System-of-systems (SoS) evolution is a complex and unpredictable process. Although various principles to facilitate collaborative SoS evolution have been proposed, there is a lack of experimental data validating their effectiveness. To address these issues, we present an Agent-Based Model (ABM) for SoS evolution in the Internet of Vehicles (IoV) , serving as a quantitative analysis tool for SoS research. By integrating multiple complex and rational behaviors of individuals, we aim to simulate real-world scenarios as accurately as possible. To simulate the SoS evolution process, our model employs multiple agents with autonomous interactions and incorporates external environmental variables. Furthermore, we propose three evaluation metrics: evolutionary time, degree of variation, and evolutionary cost, to assess the performance of SoS evolution. Our study demonstrates that enhanced information transparency significantly improves the evolutionary performance of distributed SoS. Conversely, the adoption of uniform standards only brings limited performance enhancement to distributed SoSs. Although our proposed model has limitations, it stands out from other approaches that utilize Agent-Based Modeling to analyze SoS theories. Our model focuses on realistic problem contexts and simulates realistic interaction behaviors. This study enhances the comprehension of SoS evolution processes and provides valuable insights for the formulation of effective evolutionary strategies.

Atherosclerosis (AS) is a chronic progressive disease caused by various factors, and causes various cerebrovascular and cardiovascular diseases (CVDs). Reducing the plasma levels of low-density lipoprotein-cholesterol (LDL-C) is the primary goal in preventing and treating AS. Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) plays a crucial role in regulating LDL-C metabolism. Panax notoginseng has potent lipid-reducing effects and protects against CVDs, and its saponins induce vascular dilatation, inhibit thrombus formation, and are used in treating CVDs. However, the anti-AS effect of the secondary metabolite, 20(S) -protopanaxatriol (20(S)-PPT), remains unclear. In this study, the anti-AS effect and molecular mechanism of 20(S)-PPT were investigated in vivo and in vitro by western blotting, real time-polymerase chain reaction (RT-PCR), Enzyme-linked Immunosorbent Assay (ELISA), immunofluorescence staining, and other assays. The in vitro experiments revealed that 20(S)-PPT reduced the levels of PCSK9 in the supernatant of HepG2 cells, upregulated low density lipoprotein receptor (LDLR) protein levels, promoted LDL uptake by HepG2 cells, and reduced PCSK9 mRNA transcription by upregulating the levels of FoxO3 protein and mRNA and decreasing the levels of HNF1α protein and mRNA. The in vivo experiments revealed that 20(S)-PPT upregulated aortic αSMA expression, increased the stability of atherosclerotic plaques, and reduced aortic plaque formation induced by a high-cholesterol fed in ApoE-/- mice (HCF group). Additionally, 20(S)-PPT reduced the aortic expression of CD68, reduced inflammation in the aortic root, and alleviated the hepatic lesions in the HCF group. The study revealed that 20(S)-PPT inhibited LDLR degradation via PCSK9 to alleviate AS.

In this study, we design a new refractive index sensor based on a metal–insulator–metal waveguide coupled with a notched ring and vertical rectangular resonators. We use the finite element method to study the propagation characteristics of the sensor. According to the calculation results, the transmission spectrum exhibits a typical Fano resonance shape. The phenomenon of Fano resonance is caused by the coupling between the wide spectrum and narrow spectrum. In the design, the wide spectrum signal is generated by the vertical rectangular resonator, while the narrow spectrum signal is generated by the notched ring resonator. In addition, we varied the structural parameters of the resonators and filled the structure with media of different refractive indices to study the sensing properties. The maximum achieved sensitivity of the sensor reached 1071.4 nm/RIU. The results reveal potential applications of the coupled system in the field of sensors.

Previously, a conductivity invariance phenomena (CIP) has been discovered – at a certain lift-off, the inductance change of the sensor due to a test sample is immune to conductivity variations, i.e. the inductance – lift-off curve passes through a common point at a certain lift-off, termed as conductivity invariance lift-off. However, this conductivity invariance lift-off is fixed for a particular sensor setup, which is not convenient for various sample conditions. In this paper, we propose using two parameters in the coil design – the horizontal and vertical distances between the transmitter and the receiver to control the conductivity invariance lift-off. The relationship between these two parameters and the conductivity invariance lift-off is investigated by simulation and experiments and it has been found that there is an approximate linear relationship between these two parameters and the conductivity invariance lift-off. This is useful for applications where the measurements have restrictions on lift-off, e.g. uneven coating thickness which limits the range of the lift-off of probe during the measurements. Therefore, based on this relationship, it can be easier to adjust the configuration of the probe for a better inspection of the test samples.

Infectious keratitis (IK) represents a major cause of corneal blindness. This study aims to investigate the demographics, risk factors, microbiological characteristics and antibiotic susceptibility patterns of IK in Taiwan over the past 15 years. A retrospective population-based study was conducted using the Chang Gung Research Database. Patients with IK were identified by diagnostic codes for corneal ulcer from 2004 to 2019. Of 7807 included subjects, 45.2% of patients had positive corneal cultures. The proportion of contact lens-related IK declined, while that of IK related to systemic diseases grew. The percentage of isolated gram-positive bacteria surpassed that of gram-negative bacteria in the 15-year period. The prevalence of Pseudomonas aeruginosa showed a decreasing trend (p = 0.004), whereas coagulase-negative Staphylococcus (CNS) and Propionibacterium species were increasingly detected (p < 0.001). Overall, the trend of antibiotic susceptibility of both gram-positive and gram-negative bacteria did not change throughout the study period. The susceptibility to the test antibiotics maintained over 90% in gram-negative isolates during 15 years. Vancomycin preserved 100% susceptibility to all gram-positive isolates. Since most tested antibiotics exhibited stable susceptibility over decades, this study reinforced that fluoroquinolones and fortified vancomycin continue to be good empiric therapies for treating bacterial keratitis in Taiwan.

In light of advancing technology, the conventional clock network architecture has become inadequate for addressing the intricacies inherent in modern System-on-Chip (SoC) designs. While clock mesh topology offers resilience against On-Chip Variation (OCV) fluctuations, it still necessitates manual intervention. Therefore, substantial scope exists for methodological enhancements and the refinement of rapid analytical techniques. This paper introduces a novel clock mesh synthesis approach, underpinned by dynamic programming algorithms, that guarantees latency constraints. Our experimental findings demonstrate that our algorithm achieves an additional 26.6% reduction in power consumption compared to the baseline methodology. Furthermore, it substantially reduces runtime by an average of 78.0% when contrasted with traditional simulation methods. These results highlight the potential of our methodology for enhancing the efficiency and power management of clock mesh.

During their growth, bacteria respond to complex environmental changes through equally com-plex and orderly regulatory mechanisms. sRNA has an important role as a post-transcriptional regulator in the environmental adaptation of Bacillus. In this study, we identified an sRNA Bvs091 located in the intergenic region of the Bacillus velezensis, which is widely present in the genus Bacillus and whose expression is upregulated by salt treatment. The deletion of bvs091 in B. ve-lezensis PEBA20 led to a reduced growth rate and a change in the phenotypes, with simple colony structures and low and easily degradable biofilm. Salt tolerance tests indicated that the deletion of bvs091 results in a reduced salt tolerance. galT2 mRNA is supposed to be a direct target of Bvs091 according to results obtained by using the bioinformatic method and performing qRT-PCR analysis. The microscale thermophoresis (MST) analysis showed that Bvs091 could directly bind 28‒51 bases in front of the promoter of galT2. Subsequently, the deletion of galT2 in B. velezensis resulted in increased salt tolerance. Based on the techniques of double plasmids and a half-life period, sRNA Bvs091 is confirmed as a trans-encoded sRNA that negatively regulates the mRNA expression of galT2. In brief, the trans-encoded sRNA Bvs091 acts by pairing the incomplete complementary bases of galT2 mRNA, reducing galT2 mRNA’s stability and affecting the trans-lation efficiency.

As the embedded device and internet of things (IoTs) concept prevalent in today's world, there is an increasing demand for the security and performance requirements on deploying these devices to private and public sectors. The crucial part of it is to protect privacy, confidentiality and integrity, meanwhile, maintain an adequate level of performance during transmission, storage and access of critical information. While the conventional cryptography methods, such as the Advanced Encryption Standard (AES), SHA$-$2 hashing method and RSA and Diffie Hellman for message authentication and identification, work well on systems which have reasonable processing power and memory capabilities. These do not scale well into a world with embedded systems and sensor networks, in conjunction with their nature of smaller size and lower cost. Thus, in the context of resource constrained device, lightweight cryptography methods are proposed to overcome many of the problems of conventional cryptography possessed. This includes constraints related to physical size, processing requirement, memory limitation, energy drain and production cost. This paper provides a survey of the architectures that are defined as replacements for conventional ciphers within an IoTs space and discuss some trends in the design of future lightweight algorithms. The performance metrics are carefully chosen to reflect and assess the suitability for embedded devices. The aim of this research is to identify the various performance metrics applied on different types of symmetric block ciphers especially lightweight ciphers and compare the results on versatile platforms with stream ciphers and public key methods. The comparative analysis on efficient LW cipher will be tested against other similar block ciphers on both MacBook Pro with Intel core and resource constrained device Raspberry Pi with ARM processor.

Excessive CO₂ emissions and alternative energy fuels are two major difficult issues. The utilization of CO₂ into fine chemicals is an optimal route. Diethyl carbonate (DEC) is an extremely versatile chemical intermediate. DEC is used in gasoline, pharmaceutical, chemical and other fields. DEC synthesis from CO₂ and ethanol is a typical green synthetic route. Ni-Cu@Na₃PW₁₂O₄₀ catalysts were synthesized by two novel methods of supported and mixed. The catalyst prepared by mixed method showed nice catalytic performance. It was confirmed that water removal was the key to improving conversion efficiency. In the presence of dehydrating agent of ethylene, ethanol conversion increased from ca. 3% to ca. 40%. Propylene oxide (PO) was participated in the reaction and ethanol conversion continued to reach to ca.90% while DEC selectivity dropped by half. Under optimal conditions, our Ni-Cu@Na₃PW₁₂O₄₀ catalyst effectively solved the two major issues above.

In forests, the microbial populations living in the soil can directly affect the carbon decomposed by the surface plants, and promote carbon storage and stability. In this study, 3 plots of 25.82 m×25.82 m were set up in 5 stand types, respectively. Soil samples were collected from 0~20 cm, 20~40 cm and 40~60 cm layers. Soil microbial composition, organic carbon component, pH, water content, bulk density, nitrogen, phosphorus, potassium and other physicochemical indexes and correlations were determined, and the correlations between soil carbon components and soil microbial functional modules in different mixed modes were analyzed. The results showed that: (1) The SOC of the same soil layer varied significantly, which also showed significant differences on the composition of soil bacteria and fungal microbial communities. Moreover, the bacterial community was more sensitive to the vegetation change environment, and the fungal community structure was more resistant to the influence of soil environment changes. (2) Fun_mod 1,6 and Bac_mod 7 were the microbial functional modules that played a decisive role in the process of soil carbon pool change, and the diversity and composition of bacterial community had more positive effects on soil organic carbon than that of fungal community. (3) Linear fitting and RDA results showed that POC in soil had the strongest correlation with SOC content, indicating that soil microorganisms affected the storage and stability of soil carbon mainly by regulating the conversion of surface plants (carbon sources) into POC. The soil environment of different mixed modes has different effects on soil carbon accumulation. Soil microorganisms affect soil carbon storage and stability mainly by regulating the conversion of surface plants (carbon sources) into POC forms.

The aim of this experiment was to investigate the effects of moisture content, additives and their interactions on the fermentation quality, aerobic stability and in vitro digestibility of mixed silage of amaranth and corn meal. Amaranths and corn meal were mixed in mass ratios of 69:31, 76:24 and 84:16, and the silage water content was adjusted to 60% (W1), 65% (W2) and 70% (W3), respectively. Silage treatments included no additives (U), the addition of Lactobacillus plantarum (L), the addition of cellulase (E), and the addition of Lactobacillus plantarum + cellulase (M) mixed reagents. The results showed that pH and ammonia nitrogen (NH3-N/TN) levels were significantly lower (p < 0.05) in W1 compared to W2 and W3. At the same time, dry matter (DM), organic matter (OM), in vitro dry matter digestibility (ivDMD), in vitro dry matter digestibility (ivDMD), in vitro organic matter digestibility (ivOMD), and in vitro crude protein digestibility (ivCPD) were significantly increased (p < 0.05). Meanwhile, the aerobic stability of mixed silage of seed amaranth and corn meal decreased with increasing water content. The aerobic stability of the L, E, and M treatment groups was improved by 15, 105, and 111 hours, respectively, compared to the control group at W1. pH and NH3-N/TN levels were lower in the addition of E (E and M) than in the absence of E (U and L) (3.73, 20.1 g kg−1DM vs. 3.64, 22.9 g kg−1 DM, p < 0.05).NDF and ADF were significantly lower with the addition of E than without the addition of E (598 g kg−1 DM, 145 g kg−1 DM vs. 632 g kg−1 DM, 160 g kg−1 DM, p < 0.05). However, CP, ivDMD, ivOMD, and ivCPD were significantly higher (p < 0.05). AA and NH3-N/TN were significantly reduced (p < 0.05) with the addition of L (L and M) compared to without the addition of (U and E). In conclusion, the best fermentation quality, in vitro digestibility and aerobic stability of amaranth and cornmeal mixed silage treated with Lactobacillus plantarum + cellulase (M) were achieved at 60% water content.

This general review assesses the impact of physical exercise on oxidative and nitrosative stress and the counteractive role of antioxidants, drawing from a systematic literature search up to March 2024 in databases like PubMed and Web of Science. The review highlights studies on the effect of exercise on the production of reactive oxygen species (ROS) and reactive nitrogen species (RNS) and antioxidant responses in both human and animal models based on rigorous inclusion and exclusion criteria. Due to the variety of exercise types and participants' characteristics, a narrative synthesis approach was adopted. The findings indicate that moderate exercise boosts antioxidant defenses, known as hormesis, whereas excessive physical activity may increase oxidative and nitrosative damage. The review also explores the complex effects of antioxidant supplementation, revealing that while natural dietary antioxidants support health, high-dose supplements could potentially hinder positive adaptations to exercise. Recommendations for athletes and the general active population highlight the importance of balancing exercise and dietary intake to optimize health benefits. The review concludes with a call for more detailed research on tailored exercise and nutrition plans to dissect these intricate relationships further.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Plants do need a fixed proportion of carbon (C), nitrogen (N) and phosphorus (P) elements to maintain normal metabolic activities. The P fertilizers are widely used to supplement nutrients in subtropical plantations. Stoichiometric homeostasis reflects the strategy of plants to cope with various environments (including P fertilizer supply rate). It is thus of great significance to understand C:N:P stoichiometry in the plant-litter-soil system under P addition and stoichiometric homeostasis of plant tissues for fertilization management of slash pine (Pinus elliottii Engelm) plantations. We measured the C, N and P contents in root, branch, needle, litter and soil in slash pine plantations fertilized with four treatments - P1 (25 kg P ha−1 yr−1), P2 (50 kg P ha−1 yr−1), P3 (100 kg P ha−1 yr−1), and a control (CK) in subtropical China and calculated stoichiometric homeostasis of plant tissues. Results showed that P addition increased the capacity of needle to obtain C, N and P elements and altered the C:N:P stoichiometry of plant tissues, as well promoted the accumulation of C and P elements in soil, but had no significant effect on soil stoichiometry. The nutrient contents of needle and branch were higher than those of root and litter, indicating that slash pine was more inclined to allocate nutrient to the aboveground tissues. The stoichiometric homeostasis of C, N and P among plant tissues was ranked as follows: root > branch > needle, and homeostasis of nutrient elements in the needle was C > N > P. This indicated that the C, N and P stoichiometric homeostasis was various among plant tissues and elements types under P addition. These findings suggest P addition would alleviate the P limitation of slash pine growth in subtropical regions. In the future, long-term observation experiments should be conducted and the trade-off between P addition rates and economic and ecological benefits should be considered.

This paper addresses the input coupling problem for the shape memory alloy (SMA) actuated parallel platform with completely unknown nonlinear dynamics. The problem means that in a parallel platform with multiple SMA actuators acting together, the displacement of one of the actuators will simultaneously affect the remaining actuators to change. Due to the coupling problem and nonlinear characteristics of the SMA actuators, it is not easy to control the platform to achieve bi-directional swing with completely unknown nonlinear dynamics. Therefore, a model-free adaptive sliding mode control method is proposed to improve the control accuracy of the complex motion of the platform, avoiding the complex modeling process of the SMA actuated parallel platform. Based on the model-free adaptive control (MFAC) theory, a multiple input and multiple output (MIMO) dynamic linearized mathematical model of the parallel platform is established using the online input and output data of the system. Then, a sliding mode controller is designed based on the dynamic model. A rigorous theoretical analysis proves that the proposed model-free adaptive sliding mode controller is able to stably control the SMA actuated parallel platform, and its tracking error is uniformly ultimately bounded (UUB). Finally, experiments are conducted on the established SMA actuated parallel platform. The results show that the proposed model-free controller is feasible and effective, and can control the system well to achieve the complex motion of bi-directional swing.

This paper explores the application of wavelet analysis, a multiscale approach for enhancing visual clarity, in the context of image denoising, which reduces the impact of noisy pixels, caused by various factors such as electronic sensor limitations, low-light conditions, or transmission errors in digital imaging systems. This paper introduces some common noise types like Gaussian noise and processes of image denoising, eliciting the strength of wavelet analysis. As a powerful image denoising technology, wavelet analysis needs five steps to process the image, and the key step is thresholding. There are many kinds of wavelet, and each wavelet has different advantages and functions, which makes it suitable for different applications. Hence, wavelet analysis also makes a contribution in various fields beyond signal processing and data analysis, such as Biomedical Imaging and Geophysics and Seismology, where preserving image quality is essential for accurate analysis and interpretation. In short, this research highlights the promise of wavelet analysis, emphasizing the use of high- quality image data.

Urban morphology exhibits fractal characteristics, which can be described by multifractal scaling. Multifractal parameters under positive moment orders primarily capture information about cen-tral areas with relatively stable growth, while those under negative moment orders mainly reflect information about marginal areas with more active growth. However, effectively utilizing mul-tifractal spectrums to uncover the spatio-temporal variations of urban growth remains a challenge. To addresses this issue, this paper proposes a multifractal measurement by combining theoretical principles and empirical analysis. To capture the difference between growth stability in central areas and growth activity in marginal areas, an index based on generalized correlation dimension Dq is defined. This index takes the growth rate of Dq at extreme negative moment order as the numerator, and that at extreme positive moment order as the denominator. During the stable stage of urban growth, the index demonstrates a consistent pattern over time. While during the active stage, the index may exhibit abnormal fluctuations or even jumps. This indicates that the index can reveal spatio-temporal information about urban evolution that cannot be directly observed through multifractal spectrums alone. By integrating this index with multifractal spectrums, we can more comprehensively characterize the evolutionary characteristics of urban spatial structure.

p53 is among the most frequently mutated tumor suppressor genes given its prevalence in >50% of all human cancers, including high grade serous endometrial cancers and ovarian cancers. In addition to loss of tumor suppression function, many mutated p53 (Mutp53) proteins acquire gain-of-function (GOF) activities as oncogenes to promote cancer progression, which manifest through aberrant expression of p53. As we have come to see, statins induce CHIP-mediated degradation of mutp53 by blocking the interaction between mutp53 and DNAJA1. Therefore, targeting critical downstream pathways of mutp53 provides an alternative strategy for treating cancers expressing mutp53. In this review, we summarize recent advances with Wee1 inhibitors and mevalonate pathway inhibitors, particularly statins, regarding their use in gynecological cancers with p53 mutations.

Abstract: There are a large number of cross-linked chemical bonds such as tight disulfide bonds, hydrogen bonds,and salt bonds in keratin, which makes it difficult to break the structural stability of the protein using conventional methods. The degradation of feather waste using keratinases produced by microorganisms has the advantage of being efficient and environmentally friendly. In this study, 23 strains capable of producing transparent circles were obtained via preliminary screening with skim milk as the sole carbon and nitrogen source, and 9 strains capable of degrading feathers were obtained via rescreening with feathers as the sole carbon and nitrogen source. Finally, through the determination of enzyme activity, the strain CY-A with a high ability to degrade feathers was obtained. The strain was identified as Bacillus tequilensis via morphological observation, physiological and biochemical identification, and 16 S rRNA molecular biology. The keratinase gene (bta) of Bacillus tequila was cloned, and its full-length gene sequence was 1110 bp, containing an open reading frame of 1089, encoding 369 amino acids (GeneBank accession number OR733336). The physicochemical properties, secondary structure, and tertiary structure of the recombinant protein were analyzed using bioinformatics tools such as ProtParm, SOPMA, MEGA, and SWISS-MODELS. It was found that the relative molecular mass was 37.953 kD and that the isoelectric point was 8.48. The protein was a hydrophilic protein. The keratinase bta gene was ligated to the expression vector pET28a(+) using T4 ligase, and the recombination expression plasmid pET28-bta was constructed and transformed into E. coli BL21(DE3) to obtain recombinant engineered bacteria. The expressed keratinase was purified using a Ni2+ affinity chromatography column to obtain recombinant bta keratinase bta with a molecular weight of 37.953 kD. The identification and characterization of this keratinase gene provides some theoretical basis for the further enhancement of keratinase activity by means of genetic engineering.

The purpose of this study is to examine the relationship between the institutional investors which can affect financial performance for corporate sustainability on the income smoothing. Therefore, this study focus on the connection between the nature of stock rights and income smoothing in China. For this study, hypotheses were established on the relationship each state-controlled companies, income smoothing, and information equilibrium of individual investors, and empirical analysis was conducted through related variables. The analysis results are summarized in three categories as follows. First, this research finds that state-controlled firms (CONTs) prefer income smoothing activities compared to non-state-controlled firms for the long-term sustainable development of firms using data from 2011 to 2019. Second, this study found out that Institutional investors support the behavior of CONTs to smooth their earnings because this behavior is seen as an attempt by CONTs to convey valuable private information to other investors. Third, we was able to discover that institutional investors' monitoring effect is predominantly driven by pressure-resistant institutional investors. This research complements the lack of empirical research on income smoothing and enable to give a guideline that the type of stock rights is a critical key determinant of participation in income smoothing activities for stable growth and sustainability in the future.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

The shape of the knee is a chain-like structure of an ellipsoid. This suggests that, in the latest study, in addition to rolling, there is slippage in the motion of the knee. This paper selects a mechanical braking model for cattle based on two mechanical structures in different directions at the joints. The experimental results show that the modified dynamical system has strong chaotic properties. This can be one of the basis for judging various health states.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Based on the major, trace element, and isotope data of the Cenozoic basalts in the study area, it is indicated that the basalts in this region can be classified into three distinct magma systems: alka-li basalts, tholeiite basalts, and Nushan alkali basalts. The geochemical characteristics observed in the studied basalts indicate that the mantle source in this region might have experienced met-asomatic processes prior to partial melting, which could be linked to an ancient subduction pro-cess. Combining the geochemical characteristics in the studied basalts with previous research, we propose that the underlying mantle source in Anhui province may have undergone metaso-matism due to the carbonatitic melts. These melts are believed to have originated from car-bonated eclogite, derived from subducted Pacific slab materials present in the deeper mantle. According to the Sr-Nd isotope data, it is suggested that the mantle source in the Nushan region could be derived from a depleted asthenospheric mantle, while the basaltic composition in the Niugang area may be representative of the mantle's end components associated with the EM-I enriched mantle source present in this study area. Therefore, we propose that the Anhui basalts may have originated from the partial melting of a mantle source representing a mixing of two end-members: DMM (Depleted MORB Mantle) and EM-Ⅰ (Enriched Mantle 1). The Anhui basal-tic magmas may have originated from the partial melting of EM-Ⅰ, potentially influenced by upwelling asthenospheric mantle or asthenospheric diapirism processes. The mantle source in the study area experiences partial melting at 1-5%, 15%, and 1-10%, resulting in the formation of parent magmas for alkali basalt, tholeiitic basalt, and Nushan alkali basalt. Subsequently, the parent magmas experienced fractional crystallization processes, which included minerals like olivine, pyroxene, and plagioclase. This led to the formation of various types of basalt in the study area.

Spider silk has excellent strength and elasticity in natural, researchers have been working for decades try to achieve natural spider silk outstanding mechanical properties using recombinant spider silk protein (spidroin) through artificial spinning. In this work, we chose wet spinning method to explore the relationship between concentration of coagulation bath and fiber performance. It was found that the concentration of methanol has important effect on fiber continuity, diameter and mechanical properties. Lower concentration favors spinning continuous thinner, fibers with high strain. Secondary stretching benefits spinning silk fibers with stable mechanical properties, and thermal stability. Through applying different methanol concentration and additional stretching, we obtained silk fibers with Young’s modulus of 3.052± 2.626 GPa, stress of 25.3944 ± 17.48 MPa, and strain of 140 ± 95.4%.

The essence of cross-modal generation and retrieval modeling for image-text interactions lies in semantic consistency. Among these, cross-modal representation alignment serves as the foundational requirement for achieving cross-modal semantic consistency. The crux of our proposed method entails the collaborative training of an image captioning model(referred to as the ’captioner’) and a pair of contrastive encoders for image-text matching(referred to as the ’concoder’). This synergistic approach yields concurrent enhancements in concoder’s performance, captioner’s proficiency, and cross-modal semantic coherence. We coin the proposed method as ‘ReCap’. To begin, we initialize the concoder through knowledge distillation from a pre-trained model. During the training process, we use the output of the initialized concoder as input to a residual attention network, jointly training it with the captioner to achieve semantic consistency. Subsequently, we iteratively update the concoder during the image-text momentum encoding phase using the residual attention network, creating a closed-loop for semantic consistency resolution. Upon completion of training, the concoder and captioner modules can be used independently to perform tasks related to cross-modal retrieval and cross-modal generation of text and images. In order to substantiate the efficacy of our proposed method, we initially conducted empirical experiments encompassing image-text retrieval and image captioning tasks, employing a widely recognized benchmark dataset, MSCOCO. Subsequently, we assessed the fine-grained cross-modal alignment performance of the concoder through an image classification task on the iNaturalist 2018 dataset. The achieved performance metrics notably surpassed those achieved by several incumbent state-of-the-art models, thus validating the proficiency of our method. Finally, motivated by the practical requirements of handling the nature conservation image data, we performed caption annotation for the iNaturalist 2018 dataset. Subsequently, we trained the ReCap on this annotated data. Experimental results demonstrate that our proposed method can maintain semantic consistency between cross-modal retrieval and image caption generation for species with similar visual features but distinct semantics. This achievement signifies a meaningful exploration in the field of cross-modal semantic consistency representation, holding significant practical value in the domain of biological research.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Molybdenum tailings powder (MTs) is an industrial waste that contains more than 85% contents of SiO2, Al2O3, CaO, and Fe2O3. Therefore, MTs has the potential pozzolanic activity and can be used as a mineral admixture in cementitious materials. In order to understand the influence of MTs as an admixture on the cement hydration process, the hydration heat and hydration kinetics of the composite cementitious materials (CCMs) were investigated by an isothermal calorimeter and the Krstulovic-Dabic model. Furthermore, the influences of fly ash (FA), slag (SL) and MTs on hydration heat at the same content were compared and analyzed. Results show that proper amount of MTs can promote the hydration of CCMs. When the content of MTs is not more than 15%, the second exothermic peak of CCMs appears earlier and the peak heat release increases. However, when the content of MTs exceeds 15%, the second exothermic peak of CCMs is delayed and the peak heat release decreases. The cumulative heat release of CCMs gradually decreases with an increasing content of MTs. When the replacement of MTs, FA, and SL is 15% respectively, the addition of MTs enhances the second exothermic peak of CCMs compared to FA and SL. The final heat release of MTs is higher than that of FA, but lower than that of SL. The hydration process of CCMs undergoes three stages: nucleation and crystal growth (NG), interactions at phase boundaries (I), and diffusion (D). The incorporation of MTs shortens the NG stage and I stage.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Orchids are often a mystery because of their close and complex relationships with various microorganisms in the natural environment. Orchids rely on microorganisms to obtain nutrients, affecting their seed germination, protocorm, and adult plant growth. Currently, the majority of relevant research is concentrated on isolating and identifying environmental microorganisms that support orchid development and growth. With the development of metagenomic technology, our understanding of orchid mycorrhizal fungi (OMF) and root-associated bacteria (RAB) has been expanded. New research results and discoveries have emerged, which require a comprehensive assessment to provide a reference for studying microorganisms related to orchids. Therefore, we present a comprehensive summary, identifying significant inadequacies of present methodologies while providing ideas for further research.

Late onset Pompe disease is a recessive lysosomal storage disease. Clinical features include skeletal muscles deficiency and diaphragm weakness. Clinical management relies on supportive treatment and mechanical ventilation in patents with chronic respiratory failure. M mode ultrasound and tissue Doppler imaging can be used to assess and to follow up diaphragm function.

Regeneration of biological tissues in medicine is challenging, and 3D bioprinting offers an innovative way to create functional multicellular tissues. One common way in bioprinting is bioink which is one type of the cell-loaded hydrogel. For clinical application, however, the bioprinting still suffers from satisfactory performance, e.g. in vascularization, effective antibacterial, immunomodulation and regulation of collagen deposition. Many studies have incorporated different bioactive materials into the 3D printed scaffolds to optimize the bioprinting. Here, we review a variety of additives added to the 3D bioprinting hydrogel. The underlying mechanisms and methodology for biological regeneration are important and will provide useful basis for future research.

Calcineurin plays a key role in cardiovascular pathogenesis by exerting pro-apoptotic effects in cardiomyocytes; however, its involvement in the regulation of cardiomyocyte autophagy under chronic intermittent hypoxia (CIH) remains largely unknown. Here we showed that CIH induced calcineurin activity in H9C2 cells, resulting in the attenuation of adenosine monophos-phate-activated protein kinase (AMPK) signaling and inhibition of H9C2 cell autophagy. Au-tophagy, LC3-II levels, and AMPK phosphorylation were significantly elevated in response to CIH in H9C2 cells by day 3; however, these effects were reversed, and calcineurin activity and apoptosis were significantly increased by day 5. The calcineurin inhibitor, FK506, restored AMPK activation and LC3 protein levels, and reduced CIH-induced H9C2 cell apoptosis, while calcineurin overexpression significantly attenuated the increase in LC3 levels and enhanced H9C2 cell apop-tosis. Calcineurin inhibition failed to induce autophagy or alleviate apoptosis in H9C2 cells ex-pressing a dominant negative K45R AMPK mutant. Autophagy downregulation abrogated the protective effects of FK506-mediated calcineurin inhibition. These results indicated that calcineurin suppressed adaptive autophagy during CIH by downregulating AMPK activation. Our findings showed the underlying mechanisms of calcineurin and autophagy regulation during H9C2 cell survival in response to CIH, and suggested a new strategy for preventing CIH-induced cardiomyocyte damage.

The development of a method to produce coumarins unsubstituted on the pyranic nucleus catalyzed from Wells–Dawson heteropolyacid (H₆P₂W₁₈O₆₂), phenol derivatives and ethyl 3,3-diethoxypropionate using Pechmann condensation under solvent-free conditions is described. This catalytic method was also applied successfully to synthesize various substituted coumarins, including the corresponding phenols and ethyl 3,3-diethoxypropionate. This work provides a novel, cheaper and safer way to syhthesize coumarins unsubstituted on the pyranic nucleus.

This paper extends the concept of weighted graphs to matrix weighted graphs. The consensus algorithms dictate that all agents reach consensus when the weighted graph is connected. However, it is not always the case for matrix weighted graphs. The conditions leading to different types of consensus have been extensively analysed based on the properties of matrix-weighted Laplacians and graph theoretic methods. However, in practice, there is concern on how to pick matrix-weights to achieve some desired consensus, or how the change of elements in matrix weights affects the consensus algorithm. By selecting the elements in the matrix weights, different clusters may be possible. In this paper, we map the roles of the elements of the matrix weights in the systems consensus algorithm. We explore the choice of matrix weights to achieve different types of consensus and clustering. Our results are demonstrated on a network of three agents where each agent has three states.

Fabry-Pérto (FP) cavity is the essential component of ultra-stable laser (USL) for gravitational wave detection, which couples multi-physic (Optical/Thermal/Mechanics) fields and requires ultra-high precision. To satisfy the requirements of precise and efficient design, a multi-physic coupling optimization method for fixing cubic FP cavity based on data learning is proposed. A multi-physic model for the cubic FP cavity is established and the performance is obtained by finite element analysis. The key performance indices (V, wF, wF) and key design variables (d, l, F) are determined considering the features of the FP cavity. The 49 sets of data by orthogonal experiment are acquired for the establishment and comparison of different data learning models (NN, RSF, KRG). The result turns out that the neural network has the best performance. Based on NSGA-II, the Pareto optimal front is obtained and the optimal combination of design variables is finally determined as {5,32,250}. The performance after optimization has proven to be a great improvement, of which the displacement under the fixing force and vibration test are decreased by more than 60%. The optimization strategy can not only help the design of the FP cavity but also enlighten other optimization fields.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

In March 2013, a novel avian influenza A H7N9 virus was emerged in China, which cause rapidly progressive pneumonia and with a high fatality rate. Serologic studies to evaluate neutralizing antibodies of infected patients and birds are invaluable tools for immunogenicity research of H7N9 and epidemiological investigation. Conventional neutralization assays are laborious and time-consuming which also hampered by biosafety requirement. In this study, We construct and produce pseudovirus bearing the full-length hemagglutinin (HA) of H7N9 virus in the Env-defective, luciferase-expressing HIV-1 backbone. The production of lentiviral pseudovirus was analysed by HA gene specific real-time reverse-transcription PCR, transmission electron microscopy (TEM), and Western Blot assay to prove the nucleic acid replication, the morphology of virus, and the expression of HA protein in pseudovirus. After that pseudovirus based inhibition assay was established to detect neutralizing antibodies of a panel of serum samples. Our results demonstrated that H7N9 pseudovirus which had single-cycle infection was generated. By comparing the neutralization antibody titers, pseudovirus based neutralization test could be recognized as an alternative of conventional microneutralization (MN). Hence, we conclude that it is possible to use pseudovirus inhibition assay to screen sera samples, as well as evaluate vaccine-induced neutralizing antibodies against H7N9 virus.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

Abstract Background: Parkinson's disease (PD) is a neurodegenerative disorder featured with motor and non-motor deficits. Using 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) induced dopamine neuron degeneration has been widely used to produce reliable animal models of the PD. However, most of previous preclinical studies focused on the motor dysfunctions, few non-motor symptoms were evaluated. So far there is a lack of comprehensive investigation of the non-motor symptoms in animal models. Objectives: In this study, we aim to use a battery of behavioral methods to evaluate the non-motor symptoms in MPTP-induced non-human primate PD models. Methods: Cognitive functions, sleep and psychiatric behaviors were evaluated in MPTP-treated cynomolgus monkeys. The tests consisted of delayed matching-to-sample (DMTS), physical activity monitor (PAM), apathy feeding task (AFT), human intruder test (HIT), novel fruit test (NFT) and predator confrontation test (PCT). In addition, we tested whether the dopamine receptor agonist pramipexole (PPX) will improve these non-motor symptoms. Results: The present results show that the MPTP-treated monkeys exhibited cognitive deficits, abnormal sleep, and anxiety-like behaviors as compared to the control monkeys. These symptoms were relieved partially by PPX. Conclusions: These results suggest that MPTP-induced PD monkeys displayed non-motor symptoms that were similar to those found in PD patients. PPX treatment showed moderate therapeutic effects on these non-motor symptoms. This battery of behavioral tests may provide a valuable model for future preclinical research.

A novel metal-doped carbon quantum dot, zinc-chlorine co-doped carbon quantum dots (Zn/Cl-CQDs), has been developed for the fluorescent probe detection of vitamin B2 and the analysis of the correlation properties of this carbon quantum dot and vitamin B2. Stability experiments demonstrate that Zn/Cl-CQDs possess good fluorescence properties under alkaline conditions. However, when vitamin B2 is added into Zn/Cl-CQDs, the fluorescence intensity decreases sharply, indicating that a fluorescence quenching phenomenon occurs between vitamin B2 and Zn/Cl-CQDs. Lastly, the use of Zn/Cl-CQDs in the detection of vitamin B2 tablets and vitamin B2-rich fruits resulted in recovery rates of 98.2% and 100.6%, respectively. Therefore, this method can be well applied to the detection and analysis of vitamin B2, and has great development prospects in the pharmaceutical industry and food monitoring fields.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

With the increase of global human activities, a large number of technogenic magnetic particles (TMPs) generated by industrial activities such as coal combustion, traffic and so on enter sediments on continental shelves. However, there is currently a lack of understanding of the spatiotemporal distribution of TMPs on continental shelves, as well as the sedimentary effects they cause. This review work comprehensively analyzes the source, morphology, composition, and spatiotemporal distribution characteristics of TMPs. Then it elucidates their magnetic contribution to sedimentary environments in continental shelf seas, as well as the influence of heavy metals and active iron. At the same time, the existing problems and future development directions of TMPs on continental shelves are summarized.

Bipolar disorder is a severe mood disorder and is one of the top 20 reasons of disability in the world. It causes a huge burden on society. In this study, the prediction models of bipolar disorder were constructed based on the concept of knowledge distillation. The input data consisted of patients of bipolar disorder and matched controls, all of which were selected from the open database MIMIC. The method of kernel density estimation (KDE) was exploited to generate probability density functions (PDF) which identify distributions of input data. The PDF values referred to as the soft labels were combined with the input data to construct the prediction models of bipolar disorder using decision tree and artificial neural network respectively. According to the evaluation results, indicators for identifying positive samples of bipolar disorder were improved. Meanwhile, the indicators for identifying negative samples have also been advanced. In addition, the branching attributes selected by the decision trees can be mapped back to specific disease diagnoses, which are all associated with bipolar disorder. In conclusion, using KDE to generate the soft label information of the input data can make knowledge distillation work and has improved the performances of prediction models for bipolar disorder.

We present a method to study the interannual variability of the annual cycle. The method consists of first determining the amplitude and phase of segments of 12 monthly means at all spatial points, resulting in one complex number per grid point and per year. The complex fields, once per year, are then subject to a complex EOF (CEOF) analysis. We consider as an example the barotropic stream function in the South China Sea as simulated with an ocean general circulation model across 6 decades of years, driven my realistic (NCEP) weather forcing. We find 3 to 4 to “significant” CEOFs, which account for about 53 to 62% of variance. These CEOFs go with large-scale patterns. Their time coefficients are mostly stationary, but point to some inhomogeneities related to instationarities in the forcing. In particular, the simulation since 1950-1958 deviates from the remainder of the simulation. The first CEOF describes variations in the center of the South China Sea. Its principal component describes a systematic, albeit noisy shift by almost 180o from 1960 to about the year 2000. When overlaid the long-term mean annual mean, the overall change consists of an amplification of the annual cycle in the 1960s and 1990s, whereas In the 1970s, the amplitude was reduced. Phase shifts in the anomaly (given by the CEOFs) have a small effect, because of the dominance of the mean annual cycle. These variations are not related to ENSO variability but may origin in variations of the Southeast monsoon. The second EOF represents strong changes, both in terms of intensity and phase, in the Luzon strait.

Panax ginseng C. A. Meyer (P. ginseng), has been widely used in traditional Chinese medicine (TCM). It contains a number of chemical components and possesses a variety of pharmacological activities. Alzheimer's disease (AD) is neurodegenerative disease that creates a huge burden on the lives and health of individuals. In recent years, studies have indicated that the chemical components of P. ginseng, especially ginsenosides, play a pronounced positive role in the prevention and treatment of neurological diseases. This review aimed to summarize currently studies on chemical components and the mechanisms action in AD intervention treatment of P. ginseng, especially ginsenosides. In this review, the components of P. ginseng and their respective active effects were first introduced. Then the key molecular mechanisms and signaling pathways of P. ginseng were introduced, and its different active ingredients in the prevention and treatment of Alzheimer's disease-related pathogenesis were also summarized from the pathogenesis of AD Aβ generation and aggregation, hyperphosphorylation of tau protein，oxidant stress，neuroinflammation，mitochondrial damage，disorder of neurotransmitter and gut microbiota. Signaling pathway networks related to the action of ginseng active ingredients was constructed, which could serve as a therapeutic target for Alzheimer's disease. In addition to a detailed report on P. ginseng in improving Alzheimer's disease-related pathogenesis, the application of the current technology, spatial metabonomics in AD therapeutics and diagnostics were later discussed. Spatial metabonomics could be applied to investigate the multi-target intervention of P. ginseng on Alzheimer's disease. Research perspectives for the study of P. ginseng in the treatment of Alzheimer's disease were provided for further studies.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

Using the Super-SBM method, this study calculates the carbon emission efficiency (CEE) of 30 provinces in mainland China from 2011 to 2019. Then, using the systematic GMM model, spatial Durbin model, and mediating effect model, it examines the direct effect, spatial effect, and influence mechanism of the digital economy (DE) on CEE. It was found that (1) the DE significantly promoted regional CEE, but had a negative effect on CEE in provinces with high economic correlation; (2) mechanism studies showed that the DE improved CEE by reducing energy intensity, promoting industrial upgrading and green technology innovation; (3) regional heterogeneity analysis found that the DE significantly improved CEE in eastern provinces, but not in central and western provinces. DE improves CEE in provinces with high level of economic development, but decreases CEE in provinces with low level of economic development.This paper provides some empirical and theoretical references for the development of DE to improve CEE.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The porous structure is an important three-dimensional morphological feature of the peripheral nerve guidance conduit (NGC), which permits infiltration of cells, nutrients, and molecular signals, and the discharge of metabolic waste. Porous structures with precisely customised pore sizes, porosities, and connectivities were used to construct fully permeable, semi-permeable, and asymmetric peripheral NGCs to replace traditional nerve autografts in treatment of long-segment peripheral nerve injury. In this review, the features of porous structures and classification of NGCs based on these characteristics are discussed. Common methods for constructing 3D porous NGCs in current research are described, as well as the pore characteristics and the parameters used to tune the pores. The effects of the porous structure on the physical properties of NGCs including biodegradation, mechanical performance, and permeability were analysed. Pore structure affects the biological behaviour of Schwann cells, macrophages, fibroblasts, and vascular endothelial cells during peripheral nerve regeneration. Construction of ideal porous structures is a significant advancement in the regeneration of peripheral nerve tissue engineering materials. The purpose of this review is to generalise, summarise, and analyse the preparation methods for porous NGCs and their biological functions in promoting peripheral nerve regeneration to guide development of medical nerve repair materials.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

Alzheimer’s disease and related dementias (ADRD) remain a public health challenge in developing counties. We developed a needs-based essential care service package (ECSP) for care planning of persons living with dementia (PLWD) using a cross-sectional survey among PLWD in institutions in six cities in China (n= 1,299). Face-to-face interviews were conducted with caregivers of PLWD by trained staff between 2018 and 2019. Care service needs and utilization by the level of cognitive impairment were summarized. The average age of PLWD was 80.7 years. 76% of participants had severe cognitive impairment. The needs-based ECSP with 30 service items would be sufficient in supporting care services of PLWD in China, of which seven items are core care. The selection plan for ECSP at different levels is designed as “General Care Services + Selective Care Services”, in which service items for low-, mid-and high-level care for PLWD are 7+3, 7+6, and 7+10, respectively. The findings provide the first large-scale data on service needs and utilization of PLWD in mainland China. The ECSP for PLWD advanced in the paper was a practicable and effective quantitative management means. It is deserved to application in a large scale.

Background Hokkaido is the northernmost, least populous, and coldest of the Japanese islands. It was the first prefecture to be affected by COVID-19, while Kanagawa is home to one of the most populous areas of Japan, namely the Tokyo metro area. The Japanese government responded early during the pandemic by identifying infected patients, contact tracing, and performing PCR analysis on anyone who was suspected of having been exposed to SARS-CoV-2. The government has also been publishing information about each individual who tested positive for the virus. Both Hokkaido and Kanagawa started recording COVID-19 cases in the winter of 2020 and have detailed records of thousands of patients, thus providing an invaluable resource for the transmission and behavior of the virus. Methods The current study analyzed the COVID-19 registry data from the Hokkaido and Kanagawa prefectures. The Hokkaido registry contained 1,269 cases (674 (53%) females and 595 (47%) males) recorded between February 14 and July 22, 2020. The Kanagawa registry had 3,123 cases (1,346 (43%) females and 1,777 (57%) males. The final data contained a total of 4,392 cases (2,020 (46%) females and 2,372 (54%) males). By leveraging the information on viral transmission paths available in the registry data, we performed exponential random graph model (ERGM) network analysis to examine demographic and symptomological homophilies of the SARS-CoV-2 viral transmission networks. Results We observed age, symptomatic, and asymptomatic homophilies in both prefectures. Furthermore, those patients who contracted the virus through secondary or tertiary contacts were more likely to be asymptomatic than those who contracted it from primary infection cases. The transmission networks showed that transmission occurred significantly in healthcare settings, as well as in families, although the size of the networks was small in the latter. Most of the transmissions stopped at the primary and secondary levels and no transmission beyond quaternary was observed. We also observed a higher level of asymptomatic transmission in Kanagawa than in Hokkaido. Conclusions Symptom homophilies are an important component of COVID-19 and suggest that nuanced genetic differences in the virus may affect its epithelial cell type range and can thus result in the diversity of symptoms seen in individuals infected by SARS-CoV-2. Moreover, environmental variables such as temperature and humidity may also be playing an important role in the overall pathogenesis of the virus.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

The assessment of concrete structures' durability in chlorine environments is significantly impacted by the uncertainty inherent in existing durability models. It introduce an integrated approach for updating these models, based on detection information of existing structures. This approach narrows the gap between theoretical predictions and observed structural durability. Specifically, we refine the probability model of critical chloride content by analyzing steel bar corrosion sample proportions, using Bayesian theory for greater accuracy. The enhanced model enables more reliable life expectancy prediction, forming a solid foundation for maintaining and strengthening existing structures.This method was demonstrated through a case study of a reinforced concrete industrial building with a service life of 12 years.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

With the development of artificial intelligence, the ability of capturing the background characteristics of hyperspectral imagery (HSI) is improved and promising performance in hyperspectral anomaly detection (HAD) tasks is yielded. However, existing methods proposed in recent years still suffer from certain limitations: 1) constraints are lacking in the deep feature learning process in terms of the issue for absence of prior background and anomaly information. 2) hyperspectral anomaly detectors with traditional self-supervised deep learning methods fail to ensure prioritized reconstruction of the background. 3) architectures of fully connected deep network in hyperspectral anomaly detectors lead to low utilization of spatial information and destruction for original spatial relationship of hyperspectral imagery, and disregard spectral correlation between adjacent pixels. 4) hypotheses or assumptions for background and anomaly distributions restrict the performance of many hyperspectral anomaly detectors because the distributions of background land covers are usually complex and not assumable in real-world hyperspectral imagery. With the consideration of above problems, in this paper, we propose a novel fully convolutional auto-encoder based on dual clustering and latent feature adversarial consistency (FCAE-DCAC) for HAD which is carried out in a self-supervised learning-based processing. Firstly, the density-based spatial clustering of applications with noise algorithm and connected component analysis are utilized for successive spectral and spatial clustering to obtain more precise prior background and anomaly information, which facilitates the separation between background and anomaly samples during the training of our method. Subsequently, a novel fully convolutional auto-encoder (FCAE) integrated with spatial-spectral joint attention (SSJA) is proposed to enhance the utilization of spatial information and augment feature expression. In addition, a latent feature adversarial consistency network is proposed to achieve pure background reconstruction with the ability of learning actual background distribution in hyperspectral imagery. Finally, a triplet loss is introduced to enhance the separability between background and anomaly, and the reconstruction residual serves as the anomaly detection result. We evaluate the proposed method on seven groups of real-world hyperspectral datasets, and the experimental results confirmed the effectiveness and superior performance of the proposed method versus nine state-of-the-art methods.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

The paper is concerned with a class of stochastic differential equations in infinite dimensional Hilbert space with random coefficients driven by Teugel's martingales which are more general processes. and its optimal control problem. Here Teugels martingales are a family of pairwise strongly orthonormal martingales associated with L\'{e}vy processes (see Nualart and Schoutens). There are three major ingredients. The first is to prove the existence and uniqueness of the solutions by continuous dependence theorem of solutions combining with the parameter extension method. The second is to establish the stochastic maximum principle and verification theorem for our optimal control problem by the classicconvex variation method and dual technique.The third is to represent an example of a Cauchy problem for a controlled stochastic partial differential equation driven by Teugels martingales which our theoretical results can solve.

The present study examined and compared the effects of high- and low-molecular weight (MW) chitosan, a nutraceutical, on intestinal and liver lipid metabolism in rats fed with high-fat diet. Both high- and low-MW chitosan decreased liver weight, elongated small intestine, improved the dysregulation of blood lipids and liver fat accumulation, and increased fecal lipid excretion in high-fat diet-fed rats. Supplementation of both high- and low-MW chitosan significantly inhibited the decreased phosphorylated AMP-activated protein kinase (AMPK)α and peroxisome proliferator-activated receptor (PPAR)α protein expressions and the increased lipogenesis/cholesterogenesis-associated protein expressions (sterol regulatory element binding protein (SREBP)1c, SREBP2, and PPARγ) and the decreased apolipoprotein (Apo)E and microsomal triglyceride transfer protein (MTTP) protein expressions in the livers of high-fat diet-fed rats. Both high and low-MW chitosan supplementation could also suppress the increased MTTP protein expression and the decreased angiopoietin-like protein (Angptl)4 protein expression in the intestines of high-fat diet-fed rats. Comparison between high and low-MW chitosan, high-MW chitosan has a higher efficiency than low-MW chitosan on the inhibition of intestinal lipid absorption and the increase of hepatic fatty acid oxidation, which can improve liver lipid biosynthesis and accumulation.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

The fluctuations in both time and space of the fish larvae community in relation to hydrographic characteristics in the waters surrounding the Taiwan Bank were studied in October 2021 (autumn) and March 2022 (spring). Throughout the study period, we identified a total of 149 taxa of fish larvae, encompassing 96 genera and 71 families. Engraulis japonicus, Diaphus slender type, unidentified Gobiidae, Apogon sp., unidentified Clupeidae, and Benthosema pterotum were the six most dominant taxa, together constituted 47.39% of the total catch. No significant temporal difference in abundance of fish larvae was found, but the species number of fish larvae was more diverse in spring than in autumn. There was a notable difference in species composition between the cruises, and the cluster analysis unveiled a distinct temporal structure in the assemblage of fish larvae. The dynamics of prevailing currents induced by seasonal monsoons play an important role in the transport of fish larvae. The distribution of fish larvae was closely linked to hydrographic features, where seawater temperature and salinity emerged as the primary explanatory factors influencing the composition of fish larvae assemblages in the waters surrounding the Taiwan Bank. While the increased influx of nutrients from upwelling ensures abundant food availability, the hydrographic conditions may not be suitable for every fish larva.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

The use of spherical radial basis functions (SRBFs) in regional gravity field modeling has become popular in recent years. However, to our knowledge, their potential for combining gravity data from multiple sources, particularly data with different spectrum information in the frequency domain, has not been extensively explored. Therefore, band-limited SRBFs, which have good lo-calization characteristics in the frequency domain, are the main tool in this study. We propose a residual and a-prior accuracy comparative analysis method to determine the optimal degree of expansion of SRBFs for gravity data. Using this methodology, we constructed a high-resolution geoid model called ColSRBF2023 in Colorado. The degrees of expansion for terrestrial and airborne data were set to 5200 and 1840, respectively. Results indicate that ColSRBF2023 has a standard deviation (STD) value of 2.3 cm compared to the GSVS17 validate data. This value is 2-6 mm lower than models obtained using different degrees of expansion for gravity data and models from other institutions considered in this study. Additionally, at the 1'×1' grid in the entire target area, ColSRBF2023 has an STD value of 2.4 cm when compared to the validation model. This value is also the best among the options examined in this study. These findings highlight the importance of determining the optimal expansion degree of gravity data, particularly when constructing high-resolution gravity field models in rugged mountainous regions.

Defect recognition in ballastless track structures, based on distributed acoustic sensors (DASs), was researched in order to improve detection efficiency and ensure the safe operation of trains on high-speed railways. A line in southern China was selected, and equipment was installed and debugged to collect the signals of trains and events along it. Track vibration signals were extracted by identifying a train track, denoising, framing and labeling to build a defect dataset. Time–frequency-domain statistical features, wavelet packet energy spectra and the MFCCs of vibration signals were extracted to form a multi-dimensional vector. An XGBoost model was trained and its accuracy reached 89.34%. A time-domain residual network (ResNet) that would expand the receptive field and test the accuracies obtained from convolution kernels of different sizes was proposed, and its accuracy reached 94.82%. In conclusion, both methods showed good performance with the built dataset. Additionally, the ResNet delivered more effective detection of DAS signals compared to conventional feature engineering methods.

Several specific types of ordinary and generalized separation axioms of a generalized topological space have been defined and investigated for various purposes from time to time in the literature of topological spaces. Our recent research in the field of a new class of generalized separation axioms of a generalized topological space is reported herein as a starting point for more generalized classes.

The extant Keteleeria is endemic to East and Southeast Asia, while it is widely distributed in the northern hemisphere in Earth’s history. In this paper, we reported a novel wood fossil of Keteleerioxylon changchunense Shi, Sun, Meng et Yu sp. nov. collected from the middle member of Yingcheng Formation, Yingcheng Coal Mine, Changchun City, Jilin Province, Northeast China. The quantitative growth-ring analyses of K. changchunense indicate that it was evergreen and its leaf longevity was 1-3 years, which is consistent with the foliar retention of extant Keteleeria. Its high ring markedness index (RMI) indicates that the climate seasonality was pronounced during the early Albian in Songliao Basin, Northeast China. The fossil records of Keteleeria and closely related taxa indicate that this group might originate in Northeast China, spread and migrated northward during the Cretaceous, gradually decreased in the Cenozoic, and so far only survives in East and Southeast Asia.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

This paper proposes a new approach for multi-focus images fusion based on Region Mosaicing on Contrast Pyramids (REMCP). A density-based region growing method is developed to construct a focused region mask for multi-focus images. The segmented focused region mask is decomposed into a mask pyramid, which is then used for supervised region mosaicking on a contrast pyramid. In this way, the focus measurement and the continuity of focused regions are incorporated and the pixel level pyramid fusion is improved at the region level. Objective and subjective experiments show that the proposed REMCP is more robust to noise than compared algorithms and can fully preserves the focus information of the multi-focus images meanwhile reducing distortions of the fused images.

Transcription factors (TFs) are crucial in modulating gene expression and sculpting cellular and organismal phenotypes. The identification of TF-target gene interactions is pivotal for comprehending molecular pathways and disease etiologies but has been hindered by the demanding nature of traditional experimental approaches. This paper introduces a novel web application, utilizing the R programming language, which predicts TF-target gene relationships and vice versa. Our application integrates the predictive power of various bioinformatic tools, leveraging their combined strengths to provide robust predictions. It merges databases for enhanced precision, incorporates gene expression correlation for accuracy, and employs pan-tissue correlation analysis for context-specific insights. The application also enables the integration of user data with established resources to analyze TF-target gene networks. Despite its current limitation to human data, it provides a platform for exploring gene regulatory mechanisms comprehensively. This integrated, systematic approach offers researchers an invaluable tool for dissecting the complexities of gene regulation, with the potential for future expansions to include a broader range of species.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

As an important carrier of urban residents' public life, urban public open space plays an indispensable role in improving the quality of life of urban residents. Accessibility is an important indicator to characterize the publicity and service level of a public open space. This study optimized the GIS-based, Gaussian two-part mobile search method to quantitatively calculate and evaluate the accessibility of public open space within a 5-minute walking distance for residents in Nanshan District, Shenzhen. On this basis, social survey methods, including the questionnaire survey method via a field survey and the interview method, were used to conduct field research on residents' accessibility satisfaction. Comparing the results of the survey on residents' accessibility satisfaction to the GIS quantitative evaluation results of accessibility, the results of the field research show that current residents of Nanshan are more satisfied with the accessibility of public open space. In view of the similarities and differences between the two sets of results, the influencing factors of public open space accessibility were analyzed, corresponding countermeasures were proposed for the construction of public open spaces in the future.

In this paper, we investigate the new degenerate Daehee polynomials and numbers which are called the degenerate Daehee polynomials of the second kind, and derive some new and interesting identities and properties of those polynomials.

Abstract: (1) Background: The occurrence of youth aggression has aroused widespread concern, and we would like to explore the reasons for it from both the family and individual sides of the youth. This study constructed a chain mediation model based on Bandura's Social Learning Theory to explore the mechanism of internet gaming disorder and avatar identification in it; (2) Methods: We conducted a randomized survey involving 973 adolescents from various middle schools in China. We used the Harsh Parenting Scale, the Online Gaming Disorder Scale, the Incarnate Identity Scale, and the Buss-Perry Aggression Scale to conduct a randomized survey. Empirical analyses were conducted using SPSS 25.0 and Amos 24.0 software to examine the mediating role of online gaming barriers and avatar identity; (3) Results: There was a two-by-two significant positive correlation between harsh parenting, internet gaming disorder, avatar identification and aggression. The me-diation model between harsh parenting, internet gaming disorder, avatar identification and ag-gression was well fitted ( χ2/df=7.268, GFI=0.961, AGFI=0.923, IFI=0.970, CFI=0.970, TLI=0.951, RMSEA=0.080).; (4) Conclusions: Parental harsh parenting affects adolescent aggression not only through the separate mediating roles of internet gaming disorder and avatar identification, but also through the chain mediating roles of internet gaming disorder and avatar identification.

Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.