This paper explores the application of wavelet analysis, a multiscale approach for enhancing visual clarity, in the context of image denoising, which reduces the impact of noisy pixels, caused by various factors such as electronic sensor limitations, low-light conditions, or transmission errors in digital imaging systems. This paper introduces some common noise types like Gaussian noise and processes of image denoising, eliciting the strength of wavelet analysis. As a powerful image denoising technology, wavelet analysis needs five steps to process the image, and the key step is thresholding. There are many kinds of wavelet, and each wavelet has different advantages and functions, which makes it suitable for different applications. Hence, wavelet analysis also makes a contribution in various fields beyond signal processing and data analysis, such as Biomedical Imaging and Geophysics and Seismology, where preserving image quality is essential for accurate analysis and interpretation. In short, this research highlights the promise of wavelet analysis, emphasizing the use of high- quality image data.

We aimed to evaluate the protective effects of acetyl-xylogalactan on the activity of RAW264.7 macrophages against heat stress. To this end, we assessed cell survival, phagocytic activity, in-tracellular Ca2+ level, mitochondria potential exchange, apoptotic assay findings, galactosidase activity and the RNA-seq by NGS and real-time polymerase chain reaction (PCR) expression. In our evaluation of macrophage morphology at 37°C and 41°C, the macrophages showed an oval shape at 41°C , unlike the spindle shape at 37°C. Therefore, 41°C was chosen as the heat stress condition. Subsequently, we designed an experiment to evaluate changes in the RAW264.7 macrophages after acetyl-xylogalactan treatment under heat stress. The survival of RAW264.7 macrophages treated with acetyl-xylogalactan was higher than that of controls that were not treated with acetyl-xylogalactan. Moreover, on the basis of the results of the annexin-V detection assay, the apoptotic activity of macrophages appeared to have reduced after treatment with ac-etyl-xylogalactan. Moreover, treatment with acetyl-xylogalactan resulted in a stronger recovery trend in the intracellular Ca2+ and mitochondrial membrane potential after heat stress. RNA sequencing and real-time polymerase chain reaction (PCR) illustrated that Sarcodia suieae acetyl-xylogalactan could upregulate the expression of the anti-apoptosis Cflar gene and down-regulate the expression of the apoptosis factors Ddit3, and Hyou1 to protect macrophages under heat stress.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

A novel metal-doped carbon quantum dot, zinc-chlorine co-doped carbon quantum dots (Zn/Cl-CQDs), has been developed for the fluorescent probe detection of vitamin B2 and the analysis of the correlation properties of this carbon quantum dot and vitamin B2. Stability experiments demonstrate that Zn/Cl-CQDs possess good fluorescence properties under alkaline conditions. However, when vitamin B2 is added into Zn/Cl-CQDs, the fluorescence intensity decreases sharply, indicating that a fluorescence quenching phenomenon occurs between vitamin B2 and Zn/Cl-CQDs. Lastly, the use of Zn/Cl-CQDs in the detection of vitamin B2 tablets and vitamin B2-rich fruits resulted in recovery rates of 98.2% and 100.6%, respectively. Therefore, this method can be well applied to the detection and analysis of vitamin B2, and has great development prospects in the pharmaceutical industry and food monitoring fields.

Panax ginseng C. A. Meyer (P. ginseng), has been widely used in traditional Chinese medicine (TCM). It contains a number of chemical components and possesses a variety of pharmacological activities. Alzheimer's disease (AD) is neurodegenerative disease that creates a huge burden on the lives and health of individuals. In recent years, studies have indicated that the chemical components of P. ginseng, especially ginsenosides, play a pronounced positive role in the prevention and treatment of neurological diseases. This review aimed to summarize currently studies on chemical components and the mechanisms action in AD intervention treatment of P. ginseng, especially ginsenosides. In this review, the components of P. ginseng and their respective active effects were first introduced. Then the key molecular mechanisms and signaling pathways of P. ginseng were introduced, and its different active ingredients in the prevention and treatment of Alzheimer's disease-related pathogenesis were also summarized from the pathogenesis of AD Aβ generation and aggregation, hyperphosphorylation of tau protein，oxidant stress，neuroinflammation，mitochondrial damage，disorder of neurotransmitter and gut microbiota. Signaling pathway networks related to the action of ginseng active ingredients was constructed, which could serve as a therapeutic target for Alzheimer's disease. In addition to a detailed report on P. ginseng in improving Alzheimer's disease-related pathogenesis, the application of the current technology, spatial metabonomics in AD therapeutics and diagnostics were later discussed. Spatial metabonomics could be applied to investigate the multi-target intervention of P. ginseng on Alzheimer's disease. Research perspectives for the study of P. ginseng in the treatment of Alzheimer's disease were provided for further studies.

The poor oxidation resistance of refractory high-entropy alloys (RHEAs) is a major obstacle for their use in high-temperature engineering applications. Anti-oxidation coating technology is an effective method for improving the oxidation resistance. In this paper, the Si-20Cr-20Fe coating was prepared on MoNbTaTiW RHEA by a fused slurry method. The microstructural evolution and compositions of the silicide coating under high-temperature oxidation environment were studied. The results show that the silicide coating could effectively prevent the oxidation of the MoNbTaTiW RHEA. The initial silicide coating had a double-layer structure; a high silicon-content layer mainly composed of MSi2 as the outer layer and a low silicon-content layer mainly contained M5Si3 as the inner layer. Under high-temperature oxidation conditions, the silicon element diffused from the silicide coating to the RHEA substrate while the oxidation of the coating occurred. After oxidation, the coating was composed of an outer oxide layer and an inner silicide layer. The silicide layer moved toward the inside of the substrate, led to the increase of its thickness. Compared with the initial silicified layer, its structure did not change significantly. The structure and compositions of the oxide layer on the outer surface strongly depended on the oxidation temperature. This paper provides a strategy for protecting RHEAs from oxidation at high-temperature environments.

(1) Background: The rapid development of information technology has changed the traditional concept of space, gradually shifting the "container space" to the "relational space" . The constraints of geographical spatial elements are diminishing, and the theory of virtual agglomeration is gaining attention. (2) Methods: In this study, we constructed an evaluation system for virtual agglomeration, comprising four primary indicators: virtual infrastructure level, virtual output level, virtual input level, and virtual service level. The TOPSIS method was used to calculate the virtual agglomeration level for each province, and the DEA-Malmquist method was employed to measure provincial total factor productivity (TFP) in China. Using panel data from 30 provincial regions in China from 2013 to 2021, we examined the mechanism and impact path of virtual agglomeration on TFP. (3) Result: There is an inverted U-shaped relationship between virtual agglomeration and TFP in China. The overall development level of virtual agglomeration is relatively low, within the range where the marginal effect of virtual agglomeration on TFP is positive but diminishing, indicating significant potential for further development. The impact of virtual agglomeration on TFP is stronger in the Yangtze River Economic Belt compared to non-Yangtze River areas, and the highest stable point of TFP is higher in central provinces than in eastern and western provinces. (4) Conclusions: This study provides a theoretical basis and practical reference for improving the level of virtual agglomeration .

Tremor is a prevalent neurological disorder characterized by involuntary shaking or trembling of body parts. This condition impairs fine motor skills and hand coordination to varying degrees and can even affect overall body mobility. As a result, tremors severely disrupt the daily lives and work of those affected, significantly limiting their physical activity space. This study developed an innovative Spatial Augmented Reality (SAR) system aimed at assisting individuals with tremor disorders to overcome their physical limitations and expand their range of activities. The system integrates eye-tracking and Internet of Things (IoT) technologies, enabling users to smoothly control objects in the real world through eye movements. It employs a virtual stabilization algorithm for stable interaction with objects in the real environment. The study comprehensively evaluated the system's performance through three experiments: 1) assessing the effectiveness of the virtual stabilization algorithm in enhancing the system's ability to assist individuals with tremors in stable and efficient interaction with remote objects; 2) evaluating the system's fluidity and stability in performing complex interactive tasks; 3) investigating the precision and efficiency of the system in remote interactions within complex physical environments. The results demonstrate that the system significantly improves the stability and efficiency of interactions between individuals with tremor and remote objects, reduces operational errors, and enhances the accuracy and communication efficiency of interactions.

TiO2-based building materials have air purification, auto-cleaning and sterilization functions, and these innovative green building materials have great potential for energy-saving and emission reduction applications in the future. However, there are still great challenges in improving photocatalytic efficiency and stability from laboratory to practical applications. In recent years, researchers have done a lot of work to improve the efficiency and stability of TiO2-based building materials. This paper briefly discussed the air purification principle by photocatalytic building, and the preparation techniques of TiO2-based building materials and the strategies to improve the efficiency of TiO2. Moreover, this paper has outlined the key factors that affect the photocatalytic building performance in practical applications, and analyzed the limitations and future development trends. Finally, we proposed some suggestions for further research on photocatalytic buildings and its application in practice, aiming to provide an efficient reference for developing highly efficient and stable photocatalytic building materials. The aim of this paper is to provide effective guidance for the application of TiO2-based photo-catalysts in the field of green buildings, helping to develop more efficient and stable low-carbon buildings for the development of sustainable cities.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

Recent studies have proven that synthetic aperture radar (SAR) automatic target recognition (ATR) models based on deep neural networks (DNN) are vulnerable to adversarial examples. However, existing attacks are easily failed in the case where adversarial perturbations cannot be fully fed to victim models. We call this situation perturbation offset. Moreover, since background clutter takes up most of the areas in SAR images and has low relevance to recognition results, fooling models with global perturbations is quite inefficient. This paper proposes a semi-whitebox attack network, called Universal Local Adversarial Network (ULAN), to generate universal adversarial perturbations (UAP) for the target regions of SAR images. In the proposed network, we calculate the model’s attention heatmaps through layer-wise relevance propagation (LRP), which is used to locate the target regions of SAR images that have high relevance to recognition results. In particular, we utilize a generator based on the U-Net to learn the mapping from noise to UAPs and craft adversarial examples by adding the generated local perturbations to target regions. Experiments indicate that the proposed method fundamentally prevents perturbation offset and achieves comparable attack performance to conventional global UAPs by perturbing only a quarter or less of SAR image areas.

A detailed analysis of the dehydrogenation mechanism and reversibility of LiBH₄ doped by active Al* derived from AlH₃ was performed by thermogravimetry (TG), differential scanning calorimetry (DSC), mass spectral analysis (MS), powder X-ray diffraction (XRD), scanning electronic microscopy (SEM) and Fourier transform infrared spectroscopy (FTIR). The results show that the dehydrogenation of LiBH₄/Al* is a five-step reaction: (1) LiBH₄ + Al → LiH + AlB₂ + “Li-Al-B-H” + B₂H₆ + H₂; (2) the decomposition of "Li-Al-B-H" compounds liberating H₂; (3) 2LiBH₄ + Al → 2LiH + AlB₂ + 3H₂; (4) LiBH₄ → LiH + B + 3/2H₂; (5) LiH + Al → LiAl + 1/2H₂. And the reversibility of LiBH₄/Al* composite is based on equation as follows: LiH + LiAl + AlB₂ + 7/2H₂ ↔ 2LiBH₄ + 2Al. The extent of dehydrogenation reaction between LiBH₄ and Al* greatly depends on the precipitation and growth of reaction products (LiH, AlB₂ and LiAl, etc.) on the surface of Al*. A passivation shell of Al* formed by these products is the kinetic barrier to the dehydrogenation of LiBH₄/Al* composite.

Coal mining has caused a significant loss of nitrogen content of soil in mining areas. This article studies the effects of organic fertilizer, inorganic fertilizer, and combined application of Pseudomonas fluorescens with the ability of nitrogen fixation on soil nitrogen accumulation and composition in the reclamation area of Tunlan Coal Mine from 2016 to 2022 under the condition of equal nitrogen application, providing scientific basis for microbial fertilization and rapid increase of nitrogen content in the reclaimed soil of mining areas. The results showed that as the reclamation time increased, the nitrogen content and its composition structure of the soil treated with fertilization rapidly evolved towards normal farmland soil. The soil nitrogen content increased the fastest in the treatment of Pseudomonas fluorescens + organic fertilizer (MB), compared with inorganic fertilizer (CF), organic fertilizer (M), and Pseudomonas fluorescens + inorganic fertilizer (CFB) treatments, the treatment of Pseudomonas fluorescens + organic fertilizer (MB) can bring the total nitrogen (TN) content of the soil to normal farmland soil levels 1-3 years earlier. The comprehensive scores of Pseudomonas fluorescens + organic fertilizer (MB) and Pseudomonas fluorescens + inorganic fertilizer (CFB) on the two principal components were increased 1.58 and 0.79 than those of organic fertilizer (M) and inorganic fertilizer (CF) treatments, respectively. This further indicates that the combination of Pseudomonas fluorescens and organic fertilizer has a better effect on improving soil nitrogen accumulation than the combination of Pseudomonas fluorescens and inorganic fertilizer. At the same time, the application of Pseudomonas fluorescens will increase the content of unknown nitrogen (UN) in acid-hydrolysable nitrogen (AHN), and decrease the content of amino acid nitrogen (AAN) and ammonia nitrogen (AN), relatively. However, there was no significant effect on the content of ammonium nitrogen (NH4+-N) and nitrate nitrogen (NO3--N) in soil inorganic nitrogen (SMN). When combined with inorganic fertilizer, the contribution of soil mineralized nitrogen (SMN) to total nitrogen (TN) increased by 14.78%, while when combined with organic fertilizer, the contribution of acid-hydrolysable nitrogen (AHN) to total nitrogen (TN) increased by 44.77%. In summary, the use of Pseudomonas fluorescens is beneficial for nitrogen recovery in the reclaimed soil of coal mining areas. The optimal fertilization method under the experimental conditions is the combination of Pseudomonas fluorescens and organic fertilizer.

Millimeter wave wide-band imaging is widely studied for a variety of applications. However real-time millimeter wave wide-band imaging at frequencies above 30GHz for moving targets in a large field of view has not been realized commercially. A 2D sparse array with transmitter multiplexing is a promising solution to this problem. In this article, a method combining compressed sensing and orthogonal coded multiplexing was proposed, and the imaging performance was analyzed for different reconstruction algorithms and observation matrices by imaging simulation for a continuous object. Also the influence on the dynamic range of the original signal introduced by orthogonal coded multiplexing was studied. This work demonstrated that the proposed method was effective in reconstructing the image with a real-time capability. It is shown that different algorithms and matrices resulted in distinct performances, while the evaluation parameter selection also played a role. This work provided useful instructions for both the hardware and software design of a real-time 3D millimeter wave imaging system in the future.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

The shift towards autonomous excavators in construction and mining is a significant leap towards enhancing operational efficiency and ensuring worker safety. However, it presents challenges such as the need for sophisticated decision-making and environmental perception due to complex terrains and diverse conditions. Our study introduces the E-GTN framework, a novel approach tailored for autonomous excavation that leverages advanced multisensor fusion and a custom-designed convolutional neural network to address these challenges. Results demonstrate that GridNet effectively processes grid data, enabling the reinforcement learning algorithm to make informed decisions, thereby ensuring efficient and intelligent autonomous excavator performance. The study concludes that the E-GTN framework offers a robust solution for the challenges in unmanned excavator operations, providing a valuable platform for future advancements in the field.

Polymers' controlled pyrolysis is an economical and environmentally friendly solution to prepare activated carbon. However, due to the experimental difficulty in measuring the dependence between tissues and pyrolysis parameters at high temperatures, the unknown pyrolysis mechanism hinders access to the target products with desirable morphologies and performances. In this study, we investigate the pyrolysis process of polystyrene under different heating rates and temperatures employing reactive molecular dynamics (ReaxFF-MD) simulations. A clear profile of the generation of pyrolysis products determined by the temperature and heating rate is constructed. It is found that the heating rate affects the type and amount of pyrolysis intermediates and their timing, and low-rate heating helps yield more diverse pyrolysis intermediates. While the temperature affects the pyrolytic tissues of the final equilibrium products, either too low or too high a target temperature is detrimental to generating large areas of graphitized tissue. The established theoretical evolution process matches experiments well, thus contributing to preparing target activated carbons by referring to the regulatory mechanism of pyrolytic tissues.

According to the model of proactive motivation, we constructed a moderated impact model to examine the relationship between employees perceived overqualification (POQ), transformational leadership (TL), constructive deviant behaviour (CDB), and the generational differences in their relationships. We examined research hypotheses using data of 525 individuals. Results revealed that POQ positively affects CDB, and TL strengthened the effect of POQ on positive toward CDB. Furthermore, the effect of POQ on CDB is strongest among individuals born in the 1980s, followed by those born in the 1990s, and the moderating effect of TL is strongest among individuals born in the 1980s, and not significant among those born in the 1990s. Implications, limitations, and future directions of the present study are discussed.

In the context of the COVID-19 pandemic, thousands of healthcare workers (HCWs) infected with COVID-19 have lost their lives worldwide. At the early stage of the epidemic, when COVID-19 was still not considered as a pandemic, a large number of Chinese HCWs were infected. Officials reported that more than 3,000 HCWs in Hubei contracted the virus at the early stage of the outbreak due to limited knowledge of the virus. Following reports of overloaded local hospitals, more than 42,000 medical staff, including those from the military, were dispatched to Hubei from across the country. At the peak of the fight, one in 10 intensive care medics in China were working in Wuhan. During fighting against COVID-19 in China, although a large number of HCWs were infected by SARS-CoV-2 in the early stages of the epidemic, the timely adoption of measures indicated that, a faster rate of diagnosis could be achieved, patients were isolated in-time, HCWs’ safety was prioritized, training on basic protective knowledge and unified management of HCWs was strengthened, and effective protective measures were implemented. This resulted in the accomplishment of zero SARS-CoV-2 infection among the 42,632 members of the national medical teams sent to Hubei, and the number of COVID-19 cases among HCWs in local hospitals also significantly decreased, thereby indicating that hospital-acquired infections of SARS-CoV-2 among HCWs are fully preventable.

A novel binary toxin-positive non-027, non-078 Clostridium difficile strain designated LC693 whose sequence type was ST201 was isolated from the fecal sample of a patient with severe diarrhea in China. To understand the pathogenesis basis of C. difficile ST201, this recently recovered isolate LC693 was then chosen for whole genome sequencing. The project finally generated an estimated genome size of approximately 4.07 Mbp. The genome sequence was then analyzed together with the other two ST201 strains VL-0104 and VL-0391 and compared to the epidemic 027/ST1 and 078/ST11 strains. Phylogenetic analysis demonstrated that the ST201 strains belonged to clade 3. Genome size of the three ST201 strains ranged from 4.07 Mb~4.16 Mb, with an average GC content between 28.5%~28.9%. The ST201 genomes contained more than 40 antibiotic resistance genes and 15 of them were predicted to be associated with vancomycin-resistance, suggesting that they may have a strong antibiotic resistance. The ST201 strains contained a typical clade 3 specific PaLoc with a Tn6218 element inserted, and those genes harbored on their PaLoc that participated in the toxin expression and regulation were highly homologues to the epidemic 027 and 078 strains, with the exception of tcdC. A truncated TcdC was found in the ST201 strains, which is suggestive to have a contribution to the toxin production of the ST201 strains. In addition, the ST201 strains contained intact binary toxin coding and regulation genes, which is also proposed to contribute to the virulence. Genome comparison of the ST201 strains with the epidemic 027 and 078 strain identified 641 genes specific for the C. difficile ST201, and a number of them were predicted as fitness and virulence associated genes. The identification of those genes also contributes to the pathogenesis of the ST201 strain. To our knowledge, this is the first study that the genome sequence of C. difficile ST201 was discussed in detail, and the present study would have a contribution to understanding the pathogenesis basis of C. difficile ST201.

Infectious keratitis (IK) represents a major cause of corneal blindness. This study aims to investigate the demographics, risk factors, microbiological characteristics and antibiotic susceptibility patterns of IK in Taiwan over the past 15 years. A retrospective population-based study was conducted using the Chang Gung Research Database. Patients with IK were identified by diagnostic codes for corneal ulcer from 2004 to 2019. Of 7807 included subjects, 45.2% of patients had positive corneal cultures. The proportion of contact lens-related IK declined, while that of IK related to systemic diseases grew. The percentage of isolated gram-positive bacteria surpassed that of gram-negative bacteria in the 15-year period. The prevalence of Pseudomonas aeruginosa showed a decreasing trend (p = 0.004), whereas coagulase-negative Staphylococcus (CNS) and Propionibacterium species were increasingly detected (p < 0.001). Overall, the trend of antibiotic susceptibility of both gram-positive and gram-negative bacteria did not change throughout the study period. The susceptibility to the test antibiotics maintained over 90% in gram-negative isolates during 15 years. Vancomycin preserved 100% susceptibility to all gram-positive isolates. Since most tested antibiotics exhibited stable susceptibility over decades, this study reinforced that fluoroquinolones and fortified vancomycin continue to be good empiric therapies for treating bacterial keratitis in Taiwan.

In this study, an extracellular metalloprotease from Pseudoalteromonas sp. H2 was purified and identified. The EH2 maintained more than 80% activity over a wide pH range of 5-10 and the stability was also nearly independent of pH. More than 65% of activity was detected in a wide temperature of 20-70℃. The high stability of the protease in presence of different surfactants and oxidizing agent was also observed. Moreover, we also investigated the antioxidant activities of the hydrolysates generated from porcine and salmon skins collagen by EH2. The results show that salmon skins collagen hydrolysates demonstrated higher DPPH (42.88%±1.85) and hydroxyl radical (61.83%±3.05) scavenging activity compared to those produced with porcine skins collagen. For oxygen radical absorbance capacity, the hydrolysates from porcine skins collagen had higher efficiency (7.72±0.13 μmol·TE/μmol). Even 1 nM mixed peptides can effectively reduce the levels of intracellular ROS. And the two type of substrates exerted the best antioxidant activity when hydrolyzed for 3 hours. Hydrolysis time and type of substrate exerted important effect on the antioxidant property of hydrolysates. This study may have implications for the potential application of marine protease in biocatalysis industry. In addition, the hydrolyzed peptides from meat waste containing beneficial collagen by protease have good antioxidant activity indicating it may be a potential additive in the food processing industry and cosmetics industry.

System-of-systems (SoS) evolution is a complex and unpredictable process. Although various principles to facilitate collaborative SoS evolution have been proposed, there is a lack of experimental data validating their effectiveness. To address these issues, we present an Agent-Based Model (ABM) for SoS evolution in the Internet of Vehicles (IoV) , serving as a quantitative analysis tool for SoS research. By integrating multiple complex and rational behaviors of individuals, we aim to simulate real-world scenarios as accurately as possible. To simulate the SoS evolution process, our model employs multiple agents with autonomous interactions and incorporates external environmental variables. Furthermore, we propose three evaluation metrics: evolutionary time, degree of variation, and evolutionary cost, to assess the performance of SoS evolution. Our study demonstrates that enhanced information transparency significantly improves the evolutionary performance of distributed SoS. Conversely, the adoption of uniform standards only brings limited performance enhancement to distributed SoSs. Although our proposed model has limitations, it stands out from other approaches that utilize Agent-Based Modeling to analyze SoS theories. Our model focuses on realistic problem contexts and simulates realistic interaction behaviors. This study enhances the comprehension of SoS evolution processes and provides valuable insights for the formulation of effective evolutionary strategies.

Bulbophyllum is one of the largest genera and presents some of the most intricate taxonomic problems in the family Orchidaceae, including species of ornamental and medical importance. The lack of knowledge regarding the characterization of Bulbophyllum chloroplast (cp) genomes has imposed current limitations on our study. Here, we reported the complete cp genomes of seven Bulbophyllum species, including B. ambrosia, B. crassipes, B. farreri, B. hamatum, B. shanicum, B. triste and B. violaceolabellum, and compared with related taxa to provide a better understanding of their genomic information on taxonomy and phylogeny. A total of 28 Bulbophyllum cp genomes exhibit typical quadripartite structures with lengths ranging from 145,092 bp to 165,812 bp and GC content of 36.60% to 38.04%. Each genome contained 125–132 genes, encompassing 74–86 protein-coding genes, 38 tRNA genes, and eight rRNA genes. The genome arrangements, gene contents and length were similar with differences observed in ndh gene composition. A total of 18–49 long repeats and 38–80 simple sequence repeats (SSRs) were detected and the single-nucleotide (A/T) was dominant in Bulbophyllum cp genomes, with an obvious A/T preference. An analysis of relative synonymous codon usage (RSCU) revealed Leucine (Leu) was the most frequently used codon, while cysteine (Cys) was the least used. Six highly variable regions including ndhF-trnLUAG, trnTUGU-trnLUAA, trnFGAA-ndhJ, rps15-trnNGUU, rbcL-accD and psbI-trnSGCU were identified based on the ranking of the Pi values, had the potential to serve as DNA markers for species identification and phylogeny of the genus Bulbophyllum. Phylogenetic analysis based on the complete cp genome sequences and 68 protein-coding genes strongly supported 28 Bulbophyllum species can be divided into four branches and sects. Brachyantha, Cirrhopetalum, Leopardinae defined by morphology were non-monophyly. Our results enriched the genetic resources of Bulbophyllum species, providing valuable information to illustrate the complicated taxonomy, phylogeny and evolution process of the genus.

In recent years, the unmanned aerial vehicle (UAV) synthetic aperture radar (SAR) has become a highly sought-after topic for its wide applications in the field of target recognition, detection, and tracking. However, SAR automatic target recognition (ATR) models based on deep neural networks (DNN) are suffering from adversarial examples. Generally, non-cooperators rarely disclose any information about SAR-ATR models, making adversarial attacks challenging. In this situation, we propose Transferable Adversarial Network (TAN) to attack these models with highly transferable adversarial examples. The proposed method improves the transferability via a two-player game, in which we simultaneously train two encoder-decoder models: a generator that crafts malicious samples through a one-step forward mapping from original data, and an attenuator that weakens the effectiveness of malicious samples by capturing the most harmful deformations. In particular, compared to traditional iterative methods, our approach is able to one-step map original samples to adversarial examples, thus enabling real-time attacks. Experimental results indicate that the proposed approach achieves state-of-the-art transferability with acceptable adversarial perturbations and minimum time costs compared to existing attack methods, i.e., it excellently realizes real-time transferable adversarial attacks.

In response to the increasing energy demand in Taiwan and the global trend of renewable energy development, Kuroshio energy is a potential energy source. How to extract this invaluable natural resource has then become an intriguing and important question in engineering practices. This study conducted a study for a nozzle-diffuser duct (NDD) as the Kuroshio currents energy harvester. The computational fluid dynamics (CFD) software ANSYS Fluent was employed to calculate the drag and added mass coefficients of the duct anchored to the seabed. Those coefficients were further imported into Orcaflex to simulate the motion of the duct under normal and storm wave conditions. Results showed that the duct was stable 25 m below the sea surface under normal wave condition. When the wave condition changed to storm waves, the duct needed to dive into at least 90 m below the sea surface to regain its stability and obtain high power take-off (PTO). An optimal design nozzle-diffuser-duct was reported and a PTO peak of 15 kW was expectable in the Kuroshio currents. Once a suitable offshore platform can be developed with sixty-six NDDs, a Megawatt Kuroshio ocean current power generation system is feasible in the near future.

Existing methods for detecting magnetic leakage signals from damaged wire ropes require axial saturation magnetisation, and the accuracy of the detection equipment depends on the saturation degree of magnetisation. Moreover, the expected magnetisation effect is usually difficult to achieve owing to the special characteristics of the rope structure, diameter, and operating environment of the wire rope. Consequently, in addition to other issues, the detection accuracy and versatility of the equipment are low. In this study, a method based on spatial multidimensional orthogonal array loop magnetisation for detecting mine wire rope defects is proposed. Firstly, a new sensor excitation structure model is developed. Then a method of radiant magnetic flux of permanent magnet array is analysed, and the influence law of the number of permanent radiant magnetic blocks on the magnetisation effect is studied. In addition, a method of wire rope detection based on the principle of clustering is investigated, according to which the influence law of the shape, structure, and size of the polyurethane device on the effect of magnetisation is discussed. Finally, through laboratory experiments, the test model and proposed method are verified. The results show that the magnetisation effect is better and more cost-effective when the number of permanent magnet radiation magnetic block is n=8, and the proposed detection method can effectively distinguish damaged wire rope joints. Furthermore, the proposed equipment achieved signal-to-noise ratio of the signals, improving the reliability of damage detection.

As the embedded device and internet of things (IoTs) concept prevalent in today's world, there is an increasing demand for the security and performance requirements on deploying these devices to private and public sectors. The crucial part of it is to protect privacy, confidentiality and integrity, meanwhile, maintain an adequate level of performance during transmission, storage and access of critical information. While the conventional cryptography methods, such as the Advanced Encryption Standard (AES), SHA$-$2 hashing method and RSA and Diffie Hellman for message authentication and identification, work well on systems which have reasonable processing power and memory capabilities. These do not scale well into a world with embedded systems and sensor networks, in conjunction with their nature of smaller size and lower cost. Thus, in the context of resource constrained device, lightweight cryptography methods are proposed to overcome many of the problems of conventional cryptography possessed. This includes constraints related to physical size, processing requirement, memory limitation, energy drain and production cost. This paper provides a survey of the architectures that are defined as replacements for conventional ciphers within an IoTs space and discuss some trends in the design of future lightweight algorithms. The performance metrics are carefully chosen to reflect and assess the suitability for embedded devices. The aim of this research is to identify the various performance metrics applied on different types of symmetric block ciphers especially lightweight ciphers and compare the results on versatile platforms with stream ciphers and public key methods. The comparative analysis on efficient LW cipher will be tested against other similar block ciphers on both MacBook Pro with Intel core and resource constrained device Raspberry Pi with ARM processor.

In nature and engineering applications, flexible fiber beds covering biological surfaces can play a role in reducing resistance. These fibers deform under the action of fluids, and this deformation affects the fluid flow state, forming a complex fluid-solid interaction phenomenon. To quantitatively analyze such issues, the physical model is simplified to the deformation problem of an soft hair bed caused by Stokes flow, and the deformation problem of a single fiber caused by Stokes flow is further studied. The deformation problem of an elastic single fiber in a channel caused by Stokes flow can be described by a nonlinear integral equation. We have obtained a new series solution, which has been compared with the previous perturbation method to verify the accuracy and effectiveness of the series solution. Meanwhile, we have further provided an extended form of flexible fiber deformation through experimental fitting. This fluid-solid interaction problem involves multiple fields and is very important in many natural and engineering systems. The research in this paper can not only help us better understand complex phenomena in nature but also delve into the interaction mechanism between fluids and solids, providing a theoretical basis for future scientific research and engineering applications.

Excessive CO₂ emissions and alternative energy fuels are two major difficult issues. The utilization of CO₂ into fine chemicals is an optimal route. Diethyl carbonate (DEC) is an extremely versatile chemical intermediate. DEC is used in gasoline, pharmaceutical, chemical and other fields. DEC synthesis from CO₂ and ethanol is a typical green synthetic route. Ni-Cu@Na₃PW₁₂O₄₀ catalysts were synthesized by two novel methods of supported and mixed. The catalyst prepared by mixed method showed nice catalytic performance. It was confirmed that water removal was the key to improving conversion efficiency. In the presence of dehydrating agent of ethylene, ethanol conversion increased from ca. 3% to ca. 40%. Propylene oxide (PO) was participated in the reaction and ethanol conversion continued to reach to ca.90% while DEC selectivity dropped by half. Under optimal conditions, our Ni-Cu@Na₃PW₁₂O₄₀ catalyst effectively solved the two major issues above.

The dioecious property of sea buckthorn (Hippophae rhamnoides L.) prevents sex recognition via traditional observation at the juvenile stage, thus impeding breeding and economic cropping; RAPD and SCAR markers were used to identify the sexes. A total of 45 random decamer primers were used to screen genomic DNA pools of staminate and pistillate genotypes for genetic polymorphisms. One female sex-linked marker was identified. D15 (5′-CATCCGTGCT-3′) amplified a particular band of 885 bp, which showed polymorphism among staminate and pistillate genotype plants. The SCAR marker Hrcx-15 was obtained by sequencing the fragment. The alleles of 140 pistillate genotypes were examined but not of the 140 staminate genotypes discerned via taxonomy. Staminate and pistillate genotypes of sea buckthorn plants can be distinguished, using Hrcx-15 as a genetic marker for sex identification and for expediting cultivation for commercial applications.

Electro-optic modulator (EOM) is one of the key devices of high-speed optical fiber communication system and ultra-wideband microwave photonic system. Silicon-organic hybrid (SOH) integration platform combines the advantages of silicon photonics and organic materials, providing a high electro-optic effect and compact structure for photonic integrated devices. In this paper we present a SOH integrated EOM with comprehensive investigation of EOM structure design, silicon waveguide fabrication with Slot structure, on-chip poling of organic electro-optic material, and characterization of EO modulation response. The SOH integrated EOM is measured with 3dB-bandwidth of over 50 GHz and half-wave voltage length product of 0.26 V·cm. Furthermore, we demonstrate a microwave photonics phase shifter by using the fabricated SOH integrated dual parallel Mach-Zehnder modulator. The phase shift range of 410 degree is completed from 8 GHz to 26 GHz with a power consumption of less than 38 mW.

In response to injury, vascular smooth muscle cells (VSMCs) of the arterial wall dedifferentiate into a proliferative and migratory phenotype, leading to intimal hyperplasia. The ERK1/2 pathway participates in cellular proliferation and migration while dual-specificity phosphatase 6 (DUSP6, also named MKP3) can dephosphorylate activated ERK1/2. We showed that DUSP6 was expressed in low baseline levels in normal arteries; however, arterial injury significantly increased DUSP6 levels in the vessel wall. Compared with wild-type mice, Dusp6-deficient mice had smaller neointima. In vitro, IL-1β induced DUSP6 expression and increased VSMC proliferation and migration. Lack of DUSP6 diminished IL-1β-induced VSMC proliferation and migration. DUSP6 deficiency did not affect IL-1β-stimulated ERK1/2 activation. Instead, ERK1/2 inhibitor U0126 prevented DUSP6 induction by IL-1beta, indicating that ERK1/2 functions upstream of DUSP6 to regulate DUSP6 expression in VSMCs rather than downstream as a DUSP6 substrate. IL-1β decreased levels of cell cycle inhibitor p27 and cell-cell adhesion molecule N-cadherin in VSMCs whereas lack of DUSP6 prevented their downregulation, revealing novel functions of DUSP6 in regulating these two molecules. Taken together, our results indicate that lack of DUSP6 attenuated neointima formation following arterial injury by reducing VSMC proliferation and migration, which were likely mediated via maintaining p27 and N-cadherin levels.

High salinity in soil affects the normal growth and development of crop. MicroRNA171 (miR171) plays a momentous role in plant resistance to adversity stress. The functions of Sly-miR171d and Sly-miR171e on growth of tomato and fruit nutritional quality under salt stress were studied. The results showed that the seed germination and seedling growth of tomato that silencing of Sly-miR171d/e by short tandem target mimic (STTM) were better than those of wild-type (WT). Silencing of Sly-miR171d/e seeds maintained a high germination rate, while WT tomato seeds barely germinated under 50 mM NaCl stress. Under 100 mM NaCl stress, silencing of Sly-miR171d/e increased the expression of their target gene SlGRAS24 with increasing duration of salt stress, while they enhanced the antioxidant activity, reduced reactive oxygen species (ROS) accumulation, and enhanced the salt tolerance of tomato plant by regulating gibberellin (GA) level. Moreover, the preharvest and postharvest fruit nutritional quality under salt stress was also studied, and the results showed that silencing of Sly-miR171d/e increased soluble solids, lycopene, total carotenoids, Vitamin C, organic acids and phenolic substances in tomato fruit. The present study demonstrated that silencing of Sly-miR171d/e enhanced plant salt tolerance through the GA pathway, and improved fruit nutritional quality under salt stress.

Different bone bruise patterns observed on magnetic resonance imaging (MRI) after non-contact anterior cruciate ligament (ACL) rupture and lateral patellar dislocation may indicate different injury mechanism of knee. In order to investigate the typical bone bruising patterns after ACL rupture and patellar dislocation. In this study, 77 ACL rupture and 77 patellar dislocation patients’ knee MR images with bone bruises between August 2020 and March 2022at our institution were selected and analyzed, respectively. Sagittal and transverse planes images were used to determine the bone bruise location in the lateral-medial and superior-inferior directions of the MR images. The presence, location, and intensity of the bone bruises within specific compartments of the femur and tibial after ACL rupture and patellar dislocation were recorded. Relative bone bruise patterns of the ACL rupture and patellar dislocation were classified and analyzed. Results showed that there were 4 kinds of bone bruise (1-,2-,3-,4- bone bruises) patterns after ACL rupture. The most common two patterns after ACL rupture were 3- bone bruises (including lateral side of femur and both lateral and medial side of tibia, LF+BT; both lateral and medial side of femur and lateral side of tibia, BF+LT, medial side of femur and both lateral and medial side of tibia, MF+BT) followed by 4- bone bruises (both lateral and medial side of femur and tibia, BF+BT), 2- bone bruises (LF+LT, lateral side of femur and tibia; MF+LT, medial side of femur and lateral side of tibia; LF+MT, lateral side of femur and medial side of tibia; MF+MT, medial side of femur and tibia; 0+BT, both lateral and medial side of tibia;), and 1- bone bruise (0+LT, only lateral side of tibia). There was only 1 pattern bone bruise (latera femur and medial patella bone bruise) of patellar dislocation, the most common pattern of patellar dislocation was in the inferior medial patella and lateral anterior inferior femur. The results suggest that the pattern of bone bruise after ACL rupture and patellar dislocation is completely different. There were 4 kinds of bone bruise patterns after non-contact ACL rupture while there was only 1 kind of bone bruise pattern after patellar dislocation bone bruise patients which was in the inferior medial patella and lateral anterior inferior femur.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Abstract: There are a large number of cross-linked chemical bonds such as tight disulfide bonds, hydrogen bonds,and salt bonds in keratin, which makes it difficult to break the structural stability of the protein using conventional methods. The degradation of feather waste using keratinases produced by microorganisms has the advantage of being efficient and environmentally friendly. In this study, 23 strains capable of producing transparent circles were obtained via preliminary screening with skim milk as the sole carbon and nitrogen source, and 9 strains capable of degrading feathers were obtained via rescreening with feathers as the sole carbon and nitrogen source. Finally, through the determination of enzyme activity, the strain CY-A with a high ability to degrade feathers was obtained. The strain was identified as Bacillus tequilensis via morphological observation, physiological and biochemical identification, and 16 S rRNA molecular biology. The keratinase gene (bta) of Bacillus tequila was cloned, and its full-length gene sequence was 1110 bp, containing an open reading frame of 1089, encoding 369 amino acids (GeneBank accession number OR733336). The physicochemical properties, secondary structure, and tertiary structure of the recombinant protein were analyzed using bioinformatics tools such as ProtParm, SOPMA, MEGA, and SWISS-MODELS. It was found that the relative molecular mass was 37.953 kD and that the isoelectric point was 8.48. The protein was a hydrophilic protein. The keratinase bta gene was ligated to the expression vector pET28a(+) using T4 ligase, and the recombination expression plasmid pET28-bta was constructed and transformed into E. coli BL21(DE3) to obtain recombinant engineered bacteria. The expressed keratinase was purified using a Ni2+ affinity chromatography column to obtain recombinant bta keratinase bta with a molecular weight of 37.953 kD. The identification and characterization of this keratinase gene provides some theoretical basis for the further enhancement of keratinase activity by means of genetic engineering.

p53 is among the most frequently mutated tumor suppressor genes given its prevalence in >50% of all human cancers, including high grade serous endometrial cancers and ovarian cancers. In addition to loss of tumor suppression function, many mutated p53 (Mutp53) proteins acquire gain-of-function (GOF) activities as oncogenes to promote cancer progression, which manifest through aberrant expression of p53. As we have come to see, statins induce CHIP-mediated degradation of mutp53 by blocking the interaction between mutp53 and DNAJA1. Therefore, targeting critical downstream pathways of mutp53 provides an alternative strategy for treating cancers expressing mutp53. In this review, we summarize recent advances with Wee1 inhibitors and mevalonate pathway inhibitors, particularly statins, regarding their use in gynecological cancers with p53 mutations.

Urban morphology exhibits fractal characteristics, which can be described by multifractal scaling. Multifractal parameters under positive moment orders primarily capture information about cen-tral areas with relatively stable growth, while those under negative moment orders mainly reflect information about marginal areas with more active growth. However, effectively utilizing mul-tifractal spectrums to uncover the spatio-temporal variations of urban growth remains a challenge. To addresses this issue, this paper proposes a multifractal measurement by combining theoretical principles and empirical analysis. To capture the difference between growth stability in central areas and growth activity in marginal areas, an index based on generalized correlation dimension Dq is defined. This index takes the growth rate of Dq at extreme negative moment order as the numerator, and that at extreme positive moment order as the denominator. During the stable stage of urban growth, the index demonstrates a consistent pattern over time. While during the active stage, the index may exhibit abnormal fluctuations or even jumps. This indicates that the index can reveal spatio-temporal information about urban evolution that cannot be directly observed through multifractal spectrums alone. By integrating this index with multifractal spectrums, we can more comprehensively characterize the evolutionary characteristics of urban spatial structure.

The purpose of this study is to examine the relationship between the institutional investors which can affect financial performance for corporate sustainability on the income smoothing. Therefore, this study focus on the connection between the nature of stock rights and income smoothing in China. For this study, hypotheses were established on the relationship each state-controlled companies, income smoothing, and information equilibrium of individual investors, and empirical analysis was conducted through related variables. The analysis results are summarized in three categories as follows. First, this research finds that state-controlled firms (CONTs) prefer income smoothing activities compared to non-state-controlled firms for the long-term sustainable development of firms using data from 2011 to 2019. Second, this study found out that Institutional investors support the behavior of CONTs to smooth their earnings because this behavior is seen as an attempt by CONTs to convey valuable private information to other investors. Third, we was able to discover that institutional investors' monitoring effect is predominantly driven by pressure-resistant institutional investors. This research complements the lack of empirical research on income smoothing and enable to give a guideline that the type of stock rights is a critical key determinant of participation in income smoothing activities for stable growth and sustainability in the future.

This general review assesses the impact of physical exercise on oxidative and nitrosative stress and the counteractive role of antioxidants, drawing from a systematic literature search up to March 2024 in databases like PubMed and Web of Science. The review highlights studies on the effect of exercise on the production of reactive oxygen species (ROS) and reactive nitrogen species (RNS) and antioxidant responses in both human and animal models based on rigorous inclusion and exclusion criteria. Due to the variety of exercise types and participants' characteristics, a narrative synthesis approach was adopted. The findings indicate that moderate exercise boosts antioxidant defenses, known as hormesis, whereas excessive physical activity may increase oxidative and nitrosative damage. The review also explores the complex effects of antioxidant supplementation, revealing that while natural dietary antioxidants support health, high-dose supplements could potentially hinder positive adaptations to exercise. Recommendations for athletes and the general active population highlight the importance of balancing exercise and dietary intake to optimize health benefits. The review concludes with a call for more detailed research on tailored exercise and nutrition plans to dissect these intricate relationships further.

Assessing the quality of corn seeds necessitates evaluating their content of water, fat, protein, and starch. This study integrates hyperspectral imaging technology with chemometric analysis techniques to achieve non-invasive and rapid detection of multiple key components in corn seeds. Hyperspectral images of the embryo surface of maize seeds were collected within the wavelength range of 1100~2498nm. Subsequently, image segmentation techniques were applied to extract the germ structure of the corn seeds as the region of interest. Seven spectral data preprocessing algorithms were employed, and the Detrending Transformation (DT) algorithm was identified as the optimal preprocessing method through comparative analysis using the Partial Least Squares Regression (PLSR) model. To reduce spectral redundancy and streamline the prediction model, three algorithms were employed for characteristic wavelength extraction: Successive Projections Algorithm (SPA), Competitive Adaptive Reweighted Sampling (CARS), and Uninformative Variable Elimination (UVE). Using both the original spectra and the extracted characteristic wavelengths, four content detection models were constructed: PLSR, Back Propagation Neural Network (BPNN), Radial Basis Function Neural Network (RBFNN), and Least Squares Support Vector Machine (LSSVM). The experimental results demonstrate that the DT-CARS-LSSVM model exhibits exceptional accuracy and stability in predicting these four key components, with determination coefficients of 0.9877, 0.9344, 0.9827, and 0.9592, respectively. This study not only provides a scientific basis for evaluating the quality of corn seeds but also opens up new avenues for the development of non-invasive detection technology in related fields.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

The shape of the knee is a chain-like structure of an ellipsoid. This suggests that, in the latest study, in addition to rolling, there is slippage in the motion of the knee. This paper selects a mechanical braking model for cattle based on two mechanical structures in different directions at the joints. The experimental results show that the modified dynamical system has strong chaotic properties. This can be one of the basis for judging various health states.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

The joint extraction of entities and relations is a critical task in information extraction, and its performance directly affects the performance of downstream tasks. However, existing joint extraction models based on deep learning exhibit weak processing capabilities for the phenomenon of multiple pronunciations of one character and multiple characters of one pronunciation when processing Chinese texts, resulting in performance loss. To address these issues, this paper introduces part-of-speech (POS) and pinyin features to aid the model in learning semantic features that are more contextually appropriate. A Chinese Joint Entity and Relation Extraction Model based on Progressive Contrastive Learning and Heterogeneous Feature Fusion is proposed (CJE-PCHF). During model training, an interactive fusion network based on progressive contrastive learning is employed to learn the dependencies between pinyin, POS, and semantic features. This guides the model in heterogeneous feature fusion, capturing higher-order semantic associations between heterogeneous features. On the commonly used DuIE evaluation dataset for joint extraction, this model achieved a significant improvement, with the F1 score increasing by 5.4% compared to the benchmark model CasRel.

The 2019-nCoV has been identified as the cause of an outbreak of respiratory illness in Wuhan, Hubei Province, China beginning in December 2019. This epidemic had spread to 19 countries with 11,791 confirmed cases, including 213 deaths, as of January 31, 2020. The World Health Organization declared it as a Public Health Emergency of International Concern. This study analyzed and discussed 70 research articles published until January 31, 2020 for a better understanding of the epidemiology, causes, clinical diagnosis, prevention and control of this virus. Studies thus far have shown origination in connection to a seafood market in Wuhan, but specific animal association has not been confirmed. The reported symptoms include fever, cough, fatigue, pneumonia, headache, diarrhea, hemoptysis, and dyspnea. Preventive measures such as masks, hand hygiene practices, avoidance of public contact, case detection, contact tracing, and quarantines are effective for reducing the transmission. To date, no specific antiviral treatment is proven effective, hence, infected people primarily rely on symptomatic treatment and supportive care. Although these studies had relevance to control a public emergency, more research need to be conducted to provide valid and reliable ways to manage this kind of public health emergency in both short- and long- term.

Spider silk has excellent strength and elasticity in natural, researchers have been working for decades try to achieve natural spider silk outstanding mechanical properties using recombinant spider silk protein (spidroin) through artificial spinning. In this work, we chose wet spinning method to explore the relationship between concentration of coagulation bath and fiber performance. It was found that the concentration of methanol has important effect on fiber continuity, diameter and mechanical properties. Lower concentration favors spinning continuous thinner, fibers with high strain. Secondary stretching benefits spinning silk fibers with stable mechanical properties, and thermal stability. Through applying different methanol concentration and additional stretching, we obtained silk fibers with Young’s modulus of 3.052± 2.626 GPa, stress of 25.3944 ± 17.48 MPa, and strain of 140 ± 95.4%.

Based on the major, trace element, and isotope data of the Cenozoic basalts in the study area, it is indicated that the basalts in this region can be classified into three distinct magma systems: alka-li basalts, tholeiite basalts, and Nushan alkali basalts. The geochemical characteristics observed in the studied basalts indicate that the mantle source in this region might have experienced met-asomatic processes prior to partial melting, which could be linked to an ancient subduction pro-cess. Combining the geochemical characteristics in the studied basalts with previous research, we propose that the underlying mantle source in Anhui province may have undergone metaso-matism due to the carbonatitic melts. These melts are believed to have originated from car-bonated eclogite, derived from subducted Pacific slab materials present in the deeper mantle. According to the Sr-Nd isotope data, it is suggested that the mantle source in the Nushan region could be derived from a depleted asthenospheric mantle, while the basaltic composition in the Niugang area may be representative of the mantle's end components associated with the EM-I enriched mantle source present in this study area. Therefore, we propose that the Anhui basalts may have originated from the partial melting of a mantle source representing a mixing of two end-members: DMM (Depleted MORB Mantle) and EM-Ⅰ (Enriched Mantle 1). The Anhui basal-tic magmas may have originated from the partial melting of EM-Ⅰ, potentially influenced by upwelling asthenospheric mantle or asthenospheric diapirism processes. The mantle source in the study area experiences partial melting at 1-5%, 15%, and 1-10%, resulting in the formation of parent magmas for alkali basalt, tholeiitic basalt, and Nushan alkali basalt. Subsequently, the parent magmas experienced fractional crystallization processes, which included minerals like olivine, pyroxene, and plagioclase. This led to the formation of various types of basalt in the study area.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Glaucoma, a global leading cause of blindness, necessitates accurate segmentation of the optic disc (OD) and optic cup (OC) for effective screening. However, existing segmentation methods based on convolutional neural networks (CNNs) suffer from high computational complexity and long inference times. In this paper, we propose an end-to-end segmentation method for the OD and OC using a lightweight MobileNetv3 as the feature extraction network. Our approach incorporates boundary branches and an adversarial learning network to achieve multi-label segmentation of the OD and OC. We evaluate the proposed method on three publicly available datasets: Drishti-GS, RIM-ONE-r3, and REFUGE. The experimental results demonstrate segmentation accuracies of 0.974/0.900, 0.966/0.875, and 0.962/0.880 for the OD and OC on the respective datasets, while significantly reducing inference time.

Orchids are often a mystery because of their close and complex relationships with various microorganisms in the natural environment. Orchids rely on microorganisms to obtain nutrients, affecting their seed germination, protocorm, and adult plant growth. Currently, the majority of relevant research is concentrated on isolating and identifying environmental microorganisms that support orchid development and growth. With the development of metagenomic technology, our understanding of orchid mycorrhizal fungi (OMF) and root-associated bacteria (RAB) has been expanded. New research results and discoveries have emerged, which require a comprehensive assessment to provide a reference for studying microorganisms related to orchids. Therefore, we present a comprehensive summary, identifying significant inadequacies of present methodologies while providing ideas for further research.

Molybdenum tailings powder (MTs) is an industrial waste that contains more than 85% contents of SiO2, Al2O3, CaO, and Fe2O3. Therefore, MTs has the potential pozzolanic activity and can be used as a mineral admixture in cementitious materials. In order to understand the influence of MTs as an admixture on the cement hydration process, the hydration heat and hydration kinetics of the composite cementitious materials (CCMs) were investigated by an isothermal calorimeter and the Krstulovic-Dabic model. Furthermore, the influences of fly ash (FA), slag (SL) and MTs on hydration heat at the same content were compared and analyzed. Results show that proper amount of MTs can promote the hydration of CCMs. When the content of MTs is not more than 15%, the second exothermic peak of CCMs appears earlier and the peak heat release increases. However, when the content of MTs exceeds 15%, the second exothermic peak of CCMs is delayed and the peak heat release decreases. The cumulative heat release of CCMs gradually decreases with an increasing content of MTs. When the replacement of MTs, FA, and SL is 15% respectively, the addition of MTs enhances the second exothermic peak of CCMs compared to FA and SL. The final heat release of MTs is higher than that of FA, but lower than that of SL. The hydration process of CCMs undergoes three stages: nucleation and crystal growth (NG), interactions at phase boundaries (I), and diffusion (D). The incorporation of MTs shortens the NG stage and I stage.

To clarify effects of weathered coal humic acid on water-stable aggregates and pore characteristics of reclaimed cambisol, this research analyzed the evolution characteristics of soil aggregates and pores. Effects of different humic acid dosages (0, 1%, 3%, and 5% by weight) and application period (1 year, 2 years, and 3 years) on soil aggregates and organic carbon components in soil water-stable aggregates were investigated. The results showed that water-stable macroaggregates (>0.25 mm) had the highest content in the first year; but in the third year, water-stable microaggregates (0.053–0.25 mm) had the highest content, and silt and clay (<0.053 mm) were at a maximum. In the third year of 5% treatment, mean weight and geometric mean diameters were the largest, soil structure was the most stable, and TOC and water-stable microaggregates (0.053–0.25 mm) in soil had the highest proportions. For 5% treatment, the majority of irregular pores were independent in the first year, and number of pores decreased in the second year, but average pore volume increased, forming robust connected pores. In the third year, the number of elongated and irregular pores increased. In the third year of 5% treatment, most pores were irregular and of size >100 μm, and soil structure was the most stable.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Late onset Pompe disease is a recessive lysosomal storage disease. Clinical features include skeletal muscles deficiency and diaphragm weakness. Clinical management relies on supportive treatment and mechanical ventilation in patents with chronic respiratory failure. M mode ultrasound and tissue Doppler imaging can be used to assess and to follow up diaphragm function.

Exercise-induced muscle injury is one of the most common types of sports injuries. Skeletal muscle troponin I (skTnI) serves as an ideal biomarker in assessing such injuries, facilitating timely detection and evaluation. In this study, we develop a fluorescent sandwich lateral flow immunoassay (LFIA) combined with a desktop analyzer for rapid detection of skTnI. Through optimizing the reaction system, the assay achieves a satisfying detection performance, reaching a limit of detection (LOD) of 0.5 ng/mL with a turnaround time of 15 minutes. The proposed de-tection platform offers portability, ease of use, and high sensitivity, which facilitates the moni-toring of exercise-induced muscle injuries at the point of care. This feature is particularly advan-tageous for end-users, enabling timely detection of sports-related injuries and ultimately en-hancing prognosis and sports life.

A fluorescent probe, N'-((3-methyl-5-oxo-1-phenyl-4, 5-dihydro-1H-pyrazol-4-yl) methylene)-2-oxo-2H-chromene-3-carbohydrazide (MPMC), was synthesized and characterized. Characterizations of the synthetic MPMC were conducted by proton nuclear magnetic resonance (1HNMR) spectroscopy and carbon-13 nuclear magnetic resonance spectroscopy (13C NMR). The fluorescence emission behaviors of probe MPMC towards diverse metal ions were detected and the probe exhibited high sensitivity and selectivity towards Cu2+ over other metal ions via quenching of its fluorescence. Furthermore, the existence of other metal actions made no difference on the fluorescence intensity of the MPMC-Cu2+ system apparently, that is, MPMC displayed a good anti-interference ability. Job’s plot of MPMC and copper ions indicated the detection limit was 15.16 nM (R2=0.9612) for the assayed actions, with a stoichiometric ratio of 1:1 for MPMC and Cu2+. Additionally, the color of MPMC probe solution changed from nearly colorless to yellow in the presence of Cu2+ in visible light, which the color change could be observed by the naked eye. Similarly, the color resolved bright yellow into blue in ultraviolet light. Also reusability studies indicated that MPMC probe was reusable. The pH effect of probe MPMC to Cu2+ had a broad range of pH detection 4.0 to 11.0. The response time of MPMC probe for determining Cu2+ was within 1 min. The recognition of Cu2+ by MPMC performed on pre-treated paper under sunlight and UV light both had a distinct colour change. Thus, the solid-state method for detecting Cu2+ with the naked-eye, was both economical and convenient.

Fabry-Pérto (FP) cavity is the essential component of ultra-stable laser (USL) for gravitational wave detection, which couples multi-physic (Optical/Thermal/Mechanics) fields and requires ultra-high precision. To satisfy the requirements of precise and efficient design, a multi-physic coupling optimization method for fixing cubic FP cavity based on data learning is proposed. A multi-physic model for the cubic FP cavity is established and the performance is obtained by finite element analysis. The key performance indices (V, wF, wF) and key design variables (d, l, F) are determined considering the features of the FP cavity. The 49 sets of data by orthogonal experiment are acquired for the establishment and comparison of different data learning models (NN, RSF, KRG). The result turns out that the neural network has the best performance. Based on NSGA-II, the Pareto optimal front is obtained and the optimal combination of design variables is finally determined as {5,32,250}. The performance after optimization has proven to be a great improvement, of which the displacement under the fixing force and vibration test are decreased by more than 60%. The optimization strategy can not only help the design of the FP cavity but also enlighten other optimization fields.

Utilizing ecological engineering to manage pests by enhancing the biological control function of natural predators through the selection of high-efficiency bank plants and the establishment of bank plant systems within agricultural ecosystems is an optimal strategy. While bank plant systems have found widespread use in greenhouse crop cultivation, their application in rice fields remains limited. This study aimed to assess the efficacy of Leersia sayanuka as a bank plant for controlling planthoppers and to explore the potential of sesame as a complementary plant to enhance the effectiveness of the bank plant system through field trials. The findings revealed that planting a strip of L. sayanuka, at least 50 cm wide and extending over 1 m in length, had a notable impact on planthopper control in paddy fields. Moreover, the incorporation of Sesamum indicum, a nectar plant, into the bank plant system consisting of L. sayanuka, Nilaparvata muiri, and Anagrus nilaparvatae, led to a significant increase in the population of Anagrus spp. in rice fields. This increase was accompanied by a rise in the egg parasitism rate targeting rice planthoppers, resulting in a marked improvement in overall rice planthopper control in paddy fields. Thus, the combined system demonstrated efficiency as an effective bank plant system for managing rice planthoppers.

This paper addresses the input coupling problem for the shape memory alloy (SMA) actuated parallel platform with completely unknown nonlinear dynamics. The problem means that in a parallel platform with multiple SMA actuators acting together, the displacement of one of the actuators will simultaneously affect the remaining actuators to change. Due to the coupling problem and nonlinear characteristics of the SMA actuators, it is not easy to control the platform to achieve bi-directional swing with completely unknown nonlinear dynamics. Therefore, a model-free adaptive sliding mode control method is proposed to improve the control accuracy of the complex motion of the platform, avoiding the complex modeling process of the SMA actuated parallel platform. Based on the model-free adaptive control (MFAC) theory, a multiple input and multiple output (MIMO) dynamic linearized mathematical model of the parallel platform is established using the online input and output data of the system. Then, a sliding mode controller is designed based on the dynamic model. A rigorous theoretical analysis proves that the proposed model-free adaptive sliding mode controller is able to stably control the SMA actuated parallel platform, and its tracking error is uniformly ultimately bounded (UUB). Finally, experiments are conducted on the established SMA actuated parallel platform. The results show that the proposed model-free controller is feasible and effective, and can control the system well to achieve the complex motion of bi-directional swing.

This study investigated the efficiency of scale-propellers, typically used on small drones. A scale-propeller is accepted as having a diameter of 7 to 21 inches. The Ukraine War has demonstrated the utility of relatively small, low-cost first-person view (FPV) drones, which are attritable. This investigation outlines the development of a MATLAB optimisation code, based on minimum induced loss propeller theory, which calculates the optimal chord and twist distribution for a chosen propeller operating in known flight conditions. The MATLAB code includes a minimum Reynolds number functionality, which provides the option to alter the chord distribution to ensure the entire propeller is operating above a set threshold value of Reynolds (>100,000), as this has been found to be a transition point between low and high section lift-to-drag ratios. Additional functions allow plotting of torque and thrust distributions along the blade. The results have been validated on experimental data taken from an APC ‘Thin Electric’ 10” x 7” propeller, where it was found that both the chord and twist distributions were accurately modelled. The MATLAB code resulted in a 16% increase in the maximum propulsive efficiency. Further work will investigate a direct interface to SolidWorks to aid rapid propeller manufacturing capability.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

This paper extends the concept of weighted graphs to matrix weighted graphs. The consensus algorithms dictate that all agents reach consensus when the weighted graph is connected. However, it is not always the case for matrix weighted graphs. The conditions leading to different types of consensus have been extensively analysed based on the properties of matrix-weighted Laplacians and graph theoretic methods. However, in practice, there is concern on how to pick matrix-weights to achieve some desired consensus, or how the change of elements in matrix weights affects the consensus algorithm. By selecting the elements in the matrix weights, different clusters may be possible. In this paper, we map the roles of the elements of the matrix weights in the systems consensus algorithm. We explore the choice of matrix weights to achieve different types of consensus and clustering. Our results are demonstrated on a network of three agents where each agent has three states.

LR004 is a novel chimeric (human/mouse) monoclonal antibody developed for the treatment of advanced colorectal carcinoma with detectable epidermal growth factor receptor (EGFR) expression. We aimed to investigate the preclinical pharmacokinetics (PK) and in vivo biodistribution of LR004. The PK profiles of LR004 were initially established in rhesus monkeys. Subsequently, 125I radionuclide-labeled LR004 was developed and its binding activity to the EGFR antigen were evaluated. Furthermore, the biodistribution, autoradiography, and NanoSPECT/CT of 125I-LR004 in xenograft mice bearing A431 tumors were examined. The PK data revealed a prolonged half-life and nonlinear PK characteristics of LR004 within the dose range of 6–54 mg/kg. The radiochemical purity of 125I-LR004 was approximately 98.54%, and iodination of LR004 did not affect its specific binding activity to the EGFR antigen. In a classical biodistribution study, 125I-LR004 exhibited higher uptake in highly perfused organs than in poorly perfused organs. Prolonged retention properties of 125I-LR004 in tumors were observed at 4 and 10 days. Autoradiography and NanoSPECT/CT confirmed the significant accumulation and sustained retention of 125I-LR004 at the tumor site in xenograft mice. These findings demonstrated the adequate tumor targeting capabilities of 125I-LR004 in EGFR-positive tumors, which may improve dosing strategies and future drug development.

Wear-resistant steel/carbon steel composite plate not only has the double performance advantage of high strength and wear-resistance, but also can reduce energy consumption and production cost. Based on 50% reduction rate, the wear resistance of BTW1/Q345 composite was studied at different annealing temperatures, and the dry friction and wear tests of BTW1/Q345 composite at different annealing temperatures were carried out by using RETC MFT-5000. The macro-micro morphology and wear mechanism of wear marks at different annealing temperatures were analyzed by using white light interference three-dimensional surface profiler, Scanning electron microscope scanning electron microscope (SEM) and backscatter electron diffraction (EBSD) . The results show that with the increase of annealing temperature, the grain size near the scratch of BTW1 in the wear-resistant layer of the composite plate is refined, and the wear-resistant property is higher than that of the original sample.When the annealing temperature is 860℃,the wear resistance is the best.

This paper systematically discusses the application of reinforcement learning in automatic driving system. Reinforcement learning frameworks show significant advantages in optimizing decision making, predictive perception, path planning, and controller design, exceeding the limitations of traditional supervised learning methods. The paper highlights the critical role of components such as scene understanding, positioning, and map making in autonomous driving systems, which provide reliable environmental awareness through deep learning and sensor fusion technologies to support intelligent decision-making in complex urban environments. In addition, the paper discusses innovative approaches to safety reinforcement learning to reduce risk in autonomous driving and ensure that systems adhere strictly to safety constraints while maximizing expected rewards. These findings provide an important theoretical and practical basis for further improving algorithm robustness, managing multi-agent interactions, and integrating ethical considerations in the future.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Abstract Background: Parkinson's disease (PD) is a neurodegenerative disorder featured with motor and non-motor deficits. Using 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) induced dopamine neuron degeneration has been widely used to produce reliable animal models of the PD. However, most of previous preclinical studies focused on the motor dysfunctions, few non-motor symptoms were evaluated. So far there is a lack of comprehensive investigation of the non-motor symptoms in animal models. Objectives: In this study, we aim to use a battery of behavioral methods to evaluate the non-motor symptoms in MPTP-induced non-human primate PD models. Methods: Cognitive functions, sleep and psychiatric behaviors were evaluated in MPTP-treated cynomolgus monkeys. The tests consisted of delayed matching-to-sample (DMTS), physical activity monitor (PAM), apathy feeding task (AFT), human intruder test (HIT), novel fruit test (NFT) and predator confrontation test (PCT). In addition, we tested whether the dopamine receptor agonist pramipexole (PPX) will improve these non-motor symptoms. Results: The present results show that the MPTP-treated monkeys exhibited cognitive deficits, abnormal sleep, and anxiety-like behaviors as compared to the control monkeys. These symptoms were relieved partially by PPX. Conclusions: These results suggest that MPTP-induced PD monkeys displayed non-motor symptoms that were similar to those found in PD patients. PPX treatment showed moderate therapeutic effects on these non-motor symptoms. This battery of behavioral tests may provide a valuable model for future preclinical research.

With the increase of global human activities, a large number of technogenic magnetic particles (TMPs) generated by industrial activities such as coal combustion, traffic and so on enter sediments on continental shelves. However, there is currently a lack of understanding of the spatiotemporal distribution of TMPs on continental shelves, as well as the sedimentary effects they cause. This review work comprehensively analyzes the source, morphology, composition, and spatiotemporal distribution characteristics of TMPs. Then it elucidates their magnetic contribution to sedimentary environments in continental shelf seas, as well as the influence of heavy metals and active iron. At the same time, the existing problems and future development directions of TMPs on continental shelves are summarized.

The porous structure is an important three-dimensional morphological feature of the peripheral nerve guidance conduit (NGC), which permits infiltration of cells, nutrients, and molecular signals, and the discharge of metabolic waste. Porous structures with precisely customised pore sizes, porosities, and connectivities were used to construct fully permeable, semi-permeable, and asymmetric peripheral NGCs to replace traditional nerve autografts in treatment of long-segment peripheral nerve injury. In this review, the features of porous structures and classification of NGCs based on these characteristics are discussed. Common methods for constructing 3D porous NGCs in current research are described, as well as the pore characteristics and the parameters used to tune the pores. The effects of the porous structure on the physical properties of NGCs including biodegradation, mechanical performance, and permeability were analysed. Pore structure affects the biological behaviour of Schwann cells, macrophages, fibroblasts, and vascular endothelial cells during peripheral nerve regeneration. Construction of ideal porous structures is a significant advancement in the regeneration of peripheral nerve tissue engineering materials. The purpose of this review is to generalise, summarise, and analyse the preparation methods for porous NGCs and their biological functions in promoting peripheral nerve regeneration to guide development of medical nerve repair materials.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Bipolar disorder is a severe mood disorder and is one of the top 20 reasons of disability in the world. It causes a huge burden on society. In this study, the prediction models of bipolar disorder were constructed based on the concept of knowledge distillation. The input data consisted of patients of bipolar disorder and matched controls, all of which were selected from the open database MIMIC. The method of kernel density estimation (KDE) was exploited to generate probability density functions (PDF) which identify distributions of input data. The PDF values referred to as the soft labels were combined with the input data to construct the prediction models of bipolar disorder using decision tree and artificial neural network respectively. According to the evaluation results, indicators for identifying positive samples of bipolar disorder were improved. Meanwhile, the indicators for identifying negative samples have also been advanced. In addition, the branching attributes selected by the decision trees can be mapped back to specific disease diagnoses, which are all associated with bipolar disorder. In conclusion, using KDE to generate the soft label information of the input data can make knowledge distillation work and has improved the performances of prediction models for bipolar disorder.

We present a method to study the interannual variability of the annual cycle. The method consists of first determining the amplitude and phase of segments of 12 monthly means at all spatial points, resulting in one complex number per grid point and per year. The complex fields, once per year, are then subject to a complex EOF (CEOF) analysis. We consider as an example the barotropic stream function in the South China Sea as simulated with an ocean general circulation model across 6 decades of years, driven my realistic (NCEP) weather forcing. We find 3 to 4 to “significant” CEOFs, which account for about 53 to 62% of variance. These CEOFs go with large-scale patterns. Their time coefficients are mostly stationary, but point to some inhomogeneities related to instationarities in the forcing. In particular, the simulation since 1950-1958 deviates from the remainder of the simulation. The first CEOF describes variations in the center of the South China Sea. Its principal component describes a systematic, albeit noisy shift by almost 180o from 1960 to about the year 2000. When overlaid the long-term mean annual mean, the overall change consists of an amplification of the annual cycle in the 1960s and 1990s, whereas In the 1970s, the amplitude was reduced. Phase shifts in the anomaly (given by the CEOFs) have a small effect, because of the dominance of the mean annual cycle. These variations are not related to ENSO variability but may origin in variations of the Southeast monsoon. The second EOF represents strong changes, both in terms of intensity and phase, in the Luzon strait.

Using the Super-SBM method, this study calculates the carbon emission efficiency (CEE) of 30 provinces in mainland China from 2011 to 2019. Then, using the systematic GMM model, spatial Durbin model, and mediating effect model, it examines the direct effect, spatial effect, and influence mechanism of the digital economy (DE) on CEE. It was found that (1) the DE significantly promoted regional CEE, but had a negative effect on CEE in provinces with high economic correlation; (2) mechanism studies showed that the DE improved CEE by reducing energy intensity, promoting industrial upgrading and green technology innovation; (3) regional heterogeneity analysis found that the DE significantly improved CEE in eastern provinces, but not in central and western provinces. DE improves CEE in provinces with high level of economic development, but decreases CEE in provinces with low level of economic development.This paper provides some empirical and theoretical references for the development of DE to improve CEE.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

The essence of cross-modal generation and retrieval modeling for image-text interactions lies in semantic consistency. Among these, cross-modal representation alignment serves as the foundational requirement for achieving cross-modal semantic consistency. The crux of our proposed method entails the collaborative training of an image captioning model(referred to as the ’captioner’) and a pair of contrastive encoders for image-text matching(referred to as the ’concoder’). This synergistic approach yields concurrent enhancements in concoder’s performance, captioner’s proficiency, and cross-modal semantic coherence. We coin the proposed method as ‘ReCap’. To begin, we initialize the concoder through knowledge distillation from a pre-trained model. During the training process, we use the output of the initialized concoder as input to a residual attention network, jointly training it with the captioner to achieve semantic consistency. Subsequently, we iteratively update the concoder during the image-text momentum encoding phase using the residual attention network, creating a closed-loop for semantic consistency resolution. Upon completion of training, the concoder and captioner modules can be used independently to perform tasks related to cross-modal retrieval and cross-modal generation of text and images. In order to substantiate the efficacy of our proposed method, we initially conducted empirical experiments encompassing image-text retrieval and image captioning tasks, employing a widely recognized benchmark dataset, MSCOCO. Subsequently, we assessed the fine-grained cross-modal alignment performance of the concoder through an image classification task on the iNaturalist 2018 dataset. The achieved performance metrics notably surpassed those achieved by several incumbent state-of-the-art models, thus validating the proficiency of our method. Finally, motivated by the practical requirements of handling the nature conservation image data, we performed caption annotation for the iNaturalist 2018 dataset. Subsequently, we trained the ReCap on this annotated data. Experimental results demonstrate that our proposed method can maintain semantic consistency between cross-modal retrieval and image caption generation for species with similar visual features but distinct semantics. This achievement signifies a meaningful exploration in the field of cross-modal semantic consistency representation, holding significant practical value in the domain of biological research.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

Alzheimer’s disease and related dementias (ADRD) remain a public health challenge in developing counties. We developed a needs-based essential care service package (ECSP) for care planning of persons living with dementia (PLWD) using a cross-sectional survey among PLWD in institutions in six cities in China (n= 1,299). Face-to-face interviews were conducted with caregivers of PLWD by trained staff between 2018 and 2019. Care service needs and utilization by the level of cognitive impairment were summarized. The average age of PLWD was 80.7 years. 76% of participants had severe cognitive impairment. The needs-based ECSP with 30 service items would be sufficient in supporting care services of PLWD in China, of which seven items are core care. The selection plan for ECSP at different levels is designed as “General Care Services + Selective Care Services”, in which service items for low-, mid-and high-level care for PLWD are 7+3, 7+6, and 7+10, respectively. The findings provide the first large-scale data on service needs and utilization of PLWD in mainland China. The ECSP for PLWD advanced in the paper was a practicable and effective quantitative management means. It is deserved to application in a large scale.

In this paper we study a class of impulsive delayed neural networks with parameter uncertainties and reaction-diffusion terms. Using the properties of M-matrices and some inequality techniques, some sufficient conditions are derived to guarantee the global exponential stability of the given system. The results obtained are presented by simple algebraic inequalities, which are certainly more concise than previous methods. Finally, the validity and usefulness of our results are illustrated by arithmetic examples.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

The construction industry is an important part of the national economic market of various countries; since 2013, the construction industry's added value in the gross domestic product has been more than 6%, reaching 6.89% in 2022, and is a pillar industry of the national economy. Intelligent construction is the realistic demand to promote the high-quality development of China's construction industry. It is the key focus of transforming and upgrading the traditional construction industry to information, digital, and intelligent. As a new production factor, construction robots have become the key to promoting intelligent construction. Under the guidance of various national and industry policies, thanks to China's huge construction market volume and rich application scenarios, many innovative and entrepreneurial entities have entered the field of construction robots. Architectural visualization is a crucial aspect of architectural design and communication. With the development of science and technology, artificial intelligence (AI) technology is increasingly becoming an essential tool for architectural visualization and communication. The emergence of AI technology has provided architects with more flexible and creative ways to present design ideas. All along, designers who love architecture have been passionate about exploring better solutions for architecture, but there is never an optimal solution for architectural design; AI is the fire of the future era; it brings us more opportunities but also forces us to face new challenges from the future.

Background Hokkaido is the northernmost, least populous, and coldest of the Japanese islands. It was the first prefecture to be affected by COVID-19, while Kanagawa is home to one of the most populous areas of Japan, namely the Tokyo metro area. The Japanese government responded early during the pandemic by identifying infected patients, contact tracing, and performing PCR analysis on anyone who was suspected of having been exposed to SARS-CoV-2. The government has also been publishing information about each individual who tested positive for the virus. Both Hokkaido and Kanagawa started recording COVID-19 cases in the winter of 2020 and have detailed records of thousands of patients, thus providing an invaluable resource for the transmission and behavior of the virus. Methods The current study analyzed the COVID-19 registry data from the Hokkaido and Kanagawa prefectures. The Hokkaido registry contained 1,269 cases (674 (53%) females and 595 (47%) males) recorded between February 14 and July 22, 2020. The Kanagawa registry had 3,123 cases (1,346 (43%) females and 1,777 (57%) males. The final data contained a total of 4,392 cases (2,020 (46%) females and 2,372 (54%) males). By leveraging the information on viral transmission paths available in the registry data, we performed exponential random graph model (ERGM) network analysis to examine demographic and symptomological homophilies of the SARS-CoV-2 viral transmission networks. Results We observed age, symptomatic, and asymptomatic homophilies in both prefectures. Furthermore, those patients who contracted the virus through secondary or tertiary contacts were more likely to be asymptomatic than those who contracted it from primary infection cases. The transmission networks showed that transmission occurred significantly in healthcare settings, as well as in families, although the size of the networks was small in the latter. Most of the transmissions stopped at the primary and secondary levels and no transmission beyond quaternary was observed. We also observed a higher level of asymptomatic transmission in Kanagawa than in Hokkaido. Conclusions Symptom homophilies are an important component of COVID-19 and suggest that nuanced genetic differences in the virus may affect its epithelial cell type range and can thus result in the diversity of symptoms seen in individuals infected by SARS-CoV-2. Moreover, environmental variables such as temperature and humidity may also be playing an important role in the overall pathogenesis of the virus.

Traffic sign detection plays a pivotal role in autonomous driving systems. The intricacy of the detection model necessitates high-performance hardware. Real-world traffic environments exhibit considerable variability and diversity, posing challenges for effective feature extraction by the model. Therefore, it is imperative to develop a detection model that is not only highly accurate but also lightweight. In this paper, we proposed YOLO-ADual, a novel lightweight model. Our method leverages the C3Dual and Adown lightweight modules as replacements for CPS and CBL modules in YOLOv5. The Adown module effectively mitigates feature loss during downsampling while reducing computational costs. Meanwhile, C3Dual optimizes the processing power for kernel feature extraction, enhancing computation efficiency while preserving network depth and feature extraction capability. Furthermore, the inclusion of the CBAM module enables the network to focus on salient information within the image, thus augmenting its feature representation capability. Our proposed algorithm achieves a [email protected] of 70.1% while significantly reducing the number of parameters and computational requirements to 51.83% and 64.73% of the original model, respectively. Compared to various lightweight models, our approach demonstrates competitive performance in terms of both computational efficiency and accuracy.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

With an increase in energy consumption globally, Fischer-Tropsch (FT) synthesis is a good alternative for producing fuels and chemicals from coal, natural gas or biomass. Among them, coal to liquids has been put into production in countries that have large coal reserves. In this process, Fe-based catalysts are commonly used due to their earth abundance, comparatively wide operation range and ready availability to handle low H2/CO ratio from coal. Despite their extensive applications, the kinetic and mechanistic understandings of Fe carburization and FT reaction on Fe-carbides are relatively limited due to the complexity of phase composition of the applied catalysts. This review summarizes the current state of knowledge of FT synthesis on Fe-carbide with an emphasis on underlying mechanism. Specifically, the employment of model catalyst, such as Raney-Fe, could provide a convenient way to furnish kinetic information regarding Fe carburization and subsequent FT reaction. A major challenge for further understanding catalytic reactions occurring at the Fe-carbide surface is correlating FT activity and selectivity to specific active site. To address this issue, the advancements of both DFT calculations and surface science techniques are highly demanded.

Recommender Systems (RecSys) are crucial in managing information overload and enhancing user satisfaction across various digital platforms, including e-commerce and entertainment. Evolving from traditional models to Deep Neural Networks (DNNs) and, more recently, Large Language Models (LLMs), these systems leverage sophisticated algorithms to analyze user behaviors and preferences. LLMs, such as GPT-4, are trained on extensive datasets to comprehend and generate natural language, significantly advancing their ability to deliver personalized recommendations. This tutorial explores the transformative impact of LLMs on RecSys, discussing their development, application in handling complex datasets, and the integration of contextual insights. Real-world examples illustrate how LLMs enhance recommendation accuracy and user experience, highlighting challenges and future directions in the field.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

With the development of artificial intelligence, the ability of capturing the background characteristics of hyperspectral imagery (HSI) is improved and promising performance in hyperspectral anomaly detection (HAD) tasks is yielded. However, existing methods proposed in recent years still suffer from certain limitations: 1) constraints are lacking in the deep feature learning process in terms of the issue for absence of prior background and anomaly information. 2) hyperspectral anomaly detectors with traditional self-supervised deep learning methods fail to ensure prioritized reconstruction of the background. 3) architectures of fully connected deep network in hyperspectral anomaly detectors lead to low utilization of spatial information and destruction for original spatial relationship of hyperspectral imagery, and disregard spectral correlation between adjacent pixels. 4) hypotheses or assumptions for background and anomaly distributions restrict the performance of many hyperspectral anomaly detectors because the distributions of background land covers are usually complex and not assumable in real-world hyperspectral imagery. With the consideration of above problems, in this paper, we propose a novel fully convolutional auto-encoder based on dual clustering and latent feature adversarial consistency (FCAE-DCAC) for HAD which is carried out in a self-supervised learning-based processing. Firstly, the density-based spatial clustering of applications with noise algorithm and connected component analysis are utilized for successive spectral and spatial clustering to obtain more precise prior background and anomaly information, which facilitates the separation between background and anomaly samples during the training of our method. Subsequently, a novel fully convolutional auto-encoder (FCAE) integrated with spatial-spectral joint attention (SSJA) is proposed to enhance the utilization of spatial information and augment feature expression. In addition, a latent feature adversarial consistency network is proposed to achieve pure background reconstruction with the ability of learning actual background distribution in hyperspectral imagery. Finally, a triplet loss is introduced to enhance the separability between background and anomaly, and the reconstruction residual serves as the anomaly detection result. We evaluate the proposed method on seven groups of real-world hyperspectral datasets, and the experimental results confirmed the effectiveness and superior performance of the proposed method versus nine state-of-the-art methods.

The present study examined and compared the effects of high- and low-molecular weight (MW) chitosan, a nutraceutical, on intestinal and liver lipid metabolism in rats fed with high-fat diet. Both high- and low-MW chitosan decreased liver weight, elongated small intestine, improved the dysregulation of blood lipids and liver fat accumulation, and increased fecal lipid excretion in high-fat diet-fed rats. Supplementation of both high- and low-MW chitosan significantly inhibited the decreased phosphorylated AMP-activated protein kinase (AMPK)α and peroxisome proliferator-activated receptor (PPAR)α protein expressions and the increased lipogenesis/cholesterogenesis-associated protein expressions (sterol regulatory element binding protein (SREBP)1c, SREBP2, and PPARγ) and the decreased apolipoprotein (Apo)E and microsomal triglyceride transfer protein (MTTP) protein expressions in the livers of high-fat diet-fed rats. Both high and low-MW chitosan supplementation could also suppress the increased MTTP protein expression and the decreased angiopoietin-like protein (Angptl)4 protein expression in the intestines of high-fat diet-fed rats. Comparison between high and low-MW chitosan, high-MW chitosan has a higher efficiency than low-MW chitosan on the inhibition of intestinal lipid absorption and the increase of hepatic fatty acid oxidation, which can improve liver lipid biosynthesis and accumulation.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

The application of AI technology in urban planning covers multiple levels, such as data analysis, decision support, and automated planning. Urban research relies on AI technology to understand and summarize the law of urban growth and improve the analysis of the evolution trend of urban space. Planning and design use AI technology to explore the relevant factors affecting urban development and their weights and discuss the critical role of green building technology in the sustainable development of the construction industry. With the increase in global energy consumption and carbon emissions, traditional building methods can no longer meet environmental protection requirements and efficient use of resources. As a sustainable development solution, green building technology has been paid more and more attention to and adopted by people. These technologies focus not only on the energy efficiency and environmental impact of buildings but also on the resource utilization and environmental load of green buildings over their entire life cycle driven by machine learning. This paper details the basic principles and applications of green building technologies, including AI-driven reduction of negative environmental impacts, improvement of occupant health, efficient use of resources, and optimization of indoor environmental quality. This paper focuses on the critical role of the LEED assessment system developed by the U.S. Green Building Council in advancing green building practices. In addition, the paper analyzes vital points such as water use in green building design, machine learning-driven wind environment optimization, solar technology application, and practical application cases of these technologies on a global scale.