability of the devices. The TFT with a 10 seconds NH3 plasma treatment shows the best performance; specifically, threshold voltage of 0.34 V, field-effect mobility of 15.97 cm2/Vs, Ion/Ioff ratio of 6.33×107, and sub-threshold swing of 0.36 V/dec. The proposed flexible IGZO-TFTs in this paper can be used as driving devices in the next-generation flexible displays.

Sympatric distribution and temporal overlap of cryptic zooplankton species pose a challenge to the framework of the niche differentiation theory and the mechanisms allowing competitor coexistence. We applied the methods of phylogenetic analysis, DNA taxonomy and statistical analysis to study the temporal distribution patterns of cryptic B. calyciflorus species, an excellent model, in three lakes, and to explore the putative mechanisms for their seasonal succession and temporal overlap. The results showed that in the warm-temperate Lake Yunlong, B. fernandoi and B. calyciflorus s.s. underwent a seasonal succession, which was largely attributed to their differential adaptation to water temperature. In the subtropical Lake Jinghu, B. fernandoi, B. calyciflorus s.s. and B. dorcas exhibited both seasonal succession and temporal overlap. Seasonal successions were largely attributed to their differential adaptation to temperature, and temporal overlap resulted from their differential responses to algal food concentration. In the tropical Lake Jinniu, B. calyciflorus s.s. persisted throughout the year, and overlapped with B. dorcas for 5 months. Temporal overlap resulted from their differential responses to copepod predation. These results indicated that the temporal distribution pattern of cryptic B. calyciforus species and the mechanism allowing competitor coexistence vary with different climate zones.

The ongoing outbreak of the novel coronavirus pneumonia (also known as COVID-19) has triggered a series of stringent control measures in China, such as city closure, traffic restrictions, contact tracing and household quarantine. These containment efforts often lead to changes in the contact pattern among individuals of the population. Many existing compartmental epidemic models fail to account for the effects of contact structure. In this paper, we devised a pairwise epidemic model to analyze the COVID-19 outbreak in China based on confirmed cases reported during the period February 3rd--17th, 2020. By explicitly incorporating the effects of family clusters and contact tracing followed by household quarantine and isolation, our model provides a good fit to the trajectory of COVID-19 infections and is useful to predict the epidemic trend. We obtained the average of the reproduction number $R=1.494$ ($95\%$ CI: $1.483-1.507$) for Hubei province and $R=1.178$ ($95\%$ CI: $1.145-1.158$) for China (except Hubei), suggesting that some existing studies may have overestimated the reproduction number by neglecting the dynamical correlations and clustering effects. We forecasted that the COVID-19 epidemic would peak on February 13th ($95\%$ CI: February $9-17$th) in Hubei and 6 days eariler in the regions outside Hubei. Moreover the epidemic was expected to last until the middle of March in China (except Hubei) and late April in Hubei. The sensitivity analysis shows that ongoing exposure for the susceptible and population clustering play an important role in the disease propagation. With the enforcement of household quarantine measures, the reproduction number $R$ effectively reduces and epidemic quantities decrease accordingly. Furthermore, we gave an answer to the public concern on how long the stringent containment strategies should maintain. Through numerical analysis, we suggested that the time for the resumption of work and production in China (except Hubei) and Hubei would be the middle of March and the end of April, 2020, respectively. These constructive suggestions may bring some immeasurable social-economic benefits in the long run.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

Self-sustained learning (SSL) is considered a crucial factor in promoting students’ long-term learning and development in a sustainable society. To deepen the understanding of SSL, especially in the context of learning English as a second language, the current study examined the influence of intercultural communicative skills, language mindset, and positive L2 self on SSL in English learning among 1,238 college students in China. The results showed that students not only had a strong language mindset, positive L2 self, and intercultural communicative skills but also scored higher in long-term self-sustained English learning. Findings from the Structural Equation Modeling indicated that both language mindset and intercultural communicative skills positively predicted positive L2 self and self-sustained English learning. Furthermore, language mindset and intercultural communicative skills had an indirect impact on self-sustained English learning through positive L2 self. These findings suggest that to promote English learners’ SSL, instructors should help facilitate students’ intercultural communicative skills and foster a growth language mindset, as well as positive language learning beliefs.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

The focus of our study was the changes in the composition of semi-natural dry grasslands in Hungary. Since these valuable habitats were created with the help of humans, their preservation also requires regular treatment. Our mowing experiment aimed to investigate the suppression of the native Calamagrostis epigejos L. Roth. In Hungary, in the Cserhát Mountains, eight permanent plots were mowed twice a year. The vegetation was sampled annually between 2001 and 2011. The effects of mowing were investigated with repeated measures analysis of variance (ANOVA). After 10 years, the C. epigejos cover of the mowed plots decreased significantly, from the initial average of 62.38 to 7.50%. Surprisingly, we also experienced a similar decrease in the control plots. Regular treatment also had a positive effect on the number of species and diversity. Species richness increased continuously in both treatment types, which indicates the combined effect of vegetation succession and treatment. The biomass growth of other Poaceae and Fabaceae species, which are important from a grassland management perspective, was also facilitated by mowing. Our results suggest that long-term in situ experiments and continuous botanical studies are needed to establish a reliable utilization of grasslands.

Hepatitis E virus (HEV) is a common cause of acute hepatitis worldwide, accounting for approximately 25% of deaths among pregnant women. We previously reported that pregnancy serum facilitates HEV replication in vitro. However, the differences in host cells with HEV infection induced by pregnancy serum and fetal bovine serum (FBS) are unclear. In this study, differentially expressed proteins were identified in HEV-infected hepatoma cells (HepG2) supplemented with different sera by using isobaric tags for relative and absolute quantitation. Proteomic analysis indicated that HEV infection significantly induced 1014 differentially expressed proteins in HEV-infected HepG2 cells when supplemented with FBS compared with pregnancy serum. Further validation by Western blot confirmed that filamin A, heat-shock proteins 70 and 90, Cytochrome c, and Thioredoxin were associated with HEV infection. This comparative analysis provides an important basis to further investigate HEV pathogenesis in pregnant women and HEV replication.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

The accuracy of cosmic ray observation by the Large High Altitude Air Shower Observatory Wide Field-of-view Cherenkov/fluorescence Telescope Array (LHAASO-WFCTA) is influenced by variations in aerosols in the atmosphere. The solar photometer (CE318-T) is extensively utilized within the Aerosol Robotic Network as a highly precise and reliable instrument for aerosol measurements. With this CE318-T 23, 254 sets of valid data samples in 394 days from October 2020 to October 2022 at the LHAASO site were obtained. Data analysis revealed that the baseline Aerosol Optical Depth (AOD) and A˚ngstro¨m Exponent (AE) at 440-870 nm (AE440−870nm) of the aerosols were calculated to be 0.03 and 1.07, respectively, suggesting that the LHAASO site is among the most pristine regions on Earth. The seasonality of the mean AOD are the order of spring > summer > autumn = winter. The monthly average maximum of AOD440nm occurred in April (0.11 ± 0.05) and the minimum was in December (0.03 ± 0.01). The monthly average of AE440−870nm exhibited slight variations. The seasonal characterization of aerosol types indicated that clean continental background aerosol predominated in autumn and winter, which is the optimal period for the absolute calibration of the WFCTA. Additionally, the diurnal daytime variations of AOD and AE across the four seasons are presented. Our analysis also indicates that the potential origins of aerosol over the LHAASO in four seasons were different and the atmospheric aerosols with higher AOD probably originate mainly from Northern Myanmar and Northeast India region. These results provide a baseline for comparison to the future on-site measurement of extinction coefficient profile and aerosol phase function by LHAASO-WFCTA, also enrich the valuable materials on aerosol observation in the Hengduan Mountains and Tibetan Plateau.

When using meta-heuristic optimization approaches for optimization, a large number of samples are required. In particular, when generating subgeneration, the utilization of existing samples is low and the number of individuals is high. Therefore, surrogate-based optimization has been developed, which greatly reduces the number of individuals in the subgeneration and the cost of optimization. In complex air supply scenarios, single-objective optimization results may not be comprehensive; therefore, this paper developed a double-objective air supply optimization method based on the Kriging surrogate model and Non-dominated Sorting Genetic Algorithms-II. And proposed the infill criteria based on clustering to advance the Pareto Frontier. The method was validated by an inverse prediction case, and in particular, the problems when based on 3D steady-state simulations were analyzed. The results showed that the method can quickly achieve an approximate prediction of the boundary conditions (when prediction were made based on experimental data, the number of simulations was 82 and the average error was 6.8%). Finally, the method was used to optimize the air supply parameters of a dual-aisle, single-row cabin. The Pareto set suggested that an airflow organization with dual circulation may be optimal.

The purposes of this study were to identify clinician’s characteristics associated with higher prescription rates of long-acting injectable (LAI) antipsychotics, as well as the information sources influencing medical decision-making about treatment of schizophrenia. We surveyed 202 psychiatrists during 6 regional French conferences (Bordeaux, Lyon, Marseille, Nice, Paris, Strasbourg). Data on the characteristics of practice, prescription rates of antipsychotic and information sources about their clinical decisions were collected. Most of psychiatrists used second-generation antipsychotic (SGA), and preferentially an oral formulation, in the treatment of schizophrenia. SGA LAI was prescribed to 30.4% of schizophrenic patients. The duration and the type of practice did not influence the class or formulation of antipsychotics used. The clinicians following the higher percentage of schizophrenic patients were associated with the higher use of LAI antipsychotics and the lower use of oral SGA. Personal experience, government regulatory approval and guidelines for the treatment of schizophrenia were the 3 main contributing factors guiding the clinical decision-making of clinicians about treatment of schizophrenia. The more clinicians follow schizophrenic patients, the more they use LAI antipsychotic. The development of specialised programmes with top specialists should lead to better use of LAI in the treatment of schizophrenia.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

Ovarian cysts are linked to hormone imbalances and altered gene expressions, but the connection between cysts and ion channel expression is understudied. This study explored the role of TWIK-related acid-sensitive K+ (TASK) channels in bovine ovarian cyst formation. The ovarian follicles were split into small (5 to 10 mm in diameter) and large (> 25 mm in diameter) groups. Among the measured K+, Na+, and Cl- concentrations in follicular fluid (FF) obtained from small-sized follicles (SF) and large-sized follicles (LF), the K+ concentration was significantly lower in LFFF. Quantitative PCR, western blot, and immunocytochemistry data revealed that TASK-3 expression levels significantly decreased by approximately 50% in both LF and granulosa cells obtained from LF (LFGCs) compared to the corresponding controls. The TASK-3 protein was localized to the plasma membrane of GCs. The diameter of LFGCs was larger than that of SFGC. The cell swelling response to exposure to a hypotonic solution (200 mOsm/L) was highly reduced in TASK-3-overexpressing cells compared to vector-transfected cells. TASK-3-knockdown cells showed arrested growth. Senescence markers were detected in LFGCs and TASK-3-knockdown cells. These findings suggest that reduced TASK-3 expression in LF is associated with the inhibition of GC growth, leading to senescence and cyst formation.

This paper introduces PatchFusion, an innovative approach for nonrigid tracking and reconstruction of deformable objects using a single RGB-D sensor. Existing methods face challenges in accurately capturing the rapid deformations of soft and flexible objects, thereby limiting their utility in diverse scenarios. Our approach overcomes this challenge by employing a dynamic patch-based framework that adapts to rapid inter-frame motions. Firstly, patch-wise rigid transformation fields for non-overlapping patches are solved via Iterative Closest Point (ICP) by incorporating geometric features as additional similarity constraints, thereby enhancing robustness and accuracy. Secondly, deformation optimization based on a nonrigid solver is applied to refine the coarse transformation fields. In order to enable simultaneous tracking and reconstruction of deformable objects, the patch-based rigid solver is designed to run in parallel with the nonrigid solver, serving as a plug-and-play module requiring minimal modifications for integration while enabling real-time performance. Following a comprehensive evaluation, PatchFusion showcases superior performance in effectively dealing with rapid inter-frame deformations when compared to existing techniques, rendering it a promising solution with broad applicability across domains such as robotics, computer vision, and human-computer interaction.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

Objective: The long-term care insurance (LTCI) system was introduced in 2000 to provide financial support for long-term care services to older adults. What is known on this topic report focuses on a comparative analysis of how the LTCI system has affected older people in Japan. Methods: We obtained data from the literature about the LTCI system, compared and analysed the collected articles, and concluded. Results: The LTCI system has improved access to long-term care services, with more older adults receiving care than before the system’s implementation. This service has improved the quality of life for many elderly individuals who require assistance with daily activities. Furthermore, the LTCI system has alleviated the financial burden of long-term care services since the insurance covers a large portion of the costs. It has made older adults maintain their independence and dignity, as they can afford the necessary care without relying solely on their savings or burdening their families. Conclusions: Japan’s LTCI system has positively impacted older adults by improving access to long-term care services and alleviating financial burdens. However, challenges such as increasing demand and variations in service quality need to be addressed to ensure the system effectively supports older people in Japan.