Epitaxial lithium ferrite (LiFe5O8) films with different thicknesses have been successfully fabricated on SrTiO3 (001) substrates by magnetron sputtering deposition technique. The microstructural and magnetic properties are characterized by advanced transmission electron microscope and magnetic measurement device. It was found that the formation of structural defects can be influenced by the thickness of the film. Apart from the misfit dislocations, the orientation domains form in thinner film and twin boundaries appear in thicker film, respectively, contributing to the misfit strain relaxation in the heterosystem. The magnetic measurement shows that the thinner films have enhanced magnetization and a relatively lower coercive field compared with the thicker films containing the antiferromagnetic twin boundaries. Our results provide a way for tuning the microstructure and magnetic properties of lithium ferrite films by changing the film thickness.

Over the past decades, overweight and obesity has become a global epidemic and the leading threat for death. To prevent the serious risk, an overweight or obese individual must apply a long-term weight-management strategy to control food intake and physical activities, which is however, not easy. Recently, with the advances of information technology, more and more people can use wearable devices and smartphones to obtain physical activity information, while they can also access various health-related information from Internet online social networks (OSNs). Nevertheless, there is a lack of an integrated approach that can combine these two methods in an efficient way. In this paper, we address this issue and propose a novel mobile-social framework for health recognition and recommendation, namely, H-Rec². The main ideas of H-Rec² include (1) to recognize the individual's health status using smartphone as a general platform, and (2) to recommend physical activity and food intake based on personal health information, life science principles, and health-related information obtained from OSNs. To demonstrate the potentials of the H-Rec² framework, we develop a prototype that consists of four important components: (1) an activity recognition module that senses physical activity using accelerometer, (2) a health status modeling module that applies a novel algorithm to generate personalized health status index, (3) a restaurant information collection module that collects relevant information from OSN, and (4) a restaurant recommendation module that provides personalized and context-aware recommendation. To evaluate the prototype, we conduct both objective and subjective experiments, which confirm the performance and effectiveness of the proposed system.

Seismic velocity inversion is one of the most critical issues in the field of seismic exploration and has long been the focus of numerous experts and scholars. In recent years, the advancement of machine learning technologies has infused new vitality into the research of seismic velocity inversion and yielded a wealth of research outcomes. Typically, seismic velocity inversion based on machine learning lacks control over physical processes and interpretability. Starting from wave theory and the physical processes of seismic data acquisition, this paper proposes a method for seismic velocity model inversion based on Physical Embedding Recurrent Neural Networks. Firstly, the wave equation is a mathematical representation of the physical process of acoustic waves propagating through a medium, and the finite difference method is an effective approach to solving the wave equation. With this in mind, we introduce the architecture of recurrent neural networks to describe the finite difference solution of the wave equation, realizing the embedding of physical processes into machine learning. Secondly, in seismic data acquisition, the propagation of acoustic waves from multiple sources through the medium represents a high-dimensional causal time series (wavefield snapshots), where the influential variable is the velocity model, and the received signals are the observations of the wavefield. This forms a forward modeling process as the forward simulation of the wavefield equation, and the use of error back-propagation between observations and calculations as the velocity inversion process. Through time-lapse inversion and incorporating the causal information of wavefield propagation, the non-uniqueness issue in velocity inversion is mitigated. Through mathematical derivations and theoretical model analyses, the effectiveness and rationality of the method are demonstrated. In conjunction with simulation results for complex models, the method proposed in this paper can achieve velocity inversion in complex geological structures.

The 3D reconstruction of vermiculite-based sealing material was carried out based on CT scanning experiments and Avizo software. The precision and representation of the reconstructed digital core were tested by calculating the pore structure parameters and comparing them with the experimental results of mercury compression. Avizo is a perfect interface with Fluent software to perform micro-scale seepage simulation to explore the distribution of pressure and velocity fields during fluid transport. In this paper, a new approach is proposed to study the penetration leakage of non-metallic gaskets by using equivalent pore networks.

Battery/Supercapacitor(SC) current tracking control is a key issue for hybrid energy storage system (HESS) in electric vehicles. An innovative passivity-based L2-gain adaptive control (PBL2AC) based on port-controlled Hamiltonian model with dissipativity (PCHD) for reference current tracking and bus voltage stability in HESS is presented. The developed PCHD model has considered both parameter variations and external disturbances. By using L2-gain disturbance attenuation, the PBL2AC ensures robust reference current tracking and stable bus voltage. Moreover, adaptive mechanism is adopted to estimate the electrical parameters. To validate the proposed control scheme for HESS, simulations and experiments were done and compared with traditional PID and sliding mode control under several typical driving cycles, and results show that the effectiveness of the proposed controller can be confirmed.

We present the generation and nonlinear frequency conversion of nanosecond cylindrical vector beams (CVBs) in two-mode fiber (TMF). Based on the polarized dependence vector mode coupling characteristic and the precise wavelength tunability of an acoustically-induced fiber grating (AIFG), the nanosecond cylindrical vector beams (CVBs, 1064 nm, 10 ns) is directly generated in a TMF with convenient switching characteristics between the radial and azimuthal vector beams. Furthermore, the stimulated Raman scattering (SRS) is produced based on the transmission of the nanosecond CVBs in the 100-meters long TMF, and the spatial intensity and polarization distributions characteristics the 1st-order Stokes shifted component is consistent with the nanosecond CVBs pump pulse. This work provides a method for achieving wavelength conversion of the CVBs in optical fiber.

Global warming may increase the potential evapotranspiration (Etp), thereby affecting the amount of clean water resources available in a region. In this study, the systematic biases in temperature outputs of 24 global climate models (GCMs) under 3 emission scenarios are corrected by using 8 bias correction methods. The trend of Etp in Yangzi River Delta in the 21st century is projected by using 4 Etp calculation formulas. The uncertainty of the projections is estimated and decomposed by using multi-way analysis of variance. The influence of uncertainty on the projected change signal is quantified by using the signal-to-noise ratio. The results show that, relative to the reference period (1971~2000), the annual mean daily Etp in Yangzi River Delta will increase by 0.14~0.17mm/d during the period 2021~2050 and by 0.21~0.41mm/d during the period 2061~2090, respectively. During 2021~2050, the uncertainty of Etp increase projections is dominantly contributed by the main effects of GCM (63%) and Etp calculation formula (24%). During 2061~2090, it is mainly contributed by the main effect of GCM (36%), followed by the main effects of emission scenario (34%) and Etp calculation formula (18%). The increase projections of Etp are generally reliable and robust during the two projection periods.

Coptisine (Cop) exerts a neuroprotective effect in central nervous system disease, particularly ischemic stroke. However, its protective mechanism is still unclear. This study aimed to investigate the protective effect of Cop on cerebral ischemia-reperfusion (IR) rats with a middle cerebral artery occlusion model by integrating a gas chromatography-mass spectrometry (GC-MS) based metabolomics approach with biochemical assessment. Our results showed that Cop could improve neurobehavioral function and decrease the ischemia size in IR rats. In addition, Cop was found to decrease inflammatory mediators (e.g., prostaglandin D2 (PGD2) and tumor necrosis factor-α (TNF-α) and attenuate oxidative stress response (e.g., increase the superoxide dismutase (SOD) expression and decrease 8-iso-PGF2α level). Furthermore, GC-MS based cerebrospinal fluid (CSF) metabolomics analysis indicated that Cop influenced the level of glycine, 2,3,4-trihydroxybutyric acid, oleic acid, glycerol, and ribose during IR injury. Cop exhibited a good neuroprotective effect against cerebral IR injury and metabolic alterations which might be mediated through its antioxidant and anti-inflammatory property.

Objective: To evaluate the effect of propofol combined with psychological intervention on pain and emotional evaluation in painless colonoscopic colonic polypectomy patients undergoing endoscopic mucosal resection (EMR).Methods: A total of 80 patients who underwent painless colonoscopic colonic polypectomy with EMR treatment between June 2020 and June 2022 were selected in order of admission and divided into two groups. The control group received conventional analgesia, while the observation group received propofol combined with psychological intervention. Pain visual analog scale (VAS) and emotional scale were used to evaluate pain and emotions in both groups of patients. Adverse reactions and clinical efficacy were also compared between the two groups.Results: The two groups of patients were generally comparable with no significant differences (P > 0.05). The VAS score in the observation group was significantly lower than that in the control group (P < 0.05), and the emotional scale score was also improved compared to the control group (P < 0.05). The number of patients with adverse reactions in the observation group was less than that in the control group. The clinical effective rate in the observation group was significantly higher than that in the control group (P < 0.05).Conclusion: Propofol combined with psychological intervention can effectively alleviate pain and improve emotional status in painless colonoscopic colonic polypectomy patients undergoing EMR treatment, thereby increasing the comfort and success rate of the surgery. The number of patients with adverse reactions in the observation group was less than that in the control group, and the clinical effective rate in the observation group was significantly higher than that in the control group (P < 0.05).

A single-crystal of ytterbium-doped “mixed” yttrium-lutetium aluminium garnet with a stoichiometric composition of (Y0.601Lu0.233Yb0.166)3Al5O12 was grown by the Czochralski method and its structure, vibronic, spectroscopic and laser properties were studied. The stimulated-emission cross-section for Yb3+ ions was maximized to 2.53×10-20 cm2 at 1031 nm, the emission bandwidth is ~8 nm and the reabsorption-free luminescence lifetime of the 2F5/2 state is 1.063 ms. Pumped at 941 nm, the Yb-laser generated a maximum output power of 1.04 W at 1.03 and 1.05 μm with a high slope efficiency of 76.4% and a laser threshold of 76 mW. A continuous wavelength tuning over a range of 51.6 nm (1026.4 - 1078.0 nm) was also achieved. Power scaling is achieved using a 969 nm-diode pumped microchip cavity. A maximum output power of ~9 W is obtained at 1.05 μm with a slope efficiency of 76% and with an almost circular laser beam profile.

High dimensional statistical analysis for the yield of large-scale circuits is quite difficult due to expensive simulations, especially for the memory circuits with high sigma requirement (e.g., SRAM). In this paper, we developed an efficient sparse additive model to substitute simulations. To fit high sigma region accurately, the modeling center is moved to near failure boundary searched by scaling the shape of sampling function. To solve the model efficiently, the process variables are grouped by standard cells so that the model can be solved by our developed blockwise greedy algorithm. The experiments on the 28nm memory circuits validate that our method achieves high accuracy and efficiency compared with other state-of-art works.

The Shule River Basin (SRB) is a typical arid area in northwest China with a fragile ecology. Un-derstanding vegetation dynamics and its response to climate change and human activities provides essential information for ecological and environmental resource management. This study extracted fractional vegetation coverage (FVC) data from 2000 to 2019 using the Google Earth Engine plat-form and Landsat satellite images, employing trend analysis and other methods to examine spati-otemporal changes in vegetation in the SRB. Additionally, partial correlation and residual analysis were utilized to explore the response of FVC to climate change and human activities. The main results were as follows: (1) The regional average FVC in the SRB showed a significant upward trend from 2000 to 2019, increasing by 1.3 × 10−3 y–1. The area within 1 km of roads experienced a higher increase of 3 × 10−3 y–1, while the roadless areas experienced a lower increase of 1.1 × 10−3 y–1. Road construction from 2004 to 2006 significantly reduced the FVC within 200 meters of the roads. FVC spatial heterogeneity in the SRB is significant. (2) Partial correlation analysis shows that FVC has a strong positive correlation with precipitation and surface water area, with correlation coefficients of 0.575 and 0.744, respectively. There is a weak negative correlation between FVC and land surface temperature (LST). FVC changes are more influenced by precipitation than by LST. (3) Compared to climate factors, human activities have a greater impact on vegetation dynamics in the SRB. The contributions of climate change to vegetation recovery are increasing. (4) The area changes of dif-ferent land types are closely related to climate factors and human activities, reflecting their impact on vegetation. These results provide valuable information for ecosystem restoration and environ-mental protection in the SRB.

This paper is concerned with the optimal linear quadratic Gaussian (LQG) control problem for discrete time-varying system with multiple input delays and multiplicative noises. The main contributions are two-fold. Firstly, when the state variables can be observed exactly, we obtain a necessary and suffcient condition for the multiple-delays system in terms of the non-homogeneous relationship between the state and costate, which is the solution to the coupled forward and backward stochastic difference equations. Secondly, when the state variables are partially observed, we derive a suboptimal linear output feedback controller for the discrete-time system based on the obtained results of the optimal LQG control. Numerical examples are shown to illustrate the proposed algorithm.

The rapid advancements in gene therapy have opened up new possibilities for the treatment of genetic disorders, including Duchenne muscular dystrophy, Thalassemia, cystic fibrosis, Hemophilia, and Familial hypercholesterolemia. The utilization of the clustered regularly interspaced short palindromic repeats (CRISPR) - CRISPR-associated protein (Cas) system has revolutionized the field of gene therapy by enabling precise targeting of genes. In recent years, CRISPR/Cas9 has demonstrated remarkable efficacy in treating cancer and genetic diseases. However, the susceptibility of nucleic acid drugs to degradation by nucleic acid endonucleases, necessitates the development of functional vectors capable of protecting the nucleic acids from enzymatic degradation, while ensuring safety and effectiveness. This review aims to explore the biomedical potential of non-viral vector-explore CRISPR/Cas9 systems for the treatment of genetic diseases. Furthermore, it provides a comprehensive overview of recent research advances in viral and non-viral vector-based gene therapy for genetic disorders, including insights from preclinical and clinical studies. Additionally, the review analyzes the current limitations of these delivery systems and proposes avenues for the development of novel nano-delivery platforms.

The prediction of drug--target interactions is always a key task in the field of drug redirection. However, traditional methods of predicting drug--target interactions are either mediocre or rely heavily on data stacking. In this work, we merged heterogeneous graph information and obtained effective node information and substructure information based on mutual information in graph embeddings. We then learned high quality representations for downstream tasks, and proposed an end--to--end auto--encoder model to complete the task of link prediction. Experimental results show that our method outperforms several state--of--art models. The model can achieve the area under the receiver operating characteristics (AUROC) curve of 0.959 and area under the precise recall curve (AUPR) of 0.848. We found that the mutual information between the substructure and graph--level representations contributes most to the mutual information index in a relatively sparse network. And the mutual information between the node--level and graph--level representations contributes most in a relatively dense network.

In order to understand the response mechanism between plant stress, physiological indicators and hyperspectral indices, pot experiments were conducted on Suaeda salsa seedlings collected from a coastal wetland area to reveal the effects of salt stress on the physiological indicators and reflectance spectra of Suaeda salsa at the canopy and leaf level. The Suaeda salsa seedlings were exposed to seven salt treatments of different concentrations (0 mmol/L (control), 50 mmol/L, 100 mmol/L, 200 mmol/L, 300 mmol/L, 400 mmol/L, and 600 mmol/L) in natural conditions. The physiological indicators of plant height, fresh weight, dry weight, leaf succulence, chlorophyll content, and carotenoid content were measured, in addition to the reflectance spectra of Suaeda salsa at both the canopy and leaf level. Firstly, the effects of salt stress on the physiological indicators and reflectance spectra were analyzed by the qualitative and quantitative methods. Then, physiological indicators sensitive to salt stress were further retrieved. Afterwards hyperspectral indices such as a/b and ((a-b)/(a+b) ) sensitive to salt stress were also extracted by one-way analysis of variance (ANOVA) and Student-Newman-Keuls (S-N-K) comparison test. Our results showed that plant height, root length, leaf succulence, biomass, Chl-a, and Chl-b were sensitive to salt stress, while carotenoids (Car) and relative water content on the root were not significantly affected by salt stress. At the salt concentration of 200 mmol/L, plant height, biomass, relative water content, leaf succulence peaked. With enhanced salt stress, physiological indicators decreased. The first-order derivative spectral reflectance has the highest correlation with salt stress, compared to the control. The spectral index most sensitive to the salt stress at the canopy level is (D₉₀₃−D₈₅₁)/(D₉₀₃+D₈₅₁), for which the multiple determination coefficient (r²) is 0.9216. While the most sensitive spectral index to the salt stress is (D₄₄₂−D₆₆₇)/(D₄₄₂+D₆₆₇) at the leaf level, for which the r² is −0.898. In summary, the results indicated that there exists the quantitative relationship between the physiological indicators and spectra reflectance under salt stress and hyperspectral plant indices can effectively estimate the degree of salt stress. The inconsistency between the diagnostic hyperspectral plant indices at the canopy and leaf levels may be caused by the observation conditions, canopy structure.

Background: Genetic factors are considered important risk factors for the occurrence of osteoarthritis (OA), which has received extensive attention. This study examined the research on the relationship between genetic factors and the pathogenesis of OA from a bibliometric perspective. Methods: We searched Web of Science Core Collection for original and review articles on genetic factors and OA. We used R package “bibliometrix” to perform statistical and visualization analysis of countries, institutions, authors, journals, and keywords. Results: A total of 1,127 articles met the inclusion criteria, with an average citation of 20.41 per article. From 2012 to 2022, the average annual growth rate of research in this field was 7.83%. The corresponding authors of the published articles were mainly from China, the USA, and the UK. Boston University emerged as the most active and important institution, while the Osteoarthritis and Cartilage published the most articles in this field. The keywords “polymorphism”, “genetic” and “mendelian randomization” indicate the future research directions. Conclusion: This bibliometric study provides an overview of the key topics and trends in genetic factors and OA pathogenesis research. The high-frequency keywords suggest the current and potential future focus of this field, involving methods, mechanisms, and populations.

Soil organic matter is an important component that reflects soil fertility and promotes plant growth. The soil of typical Chinese tea plantations was used as the research object in this work, and by combining soil hyperspectral data and image texture characteristics, a quantitative prediction model of soil organic matter based on machine vision and hyperspectral imaging technology was built. Three methods, standard normalized variate (SNV), multisource scattering correction (MSC) and smoothing, were first used to preprocess the spectra. After that, random frog (RF), variable combination population analysis (VCPA) and variable combination population analysis and iterative retained information variable algorithm (VCPA-IRIV) algorithms were used to extract the characteristic bands. Finally, the quantitative prediction model of nonlinear support vector regression (SVR) and linear partial least squares regression (PLSR) for soil organic matter was established by combining nine color features and five texture features of hyperspectral images. The outcomes demonstrate that, in comparison to single spectral data, fusion data may greatly increase the performance of the prediction model, with MSC+VCPA-IRIV+SVR (R2C=0.995, R2P=0.986, RPD=8.155) being the optimal approach combination. This work offers excellent justification for more investigation into nondestructive methods for determining the amount of organic matter in soil.

(1)Background: This report was an effective evaluation of using multimedia educational program for self-care and quality of life in patients with a stoma at postoperative and established a simple threshold for enterostomy self-care skills.(2)Methods:108 patients with enterostomy were randomly assigned to receive either the intervention multimedia education program (including information about preparation for enterostomy care, cleaning method, manual bag replacement steps and precautions). The primary outcome was self-care ability and quality of life (defined as overall enterostomy self-care ability and overall quality of life), which was assessed at 2 weeks after intervention via an interview.(3)Results: Compared with those who in the conventional stoma education program, patients received the multimedia education program significantly improved their overall self-care ability and quality of life in statistically. The threshold of the enterostomy self-care skill scale was 20 points, and its corresponding sensitivity was 77.8%, and the specificity was 75.7%.(4)Conclusions: According to our study, the multimedia education program could enhance self-care ability of home care and quality of life in patients with enterostomy.

We investigated the response of leaf photosynthetic capacity to climate warming and its variation among provenances of Larix gmelinii (Dahurian larch). Seedlings of 11 L. gmelinii provenances were transplanted into two common gardens with different climate conditions (control and warming climate). We measured the leaf photosynthetic capacity and explored its influencing factors. The warming treatment significantly increased the maximum net photosynthetic rate (Pmax-a), photosynthetic nitrogen use efficiency (PNUE), maximum carboxylation rate (Vcmax), maximum electron transport rate (Jmax), triose phosphate utilization rate (TPU), mesophyll conductance (gm), leaf nitrogen content (Narea), and chlorophyll content (Chlm). The Pmax-a was significantly positively associated with Vcmax, Jmax, TPU, gm, and Narea, and the slope of the correlations between Pmax-a and Vcmax, Jmax, and TPU was steeper in the warming treatment. The responses of Pmax-a, PNUE, Vcmax, Jmax, TPU, Narea, and Chlm to warming differed among provenances. The effects of warming on Pmax-a, Vcmax, Jmax, and TPU increased and then decreased as the aridity index of the original site increased. Overall, the warming treatment improved the photosynthetic capacity of L. gmelinii, but the extent of the improvement varied among provenances. These findings provide insights into the mechanisms underlying the responses of L. gmelinii to climate warming.

The utilization of tempered blast furnace (BF) slag through the direct fiber forming process to create high-value thermal insulation materials offers a dual benefit: it efficiently harnesses the latent heat within unused slag and substantially enhances the value of blast-furnace slag utilization. However, gauging the melting properties of iron slag under high temperatures is a challenge. In this study, we explore the melting behavior of SiO2 within a high-temperature molten pool. We employ dynamic visual data (video stream) captured via a non-contact charge coupled device (CCD) video recording system to extract SiO2 contours through image processing. The change in image centroid characteristics is used to establish a convolution function relationship, and MATLAB's traversal search algorithm determines SiO2's centroid position. Given that SiO2 is proportionate to crucible pixels, the area of SiO2 is calculated through pixel statistics within these contours. Subsequently, we propose a new indirect method to process image information, yielding SiO2 volume and mass at different time points. An exponential fitting yields the melting rate function of SiO2. Finally, we compare this indirect method with shape from shading (SFS), quantitative characterization, and dimensional analysis techniques. We also discuss the strengths and limitations of each method. Our findings reveal that the indirect solution method presented here boasts straightforward calculation steps and imposes minimal image format requirements. This research provides theoretical and technical support for blast-furnace slag's direct fiber forming process.

This paper explores the use of different deep learning models for predicting precipitation in 56 meteorological stations in Jilin Province, China. The models used include Stacked-LSTM, Transformer, and SVR, and Gaussian noise is added to the data to improve their robustness. Results show that the Stacked-LSTM model performs the best, achieving high prediction accuracy and stability. The study also conducts variable attribution analysis using LightGBM and finds that temperature, dew point, precipitation in previous days, and air pressure are the most important factors affecting precipitation prediction, which is consistent with traditional meteorological theory. The paper provides detailed information on the data processing, model training, and parameter settings, which can serve as a reference for future precipitation prediction tasks. The findings suggest that adding Gaussian noise to the dataset can improve the model's generalization ability, especially for predicting days with zero precipitation. Overall, this study provides useful insights into the application of deep learning models in precipitation prediction and can contribute to the development of meteorological forecasting and applications.

Semi-continuous data are very common in the social science and economics. In this paper, a Bayesian variable selection procedure is developed to assess the influence of exogenous factors including observed and unobserved on the semi-continuous data. Our formulation is based on the two-part latent variable model with polytomous response. We consider two schemes for the penalties of regression coefficients and factor loadings: the Bayesian spike and slab bimodal prior and the Bayesian lasso prior. Within the Bayesian framework, we implement Markov Chains Monte Carlo sampling method to conduct posterior inference. To facilitate posterior sampling, we recast the logistic model in part one as the norm-like mixture model. Gibbs sampler is designed to draw observations from the posterior. Our empirical results show that with suitable hyper-parameters, the spike and slab bimodal method slightly outperforms the Bayesian lasso in the current analysis. Finally, a real example related to the China household finance survey is analyzed to illustrate the application of the methodology.. .

The safe and efficient mining of coal seams with low porosity, low permeability and high inhomogeneity under complex geological conditions is a major challenge, among which the permeability of coal seams is crucial for coal mine gas extraction. The development of coal seam permeability enhancement technology can help coal mines to produce safely and efficiently, and the extracted coal bed methane can be utilized as a green energy. In order to study the effect of freezing and thawing on the evolution of mechanical and permeability properties of coal, triaxial permeability tests were carried out on low-permeability coal under two kinds of surrounding pressures. At the same time, dry, saturated and freeze-thaw coal were set up for comparison, and the effects of water and freeze-thaw were separated from each other. The triaxial mechanics and percolation laws of dry, saturated and freeze-thaw coal rocks were obtained, and the mechanism of the influence of freeze-thaw on the permeability evolution law of coal was revealed. The research results can provide theoretical guidance for the gas extraction technology of low permeability coal seams with increased permeability.

The quality of digital elevation models (DEMs) is inevitably affected by the limitations of the imaging modes and the generation methods. One effective way to solve this problem is to merge the available datasets through data fusion. In this paper, a fusion-based global DEM dataset (82°S-82°N) is introduced, which we refer to as GSDEM-30. This is a 30-m DEM mainly reconstructed from the unfilled SRTM1, AW3D30, and ASTER GDEM v2 datasets combining the multi-source and multi-scale fusion techniques. A comprehensive evaluation of the GSDEM-30 data, as well as the 30-m ASTER GDEM v2 and AW3D30 DEM, was presented. Global ICESat GLAS data and the local National Elevation Dataset (NED) were used as the reference for the vertical accuracy validation, while GlobeLand30 was introduced for the landscape analysis. Furthermore, we employed the maximum slope approach to detect the potential artefacts in the DEMs. The results show that the GDEM data are seriously affected by noise and artefacts. With the advantage of the multiple datasets and the refined post-processing, the GSDEM-30 are contaminated with fewer anomalies than both ASTER GDEM and AW3D30. The fusion techniques used can also be applied to the reconstruction of other fused DEM datasets.

Crystalline silicon nanomembrane (Si NM) is promising in wearable and implantable bioelectronics due to its electrical and mechanical performances. However, the current explorations are not enough to firmly bridge ultrathin encapsulation strategies with high performance crystalline Si NM based transistors. In this work, we utilized Al2O3/alucone as the ultrathin encapsulation strategies aim to thoroughly investigate the effect of gate dielectric surface area on the electrical performance of crystalline Si NM based metal-oxide-semiconductor capacitors (MOSCAPs). The comparative analysis was implemented on the three types of diameters (Ø) MOSCAPs with and without Al2O3/alucone encapsulation under planar and concave/convex bending conditions. Benefited from the Al2O3/alucone ultrathin encapsulations, the stability of gate leakage current density, and interfacial characteristics were maintained and improved under mechanical bending deformations for MOSCAPs with predefined Ø of 160, 240, and 320 μm compared to the bare MOSCAPs. Combined with the Ø-related mechanical analysis on the maximum strain in the critical layers and the practical measurements, the encapsulated MOSCAPs with Ø 160 μm showed the most stable electro-mechanical performances. The variations for encapsulated MOSCAPs with three types of Ø emerged in the oxide layer and the interface at dielectric/Si NM that were carefully evaluated according to the bending deformations. These findings are significant for leveraging the practical applications in the ultrathin encapsulation strategies for reliable operations of crystalline Si NM based integrated circuits (ICs).

NaoMaiTong (NMT: Radix et Rhi-zoma Rhei, Radix Ginseng, Radix Puerariae, and Rhizoma Ligustici Chuanxiong as 9: 9: 6: 6) is a traditional Chinese medicine prescription for treating ischemia cerebral apoplexy. In this work, four cell injury models of ischemic stroke were establish, namely hypoxic injury, glutamate damage, injury of potassium chloride and hydrogen peroxide damage model. The protective effects of NMT and its single herbs-containing sera of different time points on PC12 cell damage were evaluated respectively, and the corresponding efficacy-time curves were drawn. Cell viability was measured by MTT (3-(4,5)-Dimethylthiahiazo(-z-y1)-3,5-di-phenytetrazoliumromide) assay. Furthermore, an statistical methods of support vector machine (SVM) were used to establish the correlation between concentration-time-efficacy for the first time. These results revealed that NMT-containing serum has obvious protective effect on the four injury models and can significantly improve cell viability. The PK-PD correlation between fifteen ingredients in the NMT compound with four model efficacy indexes indicated that rhein, puerarin, and 3'-methoxy puerarin might be the most important constituents controlling the pharmacological effects of NMT. The study suggested that these fifteen components are likely to be the material basis of NMT and recommended to increase the amounts of Pueraria in the NMT compound. That provided the scientific basis and demonstration for the research of efficacy material base of Traditional Chinese Medicine (TCM).

It is always a difficult task to assign the peaks recorded from vibrational spectrum. Herein we explored a new pathway of density functional theory (DFT) simulation to present three kinds of spectra of ice XIV and can be referenced as inelastic neutron scattering (INS), IR, and Raman experimental spectrum. The INS spectrum is proportional to phonon density of states (PDOS) while the photon scattering signals reflect the normal vibration frequencies near the Brillouin zone (BZ) center. Based on good agreements with experimental data, we identified the relative frequency and made scientific assignments by normal vibration modes analysis. The debating two hydrogen bond (H-bond) peaks among ice phases from INS have been discussed and the dynamic process of H-bond vibrations were found to be classified into two basic modes. we deduce that two H-bond modes are a general rule among ice family and more works are ongoing to investigate this subject.

The accompanying mechanical behavior during the flow of ore-rock dispersion is an important factor leading to the instability and failure of the orepass in the ore storage section. It is of great significance to accurately understand the instability characteristics of the well wall in the ore section, during the ore drawing process by understanding the flow characteristics and internal mechanical transfer mechanism of ore-rock dispersion. Using the discrete element method to analyze the flow characteristics, contact compactness, stress distribution characteristics and contact force probability distribution of the ore-rock dispersion, it realizes the quantitative characterization of the damage degree of ore-rock flow, and reveals the damage mechanism of mine storage wall. The results show that: (1) The friction between ore-rock particles, between ore-rock and well wall is an important reason for the change of the macroscopic flow form of ore-rock from “one” to “V” type. (2) The compactness and stress concentration of ores are increasing with the increase of storage depth, which is shown that with the increase of storage depth, the greater the probability of well wall instability. (3) The probability distribution of contact force strength between particles decreases exponentially in the whole process of ore drawing, in which the strong chain plays a major role in the stability of the dispersion system. (4) The number of overpressure and the overpressure coefficient can be used to quantitatively characterize the wall damage degree under the action of ore-rock flow. The dynamic side pressure decreases periodically in the form of exponential fluctuations, and the dynamic load formed by the ore-rock flow mainly played a role in the lower area of the ore storage section.

Prostate-specific membrane antigen (PSMA) is a well validated prostate cancer marker, but reported PSMA-targeted tracers derived from the Lys-urea-Glu pharmacophore including the clinically validated [99mTc]Tc-EDDA/HYNIC-iPSMA have high off-target uptake in kidneys, spleen and salivary glands. In this study, we synthesized and evaluated three novel 99mTc-labeled PSMA-targeted tracers and investigated if the tracers derived from the Lys-urea-Aad pharmacophore could have minimized uptake in off-target organs/tissues. In vitro competition binding assays showed that compared with HYNIC-iPSMA, the three novel ligands had slightly weaker PSMA binding affinity (average Ki = 3.11 vs 8.96 - 11.6 nM). Imaging and ex vivo biodistribution studies in LNCaP tumor-bearing mice showed that [99mTc]Tc-EDDA/HYNIC-iPSMA and the three novel tracers successfully visualized LNCaP tumor xenografts in SPECT images and were excreted mainly via the renal pathway. The average tumor uptake at 1 h post-injection varied from 5.40 to 18.8 %ID/g, and the tracers derived from the Lys-urea-Aad pharmacophore had much lower uptake in spleen and salivary glands. Compared with the clinical tracer [99mTc]Tc-EDDA/HYNIC-iPSMA, the Lys-urea-Aad derived [99mTc]Tc-EDDA-KL01127 had lower background uptake and superior tumor-to-background contrast ratios, and is therefore promising for clinical translation to detect prostate cancer lesions with SPECT.

A new quinazolinone alkaloid, named peniquinazolinone A (1), as well as eleven known com-pounds, 2-(2-hydroxy-3-phenylpropionamido)-N-methylbenzamide (2), viridicatin (3), viridicatol (4), (±)-cyclopeptin (5a/5b), dehydrocyclopeptin (6), cyclopenin (7), cyclopenol (8), methyl-indole-3-carboxylate (9), 2,5-dihydroxyphenyl acetate (10), methyl m-hydroxyphenylacetate (11), conidiogenone B (12), was isolated from the endophytic Penicillium sp. HJT-A-6. The chemical structures of all compounds were elucidated by comprehensive spectroscopic analysis, including 1D, 2D NMR, and HRESIMS. The absolute configuration at C-13 of peniquinazolinone A (1) was established by applying the modified Mosher’s method. Compounds 2, 3, and 7 exhibited an op-timal promoting effect on the seed germination of Rhodiola tibetica at a concentration of 0.01 mg/mL, while the optimal concentration for compounds 4 and 9 to promote Rhodiola tibetica seed germination was 0.001 mg/mL. Compound 12 showed optimal seed-germination-promoting activity at a concentration of 0.1 mg/mL. Compared with the positive drug 6-benzyladenine (6-BA), compounds 2, 3, 4, 7, 9, and 12 could extend the seed-germination period of Rhodiola tibetica up to the 11th day.

Rapid urbanization has led to many ecological problems such as landscape fragmentation, decreased landscape connectivity, and decreased biodiversity. Building an ecological security pattern is an important way to ensure ecological security and maintain sustainable urban development. Harbin is an important large-scale city in northeastern China, and the urban central district of Harbin is used as the study area. Ecological sensitivity assessment, MSPA, gravity model, landscape connectivity assessment and MCR model were used to extract ecological source areas, ecological corridors and ecological nodes in the study area to construct and optimize the ecological security pattern. Research shows that: A total of 23 ecological source areas were identified, mainly located along the Songhua River in the central part of the study area and in the mountain forest areas within the A-cheng District in the southeastern part of the study area. 48 ecological corridors were extracted, mainly in Daowai District, A-cheng District and the eastern part of Xiangfang District. There are 8 important ecological corridors and 10 important connecting corridors. 61 ecological nodes of the first level and 65 ecological nodes of the second level were extracted. High, higher, medium, lower and low security areas were classified based on the minimum cumulative resistance surface, with the highest proportion of high ecological security areas accounting for 45.75% of the study area. 65 ecological breakpoints were extracted and restoration measures were proposed. Finally, The structure of the ecological security pattern optimization of "two axes, two belts and four areas" is proposed, and corresponding ecological management measures are put forward. The experimental system of this study can provide new ideas for the construction of ecological security patterns in other regions and provide scientific support for the ecological sustainable development of similar urban areas.

In recent years, laser engraving has received widespread attention as a convenient, efficient, and programmable method, which has enabled the obtaining of high-quality porous graphene from various precursors. Laser engraving is often used to fabricate the dielectric layer with micro-structure for capacitive pressure sensors, however, the usual choice of electrodes remains poorly flexible metal electrodes, which greatly limits the overall flexibility of the sensors. In this work, we propose a flexible capacitive pressure sensor made entirely of thermoplastic polyurethane (TPU) and laser-induced graphene (LIG) derived from wood. The capacitive pressure sensor consisted of a flexible LIG/TPU electrode (LTE), a LIG/TPU electrode with micro hole array, and dielectric layer of TPU with micro-cone array molded from laser-engraved hole array on wood, which provided high sensitivity (0.11 kPa-1), ultra-wide pressure detection range (100Pa to 1.4MPa), fast response (~300 ms) and good stability (&gt;4000 cycles, at 0-35 kPa). We believe that our research makes a significant contribution to the literature because the easily available materials derived from wood and overall consistent flexibility meet the requirements of flexible electronic devices.

The high Nb-containing TiAl-based alloy ingot beyond laboratory scale with a composition of Ti-46Al-8Nb (at. %) was prepared by a vacuum induction melting process based on BaZrO3 refractory. An ingot without macroscopic casting defects (such as pipe shrinkage and center line porosity) was finally obtained, and the chemical composition, solidification path, microstructure and tensile properties of the ingots were investigated. The results show that the deviations of Al and Nb content along a 430 mm long central part of the ingot are approximately \mathrm{\pm}0.39 at. % and \mathrm{\pm}0.14 at. %, and the oxygen content in the ingot can be controlled at around 1000 ppm. During the solidification process, the alloy suffered from peritectic reaction and formed columnar grains with anisotropy. In addition to Al segregation and Nb segregation, β-phase particles associated with γ phase at the triple junction of the colonies were observed. Moreover, the mechanical properties of the ingot in the transverse direction are significantly better than those in the longitudinal direction, with a tensile strength of up to high as 700 MPa and a corresponding fracture elongation of 1.1 %.

Soarinho Alkaline Intrusion, southeastern Brazil, makes part of the Serra do Mar Igneous Province, and it is composed of alkali feldspar syenite, alkali feldspar trachyte, quartz syenite, and mon-zonite. Geochemical and geochronological analysis of the Soarinho were compared with data from its neighbors Rio Bonito and Tanguá. Zircon U-Pb Laser Ablation ages show that Soarinho is youngest than Rio Bonito and Tanguá. Ages obtained from the monzonite (60 ± 2 Ma), alkali feldspar syenite (58 ± 2 Ma), and quartz syenite (58 ± 2 Ma) are indistinguishable within error. Petrographic and geochemical data show a clear contrast among Soarinho, Rio Bonito, Tanguá, and Lu-Hf isotopic data for the three alkaline intrusions (all negative), point to some similarities in their sources. The data suggest an enriched mantle source for Soarinho; however, an older con-tinental crust contribution cannot be discarded.

This research focuses on the Hopf bifurcation occurring at a singular point with high-order degeneracy in a class of three-dimensional systems. Based on center manifold theorem, by expanding the technique for determining singular point values of degenerate singularities in two-dimensional systems, the formal series method to determine the singular point values at the high-order degenerate critical point is discussed. Furthermore, a class of specific three-dimensional differential systems with high-order degenerate singularities is explored. By computing the singular point values and determining center conditions, we proved that a minimum of 5 small-amplitude limit cycles in the vicinity of the origin. This research provides new perspectives on the center problem and limit cycle bifurcation in high-dimensional systems with high-order degenerate singular points.

The basic idea is to expand the completed zeta function $\xi(s)$ in MacLaurin series (infinite polynomial), which can be further expressed as infinite product (Hadamard product) by conjugate complex roots. Finally, the functional equation $\xi(s)=\xi(1-s)$ leads to $(s-\alpha_i)^2 = (1-s-\alpha_i)^2, i \in \mathbb{N}$ with solution $\alpha_i= \frac{1}{2}, i \in \mathbb{N}$, where $\alpha_i$ are the real parts of the zeros of $\xi(s)$, i.e., $s_i =\alpha_i\pm j\beta_i, i\in \mathbb{N}$. Therefore, a proof of the Riemann Hypothesis is achieved.

In March 2013, a novel avian influenza A H7N9 virus was emerged in China, which cause rapidly progressive pneumonia and with a high fatality rate. Serologic studies to evaluate neutralizing antibodies of infected patients and birds are invaluable tools for immunogenicity research of H7N9 and epidemiological investigation. Conventional neutralization assays are laborious and time-consuming which also hampered by biosafety requirement. In this study, We construct and produce pseudovirus bearing the full-length hemagglutinin (HA) of H7N9 virus in the Env-defective, luciferase-expressing HIV-1 backbone. The production of lentiviral pseudovirus was analysed by HA gene specific real-time reverse-transcription PCR, transmission electron microscopy (TEM), and Western Blot assay to prove the nucleic acid replication, the morphology of virus, and the expression of HA protein in pseudovirus. After that pseudovirus based inhibition assay was established to detect neutralizing antibodies of a panel of serum samples. Our results demonstrated that H7N9 pseudovirus which had single-cycle infection was generated. By comparing the neutralization antibody titers, pseudovirus based neutralization test could be recognized as an alternative of conventional microneutralization (MN). Hence, we conclude that it is possible to use pseudovirus inhibition assay to screen sera samples, as well as evaluate vaccine-induced neutralizing antibodies against H7N9 virus.

The interband transitions of urania (UO2) are validated independently through cathode luminescence of UO2. A picture emerges consistent with density functional theory. While theory is generally consistent with experiment, it is evident that the choice of functional can significantly alter the band gap and some details of the band structure, in particular at the conduction band minimum. Strictly ab initio predictions of the optical properties of the actinide compounds, based on density functional theory alone continues to be somewhat elusive.

Solid-state LiDAR offers multiple advantages over mechanism mechanical LiDAR, including higher durability, improved coverage ratio, and lower prices. However, solid-state LiDARs typically possess a narrow field of view, making them less suitable for odometry and mapping systems, especially for mobile autonomous systems. To address this issue, we propose a novel rotating solid-state LiDAR system that incorporates a servo motor to continuously rotate the solid-state LiDAR, expanding the horizontal field of view to 360∘. Additionally, we propose a multi-sensor fusion odometry and mapping algorithm for our developed sensory system that integrates an IMU, wheel encoder, motor encoder and the LiDAR into an iterated Kalman filter to obtain a robust odometry estimation. Through comprehensive experiments, we demonstrate the effectiveness of our proposed approach in both outdoor open environments and narrow indoor environments.

This work is devoted to physical vapor deposition synthesis, and characterisation of bismuth and lutetium-substituted ferrite-garnet thin-film materials for magneto-optic (MO) applications. The properties of garnet thin films sputtered using a target of nominal composition type Bi_0.9Lu_1.85Y_0.25Fe_4.0Ga₁O₁₂ are studied. By measuring the optical transmission spectra at room temperature, the optical constants and the accurate film thicknesses can be evaluated using Swanepoel’s envelope method. The refractive index data are found to be matching very closely to these derived from Cauchy’s dispersion formula for the entire spectral range between 300-2500 nm. The optical absorption coefficient and the extinction coefficient data are studied for both the as-deposited and annealed garnet thin-film samples. A new approach is applied for accurately deriving the optical constants data simultaneously with the physical layer thickness, using a combination approach employing custom-built spectrum-fitting software in conjunction with Swanepoel’s envelope method. MO properties, such as specific Faraday rotation, MO figure of merit and MO swing factor are also investigated for several annealed garnet-phase films.

Predators are dependent on the capture of prey to meet their energetic and nutritive requirements, imposing a regime of predation risk. Consequently, prey experience both consumptive and non-consumptive effects. Non-consumptive effects may manifest through altered growth and ontogenetic trajectories of prey species, a dynamic modulated by olfactory or other sensory cues from predators. Bactrocera dorsalis Hendel represents a great invasive threat to global horticulture. While earlier research has primarily centered on the consumptive interactions between B. dorsalis and its natural enemies, the potential consequences of non-consumptive interactions on the development of B. dorsalis have been overlooked. In this study, we investigated the impact of predation risk effects, induced by both visual exposure to the predatory mantis Hierodula patellifera Serville and its associated odor, on the life history traits of B. dorsalis. Female B. dorsalis demonstrated reduced development time in the presence of isolated H. patellifera or H. patellifera odor, yet evidenced significantly increased fecundity. Conversely, males displayed no significant change in development time. Additionally, neither female nor male body weight at death was significantly influenced by predation risk from isolated predators or predator odor. These results indicated adaptive developmental strategies of B. dorsalis when faced with risks from predators and highlight the important role of predator odor, which has the potential to lay the groundwork for improving biological control efforts and innovative approaches within pest control.

The performance of bearings plays a pivotal role in determining the dependability and security of rotating machinery. In intricate systems demanding exceptional reliability and safety, the ability to accurately forecast fault occurrences during operation holds profound significance. Such predictions serve as invaluable guides for crafting well-considered reliability strategies and executing maintenance practices aimed at enhancing reliability. In order to ensure the reliability of bearing operation, this article investigates the application of three advanced techniques—Maximum Correlation Kurtosis Deconvolution (MCKD), Multi-Scale Permutation Entropy (MPE), and Long Short-Term Memory (LSTM) recurrent neural networks—for the prediction of the remaining useful life (RUL) of rolling bearings. Each technique's principles, methodologies, and applications are comprehensively reviewed, offering insights into their respective strengths and limitations. Case studies and experimental evaluations are presented to assess their performance in RUL prediction. Findings reveal that MCKD enhances fault signatures, MPE captures complexity, and LSTM excels in modeling temporal patterns. The root mean square error of the prediction results is 0.007. The fusion of these techniques offers a comprehensive approach to RUL prediction, leveraging their unique attributes for more accurate and reliable predictions.

Small molecule modulators of neurotensin receptor 1 (NTSR1), a class A G protein-coupled receptor (GPCR), has been emerging as promising therapeutics for psychiatric disorders and cancer. Interestingly, a chemical group substitution of NTSR1 modulators can launch different downstream regulation, highlighting the significance of deciphering the internal fine-tuning mechanism. Here, we conducted synergistic application of Gaussian accelerated molecular dynamics simulation, conventional molecular dynamics simulation, and Markov state models (MSM) to investigate the underpinning mechanism of ‘driver chemical groups’ of modulators triggering inverse signaling. The result indicated that the flexibility of leucine moiety in NTSR1 agonists contributes to the inward displacement of TM7 through a loosely coupled allosteric pathway, while the rigidity of adamantane moiety in NTSR1 antagonists leads to unfavorable downward transduction of agonistic signaling. Furthermore, we found that R3226.54, Y3196.51, F3537.42, R1483.32, S3567.45 and S3577.46 may play a key role in inducing the activation of NTSR1. Together, our findings not only highlight the ingenious signal transduction within class A GPCRs, but also lay a foundation for the development of targeted drugs harboring different regulatory function of NTSR1.

A typical vibrational spectrum in the ice phase has four separate bands: translation, libration, bending and stretching. Ice X, the final ice phase under high pressure, shows an exotic vibrational spectrum. Theoretically, an ideal crystal of ice X only has one peak at 998 cm-1 for Raman scattering and two peaks at 450 cm-1 and 1507 cm-1 for infrared absorption in this work. These three characteristic peaks are indicators of the phase transition between ice VII/VIII and ice X. Despite much experimental and theoretical work on ice X, only this study has clearly indicated these characteristic peaks in the region of the IR band. The phonon density of states shows quite different features than ice VIII, which could be verified by inelastic neutron scattering in the future. The dynamic processes of 15 vibrational normal modes are discussed and the typical hydrogen bonds are missing.

Due to poor ventilation conditions in the tunnel, if gas pipeline leaks, the consequence of the accident will be more serious. Therefore, before the emergency repair, gas in the tunnel needs to be excharged so as not to explode during the repair process. Therefore, it is necessary to study the ventilation of gas in the tunnel. Based on the computational fluid dynamics (CFD) theory and taking the Yanyingshan tunnel section of China-Myanmar pipeline as an example, this paper uses Fluent software to establish the leakage model of the gas pipeline and fan model in the tunnel and analyzes the influence of different fan locations and number of fans on gas concentration. It can be concluded that: (1) the use of press-in method makes it more efficient to discharge gas out of the tunnel. (2) In order to make ventilation efficient, the fan should be arranged in a higher position and needs to be at a distance from the top of the tunnel. (3) Parallel use of two fans has better ventilation effect than single fan.

With the rapid growth of large language models (LLMs), there is increasing demand for memory and computation in LLMs. Recent efforts on post-training pruning of LLMs aim to reduce the model size and computation requirements, yet the performance is still sub-optimal. In this paper, we present a plug-and-play solution for post-training pruning of LLMs. The proposed solution has two innovative components: 1) Relative Importance and Activations (RIA), a new pruning metric that jointly considers the weight and activations efficiently on LLMs; and 2) Channel Permutation, a new approach to maximally preserve important weights under N:M sparsity. The two proposed components can be readily combined to further enhance the N:M semi-structured pruning of LLMs. Our empirical experiments show that RIA alone can already surpass all existing post-training pruning methods on prevalent LLMs, e.g., LLaMA ranging from 7B to 65B. Furthermore, N:M semi-structured pruning with channel permutation can even outperform the original LLaMA2-70B on zero-shot tasks, together with practical speed-up on specific hardware. Our code is available at: https://github.com/biomedical-cybernetics/Relative-importance-and-activation-pruning

Near-infrared (NIR) photodetectors (PDs) have attracted much attention in noninvasive medical diagnosis and treatment. Especially, the self-filtered NIR PDs are highly demandable for tremendous biomedical application due to their strong ability in wavelength discrimination. In this work, we designed and then fabricated a Si micro-holes array/Graphene (Si MHA/Gr) van der Waals (vdW) Schottky NIR photodiode by using PbS quantum dots (QDs) coating. The device exhibits a unique self-filtered NIR response with a responsivity of 0.7 A/W at -1 V and a response time of 61 μs, which are higher than that without PbS QDs coating and even most of previous Si/Gr Schottky photodiodes. The light trapping of the Si MHA and the PbS QDs coating can be attributed to the high responsivity of the vdW photodiode. Furthermore, the presented NIR photodiode can also be integrated in photoplethysmography (PPG) for real-time heart-rate (HR) monitoring. The extracted HR is in great accord with the value measured with the patient monitor by analyzing the Fourier transform of the stable and reliable fingertip PPG waveform, suggesting its potential for practical applications.

In this study, a new method for synthesizing Au-NaYF4:Yb3+/Er3+-DSPE-PEG2K nanocomposites was introduced. Using a hydrothermal method, the synthesized Yb3+- and Er3+-codoped NaYF4 upconversion luminescent materials and Au nanoparticles were doped into upconversion nanomaterials and modified with DSPE-PEG2k up-conversion nanomaterials. This material is known as Ag-UCNPs-DSPE-PEG2k, it improves both the luminous intensity because of the doped Au nanoparticles and has low cytotoxicity because of the DSPE-PEG2k modified. Exciting UCNPs with a wavelength of 980nm near-infrared light will emit light with a wavelength of 520nm to further excite gold nanoparticles to convert light energy into heat. Successful synthesized gold nanoparticles was confirmed using transmission electron microscopy (TEM). The morphology of UCNPs was observed using scanning electron microscopy (SEM), and the mapping confirmed the successful doping of Au nanoparticles. Fluorescence spectra were used to compare changes in luminescence intensity before and after doping Au nanoparticles. The cytotoxicity of Au-UCNPs-DSPE-PEG2K was tested via the cell counting kit-8 (CCK-8) method, and its imaging ability was characterized using the Magnetic Resonance Imaging (MRI) and Computed Tomography (CT) method.

The existence of the hole on a plate affects the calculation of eddy current problems. Consequently, the accuracy for the prediction of the material properties decreases if the effect of the hole is not taken into account. In this paper, a novel analytical method based on the modified integration range is proposed which can address the presence of the hole. Due to the presence of the hole, the conventional Dodd-Deeds analytical solution cannot be used to calculate the inductance change. Therefore, a revised upper integration limit is introduced to replace the original limit -- ∞ when using the co-axially air-core electromagnetic sensor. With the presence of the hole, the magnitude of the received signal reduces, and the peak frequency feature changes. The analytical method is validated by measured and numerical simulation results. It is found that the upper limit is related to the radius of the open hole. With the new technique, the thickness of sample plates with holes can be estimated based on the peak frequency feature.

The development of computational acoustics allows simulation of sound generation and propagation in complex environment. In particular, meshfree methods are widely used to solve acoustics problems through arbitrarily distributed field points and approximation smoothness flexibility. As a Lagrangian meshfree method, smoothed particle hydrodynamics (SPH) method reduce the difficulty in solving problems with deformable boundaries, complex topologies, or multiphase medium. The traditional SPH method has been applied in acoustic simulation. This study presents the corrective smoothed particle method (CSPM), which is a combination of SPH kernel estimate and Taylor series expansion. The CSPM is introduced as a Lagrangian approach to improve accuracy in solving acoustic wave equations in the time domain. Moreover, a boundary treatment technique based on the hybrid meshfree and finite difference time domain (FDTD) method is proposed to represent different acoustic boundaries with particles. To model sound propagation in pipes with different boundaries, soft, rigid, and absorbing boundary conditions are built with this technique. Numerical results show that the CSPM algorithm is consistent and demonstrates convergence with exact solutions. Main computational parameters are discussed, and different boundary conditions are validated to be effective for benchmark problems in computational acoustics.

The normal growth and development of skeletal muscle is essential for the health of the body. The regulation of skeletal muscle by intestinal microorganisms and their metabolites has been continuously revealed. Acetate is the predominant short-chain fatty acid synthesized by gut microbiota through the fermentation of dietary fiber, however, the underlying molecular mechanisms governing the interaction between acetate and skeletal muscle during rapid growth stage remain to be further elucidated; Here, specific pathogen-free (SPF) mice, germ-free (GF) mice, and germ-free mice supplemented with sodium acetate (GS) were used to evaluate the effects of acetate on skeletal muscle growth and development of young mice with gut microbiota deficiency; We found the concentration of serum acetate, body mass gain, succinate dehydrogenase activity and expression of myogenesis maker gene of skeletal muscle in the GS group was higher than GF group following sodium acetate supplement. Furthermore, the transcriptome analysis revealed that acetate activated biological processes regulating skeletal muscle growth and development in GF group that are inhibited due to gut microbiota deficiency. In vitro experiment, we proved that acetate up-regulated Gm16062 to promote skeletal muscle cell differentiation; Overall, our findings proved that acetate promote skeletal muscle growth and development in young mice via increase Gm16062 expression.

During Sep. 2011, forty-four Leymus chinensis culms with stroma development were collected from Inner Mongolia. Stromata surrounded the flag leaf sheathes, white, at the final stage of development. Perithecium but not asci were observed under microscope. Nine epichloid endophyte strains were obtained from Tongliao subdivision, and sixteen from Horqin. Morphological and phylogenetic properties of these strains were investigated. Morphological properties of these strains were similar among these 27 strains. Colonies could grow to 28.5~41.1 mm/21d at 25℃; phialides 24.1~26.4 μm long, 2.1~2.5 μm at base, tapering to less than 1.0 μm at tip; conidia reniform to elliptical, 4.7~5.5×2.8~3.5 μm, indicating typical properties of Epichloë endophytes. Based on the sequences of tefA and tubB gene fragments, strains isolated from Inner Mongolia formed a distinct subclade in E. bromolica/ E. yangzii clade, with a bootstrap value of 66% and 64% respectively. Considering morphological and phylogenetic properties, we tend to determine strains isolated from Leymus chinensis as a new taxon. The detailed taxonomic position of this taxon needs further investigations on hybridization or genomic sequence.

In the recent decade, Building Information Modelling (BIM) has widely been adopted in the Architecture, Engineering and Construction (AEC) industry and completely upended the way we build. While BIM continues gain momentum in the industry, it has also attracted increasing attentions from researchers. However, most of the current study focuses on reviewing BIM for management, BIM for green building, BIM for infrastructure and BIM for Facilities Management (FM). There are few studies about Global BIM review and to discuss their complex inter-connections. In this study, we adopted a scientometric analysis method to review global BIM research from 2004-2019. A total of 1455 scholarly bibliographic records obtained from Web of Science Core Collection databased were established for the analysis. This study has identified the top productive and influential researchers, research institutes, regions/countries, subject categories and journals in the BIM field. In addition, 11 clusters of Global BIM research were also identified including construction project, green BIM, construction safety planning, automated IFC-based workflow and so on. Authors distinguished 11 clusters of global BIM research into 3 stages, namely formulating stage, accelerating stage and transforming stage. Furthermore, authors reviewed the BIM policy of Singapore and observed there is a co-production relationship between evolution of BIM policy and global BIM research. These findings provide valuable information for researchers, practitioners and policy makers by visualizing the current progress in the research field of BIM and highlighting future research needs.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

For Interferometry Synthetic Aperture Radar (InSAR), the normal baseline is one of the main factors that affect the accuracy of the ground elevation. For Gaofen-3 (GF-3) InSAR processing, the poor accuracy of the real-time orbit determination resulting in a large baseline error, leads to the modulation error in azimuth and the slope error in range for timely Digital Elevation Model (DEM) generation. In order to address this problem, a baseline estimation method based on external DEM is proposed in this paper. Firstly, according to the characteristic of the real-time orbit of GF-3 images, orbit fitting is executed to remove the non-linear error factor. Secondly, the height errors are obtained in slant-range plane between Shuttle Radar Topography Mission (SRTM) DEM and the GF-3 generated DEM after orbit fitting. At the same time, the height errors are used to estimate the baseline error which has a linear variation. In this way, the orbit error can be calibrated by the estimated baseline error. Finally, DEM generation is performed by using the modified baseline and orbit. This procedure is implemented iteratively to achieve a higher accuracy DEM. Based on the results of GF-3 interferometric SAR data for Hebei, the effectiveness of the proposed algorithm is verified and the accuracy of GF-3 real-time DEM products can be improved extensively.

Digital Elevation Models (DEMs) are widely used in geographic and environmental studies. In the current work, the fusion of multi-source DEMs is investigated to improve the overall accuracy of public domain DEMs. Multi-scale decomposition is an important analytical method in data fusion. Three multi-scale decomposition methods – the wavelet transform (WT), bidimensional empirical mode decomposition (BEMD) and nonlinear adaptive multi-scale decomposition (N-AMD) - are applied to the 1-arc-second Shuttle Radar Topography Mission Global digital elevation model (SRTM-1 DEM) and the Advanced Land Observing Satellite World 3D – 30 m digital surface model (AW3D30 DSM) in China. Of these, the WT and BEMD are popular image fusion methods. A new approach for DEM fusion is developed using N-AMD (which is originally invented to remove the cycle from sunspots). Subsequently, a window-based rule is proposed for the fusion of corresponding frequency components obtained by these methods. Quantitative results show that N-AMD is more suitable for multi-scale fusion of multi-source DEMs, taking the ice cloud and land elevation satellite (ICESat) global land surface altimetry data as a reference. The vertical accuracy of the fused DEM shows significant improvements of 29.6% and 19.3% in a mountainous region and 27.4% and 15.5% in a low-relief region, compared to the SRTM-1 and AW3D30 respectively. Furthermore, a slope position-based linear regression method is developed to calibrate the fused DEM for different slope position classes, by investigating the distribution of the fused DEM error with topography. The results indicate that the accuracy of the DEM calibrated by this method is improved by 16% and 13.6%, compared to the fused DEM in the mountainous region and low-relief region respectively, proving that it is a practical and simple means of further increasing the accuracy of the fused DEM.

Road cracks significantly affect the serviceability and safety of roadways, especially in mountainous terrain. Traditional inspection methods, such as manual detection, are excessively time-consuming, labor-intensive, and inefficient. Additionally, multi-function detection vehicles equipped with various sensors are expensive and not suitable for mountainous roads due to poor conditions. To address these challenges, this study proposes a customized Unmanned Aerial Vehicles (UAV) inspection system designed for automatic crack detection. The system focuses on enhancing autonomous capabilities in mountainous terrains by incorporating embedded algorithms for route planning, autonomous navigation, and automatic crack detection. The slide window method is proposed to enhance the autonomous navigation of UAV flights by generating path planning in mountainous roads. This method compensates for GPS/IMU positioning errors, particularly in GPS-denied or GPS-drift scenarios. Moreover, the YOLOv8 algorithm is introduced to conduct autonomous crack detection from UAV imagery in the offboard module. To validate our UAV inspection system's performance, we conducted several experiments to assess its accuracy, robustness, and efficiency. The experimental results demonstrate that our UAS inspection system accurately estimates the flight trajectory along the mountainous road for autonomous navigation. Furthermore, the experimental detection results also demonstrate that the YOLOv8 algorithm achieves higher recognition accuracy compared to the YOLOv5, and YOLOv7-tiny algorithms, exceeding 3.1%,and 6.8% of mAP, respectively. In summary, the UAV inspection system proposed in this study can provide a useful tool and technological guidance for the regular inspection of mountainous roads.

As the general acceptance of fiber-reinforced polymer (FRP) in the concrete construction industry continues to rise, it is increasingly imperative that the crack width of FRP reinforced concrete members of pavement and girder be predicted with good accuracy due to strengthening of RC pavement, slabs or beams structures using FRP is known to control crack width. However, no specific provisions are provided by most international design codes for predicting crack width in FRP reinforced concrete flexure members. In this paper, five formulas for predicting the crack width for FRP reinforced structures are derived from three common computational theories which including statistical method, comprehensive theory, and bond-slip theory. The formula of statistical method is simplest, but the parameters depend on much sample data. The comprehensive and slippage theory based on semi-empirical statistical crack spacing are obtained through the calculation of non-uniformity coefficient of strain. The comprehensive and slippage theory based on semi-empirical axial force balance are obtained through the calculation of tensile reinforcement factor. The comparative analysis of performance of five formulas is carried out. The results indicate that the formula from comprehensive theory based on semi-empirical statistical crack spacing is recommended for predicting the crack width of FRP reinforced concrete flexural structure.

To address the problems of poor recognition, low detection accuracy, a large number of model parameters and computation, complex network structure, and unfavorable portability to embedded devices in traditional tennis ball detection algorithms, this study proposes a lightweight tennis ball detection algorithm YOLOv5s-Z based on Robomater EP. The main work is as follows: Firstly, constructing lightweight G-Backbone and G-Neck network layers to reduce the number of parameters and computation of the network structure. Secondly, the convolutional coordinate attention is incorporated in G-Backbnone to embed the location information into the channel attention, which makes the network obtain the location information in a larger area through multiple convolutions and enhances the expression ability of the mobile network learning features. In addition, the Concat module in the original feature fusion is modified into a weighted bi-directional feature pyramid W-BiFPN with settable learning weights to improve the feature fusion capability and achieve efficient weighted feature fusion and bi-directional cross-scale connectivity. The EIOU loss is introduced to split the influence factor of aspect ratio and calculate the length and width of the target frame and anchor frame respectively, combined with Focal-EIOU Loss to solve the problem of imbalance between difficult and easy samples. The activation function Meta-ACON is introduced to achieve an adaptive selection of whether to activate the neurons and improve the detection accuracy. Finally, the experimental results show that compared with the original algorithm, the YOLOv5s-Z algorithm reduces the number of parameters and computation by 42$\%$ and 44$\%$, the model size by 39$\%$, and 2$\%$ improvement in average accuracy mean value, which verifies the effectiveness of the improved algorithm and the light weight of the model to meet the deployment requirements of embedded devices, and adapts Robomaster EP for accurate detection and real-time recognition of tennis balls.

Product innovation is a crucial factor in enterprise survival. Even though there are sources from strategic theory that guides the clear comprehension towards appreciating the nexus between these two variables (product innovation and enterprise survival), there are still many lacunas that should be addressed and filled. Consequently, the need for additional empirical corroboration or support is pertinent. This study aimed at verifying the nexus between product innovation and enterprise survival, and how they are affected by the existence of antecedent variables such as competitive intensity and competitive advantage. In the methodology, this study adopts the conduct of explanatory and cross-sectional investigations through the use of structural equation modelling (SEM) to a sample of selected food and beverages enterprises in Lagos, Nigeria. Regarding the food and beverage enterprises in Lagos, Nigeria, this study discovered that competitive intensity has huge positive implication on product innovation at (0.39; t = 5.69, p < 0.05). This gives numerical evidence that, in the face of more market competition, enterprises will be pressured to adopt the model of costs reduction on products which will enhance the reduction of product prices, and will have significant impact on profit. However, the findings reveal that there is no significance between competitive advantage and product innovation at (0.002; t = 0.203, p > 0.05), and there is no significance between product innovation and enterprise survival at (-0.035; t = -1.583, p > .05). As a result, the food and beverage enterprises should concentrate more on product innovation so that they will be able to stand the intensity of competition. The results emanated from the study is germane as it make significant contribution to literature and the body of knowledge and on strategic management by enlightening that competitive intensity is a necessary inducement for product innovation.

Background: Coronavirus disease 2019 (COVID-19) is a new viral respiratory disease and whether pregnant women are at increased risk of infection is unknown. Viral pneumonia is an important indirect cause of maternal death. Little is known about the effects of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) during pregnancy. Objective: To describe the clinical characteristics of COVID-19 in pregnancy and their newborn infant, and we sought to explored whether the SARS-CoV-2 can be intrauterine vertically transmitted. Study Design: The study was a case series study conducted in the obstetric ward of Tongji Hospital affiliated to Huazhong University of science and technology, Wuhan, China. Demographic, clinical, laboratory and radiological profiles of the SARS-CoV-2 infection case series. A systematic testing procedure for SARS-CoV-2 infection using oropharyngeal swab, placenta tissue, vaginal mucus, and breast milk of mothers. and oropharyngeal swab, umbilical cord blood, and serum of newborns was conducted. Results: We have conducted the most thorough virological assessment to date, and we include a longer clinical observation in mother-infant dyads during hospitalization. The clinical course and outcomes of three pregnant women who acquired SARS-CoV-2 infection late pregnancy are described in mother-infant dyads. Two had caesarean delivery in their third trimester. All patients showed an uneventful perinatal course, and a successful outcome. No infants became infected by vertical transmission or during delivery. Conclusion: No evidence to suggest the potential risk of intrauterine vertical transmission in the case series and further in-depth study is needed. Both the pregnancy woman and infant showed fewer adverse maternal and neonatal outcomes.

The rock joint fissure slope in cold regions is prone to deformation and failure problems such as relaxation, tension and collapse under freeze-thaw (F-T) cycles. Based on the ideology of clean production and promoting the structural integrity of geotechnical projects in cold areas, this study designed and prepared aeolian-sand (AS) to replace part of river sand as a filling mortar material by taking advantage of the low cost and easy availability of AS. Investigations were carried out to determine the impact of varying proportions of AS in mortar on the microstructure and shear properties of the mortar-rock interface under F-T cycles. Therefore, F-T cycle testing, nuclear magnetic resonance (NMR) testing and shear testing were carried out on grout with different proportions of AS. The results show that the right proportion of AS replacement could enhance the shear deformation resistance and F-T resistance of the mortar-rock interface, and 30% proportion is the optimal proportion. By increasing of F-T cycles, the three types of specimens showed different degrees of particle spalling, shedding and cracking. The slurry-rock interface layer in the A (0%) group exhibited the most severe F-T deterioration, while the B (15%) group showed a lesser degree, and the C (30%) group performed the best. T2 spectrum curve and total spectrum area change law from the microscopic point of view to verify the 30% AS proportion mortar-rock interface F-T resistance is the strongest, followed by 15% AS proportion mortar, the weakest is ordinary mortar. The degradation of the mortar-rock bond is primarily due to the conversion of solid to liquid phases and the movement of internal water caused by fluctuating temperatures. The extent of F-T deterioration in the slurry-rock interface layer is greatly affected by the varying proportions of AS. The shear strength and shear stiffness of specific proportion of AS decreased with the increase of F-T cycles. For same F-T cycles, the shear strength and shear stiffness of group C (30%) were the highest, followed by group B (15%) and group A (0%). The grout material not only reinforces the F-T joint fissure slope, but also reduces the cost of grout reinforcement and promotes the clean production of geotechnical structures.

To compare The effects of organic and inorganic impregnation on the properties of unmodified, phenol formaldehyde oligomer-modified (PFOMCF), and sodium silicate-modified Chinese fir wood (SSMCF) were compared using samples prepared using the respiratory impregnation method. Impregnation and reinforcement effects and water resistance of PFOMCF and SSMCF were compared and the results was showed that the weight percentage gain, density increase rate, bending strength, and compressive strength of SSMCF were clearly higher than those of PFOMCF and had a lower water absorption rate within 60 h. The impregnation and reinforcement effects and dimensional stability of SSMCF were better than those of PFOMCF. FT-IR, XRD, CONE, and TGA examinations were used to test and analyze the chemical structure, crystalline structure, flame retardancy, and heat resistance of these modified woods. The results indicated that SSMCF possessed more hydrogen bonds than PFOMCF and that Si–O–Si chemical bonding with high bond energy was formed. Meanwhile, the weakened degree of the diffraction peak of SSMCF was much less than that of PFOMCF. These results explained that the mechanical properties and water resistance of SSMCF were better than PFOMCF. Compared with PFOMCF, SSMCF had a lower heat release rate (HRR), peak-HRR, mean-HRR, total heat release, smoke production rate, and total smoke production as well as higher thermal decomposition temperature and residual rate. Inorganic sodium silicate was shown to be a better flame retardant, while SSMCF had good smoke suppression effects, thermal stability, and safety performance in the case of fire.

Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) is a single stranded RNA virus which has resulted in the Coronavirus Disease 2019 (COVID-19) pandemic and has infected millions of people all over the world. SARS-CoV-2 has been mutating rapidly resulting in the emergence of multiple variants to escape the host immune system mainly by mutations in its receptor binding domain (RBD) of the spike protein. This rapid evolution of the SARS-CoV-2 posed a great challenge regarding the efficacy and effectiveness of the current SARS-CoV-2 vaccines. The RBD and full-length spike of SARS-CoV-2 is the main target of the neutralizing antibodies. Many SARS-CoV-2 variants are considered to have the potential to escape from the host immune system. In this study, the RBD of Alpha, Beta, Gamma, Kappa and Omicron and the full-length spike of BA.1, BA.2, BA.3, BA.4/5, BQ.1.1 and XBB.1.5 Omicron variants were used as coating antigens in Enzyme Linked Immuno-Sorbent Assay (ELISA) to check the neutralization capability of COVID-19 convalescent sera from patients of first wave of infection occurring in Wuhan. Our results show that the currently circulating Omicron BQ.1.1, XBB.1.5 and previous Omicron BA.1, BA.2 and BA.4/5 do not show significant reduction in neutralization, while Omicron BA.3 and previous variants Alpha, Beta, Gamma, Kappa, and Omicron showed a significantly reduced neutralization when compared to the wild-type Wuhan strain. These results indicate patients recovering from natural infection of early original Wuhan strain may have the potential to resist infection of current circulating variants and the vaccines using the prototype antigen may still working for newly emerged variants.

Surface water distribution extracted from remote sensing data has been used in water resource assessment, coastal management, and environmental change studies. Traditional manual methods for extracting water bodies cannot satisfy the requirements for mass processing of remote sensing data; therefore, accurate automated extraction of such water bodies has remained a challenge. The histogram bimodal method (HBM) is a frequently used objective tool for threshold selection in image segmentation. The threshold is determined by seeking twin peaks, and the valley values between them; however, automatically calculating the threshold is difficult because complex surfaces and image noise which lead to not perfect twin peaks (single or multiple peaks). We developed an operational automated water extraction method, the modified histogram bimodal method (MHBM). The MHBM defines the threshold range of water extraction through mass static data; therefore, it does not require the identification of twin histogram peaks. It then seeks the minimum values in the threshold range to achieve automated threshold. We calibrated the MHBM for many lakes in China using Landsat 8 Operational Land Imager (OLI) images, for which the relative error (RE) and squared correlation coefficient (R2) for threshold accuracy were found to be 2.1% and 0.96, respectively. The RE and root-mean-square error (RMSE) for the area accuracy of MHBM were 0.59% and 7.4 km2. The results show that the MHBM could easily be applied to mass time-series remote sensing data to calculate water thresholds within water index images and successfully extract the spatial distribution of large water bodies automatically.

Abstract:This study aimed to explore the effects of supplementary feeding on milk yield, blood biochemical indexes, milk components, and fecal microflora diversity of Yili horses under grazing condition.18 grazing Yili mare horses with physiological condition consistent were randomly assigned to three groups with six mare horses each. The control group normal grazing, whereas the test group I and II were provided with supplemented with 1 kg/d of concentrate and 1 kg/d of concentrate + 0.4 kg/d coated fatty acids, respectively. After 3 days of pre-feeding, begin the experiment.Horse milk was collected every 7 days, and 10% of the milk yield of each horse was mixed in 100 mL milk sample bottles and stored in -20℃ refrigerator.Which blood samples were collected from the jugular vein before morning feeding (0 h) and at 1,2,3,4,6,9 and 12 h after morning feeding on day 40, and the plasma were centrifuged at 4000 rpm for 15 min and conservation at-20℃. Excrement was collected within 8 h on days 45 and 46 of the test, mixed with 5g of fresh fecal samples in a 5 mL frozen storage tubes and stored in liquid nitrogen. Compared with the control group, the lactation volume of Yili horses in test groups I and II was significantly higher throughout the trial period (P <0.05), and the late test group II was significantly higher than test group I (P <0.05). The yield of milk fat, lactose, and milk protein in test group II was significantly higher than that in test group I and control group (P <0.05); the urea nitrogen content in test group I was significantly lower than the control group (P <0.01). The lauric acid, tetradecanoic acid, cis-11,14,17-eicosotrienic acid, total saturated fatty acid, and total saturated fatty acid/total unsaturated fatty acid in test group II were significantly higher than those in the control group and test group I (P <0.05); The plasma glucose concentration of mares in test group II was significantly higher than that of control group and test group I at 1, 2 and 9 h after feeding (P <0.05), and significantly higher at 4 h after feeding (P <0.05); At 3 h and 6 h after feeding, test group II mares had significantly higher plasma free fatty acids and triglycerides concentrations than the control and test group I (P <0.05), at 4 h after feeding, the plasma triglyceride concentrations were significantly higher than the control and test I groups (P <0.05). Plasma low density lipoprotein and very low density lipoprotein concentrations were significantly higher in mares at 3 h and 9 h after feeding than in control and group I (P <0.05). The total number of OTUs was 3483, and the number of OTUs was 4984,5487, and 5158 in the control and test I and II, respectively. At the phylum level, the total abundance of Bacteroidetes and Firmicutes was more than 75%, and the test group Verrucomicrobia was significantly higher than the control group (P <0.05), and the test group II was significantly higher than the test group I (P <0.05). The Treponema_saccharophilum was significant difference in the feces of the control group (P <0.05); WCHB 1_41, kiritimatiellae, and Verrucomicrobia were significant difference of the test group II (P <0.05) and the fecal flora was mainly related to lipid synthesis, metabolism, and energy metabolism (P <0.05). Supplemental feeding can improve lactation volume of grazing Yili horses, improve the absorption and utilization of fatty acids, and improve the composition and diversity of horse milk and fecal flora to a certain extent.

In order to improve the adaptability of broilers to low-temperature environments and their ability to resist acute cold stress (ACS), 240 one-day-old broilers were selected and randomly divided into three groups. The control treatment (CC) was raised at the conventional feeding temperature from 1-43 days (d), the cold stimulation treatments (CS) were kept at 3 °C below the temperature of CC at 1-d intervals for 3 and 6 hours from 15 to 35 d, namely CS3 and CS6, respectively. Then all broilers were kept at 20 °C from 36 to 43 d. ACS was then carried out at 44 d, and the ambient temperature was dropped to 10 °C for 6 hours. The study investigated the production perfor-mance, as well as levels of intestinal barrier genes (including Claudin-1, E-cadherin, Occludin, ZO-1, ZO-2 and Mucin2), secretory IgA in duodenum and jejunum, and immunoglobulins (IgA and IgG) in serum. The results showed that IMCS could increase the daily weight gain and decrease the feed conversion ratio. During the IMCS, the expression levels of intestinal barrier genes were up-regulated and the content of secretory IgA was increased. When IMCS ceased for one week, the level of immunoglobulins in serum stabilized, and the expression levels of Occludin, ZO-2 and Mucin2 still maintained high levels. After ACS, broilers that received IMCS training maintained the high levels of intestinal barrier genes and secretory IgA.

The most recent National Research Council Nutrient Requirements for Sheep and Goats was published in 2007, one of the most consequential nutrient requirement recommendations for sheep and goats in the world. It is pertinent to continue the refinement and discussion of nutrient utilization and requirements for the purposes of enhancing the efficiency of production systems, maximizing resource economy, and minimizing the carbon footprint, among others. Progress has been made in the estimation of energy and protein requirements in sheep and goats, mainly utilizing empirical feeding experimentation, comparative slaughter technique and minimum endogenous loss method. In sheep, newer estimates of energy and protein requirements for maintenance and growth and partial efficiencies had been reported since 2007. There were suggestions that energy and protein requirements could have been affected by breed, wool growth, gender and size; with these reported values being similar or lower than the recommended values in international feeding systems such as NRC, ARC, INRA and AFRC. In goats, energy and protein requirements for growing goats were reported to be either higher or lower than the established recommendations, depending upon meat or dairy breeds. Effect of gender on energy requirement appeared to be related to the stage of growth or degree of maturity. Newer data also suggested that the guidelines of the major feeding systems for the entire growth phase may not be adequate for non-pregnant and non-lactating pubertal females. In multiparous pregnant goats, energy and protein requirements for maintenance did not appear to be affected by days of pregnancy, but efficiencies of metabolizable energy and metabolizable protein utilization for pregnancy were. There were suggestions that that metabolizable protein synthesis in the rumen can be predicted from energy intake using combined equations that encompass both sheep and goats, but more data on goats were called for to account for specific differences in nutrition. In addition to sulfur, there has been progress made on the estimation of maintenance and growth requirements of calcium, phosphorus, potassium and magnesium in goats, with suggestions on the consideration of gender and breed differences. Species, level of Intake, genotype, mature size, age, gender, body composition, use of tissue energy, activity, season, and acclimatization continue to be important considerations for the estimation of nutrient requirements in sheep and goats, with emerging factors such as climate change, heat stress, parasitism and secondary plant compounds. Model equations and partial efficiencies used by NRC to predict energy and protein requirements for maintenance, growth, lactation, and fiber have been highlighted and discussed for the purpose of a more focus discussion and refinement for the future. Potential and limitation of both traditional and emerging methodologies in determining the nutrient requirements in sheep and goats were discussed. To justify the research investment, emerging methodologies such as nutrigenomics will have to be linked more directly to the improvement of production efficiency via more precise prediction of nutrient requirement.

With the advancement of technology, signal modulation types are becoming increasingly diverse and complex. The phenomenon of signal time-frequency overlap during transmission poses significant challenges for the classification and recognition of mixed signals, including poor recognition capabilities and low generality. This paper presents a recognition model for fine-grained analysis of mixed signal characteristics, proposing a Geometry Coordinate attention mechanism and introducing a low-rank bilinear pooling module to more effectively extract signal features for classification. The model employs a residual neural network as its backbone architecture and utilizes the Geometry Coordinate attention mechanism for time-frequency weighted analysis based on information geometry theory. This analysis targets multiple-scale features within the architecture, producing time-frequency weighted features of the signal. These weighted features are further analyzed through a low-rank bilinear pooling module, combined with the backbone features, to achieve fine-grained feature fusion. This results in a fused feature vector for mixed signal classification. Experiments were conducted on a simulated dataset comprising 39,600 mixed signal time-frequency plots. The model was benchmarked against a baseline using a residual neural network. The experimental outcomes demonstrated an improvement of 9% in the exact match ratio and 5% in the Hamming score. These results indicate that the proposed model significantly enhances the recognition capability and generalizability of mixed signal classification.

Selenium (Se) is an essential trace element for human beings and Se supplementation is of great significance. In this paper, high selenized Gastrodia elata Blume Polysaccharides (SeGEP) were obtained through pre-sulfation before conducting the selenylation modification process, which owned a maximum Se content reach to 2.29%. UV, FT-IR, NMR, SEM, EDX, HPLC, size-exclusion chromatography and periodate oxidation analysis showed that the seleninic group had been successfully introduced into GEP with the substitution position at C-6 of glucose. Immunostimulating assays were conducted in vitro and in vivo on RAW 264.7 cells and cyclophosphamide (CTX)-induced mice model, respectively. The results showed that Se-GEP enhanced RAW264.7 cells proliferation, cell phagocytosis, and secretion of nitric oxide (NO) and interleukin (IL)-1β factors. In addition, Se-GEP enhanced the immunologic activity of CTX-treated mice by increasing the spleen and thymus indices, enhancing the phagocytic function, and activating both Th1 and Th2 lymphocytes. The current outcome also suggested that Se-GEP with covalently bonding Se group possessing increased safety and has a potential dietary selenium nutrient for improving human immunity.

As the adoption of renewable energy sources grows, ensuring a stable power balance across various time frames has become a central challenge for modern power systems. In line with the "dual carbon" objectives and the seamless integration of renewable energy sources, harnessing the advantages of various energy storage resources and coordinating the operation of long-term and short-term storage have become pivotal directions for future energy storage deployment. To address the complexities arising from the coupling of different time scales in optimizing energy storage capacity, this paper proposes a method for energy storage planning that accounts for power imbalance risks across multiple time scales. Initially, the Seasonal and Trend decomposition using the Loess (STL) decomposition method is utilized to temporally decouple actual operational data. Subsequently, power balance computations are performed based on the obtained data at various time scales to optimize the allocation of different types of energy storage capacities and assess the associated imbalance risks. Finally, the effectiveness of the proposed approach is validated through hourly applications using real-world data from a province in China over recent years.

Recent researches indicated that metal nanoparticles which have the unique optical properties can be used to enhance the spectral response of the photovoltaic modules. Since most of the nanoparticles have enhancement effects in a specific wavelength range, improving the spectral response of the photovoltaic modules in a broadband range is crucial for their applications in imaging, energy harvesting, and optical communication. In this study, flower-like silver particles are applied to achieve the enhancement effects in a broadband range. The optical absorption of photovoltaic modules is improved in a broad wavelength range of 400~2000 nm by immobilizing flower-like silver particles onto an amorphous Si p-i-n structure, and the peak responsivity of the spectral response is enhanced by about 10 times. Theoretical investigation further elaborates that the enhancement originates from the near-field effects of silver particles due to the interaction of different parts of the flower-like silver particles. Through these studies, we demonstrate that, utilizing the subwavelength silver particles with roughness surface can achieve the spectral response of the photovoltaic modules enhanced in broadband range, which can improve the utilization efficiency of optical energy for the applications of sensing, imaging, optical communication, and energy harvesting.

Rapidly and accurately extracting tobacco plant information can facilitate tobacco planting man-agement, precise fertilization and yield prediction. In karst plateau of southern China, tobacco plant identification is affected by large ground undulations, fragmented planting areas, complex and diverse habitats and uneven plant growth. This study took a tobacco planting area in Gui-zhou Province as the research object and used DJI UAVs to collect UAV visible light images. Considering plot fragmentation, plant size, presence of weeds and shadow masking, this area was classified into eight habitats. The datasets of different habitats were constructed to train the U-Net model. The results show that (1) the overall precision, recall, F1-score and IOU of tobacco plant information extraction were 0.68, 0.85, 0.75 and 0.60, respectively. (2) The precision was the highest for the subsurface-fragmented and weed-free habitat and the lowest for the smooth-tectonics and weed-infested habitat. (3) The weed-infested habitat with smaller tobacco plants can cause blurred images, reducing the plant identification accuracy. This study verified the feasibility of the U-Net model for tobacco single-plant identification in complex habitats. Decomposing complex habitats to establish the sample set method is a new attempt to improve crop identification in complex habitats in karst mountainous areas.

The manuscript reported the synthesis of Al2O3 nano-coating onto quartz fiber by plasma electrolysis spray for enhanced thermal conductivity and stability. The nano- and micro-sized clusters were partially observed on the coating, while most coating was relatively smooth. It was suggested that the formation of a ceramic coating was followed as the nucleation-growth raw, that is, the formation of the coating clusters was dependent on the fast grow-up partially, implying the inhomogeneous energy distribution in the electrolysis plasma. The deposition of the Al2O3 coating increased the annealing tensile strength from 19.2 MPa to 58.1 MPa. The thermal conductivity of the coated quartz fiber was measured to be 1.17 W m-1 K-1, increased by ~45% compared to the bare fiber. The formation mechanism of the Al2O3 coating was preliminarily discussed. We believe that the thermally conductive quartz fiber with high thermal stability by plasma electrolysis spray will find a wide range of applications in industries.

By repeated unloading and loading of the excavation dynamic and static loads, repeated train dynamic and static loads of multi-factors, the underpass tunnel, cross tunnel engineering influence area rock layer, the existing tunnel structure of the three constitutes a multifaceted structure, multi-factor interaction system. Existing tunnels into the prediction theory model of the new tunnel excavation process of dynamic and static loads, dynamic and static loads of existing tunnels are mostly analyzed individually, the results of synergistic analysis needs to be improved. Based on the theory of the current layer method, the paper comprehensively considers the stiffness of the existing tunnel, the stiffness of the new tunnel, the excavation method load and the existing tunnel load, coupled with Peck's empirical formula, the theoretical model of deformation prediction for excavation of a two-lane highway tunnel under the tunnel through the existing railroad is proposed, and verified and optimized by numerical calculations and monitoring data, which proves the applicability and reliability of the theoretical model in the similar strata and the project promotion.

The research on the excavation mechanical properties of underpass tunnels has already had certain results, but fewer of them consider the effects of dynamic and static loads on the excavation mechanical properties of underground tunnels at the same time, especially the lack of research cases of double-line highway tunnels with angled underpasses of existing railway tunnels. In this paper, based on the tunnel project of the new double-line Shiqian Highway Tunnel passing under the Hurong Railway at an oblique angle, the mechanical parameters of the rock body in the cross-tunneling area under the influence of static and dynamic load coupling are obtained by using the disturbance quantification coefficients and the Hoek-Brown criterion based on the method of over-advanced geological prediction and the investigation of the surrounding rock on the palisade face, and the engineering-scale finite element model is constructed and the mechanical characteristics of the excavation in the tunnel of the double-lane highway tunnel passing under the existing railroad under the influence of the static and dynamic loads are analyzed. The results show that: the new tunnel rock movement law for the top of the arch sinking, bottom plate bulging, side wall to move outward, the height and width of the arch and bottom plate arch with the tunnel excavation and increase, the side wall rock displacement effect is smaller; left and right lines of the tunnel disturbed area of the rule of change is similar; the existing tunnel bottom plate displacement is more than the top plate and the left and right side walls by the excavation of the time step influence is larger. Typical profile displacement is mainly determined by the distance from the excavation surface; the new tunnel in the four types of calculation conditions of the rock disturbance angle is the same; the existing tunnel roof and side wall Von Mises stress extreme occurs in the tunnel structure, the bottom plate there are pressure relief and pressure-bearing areas; based on the displacement control criteria, the recommended upper and lower step blasting method.

The broad emission bump in the electromagnetic spectra observed following the detection of gravitational waves created during the kilonova event of merger of two neutron stars in August 2017, GW170817, has been linked to the heavy elements of lanthanides (Z=57-71), and a new understanding of creation of heavy elements in the r-process. The initial spectral emission bump has a wavelength range of 3000 - 7000 \AA, thus covering the region of ultraviolet (UV) to optical (O) wavelengths, and is similar to those seen for lanthanides. Most lanthanides have large number of closely lying energy levels which introduce extensive sets of radiative transitions which often form broad region of lines of significant strength. The current study explores these broad features through photoabsorption spectroscopy of 25 lanthanides ions, Ho I-III, Er I-IV, Tm I-V, Yb I-VI and Lu I-VII. With excitations only to a few orbitals up beyond the ground configurations, we find most of these ions cover large number of bound levels with open $4f$ orbital and produce tens to about hundred thousands lines that may form one or multiple broad features in X-ray to UV, O, and infrared (IR) regions. Spectrum of each of 25 ions is presented indicating presence, shape and wavelength region of the features. Accuracy of atomic data to interpret the merger spectra has been a outstanding problem. The present study aims at providing improved atomic data for energies and transition parameters obtained using relativistic Breit-Pauli approximation implemented in the atomic structure code SUPERSTRUCTURE. The present data have been benchmarked with available experimental data for energies and transition parameters. The study finds that number of ions under the present study are possible contributors of the emission bump of GW170817. All atomic data will be made available online at NORAD-Atomic-Data database.

While considering the sensitivity over the parameter optimization, it is essential to determine which parameters have the most significant implications on model performance. This study focuses on the baseflow recession constant as one of the independent basin parameters to forecast low flows, perform hydrograph analysis, and calibrate rainfall-runoff models for significant improvement. Prior studies examined that the optimization of data adjustment parameters can improve the hydrological model performance and determine the minimum acceptable data length for data scarce regions using the Xinanjaing model. However, it is essential to pay special attention to the sensitivity of the recession constant, which can also impact the model performance during the data scarcity. Therefore, this study extends the research to comprehend the recession constant sensitivity over data adjustment parameters in the shorter datasets leading to more reliable parameter estimation. In terms of that, this study explores how recession constant affects hydrological parameter estimation on annual scale while keeping data adjustment parameters constant in continuous hydrological modeling, employing the Xinanjiang (XAJ) model as a case study. This study considered two approaches of recession constant (cg); (i) assessing the relationship between cg and the data adjustment parameter (Cep), for the 28-year datasets, (ii) investigating the significant impacts of the sensitivity of cg over Cep in shorter datasets which can affect the estimation of the acceptable minimum data length in the data scarce basins. The study underscores the importance of the recession constant sensitivity for reliable continuous hydrological model predictions, especially in data-scared areas. The study’s outcomes enhance the understanding of the importance of parameter sensitivity and its relationship in conceptual hydrological modeling during the data limitations.

In order to correct attenuated millimeter-wavelength (Ka-band) radar data and address the problem of instability, an attenuation correction methodology (attenuation correction with variation trend constraint; VTC) was developed. Using synchronous observation conditions and multi-band radars, the VTC method adopts the variation trends of reflectivity in X-band radar data captured with wavelet transform as a constraint to adjust reflectivity factors of millimeter-wavelength radar. The correction was evaluated by comparing reflectivities obtained by millimeter-wavelength cloud radar and X-band weather radar. Experiments showed that attenuation was a major contributory factor in the different reflectivities of the two radars when relatively intense echoes exist, and the attenuation correction developed in this study significantly improved data quality for millimeter-wavelength radar. Reflectivity differences between the two radars were reduced and reflectivity correlations were enhanced. Errors caused by attenuation were eliminated, while variation details in the reflectivity factors were retained. The VTC method is superior to the bin-by-bin method in terms of correction amplitude and can be used for attenuation correction of shorter wavelength radar assisted by longer wavelength radar data.

In (Semigroup Forum 77: 325-338, 2008) Mahmoudi M. and Renshaw J. solved a study that covers of cyclic $S$-acts over monoids. This article is an attempt to initiate the covers of finitely generated $S$-acts. We give a necessary and sufficient condition for a monoid to have the properties that $n$-generated $S$-acts have strongly flat covers, Condition $(P)$ covers and projective covers. The main conclusions extend some known results. We show also that Condition $(P)$ covers of finitely generated $S$-acts are not unique, unlike the situation for strongly flat covers. Additionally, we demonstrate that the property of Enochs' $\mathcal{X}$-precover of $S$-act $A$, where $\mathcal{X}$ denotes a class of $S$-acts that are closed under isomorphisms.

Mass hauling operations play central roles in construction projects. They typically use many haulers that consume large amounts of energy and emit significant quantities of CO₂. However, practical methods for estimating the energy consumption and CO₂ emissions of such operations during project planning are lacking. This paper presents a detailed model for estimating the energy consumption and CO₂ emissions of mass haulers that integrates the mass hauling plan with a set of predictive equations. The mass hauling plan is generated using a planning program such as DynaRoad in conjunction with data on the productivity of selected haulers and the amount of material to be hauled during cutting, filling, borrowing, and disposal operations. This plan is then used as input for estimating the energy consumption and CO₂ emissions of the selected hauling fleet. The proposed model will help planners to assess the energy and environmental performance of mass hauling plans, and to select hauler and fleet configurations that will minimize these quantities. The model was applied in a case study, demonstrating that it can reliably predict energy consumption, CO₂ emissions, and hauler productivity as functions of the hauling distance for individual haulers and entire hauling fleets.

Promoting green development has become an important way to optimize the ecological and economic structure and promote sustainable development. The Yangtze River Economic Belt is an important economic corridor in China, and it remains to be examined whether the implementation of environmental regulations has enhanced the green total factor productivity (GTFP) of cities. This paper calculates the green total factor productivity of 107 cities within the Yangtze River Economic Belt by using the super-efficient SBM model and the GML index with Chinese city panel data from 2007-2019 and measures the intensity of environmental regulations through textual analysis. The bidirectional fixed-effects model constructed in this paper suggests an inverted U-shaped relationship between environmental regulation and GTFP, which is confirmed by a series of robustness tests. Green technology innovation and advanced industrial structure play a mechanism role in this. In regions with lower levels of green technology and industrial structure, the inverted U-shaped relationship between environmental regulation and green total factor productivity is more significant. In addition, the phenomenon of GTFP rising and then falling because of environmental regulation is more obvious in cities in the middle and upper reaches of the Yangtze River and outside the urban agglomerations. Therefore, when formulating environmental regulation policies, it is necessary to balance the relationship between economic development and environmental protection and harmonize the environment and economic development of the entire Yangtze River Basin.

Background: Previous in vitro and in vivo studies have demonstrated that storage of cooked rice at 4 °C for 24 h and reheating to 65 °C significantly reduced starch digestibility and postprandial glycaemic responses. Moreover, the effect was greater for parboiled rice compared to other rice varieties commonly consumed in New Zealand. This study aimed to evaluate consumer preferences of related sensory attributes and consumer acceptability of several rice varieties freshly cooked or reheated. Method: Sixty-four consumers volunteered and recorded on Visual Analoge Scales their preference and acceptability of freshly prepared or cold-stored and reheated medium grain white, medium grain brown and parboiled rice. Results: All six rice samples were accepted by participants (average 54%). Reheated parboiled rice and reheated medium grain brown rice were both accepted by participants as a preferred staple meal compared to other rice samples. Among all rice samples, the sweetness and the flavour of freshly cooked warm medium-grain white rice were less preferred (scored 42.1% and 45.0% respectively) compared with other samples (P = 0.05). Participants who prepared and consumed brown rice at home regularly (more than 10 times per month), preferred the reheated brown rice (73.8% (67.4, 80.2)) and reheated parboiled rice (74.3% (67.9, 80.7)) (P < 0.001). Conclusions: It is suggested that reheated parboiled rice, with the lowest starch digestibility and glycaemic impact (both in vitro glucose release and in vivo glucose response) could be accepted as a healthier alternative for the daily staple meal.

This paper presents a two-stage ADC based on pseudo-differential operational transconductance amplifier (OTA), which is designed for the readout circuit of X-ray linear array sensor. This hybrid ADC employs an incremental sigma-delta ADC and a cyclic ADC, achieving a good trade-off between accuracy and conversion speed. The two stages share the same hardware to reduce power consumption and die area. A common-mood feedback module is used to suppress the influence of charge injection, and the effectiveness is demonstrated by detailed theoretical analysis. A test chip of 14-bit ADC is fabricated in 0.35μm CMOS technology. The measured root mean square (RMS) value of DNL is 0.254 LSB, and the maximum value of INL is -0.776/+1.56 LSB. The measured effective number of bits (ENOB) is 13.43 bits.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.

With the increasing concern of environment, the energy-efficiency scheduling of manufacturing industry is becoming urgent and popular. In turning processes, both spindle speed and processing time can affect the final energy consumption and thus the spindle speed and scheduling scheme need to be optimized simultaneously. Since the turning workshop can be regarded as the flexible flow shop, this paper formulates a mixed integer linear programming model for energy-efficient scheduling of flexible flow shop. Accordingly, a new decoding method is developed by considering of the optimization of spindle speed and scheduling scheme simultaneously, and an estimation of distribution algorithm adopting the new decoding method is proposed to solve large-size problems. The parameters of this algorithm are determined by statistical technique with a simplified practical case. In order to validate the proposed method, a case from practical factories is studied, in which the makespan can be shortened by 25.22%, and the consumed energy can be saved by 5.48%. These results demonstrate the effectiveness of the proposed mathematical model and algorithm.

Electrical remodelling as a result of the homeodomain transcription factor 2 (Pitx2)‐dependent gene regulation was linked to atrial fibrillation (AF) and AF patients with single nucleotide polymorphisms at chromosome 4q25 responded favorably to Class I antiarrhythmic drugs (AADs). The possible reasons behind this remain elusive. The purpose of this study was to assess the efficacy of AADs disopyramide, quinidine, and propafenone on human atrial arrhythmias mediated by Pitx2-induced remodelling, from a single cell to the tissue level, using drug binding models with multi-channel pharmacology. Experimentally calibrated populations of human atrial action potential (AP) models in both sinus rhythm (SR) and Pitx2-induced AF conditions were constructed by using two distinct models to represent morphological subtypes of AP. Multi-channel pharmacological effects of disopyramide, quinidine, and propafenone on ionic currents were considered. Simulated results showed that Pitx2-induced remodelling increased maximum upstroke velocity (dVdtmax) and conduction velocity (CV), and decreased AP duration (APD) and wavelength (WL). At the concentrations tested in this study, these AADs decreased dVdtmax and CV and prolonged APD in the setting of Pitx2-induced AF. Our findings of alterations in WL indicated that quinidine and disopyramide may be more effective against Pitx2-induced AF than propafenone by prolonging WL.

Wound healing is a complex, dynamic process involving the coordinated interaction of diverse cell types, growth factors, cytokines, and extracellular matrix components. Despite emerging evidence highlighting their importance, dermal sheath cells remain a largely overlooked aspect of wound healing research. This review explores the multifunctional roles of dermal sheath cells in various phases of wound healing, including modulating inflammation, aiding in proliferation, and contributing to extracellular matrix remodeling. Special attention is devoted to the paracrine effects of dermal sheath cells and their role in fibrosis, highlighting their potential in improving healing outcomes, especially in differentiating between hairy and non-hairy skin sites. By drawing connections between dermal sheath cells activity and wound healing outcomes, this work proposes new insights into the mechanisms of tissue regeneration and repair, marking a step forward in our understanding of wound healing processes.

This paper aims to address the exponential stability and stabilization problems for a class of delayed nonlinear Markov jump systems under randomly occurring Denial-of-Service (DoS) attack and packet loss. Firstly, the stochastic characteristics of DoS attack and packet loss are depicted by the attack success rate and packet loss rate. Secondly, a Period Observation Window (POW) method and a hybrid-input strategy are proposed to compensate for the impact of DoS attack and packet loss on the system. Thirdly, A Dynamic Event-triggered Mechanism (DETM) is introduced to save more network resources and ensure the security and reliability of systems. Then, by constructing a general common Lyapunov functional and combining with the DETM and other inequality analysis techniques, the less conservative stability and stabilization criteria for the underlying systems are derived. In the end, the effectiveness of our result is verified through a numerical example.

Liquid-liquid phase separation (LLPS) of proteins has been found ubiquitously in eukaryotic cells, critical in the controlling of many biological processes through forming a temporary condensed phase with different bimolecular components. TDP-43 is recruited to stress granules in cells and is the main component of TDP-43 granules and proteinaceous amyloid inclusions in patients with amyotrophic lateral sclerosis (ALS). TDP-43 low complexity domain (LCD) is able to demix in solution forming the protein condensed droplets. The molecular interactions regulating its LLPS were investigated at the protein fusion equilibrium stage, where the droplets stopped growing. We found the molecules in the droplet were still liquid-like but with enhanced intermolecular helix-helix interaction in the LCD. The protein would start to aggregate after about 200 minutes of lag time and aggregate slower than at the condition when the protein does not phase separate or the molecules have a reduced intermolecular helical interaction. A structural transition intermediate towards protein aggregation was also discovered involving a decrease of the intermolecular helix-helix interaction and a reduction in the helicity. Therefore, LLPS and the intermolecular helical interaction could help maintain the stability of TDP-43 LCD.

Although Eulerian approaches are standard in computational acoustics, they are less effective for certain classes of problems like bubble acoustics and combustion noise. A different approach for solving acoustic problems is to compute with individual particles following particle motion. In this paper, a Lagrangian approach to model sound propagation in moving fluid is presented and implemented numerically, using three meshfree methods to solve the Lagrangian acoustic perturbation equations (LAPE) in the time domain. The LAPE split the fluid dynamic equations into a set of hydrodynamic equations for the motion of fluid particles and perturbation equations for the acoustic quantities corresponding to each fluid particle. Then, three meshfree methods, the smoothed particle hydrodynamics (SPH) method, the corrective smoothed particle (CSP) method, and the generalized finite difference (GFD) method, are introduced to solve the LAPE and the linearized LAPE (LLAPE). The SPH and CSP methods are widely used meshfree methods, while the GFD method based on the Taylor series expansion can be easily extended to higher orders. Applications to modeling sound propagation in steady or unsteady fluids in motion are outlined, treating a number of different cases in one and two space dimensions. A comparison of the LAPE and the LLAPE using the three meshfree methods is also presented. The Lagrangian approach shows good agreement with exact solutions. The comparison indicates that the CSP and GFD method exhibit convergence in cases with different background flow. The GFD method is more accurate, while the CSP method can handle higher Courant numbers.

In order to study the acoustic emission characteristics of sandstone under the action of the high temperature-water cooling cycle, the RMT-150B electro-hydraulic servo rock test system and the DS-5 acoustic emission detection and analysis system were used to conduct a single analysis of the sandstone after the high temperature-water cooling cycle. Experimental study on acoustic emission characteristics under axial compression, analyzing the deformation, strength and acoustic emission characteristics of sandstone under different temperatures and cycles. The results of the study show that the high temperature-water cooling action causes changes in the physical properties of the sandstone. The expansion rate of the rock sample decreases first and then increases when the temperature rises, and the strength first increases and then decreases. The number of cycles has little effect on the physical properties of the rock sample; sandstone acoustic emission ringing count increases with the increase of temperature and cycle times, acoustic emission activities become more frequent with the loading process; with the increase of cycle times and temperature, acoustic emission ringing counts and accumulative acoustic emission energy appear earlier The rock sample enters the elastic deformation stage ahead of schedule, the yielding period increases, and the rock sample presents a trend of transition from brittle failure to ductile failure; the ringing count and cumulative energy increase with the increase in temperature and cycle times, and the high-energy ringing count and cumulative energy increase. The simultaneous sharp increase of the rock sample is the harbinger of the failure and instability of the rock sample.

Background: The major histocompatibility complex (MHC) plays a key role in the adaptive immune response to pathogens due to its extraordinary polymorphism. However, the spatial patterns of MHC variation in the striped hamster remain unclear, particularly regarding the relative contribution of balancing selection in shaping MHC population and diversity compared to neutral forces. Methods: In this study, we investigated the immunogenic variation of the striped hamster in four wild populations in Inner Mongolia, which experience heterogeneous parasitic stress. Our goal was to identify local adaptation by comparing the genetic structure at MHC with that at seven microsatellite loci, taking into account neutral processes. Results: We observed significant variation in parasite pressure among sites, with parasite burden showing a correlation with temperature and precipitation. Molecular analysis revealed a similar co-structure between MHC and microsatellite loci. We observed lower genetic differentiation at MHC loci compared to microsatellite loci, and no correlation was found between the two. Conclusions: Overall, these results suggest a complex interplay between neutral evolutionary forces and balancing selection in shaping the spatial patterns of MHC variation. Local adaptation was not detected at a small scale but may be applicable at a larger scale.

Agriculture is pivotal in national economies, with pest detection significantly influencing food quality and quantity. Pest classification remains challenging in automated agriculture monitoring systems, exacerbated by the non-uniform pest scales and the scarcity of high-quality datasets. In this study, we constructed a pest dataset by acquiring domain-agnostic images from the Internet and resizing them to a standardized 299x299 pixel format. Additionally, we employed diffusion models to generate supplementary data. While Convolutional Neural Networks (CNNs) are prevalent for prediction and classification, they often lack effective global information integration and discriminative feature representation. To address these limitations, we propose the RS Transformer, an innovative model that combines elements like the Region Proposal Network, Swin Transformer, and ROI Align. Additionally, we introduce the Randomly Generated Stable Diffusion Dataset (RGSDD) to augment the availability of high-quality pest datasets. Extensive experimental evaluations demonstrate the superiority of our approach compared to both two-stage models (SSD and Faster R-CNN) and one-stage models (YOLOv3, YOLOv4, YOLOv5m, YOLOv8, and DETR). We rigorously assess performance using metrics such as mean Average Precision (mAP), F1Score, Recall, and mean Detection Time (mDT). Our research contributes to advancing pest detection methodologies in automated agriculture systems, promising improved food production and quality.

To realize fast and effective synthetic aperture radar (SAR) deception jamming, a high-quality SAR deception jamming template library can be generated by performing sample augmentation on SAR deception jamming templates. However, current sample augmentation schemes of SAR deception jamming templates face certain problems. First, the authenticity of templates is low due to the lack of speckle noise. Second, the generated templates have low similarity to the target and shadow areas of the input templates. To solve these problems, this study proposes a sample augmentation scheme based on generative adversarial networks, which can generate a high-quality library of SAR deception jamming templates with shadows. The proposed scheme solves the two aforementioned problems from the following aspects. First, the influence of the speckle noise is considered in the network to avoid the problem of reduced authenticity in generated images. Second, a channel attention mechanism module is used to improve the network's learning ability of shadow features, which improves the similarity between the generated template and the shadow area in the input template. Finally, the proposed scheme and the SinGAN scheme are compared regarding the equivalent numbers of looks and the structural similarity between the target and shadow in the sample augmentation results. The comparison results demonstrate that, compared to the templates generated by the SinGAN scheme, those generated by the proposed scheme have targets and shadow features similar to those of the original image, and can incorporate speckle noise characteristics, resulting in higher authenticity, which helps to achieve fast and effective SAR deception jamming.

Target detection and segmentation in synthetic aperture radar (SAR) images are vital steps for many remote sensing applications. In the era of data-driven deep learning, this task is extremely challenging due to the limited labeled data. Few-shot Learning has the ability to learn quickly from few samples with supervised information. Inspired by this, a few-shot learning framework named MSG-FN is proposed to solve the segmentation of ship targets in heterologous SAR images with few annotated samples. The proposed MSG-FN adopts a dual-branch network consisting of a support branch and a query branch. The support branch is used to extract features with an encoder, and the query branch uses a U-shaped encoder-decoder structure to segment the target in the query image. The encoder of each branch is composed of well-designed residual blocks combined with filter response normalization to capture robust and domain-independent features. A multi-scale similarity guidance module is proposed to improve the scale adaptability of detection by applying hand-on-hand guidance of support features to query features of various scales. In addition, a SAR dataset named SARShip-4i is built to evaluate the proposed MSG-FN and the experimental results show that the proposed method achieves superior segmentation results compared with the state-of-the-arts.

In this study, a new method for synthesizing Ag-NaYF4:Yb3+/Er3+ @ SiO2 nanocomposites was introduced. Using a hydrothermal method, the synthesized Yb3+- and Er3+-codoped NaYF4 upconversion luminescent materials and Ag nanoparticles were doped into upconversion nanomaterials and coated with SiO2 up-conversion nanomaterials. This material is known as Ag-UCNPs-SiO2’ it improves both the luminous intensity because of the doped Ag nanoparticles and has low cytotoxicity because of the SiO2 coating. The morphology of UCNPs was observed using scanning electron microscopy (SEM), and the mapping confirmed the successful doping of Ag nanoparticles. Successful coating of SiO2 was confirmed using transmission electron microscopy (TEM). Fluorescence spectra were used to compare changes in luminescence intensity before and after doping Ag nanoparticles. The reason for the increase in luminescence intensity after doping with Ag nanoparticles was simulated using first-principles calculations. The cytotoxicity of Ag-UCNPs-SiO2 was tested via the cell counting kit-8 (CCK-8) method, and its imaging ability was characterized using the micro-CT method.

Maritime ship monitoring plays an important role in maritime transportation. Fast and accurate detection of maritime ship is the key to maritime ship monitoring. The main sources of marine ship images are optical images and synthetic aperture radar (SAR) images. Different from natural images, SAR images are independent to daylight and weather conditions. Traditional ship detection methods of SAR images mainly depend on the statistical distribution of sea clutter, which leads to poor robustness. As a deep learning detector, RetinaNet can break this obstacle, and the problem of imbalance on feature level and objective level can be further solved by combining with Libra R-CNN algorithm. In this paper, we modify the feature fusion part of Libra RetinaNet by adding a bottom-up path augmentation structure to better preserve the low-level feature information, and we expand the dataset through style transfer. We evaluate our method on the publicly available SAR dataset of ship detection with complex backgrounds. The experimental results show that the improved Libra RetinaNet can effectively detect multi-scale ships through expansion of the dataset, with an average accuracy of 97.38%.

Scattering hyperspectral technology is a nondestructive testing method with many advantages. Here, we propose a method to improve the accuracy of egg freshness, research the influence of incident angles of light source on the accuracy and explain its mechanism. A variety of weak classifiers classify eggs based on the spectra after preprocessing and feature wavelength extraction to obtain three classifiers with the highest accuracy. The three classifiers are used as metamodels of stacking ensemble learning to improve the highest accuracy from 96.25% to 100%. Moreover, the highest accuracy of scattering, reflection, transmission and mixed hyperspectral of eggs are 100.00%, 88.75%, 95.00% and 96.25%, respectively, indicating that the scattering hyperspectral for egg freshness detection is better than that of the others. In addition, the accuracy is inversely proportional to the angle of incidence due that the smaller the incident angle, the camera collects a larger proportion of scattering light, which contains more biochemical parameters of an egg than that of reflection and transmission. These results are very important for improving the accuracy of non-destructive testing and selecting the incident angle of the light source, and have potential applications in online non-destructive testing.