Existing methods for 3D human pose estimation mainly divide the task into two stages. The first stage identifies the 2D coordinates of the human joints in the input image, namely the 2D human joint coordinates. The second stage uses the results from the first stage as input to recover the depth information of human joints from the 2D human joint coordinates to achieve 3D human pose estimation. However, the recognition accuracy of the two-stage method relies heavily on the results of the first stage and includes too many redundant processing steps, which reduces the inference efficiency of the network. To address these issues, we propose the EDD, a fully End-to-end 3D human pose estimation method based on transformer architecture with Dual Decoders. By learning multiple human poses, the model can directly infer all 3D human poses in the image using a pose decoder, and then further optimize the recognition result using a joint decoder based on the kinematic relations between joints. With the attention mechanism, this method can adaptively focus on the most relevant features to the target joint, effectively overcoming the feature misalignment problem in the human pose estimation task and greatly improving the model performance. Any complex post-processing step, such as non-maximum suppression, is eliminated, further improving the efficiency of the model. The results show that the method achieves an accuracy of 87.4% on the MuPoTS-3D dataset, significantly improving the accuracy of end-to-end 3D human pose estimation methods.

A variable speed anti-tangling reel mechanism was designed to address the problems of tangling, hanging and rewinding of the tassel wheel and the high paddling loss in the current Chinese rape combine harvester cutting table. The kinematic equations of the reel mechanism were developed, and the analysis showed that the speed in the entry stage is low and the speed in the exit stage is high, and the attitude of the reel teeth change with the rape plant movement during the whole paddling process. A single-factor test and a multi-factor regression orthogonal combination test were carried out using the cutting table loss rate of rape harvesting as the evaluation index. The main and secondary factors affecting the cutting table loss of the variable speed reel were obtained as the reel speed, the machine travel speed and the ground angle of the frame. A mathematical model of regression of cutter loss and the main influencing factors was established, with the coefficient of determination R2 = 0.9918. The optimal combination of parameters for the variable speed reel was obtained with the lowest cutting table loss rate in rape harvesting as the optimization target: reel speed 25r/min, frame parallel to the ground and implement travel speed 0.7m/s. Field validation tests and comparative tests of cutting table loss of the two reels were carried out. The test results show that the regression mathematical model of the cutting table loss is more accurate, and the cutting table loss is reduced by 13.9% with the variable speed reel compared to the cam-action reel, and there are no problems with the paddle teeth hanging and tangling during the paddling process.

As major natural disasters in grassland areas, fires and dust events seriously threaten human safety, property, and animal husbandry. Furthermore, these phenomena may be mutually reinforcing, which can lead to more severe cascading disasters. However, few studies have been on the mechanisms of grassland fire and dust events disaster chain. Therefore, we selected Dornod aimag (province), a typical temperate grassland, as the study area and analyzed the spatiotemporal variation patterns of grassland fires and dust weather, as well as the effect of grassland fires on dust weather based on MCD64A1 Burnt Area data and SYNOP dust data. The mechanism of grassland fires on dust weather was further investigated using the MOD13A3 vegetation index product and ERA5 wind speed, wind direction, and precipitation data. The results revealed that grassland fires and dust weather varied spatially across the study area. Furthermore, grassland fires occurred mainly in spring (April to May), summer (June), and autumn (October), while dust weather mainly occurred in spring (March to May). Moreover, autumn, winter, and spring cumulative grassland fires (both days and area) substantially affected the spring total dust weather days and dust storm days, particularly the spring cumulative dust storm days. Additionally, higher precipitation in the summer of 2014 resulted in higher vegetation coverage and more fuel in the autumn and winter of 2014, and even in the spring of 2015. As a result, the cumulative grassland fire days was higher, and the area was larger from September 2014 to April 2015, leading to a considerable increase in the cumulative dust storm days in May 2015. This study has important implications for disaster prevention and mitigation, ecological and environmental protection, and sustainable development in grasslands.

Influenced by the quasi-stationary Mei-yu front and the development of mesoscale low vortices on the Mei-yu front, a torrential rain event occurred in Suzhou on July 6, 2020. The 24-hour rainfall recorded by the automatic station exceeded 200 millimeters, with the highest hourly intensity surpassing 70 millimeters, accompanied by thunderstorms and strong winds. This heavy precipitation process was characterized by suddenness, extremity, long duration, high precipitation efficiency, and backward propagation. Using various data sources such as the European ERA5 reanalysis data, ground-based automatic stations, sounding, Doppler weather radar, and wind profile radar, this paper analyzed in detail the circulation characteristics and radar echo structures of this torrential rain event, and further studied the triggering, feature evolution, and maintenance mechanisms of the heavy precipitation.The results show: (1) The continuously strengthening low-level jet stream propagates downward forming an ultra-low-level jet stream. Heavy precipitation is located on the left front side of the jet exit area, where strong convergence and lifting in the boundary layer overlap with the ascending branch of the secondary circulation above the shear line, resulting in heavy precipitation. (2) A supercell storm with intense precipitation produced this heavy rainfall event, characterized by a low centroid of strong echo; echo-free vault, bounded weak echo region, and other supercell structural features. During this event, the high reflectivity factor areas corresponded to high KDP value areas, indicating a large amount of liquid water content. Vertically, the KDP column can track the rainwater mixing ratio well, and its location corresponds to the vicinity of the short-term heavy precipitation occurrence. The high KDP value area mainly consists of numerous precipitation particles, and the vertical vortex wind field structure causes rapid growth of precipitation particles through continuous rolling. Furthermore, it can be found through correlation coefficients (CC) that there are always high-value areas for CC since they correspond to areas of intense precipitation. (3) Continuous triggering of mesoscale convective cloud clusters on the east-west ground convergence line leads to new development and forms a "train effect." Strong frontogenesis in both horizontal and vertical directions triggers and sustains this heavy precipitation event. The significant increase in liquid water and water vapor density has indicative significance for the occurrence of heavy precipitation.

Lactobacillus plantarum has been observed to play a crucial role in shaping the sensory properties of chili sauce. However, the specific taste-active metabolites responsible for the desirable flavor profile of chili sauce remain inadequately characterized. This study employed a combination of metabolomics and web-based computational tools analysis to investigate the dynamic changes in taste-active metabolites during chili sauce fermentation. Initially, metabolites were rapidly annotated using a feature-based molecular network, leading to the tentative annotation of 206 metabolites, of which a significant proportion had not been previously reported. Subsequently, the VirtualTaste tool identified dihydrosphingosine, lactic acid, isoleucine, phytosphingosine, and gluconic acid as potential taste markers for quality control. Finally, pathway enrichment analysis revealed that these components were primarily associated with amino acid tRNA, phenylalanine, tyrosine, and tryptophan biosynthesis, as well as sphingolipid metabolism. This study provides valuable insights into the mechanisms underlying the formation of the distinctive flavor of chili sauce.

Entanglement is one of the most striking features in quantum systems. Today, quantum entanglement plays a vital role in quantum technology, the non-classical correlation of quantum entanglement is an important resource for quantum communication and quantum computing. Entanglement can be divided into two categories: between multi-particle systems and between various degrees of freedom in a single-particle system (intraparticle entangled states). This work first analogized the distinctions and connections between two kinds of entangled states. Then it designed three types of entanglement-swapping methods based on Bell state joint measurement, cross-Kerr medium, and linear optical elements for intraparticle entangled states by analogizing the entanglement swapping between multiple particles. Intraparticle entanglement swapping can be applied in super quantum dense encoding, quantum information transmission, and quantum teleportation. This work is beneficial for promoting the development of quantum information technologies.

High dietary phosphate intake and poor adherence to phosphate-binding-therapy elevate the risk of hyperphosphatemia in maintenance hemodialysis (HD; MHD) patients. Therefore, chronic kidney disease-related mineral and bone disorder (CKD-MBD) indicators increase; consequently, risks of CKD-MBDs and inflammation are elevated. This double-blind, randomized control trial intervention study was designed to investigate the possibility of reducing blood CKD-MBD indicators and modulating inflammatory indicators by consuming low-phosphate (LP) meals accompanied by a minimum dose of a calcium-based phosphate binder (CaCO3). MHD patients were recruited and randomly assigned to an LP meal group (LP group) or a control group. After initial data collection, blood collection, and dietary counseling, subjects were asked to consume a washout diet for 1 week. During the washout diet period, subjects consumed their usual diet but took 1 tablet of calcium carbonate (1CaCO3) as a phosphate binder with each meal. After the washout diet period, subjects in the LP group and control group respectively consumed LP meals and regular meals twice a day for 1 week. Meat in the LP meals was boiled before the regular cooking process, but meat in control meals was not. All meals were supplied by a central kitchen so that the contents of phosphate and other nutrients could be identified. In total, 40 MHD patients completed the study program. After 1 week of the dietary intervention, the blood Ca x P product and dietary phosphate had significantly decreased in the LP group compared to the control group (p<0.05). The LP group had significantly lower variations in dietary phosphate intake, blood calcium, Ca x P product, and tumor necrosis factor (TNF)-α than the control group by comparing differences between after the dietary intervention and the baseline (△after intervention - baseline, p<0.05). The increase in dietary phosphate intake (△3rd - 2nd dietary phosphate intake) augmented the increase in the TNF-α level by 6.24-fold (odds ratio [95% confidence interval]: 6.24 [1.12~34.92], p<0.05). These results highlighted the conclusion that LP meals accompanied by a minimum dose of CaCO3 downregulated pro-inflammation by reducing CKD-MBD indicators which was triggered by decreasing dietary phosphate intake.

The cause-effect relationship between iron deficiency anemia (IDA) and osteoporosis has not been established in the general population. Thus, the current longitudinal study determined the role of IDA as a risk factor for osteoporosis by analyzing a large nationwide population-based sample. In a sample of 1,000,000 randomly sampled individuals from the 1998-2012 Taiwan National Health Insurance Research Database, patients with IDA (case group [n=35,751]) and individuals without IDA (control group [n=178,755]) were compared. Patients who were <20 years of age and who had pre-existing osteoporosis prior to the diagnosis of IDA were excluded. Each patient with IDA was age- and gender-matched to 5 individuals without IDA. The diagnoses of IDA and osteoporosis (coded using ICD-9CM) were further confirmed with blood test results and X-ray bone densitometry to ensure the accuracy of the diagnoses. Osteoporosis occurred more often among patients with IDA compared to individuals without IDA (2.27% vs. 1.32%, p<0.001). Cox proportional hazard analysis revealed that the risk for osteoporosis was significantly higher in the case than the control group (hazard ratio [HR]=1.74; 95% CI=1.61-1.88) and remained similar after adjustment for covariates (adjusted HR=1.81; 95% CI=1.67-1.97). Compared with individuals without IDA, the risk for osteoporosis was even higher for patients with IDA who received intravenous ferrum therapy (adjusted HR=2.21; 95% CI=1.85-2.63). In contrast, the risk for osteoporosis was reduced for patients with IDA who received a blood transfusion (adjusted HR=1.47; 95% CI=1.20-1.80). As a predictor, prior IDA is a significant and independent risk factor for development of osteoporosis. In contrast to blood transfusion treatment, the use of intravenous ferrum may further increase the risk for future osteoporosis.

Carnivore protoparvovirus 1 (CPPV-1) is a DNA virus causing gastrointestinal disease and immunosuppression in various terrestrial carnivores. Domestic dogs and cats are considered the primary CPPV-1 reservoirs. The habitat overlaps of wild carnivores and free-roaming dogs increases the threat of CPPV-1 transmission between them. This study explored the CPPV-1 distribution among wild carnivores through PCR screening and compared the DNA sequences of the partial capsid protein (VP2) between wild and domestic carnivores. In total, 181 samples were screened for the CPPV-1 VP2 gene, including 32 masked palm civets (Paguma larvata), 63 Chinese ferret badgers (Melogale moschata), and 86 crab-eating mongooses (Herpestes urva), from 2015 to 2019 in Taiwan. The average prevalence of CPPV-1 was 17.7% (32/181), with the highest prevalence in masked palm civets (37.5%). In addition, a masked palm civet was coinfected with two CPPV-1 strains. Among the 33 partial VP2 gene sequences, 23 were identical to sequences amplified from domestic dogs and cats in Asia and the remaining 10 were identified for the first time. This study demonstrated that CPPV-1 has circulated between domestic and wild carnivores in rural Taiwan. Therefore, further population control and health management of free-roaming domestic carnivores are recommended.

L-Theanine, a unique non-protein amino acid, is an important bioactive component of green tea. Previous studies have shown that L-theanine has many potent health benefits, such as anti-anxiety effect, regulation of immune response, relaxing neural tension, reducing oxidative damage. However, little is known concerning whether L-theanine can improve the clearance of mitochondrial DNA (mtDNA) damage in organisms. Here, we reported that L-theanine treatment increased ATP production and improved mitochondrial morphology to extend the lifespan of UVC-exposed nematodes. Mechanistic investigations showed that L-theanine treatment enhanced the removal of mtDNA damage and extended lifespan by activating autophagy, mitophagy, mitochondrial dynamics, and mitochondrial unfolded protein response (UPRmt) in UVC-exposed nematodes. In addition, L-theanine treatment also up-regulated the expression of genes related to mitochondrial energy metabolism in UVC-exposed nematodes. Our study provided a theoretical basis for the possibility that tea drinking may prevent mitochondrial related diseases.

The electroencephalogram (EEG) is a record of brain activity. Brain Computer Interface (BCI) technology formed by the EEG signal has become one of the hotspots at present. How to extract the feature signal of EEG is the most basic research of BCI technology. In this paper, A new method of recognizing fatigue, conscious, concentrated state of human brain is proposed by the combination of discrete wavelet transform and the neural network based on EEG signal. First of all, the law signal is preprocessed by the wavelet denoising method because the law EEG signal contains a large number of high frequency noise, which is decomposed into multi-layer high frequency signal and low frequency signal. thus, δ wave, θ wave, α wave, β wave are obtained by the wavelet transform. And then, frequency band energy of the different wave is regards as the feature signal of EEG. In the experiment, the feature signal is classified by radial basic function (RBF) and annealed chaotic competitive learning network (ACCLN). RBF and ACCLN networks are trained with 500 sets of sample data and are tested by 100 sets of samples in different mental states. The experimental results show that the average accuracy of RBF network under three conditions are 88.75%, 88.25%, 88.5%, respectively, and the correct rate of ACCLN network is 97%, 98%, 98%, respectively.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The quality of healthcare services is a very important indicator of social welfare in developed and emerging countries. Good quality levels are critical to ensuring patient safety, improving health outcomes, increasing patient satisfaction, optimizing resource utilization, and meeting regulatory requirements. The stable and sustainable operation of medical institutions urgently requires the establishment of a reliable and effective medical quality performance evaluation platform. However, the complexity of the evaluation process, involving numerous evaluators and the consideration of different subjective and objective criteria, poses significant challenges and essentially constitutes a group multi-criteria decision-making problem. This article uses the overall medical environment of the institution, medical service attitude, medical security, administrative service measures, etc. as measurement standards to deal with this challenge. It proposes a medical service quality measurement model suitable for both qualitative and quantitative analysis. In view of the heterogeneity of information, the two-tuple fuzzy language calculation method is introduced to enable evaluators to skillfully manage diverse information and effectively avoid potential information omission problems in the subjective evaluation integration process. The effectiveness and feasibility of the model were demonstrated by applying it to the operational framework of a medical institution in central Taiwan.

Introduction: The treatment of peritoneal dialysis in end-stage renal disease is increasing in clinical practice. The main purpose of this study was to evaluate the effect of far-infrared radiation therapy on inflammation and the cellular immunity of patients undergoing peritoneal dialysis. Materials and Methods: We recruited 56 patients undergoing peritoneal dialysis, and we included 32 patients from the experimental group and 24 patients from the control group in the final analysis. The experimental evaluation in our study was as follows: (1) We used abdominal computed tomography to measure the diameter and degree of hardening of the abdominal veins and large blood vessels to explore the changes in abdominal blood vessels. (2) The study compared the effects of peritoneal dialysis using albumin, blood urea nitrogen, creatinine, white blood cell, neutrophil-to-lymphocyte ratio, platelet-to-lymphocyte ratio, erythrocyte sedimentation rate, Hs-CRP clearance rate, and HBAlC. (3) We compared the cytokine concentration of blood between the two groups while controlling for GM-CSF, IL-2, IFN-γ, IL-6, IL-18, IL-4, IL-5, IL-13, IL-12p70, TNF-α, and IL-1β. Results and Discussion: (1) There was no significant difference in the abdominal blood vessels of the experimental group relative to the control group according to abdominal CT measured over 6 months. (2) Our study demonstrates the statistically significant effect of FIR therapy on the following parameters: albumin (p = 0.048*), creatinine (p = 0.039*), and Hs-CRP (p < 0.001**) decreased significantly, and glomerular filtration rate (eGFR, p = 0.043*) and glucose (p < 0.001**) increased significantly. Our study found that, in the experimental group, albumin and creatinine decreased significantly due to FIR therapy for 6 months. However, our study also found that, in the experimental group, glucose (p < 0.001**) increased significantly due to FIR therapy for 6 months. Peritoneal dialysis combined with FIR can reduce the side effects of glucose in dialysis buffer, which interferes with peritoneal inflammation and peritoneal mesothelial cell fibrosis. In addition, we also found that, in the experimental group, Hs-CRP (p < 0.001**) decreased significantly due to FIR therapy for 6 months. (3) No statistical significance in the inflammatory cytokines related to FIR therapy differences was observed in our study. IFN-γ (p = 0.124), IL-12p70 (p = 0.093), IL-18 (p = 0.213), and TNF-α (p = 0.254) did not exhibit significant improvements in peritoneal dialysis with FIR treatment over 6 months. IFN-γ and IL-18 in the plasma of patients in the experimental group and the control group were higher in the third month than in the first month. Conclusion: We found that the effect of peritoneal dialysis improved significantly with FIR therapy, and significant improvements in the peritoneal permeability and inflammatory response were observed. end-stage renal disease; peritoneal dialysis; far-infrared therapy (FIR)

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

We consider the inverse function $z=g(w)$ of a (normalized) starlike function $w=f(z)$ of order $\alpha$ on the unit disk of the complex plane with $0<\alpha<1.$ Krzy{\. z}, Libera and Z\l otkiewicz obtained sharp estimates of the second and the third coefficients of $g(w)$ in their 1979 paper. Prokhorov and Szynal gave sharp estimates of the fourth coefficient of $g(w)$ as a consequence of the solution to an extremal problem in 1981. We give a straightforward proof of the estimate of the fourth coefficient of $g(w)$ together with explicit forms of the extremal functions.

Chimeric antigen receptor (CAR) T-cell therapy has greatly improved outcomes for patients with relapsed or refractory hematological malignancies. However, challenges such as treatment resistance, relapse, and severe toxicity still hinder its widespread clinical application. Traditional transcriptome analysis has provided limited insights into the complex transcriptional landscape of both leukemia cells and engineered CAR-T cells, as well as their interactions within the tumor microenvironment. However, with the advent of single-cell sequencing techniques, a paradigm shift has occurred, providing robust tools to unravel the complexities of these factors. These techniques enable unbiased analysis of cellular heterogeneity and molecular patterns. These insights are invaluable for precise receptor design, guiding gene-based T cell modification, and optimizing manufacturing conditions. Consequently, this review utilizes modern single-cell sequencing techniques to clarify the transcriptional intricacies of leukemia cells and CAR-Ts. The aim of this manuscript is to discuss the potential mechanisms that contribute to the clinical failures of CAR-T immunotherapy. We will examine the biological characteristics of CAR-Ts, the mechanisms that govern clinical responses, and the intricacies of adverse events. By exploring these aspects, we hope to gain a deeper understanding of CAR-T therapy, which will ultimately lead to improved clinical outcomes and broader therapeutic applications.

Keywords: mHealth; peritoneal dialysis; functionality; usability

Developing clinically meaningful nanomedicines for cancer therapy requires the drugs to be effective, safe, simple, cheap, and easy to store. In the present work, we report that a simple cationic Fe(III)-rich salt of [FeIIICl(TMPPH2)][FeIIICl4]2 (Fe-TMPP) exhibits a superior anticancer performance toward a broad spectrum of cancer cell lines, including breast, colorectal cancer, liver, pancreatic, prostate, and gastric cancers, with half maximal inhibitory concentration (IC50) values in the range of 0.098−3.97 μM (0.066−2.68 μg mL−1), and comparable to the best-reported medicines. Fe-TMPP can forms stand-alone nanoparticles in water without the need for extra surface modification or organic-solvent-assisted antisolvent precipitation. Critically, Fe-TMPP is TME-responsive (TME = tumor microenvironment), and can only elicit its function in the TME with overexpressed H2O2, converting H2O2 to the cytotoxic •OH to oxidize the phospholipid of the cancer cell membrane, causing ferroptosis, a programmed cell death process of cancer cells.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Molecular hydrogen (H2) has been shown to have antioxidant and anti-inflammatory activities that may reduce the development and progression of many diseases. In this study, Hydrogen-rich water (HRW) was obtained by reacting hybrid magnesium-carbon hydrogen storage materials with water. Then the effects of intake of HRW on the activities of xenobiotic-metabolizing enzymes, membrane transporters, and oxidative stress in rats were investigated. Rats were given HRW ad libitum for 4 weeks. Results showed that intake of HRW had no significant effect on the activities of various cytochrome P450 (CYP) enzymes (CYP1A1, 1A2, 2B, 2C, 2D, 2E1, 3A, 4A), glutathione-S-transferase and UDP-glucuronosyltransferase. Except for a slight lower plasma glucose concentration, intake of HRW had no effect on other plasma biochemical parameters in rats. P-Glycoprotein and multidrug resistance-associated protein (Mrp)2 protein expressions in liver were elevated after intake of HRW. However, HRW had no significant effects on glutathione, glutathione peroxidase, or lipid peroxidation in liver. Results from this study suggest that consumption of HRW may not affect xenobiotic metabolism or oxidative stress in liver. However, intake of HRW may increase the efflux of xenobiotics or toxic substances from the liver into bile by enhancing the expression of p-glycoprotein and Mrp2 protein.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Complex models have received significant interest in recent years and are being increasingly used to explain the stochastic phenomenon with upward and downward fluctuation such as the stock market. Different from existing semi-variance methods in traditional integer dimension construction for two variables, this paper proposes a simplified multi-factorized fractional dimension derivation with the exact Excel tool algorithm involving the fractional center moment extension to covariance, which is a complex parameter average that is a multi-factorized extension to Pearson covariance. By examining the peaks and troughs of gold price averages, the proposed algorithm provides more insight into revealing underlying stock market trends to see who is the financial market leader during good economic times. The calculation results demonstrate that the complex covariance is able to distinguish subtle differences among stock market performances and gold prices for the same field that the two variable covariance may overlook. We take the London, Tokyo, Shanghai, Toronto and Nasdaq as the representative examples.

This study presents an exploration into identifying the interactions between ocean waves and the continental margin in the origination of double-frequency (DF, 0.1-0.5 Hz) microseisms recorded at 33 stations across East Coast of USA (ECUSA) during a ten-day period of ordinary ocean wave climate. Daily primary vibration directions are calculated in three frequency bands and projected as great circles passing through each station. In each band, the great circles from all stations exhibit largest spatial density primarily near the continental slope in the western North Atlantic Ocean. Generation mechanisms of three DF microseism events are explored by comparing temporal and spatial variations of the DF microseisms with the migration patterns of ocean wave fronts in Wavewatch III hindcasts. Correlation analyses are conducted by comparing the frequency compositions of and calculating the correlation coefficients between the DF microseisms and the ocean waves recorded at selected buoys. The observations and analyses lead to a hypothesis that the continental slope causes wave reflection, generating low frequency DF energy and that the continental shelf is where high frequency DF energy is mainly generated in ECUSA. The hypothesis is supported by the primary vibration directions being mainly perpendicular to the strike of the continental slope.

Trichoderma spp. are widely used in plant disease control as biocontrol agents. Inducing plant disease resistance is an important biocontrol mechanism of Trichoderma. It is of great significance to explore the factors involved in the surface recognition and interaction of Trichoderma with plants. Hydrophobin is a small molecular protein rich in cysteine in higher filamentous fungi and has been found to participate in the morphogenesis and interaction of fungi with other organisms. In this study, the type II hydrophobic protein-coding gene Thfb6 from T. harzianum TH33 was cloned and heterologously expressed in Escherichia coli BL21 (DE3). The purified recombinant protein Thfb6 induced a hypersensitive response in tobacco leaves, a burst of reactive oxygen species, and an accumulation of callose, phenolic substances, and lignin in tobacco, indicating that Thfb6 can induce an early defense reaction in tobacco. Thfb6 also enhanced the systemic resistance of tobacco against tobacco mosaic virus. The rate of lesion number reduction by treatment with Thfb6 could be up to 36.02%. Thfb6 increased the activity of tobacco defense-related enzymes, including phenylalanine ammonia-lyase (PAL), polyphenol oxidase, and peroxidase, which were all more than three times the control after 3–5 days post treatment of Thfb6. The transcription of resistance-related genes, including the PAL gene, non-expresser of pathogenesis-related gene1 (NPR1), and basic pathogenesis-related gene 1 (PR1-b), were upregulated after Thfb6 treatment. The relative expression levels of the PAL and NPR1 genes were highest on the third and fourth days after Thfb6 treatment, at 5.5 times and 8.3 times that of the control, respectively. The relative expression level of PR1 on the sixth day after Thfb6 treatment was 5.3 times that of the control. These results indicate that the improvement of defense-related enzyme activity and the induced expression of disease-resistance-related genes were the main mechanisms by which Thfb6 induced systemic resistance in tobacco.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Various vaccines have been developed in response to the SARS-CoV-2 pandemic, and the safety of vaccines has become an important issue. COVID-19 vaccines-related central nervous system inflammatory demyelinating diseases (CNS IDDs) have been reported recently. We present one case of AstraZeneca vaccine-related myelin oligodendrocyte glycoprotein (MOG) antibody-associated disease and literature review another 78 patients published from January 2020 to October 2022. Patients were divided into three vaccine groups (viral vector, mRNA and inactivated vaccines) for further analyses. Among 79 patients with COVID-19 vaccines-related CNS IDDs, 49 (62%) cases received viral vector vaccines, 20 (25.3%) received mRNA vaccines and 10 (12.7%) received inactivated vaccines. Twenty-seven cases (34.2%) were confirmed with autoantibodies, including 15 patients (19%) with anti-MOG, 11 (13.9%) with anti-aquaporin 4 (AQP4), and one (1.3%) with both antibodies. Significantly, more males developed CNS IDDs post viral vector vaccines compared to mRNA and inactivated vaccines. Patients receiving mRNA vaccines were older than other groups. Furthermore, mRNA and inactivated vaccines correlated more with anti-AQP4 antibodies, while viral vector vaccines showed higher MOG positivity. The research suggests potential associations between COVID-19 vaccines-related CNS IDDs and gender, age, and autoantibodies, contingent on vaccine types. Protein sequence analysis implies similarities between the S protein and AQP4/MOG. Further studies may elucidate the mechanisms of CNS IDDs, aiding vaccine selection for specific groups.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

incipient fault diagnosis is particularly important in process industrial systems, as its early detection helps to prevent major accidents. Against this background, this study proposes a combined method of Mixed Kernel Principal Components Analysis and Dynamic Canonical Correlation Analysis (MK-DCCA). The robust generalization performance of this approach is demonstrated through experimental validation on a randomly generated dataset. Furthermore, Comparative experiments were conducted on a CSTR Simulink model, comparing the MK-DCCA method with DCCA and DCVA methods, demonstrating its excellent detection performance for incipient fault in nonlinear and dynamic system. Meanwhile, fault identification experiments were conducted, validating the high accuracy of fault identification method based on contribution. The experimental findings demonstrate that the method possesses a certain industrial significance and academic relevance.

This paper presents a numerical algorithm for solving high-order BVPs. We introduce the construction method of multiscale orthonormal basis in W^m[0; 1] by multiscale orthonormal basis in W¹[0; 1]. We de fine approximate solution, and obtain the approximate solution of high-order BVPs by using the approximate theory. Moreover, the convergence and stability of the algorithm are improved. At last, several numerical experiments show the feasibility of the proposed method.

Objective: To study the factors affecting the time of umbilical cord shedding in premature infants.Methods: A total of 151 premature infants who were born in the obstetrics department of a Class III hospital in Hefei from November 2020 to June 2021 were selected as subjects. All premature infants and their families met the complete inclusion criteria. A total of 33 related factors from 3 aspects, including the birth situation of premature infants, the condition of premature infants in hospital and the condition of pregnant mothers, were collected for univariate analysis and multiple Logistic regression analysis. The relevant factors affecting the umbilical cord shedding time of premature infants were screened through the univariate analysis results, and the main factors affecting the umbilical cord shedding time of premature infants were screened through the multiple Logistic regression analysis results.it was found that the weight, gestural age, admission age, whether the premature infants were combined with NRDS, the use of antibiotics, the duration in the warm box, the initial temperature in the warm box, the duration of light therapy, the degree of Apgar for 1 minute, the maternal education level had an effect on the time of umbilical cord shedding of premature infants (P < 0.05). Through Logistic multiple regression analysis, it was screened that the duration of premature infants in the incubator was the main factor affecting the umbilical cord shedding time of premature infants (P < 0.05).Conclusion: Factors such as premature infants' weight, gestural age, admission age, whether they are combined with NRDS, antibiotic use, duration in the incubator, initial temperature in the incubator, duration of phototherapy, Apgar level of 1 minute, and maternal education level will affect the umbilical cord shedding time of premature infants. Among them, duration in the incubator is the main factor affecting the umbilical cord shedding time of premature infants.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

In this research, 117,718 ionospheric perturbations, with a space size (t) of 20–300 s but no limit on amplitude (A) have been automatically searched globally by a software from ion density data measured by the DEMETER satellite for more than 6 years. The influence of the solar activity on the ionosphere has been firstly examined and the results have presented that the solar activities can globally enhance ionospheric irregularities but rarely induce plasma variations more than 100%. A statistical work has been performed on ion PERs to check their dependence on local time and it is shown that there are 24.8% perturbations appeared in daytime (10:30 LT) and 75.2% ones in nighttime (22:30 LT). Ionospheric fluctuations with an absolute amplitude A < 10% tend to be background variations and the percentages of positive perturbations with small A < 20% are 64% in daytime and 26.8% in nighttime, respectively, but this number is revers for mid-large amplitude PERs. There is a demarcation point in space size t = 120 s and occurrence probabilities of day PERs are always higher than that of nighttime ones before this point while this trend is contrary after this point. Distributions of PER according to various amplitudes or space scales have been characterized by typical seasonal variations either in daytime or in nighttime. The EIA only exists in dayside equinox and winter occupying two lowlatitude crests with lower Np. The huge WSA appears in all periods except for dayside summer full of PERs with enhanced amplitude, especially in winter night. The WN-like structure can be obviously figured out in all seasons showing absolutely space large-scales. In the meanwhile, several magnetic anomalous zones of planetary scale non-dipole fields, such as the SAMA, Northern Africa anomaly, and so on, have been also successfully detected by extreme negative ion perturbations in this time.

Objective: To explore the inflammatory markers for the development of obliterative bronchiolitis (OB) after adenovirus infection in children. Methods: In this retrospective study, the medical data of 62 children with adenovirus pneumonia treated in our hospital between February 2020 and November 2021 were collected and assigned to an OB group (n = 30) or non-OB group (n = 32) according to the presence of OB. Clinical characteristics of patients included gender, age, prematurity, underlying disease, length of hospitalization, type of adenovirus infection, ventilator use, length of ventilator use, and laboratory index levels. Results: Children with OB were associated with higher serum ferritin levels versus those without (P < 0.05). There were no significant differences in the immunoglobulin E (IgE), interleukin-6 (IL-6), partial arterial pressure of oxygen (PaO₂), D-dimer, lactate dehydrogenase (LDH), and lymphocyte absolute values between the two groups of children (P > 0.05). Logistic multifactorial regression analysis revealed that the length of ventilator use and serum ferritin level were inflammatory markers for the development of OB in children with adenovirus pneumonia. Conclusion: The length of ventilator use and serum ferritin levels are inflammatory markers for the development of OB after adenovirus infection in children, and timely measurement of the above indicators in children is instrumental in predicting the prognosis of children.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

(1)Background: This report was an effective evaluation of using multimedia educational program for self-care and quality of life in patients with a stoma at postoperative and established a simple threshold for enterostomy self-care skills.(2)Methods:108 patients with enterostomy were randomly assigned to receive either the intervention multimedia education program (including information about preparation for enterostomy care, cleaning method, manual bag replacement steps and precautions). The primary outcome was self-care ability and quality of life (defined as overall enterostomy self-care ability and overall quality of life), which was assessed at 2 weeks after intervention via an interview.(3)Results: Compared with those who in the conventional stoma education program, patients received the multimedia education program significantly improved their overall self-care ability and quality of life in statistically. The threshold of the enterostomy self-care skill scale was 20 points, and its corresponding sensitivity was 77.8%, and the specificity was 75.7%.(4)Conclusions: According to our study, the multimedia education program could enhance self-care ability of home care and quality of life in patients with enterostomy.

Mild cognitive impairment (MCI) is when brain function declines. It is a transition stage between normal aging and Alzheimer's disease (AD) and may be an underlying symptom of AD. Improper use of test instruments or imperfect test methods in clinical practice often leads to variations in test results. In addition, there may be resistance from the subject if he/she has to undergo multiple screening tests simultaneously. Therefore, the objective of this study was to use virtual reality to create an image testing scenario that integrates Mini-Cog, Short Portable Mental Status Questionnaire (SPMSQ), Mini-mental Status Examination (MMSE), Saint Louis University Mental Status Examination (SLUMS), Clinical Dementia Rating (CDR), and Cognitive Abilities Screening Instrument (CASI), and combine fuzzy logic control (FLC) technology to develop an MCI forecasting system. There were 24 middle-aged to older adults aged 50 to 65 years who participated in the evaluation experiment. The results showed that the MCI forecasting system developed in this study is highly correlated with the traditional screening tests, including Mini-Cog, SPMSQ, MMSE, SLUMS, and CASI. The forecasting system can provide an integrated reference score for testers in making judgments. In addition, the distribution of the System Usability Scale (SUS) evaluation scores for the MCI forecasting system revealed that 87.5% were grade C (good to use) or above, and 29.2% were grade B (extremely good to use) or above. The forecasting system receives positive feedback from the subjects.

The orthogonal matrix with cube be symmetric is a common class of matrices with important properties. We pay attention to this kind of matrices. By using the close relationship between the eigenvalues of a matrix and the trace of its power, we obtain the algorithm for its all possible different eigenvalues and multiplicities. The calculation formula is expressed only by the trace of a matrix and its power, avoiding solving the characteristic polynomial. The method is simple and practical. Furthermore, a new essential characterization for the sum of orthogonal matrix pairs being orthogonal is given as well.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

The vibration signal of the engine contains strong background noise and many kinds of modulating components, which is difficult to diagnose. Variational mode decomposition (VMD) is a recently introduced adaptive signal decomposition algorithm with a solid theoretical foundation and good noise robustness compared with empirical mode decomposition (EMD). VMD can effectively avoid endpoint effect and modal aliasing. However, VMD cannot effectively eliminate the random noise in the signal, so the random decrement technique is introduced to solve the problem. Based on the crankshaft bearing fault simulation experiment, the four kinds of wear state vibration signals are decomposed by VMD, and the modal components with smaller permutation entropy are selected as fault components. Then the fault component is processed by the random decrement technique, and the Hilbert envelope spectrum of the fault component is obtained. Compared with the fault feature extraction method based on EMD and EEMD, the feature extraction results of the proposed method are better than those of the above two methods. The simulation analysis and the simulation test of the crankshaft bearing fault verify the effectiveness of the proposed method.

Objective: To evaluate the effect of propofol combined with psychological intervention on pain and emotional evaluation in painless colonoscopic colonic polypectomy patients undergoing endoscopic mucosal resection (EMR).Methods: A total of 80 patients who underwent painless colonoscopic colonic polypectomy with EMR treatment between June 2020 and June 2022 were selected in order of admission and divided into two groups. The control group received conventional analgesia, while the observation group received propofol combined with psychological intervention. Pain visual analog scale (VAS) and emotional scale were used to evaluate pain and emotions in both groups of patients. Adverse reactions and clinical efficacy were also compared between the two groups.Results: The two groups of patients were generally comparable with no significant differences (P > 0.05). The VAS score in the observation group was significantly lower than that in the control group (P < 0.05), and the emotional scale score was also improved compared to the control group (P < 0.05). The number of patients with adverse reactions in the observation group was less than that in the control group. The clinical effective rate in the observation group was significantly higher than that in the control group (P < 0.05).Conclusion: Propofol combined with psychological intervention can effectively alleviate pain and improve emotional status in painless colonoscopic colonic polypectomy patients undergoing EMR treatment, thereby increasing the comfort and success rate of the surgery. The number of patients with adverse reactions in the observation group was less than that in the control group, and the clinical effective rate in the observation group was significantly higher than that in the control group (P < 0.05).

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

The promotion of plant growth and suppression of plant disease using beneficial microorganisms is considered an alternative to the application of chemical fertilizers or pesticides in the field. In this study, a coconut-scented antagonistic Trichoderma strain LZ42, previously isolated from Genoderma lucidum-cultivated soil, was investigated for biostimulatory and biocontrol functions in tomato seedlings. Morphological and phylogenetic analyses suggested that strain LZ42 is closely related to T. atroviride. Tomato plants showed increased aerial and root dry weights in greenhouse trials after treatment with T. atroviride LZ42 formulated in talc, indicating the biostimulatory function of this fungus. T. atroviride LZ42 effectively suppressed Fusarium wilt disease in tomato seedlings, with an 82.69% control efficiency, which is similar to that of fungicide treatment. The volatile organic compounds (VOCs) emitted by T. atroviride LZ42 were found to affect the primary root growth direction and promote the root growth of tomato seedlings in root Y-tube olfactometer assays. The fungal VOCs from T. atroviride LZ42 were observed to significantly inhibit F. oxysporum in a sandwiched Petri dish assay. SPME-GC-MS analysis revealed several VOCs emitted by T. atroviride LZ42; the dominant compound was tentatively identified as 6-pentyl-2H-pyran-2-one (6-PP). 6-PP exhibited a stronger ability to influence the direction of the primary roots of tomato seedlings but not the length of the primary roots. The inhibitory effect of 6-PP on F. oxysporum was the highest among the tested pure VOCs, showing a 50% effective concentration (EC50) of 5.76 μL mL-1 headspace. In conclusion, T. atroviride LZ42, which emits VOCs with multiple functions, is a promising agent for the biostimulation of vegetable plants and integrated management of Fusarium wilt disease.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

Food waste is a common issue arising from grinding of food by experimental animals, leading to excessive food scraps falling into cages. In the wild, animals grind food by gnawing vegetation and seeds, potentially damaging the ecological environment. However, limited ecology studies have focused on food grinding behavior since the last century, with even fewer on rodent food grinding, particularly recently. Although food grinding function is partially understood, biological purposes remain under-investigated and driving factors unclear. This review aims to explain potential causes of animal food grinding, identify influencing factors, and discuss contexts and limitations. Specifically, we emphasize recent progress on gut microbiota significance for food grinding. Moreover, we show abnormal food grinding is determined by degree of excess normal behavior, emphasizing food grinding is not meaningless. Findings from this review promote comprehensive research on the myriad factors, multifaceted roles, and intricate evolution underlying food grinding behavior, benefiting laboratory animal husbandry and ecological environment protection, and identifying potential physiological benefits yet undiscovered.

The migration paths and distribution driving factors of heavy metals in dry and windy area polluted by their production in the North China need a further research. To address this research gap, we collected 675 soil samples, 72 atmospheric deposition samples and 20 water samples around a production area and measured its heavy metal concentrations. Results showed that the Cu, Zn, As and Pb in 0-10 cm soil layer showed a fan-shaped distribution, which was consistent with their atmospheric deposition fluxes. It indicated the distribution patterns of these heavy metals were driven by strong winds in studied area. Although Cr concentrated to the production area in the 0-10 cm soil layer, principal component analysis showed that this migration was through wind as well. The concentration of Cd in the river increased from 0.257 mg/L to 0.460 mg/L along water flowing, and caused the same distribution trend in soil near the river from upstream to downstream. Unlike the above, surface runoff should drive the Cd migration. The concentration of Pb in the river was over threshold of pollution, and also led to an accumulation in the 5-10 cm soil layer. It suggested that the migration of Pb was through both wind and surface runoff. Six studied heavy metals showed different migration behaviors, and specific control strategies for individual heavy metal should be concerned.

For older adults, approaching end-of-life (EOL) brings unique transitions related to family relationships. Unfortunately, most families greatly underestimate the need to discuss these difficult issues. For example, parents approaching EOL issues often struggle with receiving assistance from others, avoiding family conflict, and maintaining their sense of personhood. In addition, discussions of EOL issues force family members to face their parents’ mortality, which can be particularly difficult for the adult children to process emotionally. This study explored aging issues identified by aging parents and their families as they traverse these impending EOL changes. Ten focus groups of seniors (n = 65) were conducted. Focus groups were organized according to race (African American/Caucasian), gender, and whether the older adult was living independently or in an assisted care facility. When asked open-ended questions about discussing aging and EOL issues with family members, participants revealed tensions that led us to consider Relational Dialectics Theory as a framework for analysis. The predominant tension highlighted in this report was certainty versus uncertainty, with the two sub-themes of sustained life versus sustained personhood and confronting versus avoiding EOL issues. For these data, there were more similarities than differences as a result of gender, race, or living situation than one might expect, although culture and financial status were found to be influential in the avoidance of EOL discussions. The results of this study help to provide additional insight into relational dialectics related to aging, EOL, and the importance of communication in facilitating family coping.

Candida albicans is a major fungal pathogen of humans, accounting for 15% of nosocomial infections with an estimated attributable mortality of 47%. C. albicans is usually a benign member of the human microbiome in healthy people. Under constant exposure to highly dynamic environmental cues in diverse host niches, C. albicans has successfully evolved to adapt to both commensal and pathogenic lifestyles. The ability of C. albicans to undergo a reversible morphological transition from yeast to filamentous forms is a well-established virulent trait. Over the past few decades, a significant amount of research has been carried out to understand the underlying regulatory mechanisms, signaling pathways, and transcription factors that govern the C. albicans yeast-to-hyphal transition. This review will summarize our current understanding of well-elucidated signal transduction pathways that activate C. albicans hyphal morphogenesis in response to various environmental cues and the cell cycle machinery involved in the subsequent regulation and maintenance of hyphal morphogenesis.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

Image stitching is a crucial aspect of image processing. However, factors like perspective and environment often lead to irregular shapes in stitched images. Cropping or completion methods typically result in substantial loss of information. This paper proposes a method for rectifying irregularly images into rectangles using deformable meshes and residual networks. The method utilizes a convolutional neural network to quantify rigid structures of images. Choosing the most suitable mesh structure based on the extraction results, offering options such as triangular, rectangular, and hexagonal. Subsequently, the irregularly image, predefined mesh structure, and predicted mesh structure are input into a wide residual neural network for regression. The loss function comprises local and global, aimed at minimizing the loss of image information within the mesh and global target. This method not only significantly reduces information loss during rectification but also adapting to different images with various rigid structures. Validation on the DIR-D dataset shows this method outperforms state-of-the-art methods in image rectification.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Ornamental kale (Brassica oleracea var. acephala) is an attractive ornamental plant with a range of leaf colors and shapes. Breeding new varieties of ornamental kale has proven challenging due to its lengthy breeding cycle and the limited availability of genetic markers. Microspore culture is an effective approach to generate new materials and genetic maps are a prerequisite for quantitative trait loci analysis, MAS, fine gene mapping, and genome sequence assembly. In this study, a F1DH ornamental kale population comprising 300 DH lines was constructed using microspore culture. A high-density genetic map was developed by conducting whole-genome sequencing on 150 individuals from the F1DH population. The genetic map contained 1,696 bin-markers with 982,642 single-nucleotide polymorphisms (SNPs) spanning a total distance of 775.81 cM on all nine chromosomes with an average distance between markers of 0.46 cM. The ornamental kale genetic map contained substantially more SNP markers compared with published genetic maps for other B. oleracea crops. The F1DH progenies provide an excellent resource for germplasm innovation and breeding new varieties of ornamental kale. The high-density genetic map provides crucial insights for gene mapping and unraveling the molecular mechanisms behind important agronomic traits in ornamental kale.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

Proper Post-Activation Performance Enhancement helps to improve athletic performance. This study aimed to investigate the effects of two different velocity loss (VL), 10%VL and 20%VL, on post-activation performance enhancement (PAPE) in 20m sprint performance among sprint athletes. Twenty-four male sprint athletes (100m sprint time: 10.96±0.15 s) were recruited. A randomized crossover experimental design was used for traditional group (TG), 10%VL, and 20%VL interventions. Sprint tests were conducted at the 4th, 8th, 12th, and 16th minutes after the intervention. Two-way repeated measures ANOVA revealed an interaction effect between group and time on 20m sprint performance (F=2.817, p=0.037, partial η²=0.585). Simple effect analyses showed significant differences compared to baseline at the 4th minute for the 20%VL group (P&lt;0.05). Cohen's d values indicated improvement in 10m sprint times at the 8th minute of the rest interval for all three intervention groups (TG: ES=-0.270, 10%VL: ES=-0.038, 20%VL: ES=-0.279). Improvement in 20m sprint times was observed at the 4th minute for the 20%VL group (ES=-0.296) and at the 16th minute for the 10%VL group (ES=-0.276). Compared to traditional PAPE schemes based on 1RM, PAPE schemes based on velocity loss (20%VL) can better induce PAPE effects in sprint athletes.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

Adlay (Coix lachryma-jobi L. var. ma-yuen Stapf) contains various phytonutrients for treating many diseases in Asia. To investigate whether orally administered of adlay bran oil (ABO) can cause drug interactions, the effects of ABO on the pharmacokinetics of five cytochrome P450 (CYP) probe drugs were evaluated. Rats were given a single oral dose (2.5 mL/kg BW) of ABO 1 h before administration of a drug cocktail either orally or intravenously, and blood was collected at various time points. A single oral dose of ABO administration did not affect the pharmacokinetics of five probe drugs when given as a drug cocktail intravenously. However, ABO increased plasma theophylline, dextromethorphan, and diltiazem when co-administered an oral drug cocktail. After 7-days of feeding with an ABO-containing diet, plasma concentrations of theophylline and chlorzoxazone were increased after oral administration of drug cocktail. The major CYP enzyme activities in liver and intestinal were not affected by ABO treatment. Results from this study indicate that a single oral dose or short-term administration of ABO may increase plasma drug concentrations when ABO is given concomitantly with drugs. ABO is likely to enhance intestinal drug absorption. Therefore, caution is needed to avoid food-drug interactions between ABO and co-administered drugs.

Limited knowledge is available about the association between autistic spectrum disorder (ASD) and precocious puberty. Our study examined the association between the two medical conditions, and the effect modification by sex and neuropsychiatric comorbidities in a nationwide population. To compare the risk of precocious puberty between ASD and non-ASD cases, we conducted Cox regression analysis, using ASD as exposure and time-to-precocious puberty as outcome. We adjusted for sex, attention-deficit/hyperactivity disorder (ADHD), tics disorder, obsessive–compulsive disorder (OCD), anxiety disorder, intellectual disability, and epilepsy. We performed a moderation analysis to examine the potential moderating effects by sex or comorbidities. Patients with ASD were prone to have precocious puberty, with an adjusted hazard ratio (aHR) of 1.80 (95% CI: 1.61-2.01). For the effect modification, sex, specifically females, moderated the association between ASD and precocious puberty, with relative excess risk due to interaction (RERI) 7.35 (95% CI 4.90-9.80). No significant effect modification was found for any of the comorbidities within the scope of additive effect modification. We found that patients with ASD were prone to precocious puberty, regardless of sex or comorbid neuropsychiatric disorders. Girls with ASD are at particularly higher risk to develop precocious puberty.

Plants endogenous hormones play an important role in resistance to soil lead (Pb) contamination. In order to explore the response of plant hormones to Pb stress, pot experiment was conducted to analysis the hormones contents, related gene expressions and Pb accumulation of Arabis alpina under Pb treatment and transporter (CAX(cation exchangers), HMA(heavy metal ATPase) and ABC(ATP-binding cassette transporter)) activities under foliage spraying auxin (IAA). The results showed that contents of total Pb and soluble components Pb (vacuoles) in roots and leaves of Arabis alpina increased with increase of Pb treatment concentrations. Compering to 100 mg·kg-1 Pb2+ treatment, Pb contents in soluble components of roots and leaves under 300 mg·kg-1 Pb2+ treatment increased by 896.3% and 238.8%, respectively. The contents of endogenous hormones in leaves and roots increased under Pb treatment concentrations. Comparing to control (0 mg·kg-1 Pb2+ treatment), contents of auxin in roots and leaves under 100 mg∙kg-1 Pb treatment increased by 176.19% and 585.29%, respectively. Auxin contents in xylem saps under 100 and 300 mg∙kg-1 Pb treatments increased by 283.14% and 100.30%, respectively. Gene expression related to auxin transport was up-adjusted. The expressions of three gene related to auxin-repressed 12.5 kDa protein and auxin-responsive GH3 family were down-adjusted. Under foliage spraying IAA, Pb contents in leaves increased by 29.81% and Pb content in symplast sap was higher than that with non spraying IAA treatment. The activities of CAX and HMA in roots of A. alpina increased by 9.62% and 8.79% with foliage spraying IAA treatment, while activity of ABC decreased by 21.94%. In general, contents of auxin and related genes expressions of A. alpina increased under Pb treatment, which enhanced activities of CAX and HMA resulting in Pb translocation through symplast pathway.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

A university canteen is a queueing system characterised by non-stationary time of arrival with limited resources where the arrival rate is time dependent and has different pattern of arrival for different time interval. This means at certain time of the day, the arrival rate is much higher than other time and for a university canteen, the arrival rate of customer during the lunchtime is much higher and the food (resources) is limited. Non-stationary time dependent queueing system is not easily modelled mathematically hence such queueing systems are modelled using simulation tools such as ARENA. In order to model a non-stationary time dependent queueing system with limited resources and solve queueing problems using ARENA, researchers have to depend on their knowledge and experience in identifying the appropriate and relevant parameters for the system and make modifications to these parameters of the system to solve queueing problems by means of trial and error. Hence, this research work explores the potentials of applying a systematic problem solving tool, TRIZ to help users to make better decisions in deriving solutions to improve a non-stationary time dependent queueing system with limited resources. A case study was carried out to minimize the waiting time of the customers at the cafeteria of the Faculty of Engineering, Universiti Putra Malaysia (UPM), which has queueing problems for years during lunchtime. TRIZ was applied in this case study and the results showed that TRIZ can assist researchers to derive a solution model that lead to shorter waiting time without incurring additional cost and resources.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

To decrease privacy risks, consumers may choose to misrepresent when they are asked to offer personal information. This paper examines the impact of consumer misrepresentation on a monopolistic firm and consumers with an economic model. The results show that consumer misrepresentation may benefit the firm but hurt consumers. In addition, consumers misrepresentation may encourage the firm to provide higher personalized service level in certain scenarios, such as, when the unit cost of personalized service is low. Thirdly, when consumers misrepresent, and the firm only covers part of the market, a greater unit value of consumer’s privacy information will reduce the firm’s profit, but a greater unit cost of personalized service increases the firm’s profit.

Programmed cell death protein 1 (PD-1) is a biomarker on the surface of cells that has a role in promoting self-tolerance by suppressing the inflammatory activity of T cells. In this work, one peptide of PD-1 was used as the template in molecular imprinting. The magnetic peptide-imprinted poly(ethylene-co-vinyl alcohol) composite nanoparticles (MPIP NPs) were characterized by dynamic light scattering (DLS), high-performance liquid chromatography (HPLC), Brunauer-Emmett-Teller (BET) analysis and superconducting quantum interference device (SQUID) analysis. Natural killer-92 (NK-92) cells were added to these composite nanoparticles and then incubated with human hepatoma (HepG2) cells. The viability and apoptosis pathway of HepG2 were then studied using cell counting kit-8 (CCK8) and the quantitative real-time polymerase chain reaction (qRT-PCR), respectively. These nanoparticles were found significantly enhance the activity of natural killer cells toward HepG2 cells by increasing expression of NK-kB, caspase 8 and especially caspase 3.

Supramolecular solvent (SUPRAS) has received increasing interest as an innovative, efficient, and green solvent for the effective extraction and separation of bioactive compounds from natural resources. However, studies on the use of SUPRAS for the extraction of phenolic components from plants, which are highly valued in food products due to their excellent antioxidant capacity, are still lacking. The present study developed a green ultrasound-assisted and efficient SU-PRAS method to simultaneously determine three phenolic acids in Prunella vulgaris by high-performance liquid chromatography (HPLC) and the experimental parameters were optimized in detail. The efficiency and antioxidant properties of the phenolic compounds obtained by different extraction methods were also compared. Under the optimal conditions, the extraction efficiency of SUPRAS, prepared with octanoic acid reverse micelles dispersed in ethanol-water, was substantially higher than conventional organic reagents. Moreover, this SUPRAS method also showed more significant antioxidant capacities. The confocal laser scanning microscopy (CLSM) images presented the spherical droplet structure of SUPRAS (A well-defined circle), which coincided with the position of the fluorescence position of phenolic acids. The phenolic acids were encapsulated in the vesicles by the SUPRAS droplets, which indicated the efficient extraction capacities of SUPRAS for the target compounds. Finally, combined with the CLSM method, the mechanism of the proposed method was further clarified, and the superior extraction performance of SUPRAS was theoretically demonstrated through molecular dynamics simulations. In comparison with conventional methods, the higher extraction efficiency of SUPRAS can be illustrated by the larger solvent contact surface area, more types of hydrogen bonds between extractants and supramolecular solvents, and stronger and more stable interaction forces. The results of the theoretical studies are in rational agreement with the experimental outcome.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

Transcription factors (TFs) are crucial in modulating gene expression and sculpting cellular and organismal phenotypes. The identification of TF-target gene interactions is pivotal for comprehending molecular pathways and disease etiologies but has been hindered by the demanding nature of traditional experimental approaches. This paper introduces a novel web application, utilizing the R programming language, which predicts TF-target gene relationships and vice versa. Our application integrates the predictive power of various bioinformatic tools, leveraging their combined strengths to provide robust predictions. It merges databases for enhanced precision, incorporates gene expression correlation for accuracy, and employs pan-tissue correlation analysis for context-specific insights. The application also enables the integration of user data with established resources to analyze TF-target gene networks. Despite its current limitation to human data, it provides a platform for exploring gene regulatory mechanisms comprehensively. This integrated, systematic approach offers researchers an invaluable tool for dissecting the complexities of gene regulation, with the potential for future expansions to include a broader range of species.

This paper proposes a new approach for multi-focus images fusion based on Region Mosaicing on Contrast Pyramids (REMCP). A density-based region growing method is developed to construct a focused region mask for multi-focus images. The segmented focused region mask is decomposed into a mask pyramid, which is then used for supervised region mosaicking on a contrast pyramid. In this way, the focus measurement and the continuity of focused regions are incorporated and the pixel level pyramid fusion is improved at the region level. Objective and subjective experiments show that the proposed REMCP is more robust to noise than compared algorithms and can fully preserves the focus information of the multi-focus images meanwhile reducing distortions of the fused images.

Astringency is an important sensory characteristic of food and beverages containing polyphenols. However, astringency perception in elderly people has not been documented. The aim of the present work was to evaluate sensitivity to astringency as a function of age and salivary flow. Fifty-four panellists, including 30 elderly people (age=75±4.2 years) and 24 young people (age=29.4±3.8 years), participated in this study. Astringency sensitivity was evaluated by the 2-alternative forced choice (2-AFC) procedure using tannic acid solutions. Whole saliva was collected for 5 min before and after sensory tests. The results showed that the astringency threshold was significantly higher in the elderly group than in the young group. Moreover, a negative correlation between salivary flow and threshold was observed in the young group only. These results showed a difference in oral astringency perception as a function of age for the first time. This difference can be linked to salivary properties that differ as a function of age.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

In this paper, we investigate the new degenerate Daehee polynomials and numbers which are called the degenerate Daehee polynomials of the second kind, and derive some new and interesting identities and properties of those polynomials.

The environmental policy is compelling industries to treat their wastewater to a level that can be released into the domestic sewer system or even for reuse. However, many industrial branches are lacking space for traditional wastewater plant. Hence, electrokinetics wastewater treatment is a viable alternative as it is fast and does not require large space. However, the electrokinetics wastewater treatment is still mostly tested in the laboratory. In the current study, a prototype of electrokinetics wastewater treatment industrial-size device has been designed, constructed and tested under real conditions. In this paper the device is described and the results obtained from the operation of the device are presented and discussed.

This study aimed to investigate the relationship between sleep duration, dementia severity, age, and ANS regulation. This cross-sectional pilot study included 27 older patients with probable Alzheimer’s disease, hospitalized at a psychiatric center. We measured heart rate variability to assess ANS regulation at night, evaluated dementia severity using the Clinical Dementia Rating scale, and obtained sleep duration data from sleep diaries maintained by psychiatric nurses. The data were analyzed using repeated-measures generalized linear models with age, sex, dementia severity, and medication (antipsychotics) as covariates. A sleep duration of 7–8 h per night was associated with better ANS regulation than other sleep durations, as indicated by sympathovagal balance (p = 0.005). ANS dysregulation was characterized by a 20.7% increase in sympathetic nervous system activity and a 14.8% decrease in parasympathetic nervous system (PSNS) activity. We found a significant correlation between dementia severity and PSNS activity (p = 0.04) and observed an inverted U-shaped association between sleep duration and ANS regulation. This pilot study demonstrated that a sleep duration of 7–8 h per night may be critical in maintaining optimal ANS regulation. Bidirectional associations between sleep duration, inadequate sleep duration, aging, and ANS regulation warrant further investigation.

Image stitching is a crucial aspect of image processing. However, factors like perspective and environment often lead to irregular shapes in stitched images. Cropping or completion methods typically result in substantial loss of information. This paper proposes a method for rectifying irregularly images into rectangles using deformable meshes and residual networks. The method utilizes a convolutional neural network to quantify rigid structures of images. Choosing the most suitable mesh structure based on the extraction results, offering options such as triangular, rectangular, and hexagonal. Subsequently, the irregularly image, predefined mesh structure, and predicted mesh structure are input into a wide residual neural network for regression. The loss function comprises local and global, aimed at minimizing the loss of image information within the mesh and global target. This method not only significantly reduces information loss during rectification but also adapting to different images with various rigid structures. Validation on the DIR-D dataset shows this method outperforms state-of-the-art methods in image rectification.

Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

The Android-based IoT platform just like the existing Android provides an environment that makes it easy to utilize Google's infrastructure services including development tools and APIs through which it helps to control the sensors of IoT devices. Applications running on the Android-based IoT platform are often UI free and are used without the user’s consent to registered permissions. It is difficult to respond to the misuse of permissions as well as to check them when they are registered indiscriminately while updating applications. This paper analyzes the versions of before and after an application the update running on the Android-based IoT platform and the collected permission lists. It aims to identify the same permissions before and after the update, and deleted and newly added permissions after the update were identified, and thereby respond to security threats that can arise from the permissions that is not needed for IoT devices to perform certain functions.