A novel coronavirus (2019-nCoV) was first identified in Wuhan, Hubei Province, and then spreads to the other Provinces of China. 2019-nCoV was reported to share the same receptor, Angiotensin-converting enzyme 2 (ACE2), with SARS-CoV. Previous studies have found ACE2 is abundantly present in humans in the epithelia of the lung and small intestines, and they found ACE2 expression in the basal layer of the non-keratinizing squamous epithelium in nasal and oral mucosa and the nasopharynx. Here based on the public single-cell RNA-Seq datasets, we analyzed the ACE2 expression in the nasal, mouth, lung, and colon tissues. We find that the number of ACE2-expressing cells in the nasal tissue and mouth is comparable to the number of ACE2-expressing cells in the lung tissue and colon. We also find that ACE2 tends to be co-expressed with HLA-DRB1, which plays a central role in the immune system by presenting peptides derived from extracellular proteins, in the nasal, mouth, lung, and colon tissues at single-cell resolution. We hope this provides valuable information for virus-prevention strategy and therapeutic strategy development.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

This study investigated whether reciprocal collaborative pedagogy significantly impacts Indonesian electrical engineering polytechnic students in reducing reading anxiety and improving self-efficacy in ESP reading comprehension skills. Fifty Polytechnic students were equally assigned to two groups. Control groups learned in the traditional reciprocal teaching method individually. Experimental group engaged in reciprocal collaborative pedagogy. Each group received a 6-week reading strategy training. E-learning platforms were used in this study as a complementary tool to distribute ESP reading materials, announcements, and the experiment details being taught. The quantitative and qualitative results demonstrated that the tasks in reciprocal collaborative pedagogy positively affects Indonesian electrical engineering polytechnic students' learning experience and outcomes. This pedagogy promotes a productive learning environment through peer interaction, active engagement, and peer group discussions of the whole learning activities, reducing feelings of anxiety and building confidence in ESP-specialized text.

The growing number of the accessed energy-efficient frequency conversion air conditioners is likely to generate a large number of harmonics on the power grid. The following shortage in the reactive power of peak load may trigger voltage collapse. Hence, this conflicts with people’s expectations for a cozy environment. Concerning the problems mentioned above, an active management scheme is put forward to balance the electricity use and the normal operation of air conditioning systems. To be specific, schemes to suppress the low voltage ride through (LVRT) and harmonic are designed firstly. Then to deaden the adverse effects caused by nonlinear group load running on the grid, and to prevent the unexpected accidents engendered from grid malfunction, the dynamic sensing information obtained by an online monitor is analyzed, which can be seen as an actively supervise mechanism. The combined application of active and passive filtering technology is studied as well. Thirdly, the new energy storage is accessed reliably to cope with peak-cutting or grid breaking emergencies, and the fuzzy control algorithm is researched. Finally, system feasibility is verified by functional modules co-operation simulation, and active management target is achieved under scientific and reasonable state-of-charge (SOC) management strategy.

Ransomware constitutes a distinctive category of pernicious software that sequesters a user's digital assets by encryption, holding them hostage until a sum is extorted from the victim. These incursions have escalated to become among the most prevalent and significant threats confronting both individuals and corporate entities. In combatting this virulent program, dynamic analysis has been established as the favored detection modality. Such analyses typically hinge on Windows API calls, the conduits through which programs requisition services from the operating system. Yet, the superfluous and unrelated Windows API calls interjected by adversaries into the execution stream of suspect binaries precipitate an excessively noisy behavioral sequence, which impairs the performance of counter-ransomware mechanisms. The research outlined herein introduces a novel non-signature-based detection paradigm that harnesses efficacious Windows API call sequences through supervised machine learning strategies. An innovative Enhanced Min Max (EmRmR) filter technique is proposed, aiming to purge noisy features and isolate the most indicative feature subset that encapsulates the ransomware's true behavior. The EmRmR method, diverging from the traditional Min Max approach, circumvents the superfluous calculations that are a hallmark of the conventional algorithms, thereby necessitating a reduced number of evaluations. Additionally, a refinement procedure has been integrated to contract the program's call trace volume by discarding those Windows API calls lacking a robust correlation with ransomware's pivotal behavior. Subsequent to rigorous experimental analyses and juxtaposition with extant behavior-based detection methodologies, the proposed strategy has demonstrated its efficacy in differentiating ransomware behavior, delivering high detection precision alongside a diminution in false-positive occurrences.

The management of blunt abdominopelvic trauma with combined hemoperitoneum and pelvic fractures is challenging for trauma surgeons. Although angioembolization can achieve hemostasis in most visceral organ injuries and pelvic fractures after blunt abdominal trauma, it cannot effectively control hemorrhage in patients with blunt bowel mesenteric injury (BBMI). This study aimed to determine the risk factors associated with hemodynamically unstable patients with BBMI and to test the hypothesis that pelvic fracture is an independent risk factor for patients with unstable BBMI and concomitant pelvic fracture to guide the therapeutic sequence for difficult-to-manage patients. This retrospective study reviewed the data of hospitalized patients with trauma between 2009 and 2021 and included 158 adult patients with surgically proven BBMI. The patients were divided on the basis of the presence of a shock episode before emergency laparotomy. The shock group included 44.3% of all patients in the study (n = 70). Clinical injury severity and prognosis for patients in the shock group were poorer than those for patients in the non-shock group, and more invasive treatments and transfusions were performed for patients in the shock group than for those in the non-shock group. Pelvic fractures were more frequently associated in the shock group than in the non-shock group (21.4% vs. 5.7%; p = 0.003). In multivariate analysis, the presence of intracerebral hemorrhage (odds ratio [OR] = 10.87, 95% confidence intervals [CIs]: 1.70–69.75) and rib fracture (OR = 5.94, 95% CIs = 1.06–33.45) were identified as independent predictors of shock, whereas the effect of pelvic fracture did not achieve statistical significance (OR = 2.94, 95% CIs = 0.66–13.13) after adjusting for confounding factors. For patients with BBMI, outcomes need to be improved during early diagnosis and treatments should be expeditiously performed on the basis of the rapid identification of unstable hemodynamic status. In unstable patients with concomitant pelvic fractures, we support the current management algorithm that recommends performing laparotomy first.

The rapid development of digital multimedia has resulted in a massive storm of large-scale data. The data compression method reduces data size and lowers transmission costs. As a result, data-hiding research in the compression domain poses significant challenges to researchers. This paper proposes a highly imperceptible data-hiding scheme for a compressed image of Absolute Moment Block Truncation Coding (AMBTC). The combination theory is implemented to ensure the high imperceptibility of the modified compressed images. By only modifying one pixel in a block to embed secret bits, the experimental results show that the proposed method achieved high imperceptibility and high hiding capacity.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

This study proposes and validates a novel combustion control system for Oil-Fired Boilers aimed at reducing air pollutant emissions through flame image prediction. The proposed system is easily applicable to existing ships. Traditional proportional combustion control systems supply fuel and air at fixed ratios according to the set steam load, without considering the emission of air pollutants. To address this, a stable and immediate control system is proposed, which adjusts the air supply to modify the combustion state. The combustion control system utilizes oxygen concentration predictions from flame images via SEF+SVM as control inputs, and applies Internal Model Control (IMC)-based Proportional-Integral (PI) control for real-time combustion control. Due to the complexity of modeling the image-based system, IMC parameter tuning through experimentation is essential for achieving effective control performance. Experiments conducted on a 3000 kg/h marine oil-fired boiler in actual operation optimized the controller parameters for stability and responsiveness, and validated their effectiveness. The results demonstrate the potential of the proposed system to improve combustion efficiency and reduce emissions of air pollutants. This study provides a feasible and effective solution for enhancing the environmental performance of marine oil-fired boilers. Given its ease of application to existing ships, it is expected to contribute to sustainable air pollution reduction across the maritime environment.

The ANFC/ABPE-10 composite film was prepared by ABPE-10 impregnating into ANFC films under negative pressure. And the composite film had meted high performance FOLED substrate requirement even when ANFC dosage was high for approximately 70%, which was consistent with for low cost efficiency, recyclability, and environmentally friendly. The enhanced properties of ANFC films were mainly because of the nature of ABPE-10 itself and the IPN structure formed between ABPE-10 and ANFC film. The transparency of composite films with different ANFC dosage was significantly increased from 67% to 88% by UV-Vis analysis. The composite film inherited the properties of AFNC, obtaining low CTE characteristics and ductile compact structure. The contact angles of ANFC films increased by 102% from 49.2° to 102.9°after dipping ABPE-10. Additionally, the composite films had outstanding mechanical properties such as tensile strength 173.72 MPa, Young’s modulus 4.06 GPa, and elongation at break 5.81%.

Praeruptorin A(PA), a naturally existing pyranocumarin, is isolated from the dried root of Peucedanum praeruptorum Dunn. So far the anti-cancer effect and molecular mechanism behind Praeruptorin A action in human cervical cancer HeLa cells remain unknown. In the present study, we find that PA reduces cell proliferation and colony formation of human cervical cancer HeLa cells through inducing cell cycle arrest at G0/G1 phase. PA-upregulated p21 and p27 proteins are observed, accompanied with inhibition of cyclin D1 and S-phase kinase-associated protein 2(Skp2) proteins expression. PA could significantly inhibit migration and invasion of human HeLa cells. Meanwhile, PA significantly reduces invasive protein expression of matrix metalloproteinase-2 (MMP-2), and increases protein expression of tissue inhibitor of metalloproteinase-2 (TIMP-2). PA is observed to possess the capacity in suppressing ERK1/2 activation. PD98059 (ERK specific inhibitor) significantly enhances PA-induced downregulation of MMP-2 expression, and upregulation of TIMP-2 expression. Moreover, we found that PA treatment notably inhibits 12-O-tetradecanoylphorbol-13-acetate(TPA)-upregulated ERK1/2 activation, MMP-2 expression, cellular migration and invasion in human HeLa cells. Taken together, these findings are the first to demonstrate the anti-cancer activity of PA, which may act as a promising therapeutic agent for the treatment of human cervical cancer.

The objective of this study is to investigate the effect of the premixed ethanol ratio based on the same total heating value in-cylinder on the equivalence ratio distributions and the injected fuel droplet behavior in the cylinder of the RCCI engine. The spray simulation was conducted by dividing two-part. First, the spray validation simulations progressed to find the spray-influenced factor of the test injector. Next, the engine simulations were performed with the spray-influenced factor obtained from spray validation simulations to investigate the effect of the premixed ethanol ratio based on the same total heating value in-cylinder on the injected fuel atomization and the equivalence ratio distributions. The introduced total heating value was fixed at 595J based on the lower heating value of diesel 14mg. The heating value of the premixed ethanol ratio varied from 0% to 40% based on the same total heating value in-cylinder in steps of 10%. It was revealed that when the premixed ethanol ratio based on the same total heating value in-cylinder was increased, the spray tip penetration value was reduced from the time after 4deg of diesel injection start because of the short injection duration by the small amount of diesel fuel. The SMD value was also more enormous up to 32.58% with increasing the premixed ethanol ratio because of the low kinetic energy of the injected fuel by the short injection duration and the slow evaporation of the injected fuel by the low cylinder temperature.

The skyrocketing growth in the number of Internet of Things (IoT) devices will certainly pose a huge traffic demand for fifth-generation (5G) wireless networks and beyond. In-band full-duplex (IBFD), which is theoretically expected to double the spectral efficiency of a half-duplex (HD) wireless channel and to connect more devices, has been considered as a promising technology to accelerate the development of IoT. To exploit the full potential of IBFD, the key challenge is how to handle network interference (including self-interference, co-channel interference and multiuser interference) more effectively. In this paper, we propose a simple yet efficient user grouping method, where a base station (BS) serves strong downlink users and weak uplink users and vice versa in different frequency bands, mitigating severe network interference. We aim to maximize a minimum rate among all users subject to bandwidth and power constraints, which is formulated as a highly nonconvex optimization problem. By leveraging inner approximation framework, we develop a very efficient iterative algorithm to solve this problem, which guarantees at least a local optimal solution. Numerical results are provided to show not only the benefit of using full-duplex raido at BS, but also the advantage of the proposed user grouping method.

To investigate the repair mechanism of umbilical cord mesenchymal stem cells (UC-MSCs) in hydrogel on pancreatic β-cells in diabetes, MIN-6 damaged by streptozotocin (STZ) in vitro was used in co-culture with UC-MSCs in hydrogel (UC-MSCs + hydrogel). It was found that UC-MSCs + hydrogel had a significant repair effect on injured MIN-6 cells, which was better than the use of UC-MSCs alone (without hydrogel). After repair, the expression of superoxide dismutase (SOD) and catalase (CAT) as well as the total antioxidant capacity (T-AOC) of the repaired MIN-6 cells were increased, effectively reducing the oxidative stress caused by STZ. In addition, UC-MSCs + hydrogel were able to curb the inflammatory response by promoting the expression of anti-inflammatory factor IL-10 and reducing inflammatory factor IL-1β. In addition, the expression of both nuclear antigen Ki67 for cell proliferation and insulin-related genes such as Pdx1 and MafA was increased in the repaired MIN-6 cells by UC-MSCs + hydrogel, suggesting that the repair effect promotes the proliferation of the injured MIN-6 cells. Compared with the use of UC-MSCs alone, UC-MSCs + hydrogel exhibited longer survival time of UC-MSCs, because the porous structure and hydrophilic properties of the hydrogel could affect the growth of cells and slow down their metabolic activities, resulting in a better repair effect on the injured MIN-6 cells.

To alleviate the contradiction between the increasing demand for water and the shortage of resources and to provide a favorable institutional environment for water rights trading, the Chinese government has strengthened the top-level design of water management system. However, the water-rich regions (southern regions of China) have good water resource endowment and a surplus of total water consumption indicators. Does this mean that there is no incentive and no need to conduct water rights trading in these regions? Through the investigation of water rights circulation cases in the Taihu Basin, a typical water-rich region of China, we established the existence of trading demand and some difficulties in conducting transactions. This paper argues that the needs of trading include alleviating the water gap in regional development, solving the water demand for large new projects, coordinating trans-jurisdiction water disputes. The plight of trading includes the lack of awareness, irregular process, excessive administrative intervention, and imperfect trading system.

We demonstrate hybrid integration of a lithium niobate microring resonator with a silicon nitride waveguide in the vertical configuration to achieve efficient light coupling. The microring resonator is fabricated on a lithium niobate on insulator (LNOI) substrate using photolithography assisted chemo-mechanical etching (PLACE). A fused silica cladding layer is deposited on the LNOI ring resonator. The silicon nitride waveguide is further produced on the fused silica cladding layer by first fabricating a trench in the fused silica using focused ion beam (FIB) etching for facilitating the evanescent coupling, followed by formation of the silicon nitride waveguide on the bottom of the trench. The FIB etching ensures the required high positioning accuracy between the waveguide and the ring resonator. We achieve Q-factors as high as 1.4*10^7 with the vertically integrated device.

Environmental, social, and governance (ESG) investment has become a common trend in capital markets, and many institutional investors have publicly declared their long-term ESG investment target (ESGIT). This study focuses on investors who conduct strategic asset allocation (SAA) using composite indices but establish their ESGIT outside the SAA process. A mismatch could arise between investors’ planned and actual portfolios because they must pursue their ESGIT by asset selection, which inevitably makes the constituents of their portfolios different from those of composite indices. To scrutinize the potential existence of a misalignment between their SAA and ESGIT, this study analyzes actual stock and bond indices over the past decade using traditional mean-variance optimization. The results reveal significant differences between the expected and realized performances, and the misalignment is more significant when the analysis period is divided into two sub-periods: stable and volatile. Specifically, the results indicate that the efficient frontier constructed using ESG indices significantly differs from that constructed using composite indices, and that the difference between these two efficient frontiers becomes more significant during volatile periods. Furthermore, the results show that investors cannot meet their targets if their ESGIT is established outside the SAA process.

The first appearance of viruses can date back to the late last century. As an effective form of malware, viruses reside in the permanent storage of target hosts. Before a virus can execute, that must load into memory from the persistent storage included in the associated file. Due to the reliable destructive power of viruses, many mechanisms have been developed to defend computer systems against these hazardous threats. Antivirus software is one of the most famous and popular among these mechanisms. Most antivirus software uses static analysis (signature-based) technology on files stored in permanent storage, such as hard disks or USB flashes, to detect viruses hidden in files. Fileless malware was developed to enhance the survivability of malware by circumventing detection. Fileless malware only exists in the target hosts’ memory, not files. Antivirus software cannot even access the fileless malware code, much less analyze it, since it may be performed in memory directly without needing to load it from a disk. As a result, it is difficult for an antivirus engine to defend a system against fileless malware attacks. This paper proposes a kernel-based solution called Check-on-Execution (CoE) to detect fileless malware on a Linux system. When a program is going to execute a piece of code in a writable and executable memory area of a process, CoE suspends the code execution first. Coe retrieves the code from memory, packs the code with an ELF header to create an ELF file, and uses VirusTotal to check the file to prevent a Linux system from executing fileless malware. Experimental results show that CoE noticeably enhances the ability of a Linux system to defend itself again fileless malware. CoE is also suitable for protecting a system from shell code injection attacks, such as buffer and heap overflow attacks. It is capable of handling even packed malware. But in this paper, we only focus on fileless malware.

Load variations in any power system result in losses escalation and voltage drops. With the sensible and optimal allocation of distributed generators (DGs), these problems could be considerably mitigated. It has been seen in the priorly existing methods that ideally allocation of DGs has been carried out during fixed loads and constant power requirements. However, in real scenarios the loads are always variable and allocation of DGs must be done in accordance to the variations of the connected load. Therefore, the current paper addressed the aforementioned problem by distinctive optimal allocation of DGs for each variability of 24hour load horizon. However, the single exclusive solution is considered among all allocations of 24 hours. The min-max regret concept has been utilized in order to deal with such methodology. Altogether, 24 scenarios are analyzed wherein each scenario corresponds to a specific hour of the respective day. The optimal allocation of DGs in terms of their optimal sizing and placement has been carried out by using three algorithms including battle royal optimization (BRO), accelerated particle swarm optimization (APSO) and genetic algorithm (GA). The multi-objective optimization problem is evaluated on the basis of minimum value criterion of the multi-objective index (MO). MO comprises of active and reactive power losses and voltage deviation. Hence, in order to find robustness of proposed technique, Conseil international des grands réseaux electriques (CIGRE’s) MV benchmark model incorporating 14 buses has been considerably used as a test network. In the end the results of three proposed algorithms have been compared.

A highly-integrated experimental system for plasma decomposition of fuels was built. Experiments were conducted and confirmed that macromolecular chain hydrocarbons were cracked by large-gap dielectric barrier discharge under the excitation of a microsecond-pulse power supply. Alkanes and olefins with a C atom number smaller than 10 as well as hydrogen were found in the cracked products of n-decane (n-C10H22). The combination of preheating and plasma decomposition had strong selectivity for olefins. Under strong discharge conditions, micromolecular olefins were found in the products. Moreover, there was a general tendency that micromolecular olefins gradually accounted for higher percentage of products at higher temperature and discharge frequency.

In this paper, we consider a reconfigurable intelligent surface (RIS)-assisted integrated satellite-high altitude platform-terrestrial networks (IS-HAP-TNs) that can improve network performance by exploiting HAP's stability and RIS's reflection. Specifically, the reflector RIS is installed on the side of HAP to reflect signals from the multiple ground user equipments (UEs) to the satellite. To aim at maximising system sum rate, we jointly optimize the transmit beamforming matrix at the ground UEs and RIS phase shift matrix. Due to the limitation of the unit modulus of the RIS reflective elements constraint, the combinatorial optimization problem is difficult to tackle it effectively by traditional solving methods. Based on this, this paper studies deep reinforcement learning (DRL) algorithm to achieve online decision making for this joint optimization problem. In addition, it is verified through simulation experiments that the proposed DRL algorithm outperforms the standard scheme in terms of system performance and execution time, and higher computing speed, making real-time decision making truly feasible。

Juvenile hormones (JH) play crucial roles in insect development, reproduction, and other physi-ological functions. Because JH is specific to arthropods, including insects, it has long been stud-ied for use in pest control. Accordingly, this study aimed to identify the substances that act as JH disruptors from edible plants. Curcuminoids generally exhibit a wide range of biological ac-tivities, such as antioxidant, anti-inflammatory, antibacterial, and insecticidal properties, and they exhibit insect growth inhibitory effects. Demethoxycurcumin and bisdemethoxycurcumin, two curcuminoids from the turmeric plant Curcuma longa L. inhibit the formation of a metho-prene-tolerant (Met)–Taiman (Tai) heterodimer complex as shown through in vitro yeast two-hybrid assays. An artificial diet containing 1% (w/v) demethoxycurcumin or bisdemethox-ycurcumin reduced the number of larvae, leading to no pupal development. Building on our re-sults regarding curcuminoids, researchers can use our study as a reference to develop eco-friendly pesticides.

Plant-derived compounds have been historically used for the treatment of various diseases and an important source of several clinically useful anti-cancer agents. The Artemisia annua is known as a medicinal herb that is effective against cancer. Thus, the purpose of this study was to investigate whether ethanol extracts of Artemisia annua could increase an anti-cancer effect against LS174T cells. Our results show that Artemisia annua extracts (AAE) induces apoptosis through the regulation of mitochondria outer membrane potential. We demonstrate that apoptosis is induced by p53-dependent manner when cells were treated with Nutlin-3 (MDM2 inhibitor) and LY294002 (Akt inhibitor). In addition, the apoptotic effect was also observed in the p53-independent manner through pifithrin-α (p53 inhibitor) and celecoxib (COX-2 inhibitor) treatment. As in in vitro, AAE induced apoptotic effects and regulated apoptosis-related proteins in LS174T xenograft model. Taken together, these results suggest that Artemisia annua extracts exerts an anti-cancer effect through p53-independent manner, as well as p53-dependent manner by p53´ translocation in LS174T colon cancer cells.

We demonstrate high quality (intrinsic Q factor ~2.8×106) racetrack microresonators fabricated on lithium niobate (LN) thin film with a free spectral range (FSR) of ~86.38 pm. By integrating microelectrodes alongside the two straight arms of the racetrack resonator, the resonance wavelength around the 1550 nm can be red shifted by 92 pm when the electric voltage is raised from -100 V to 100 V. The microresonators of the tuning range spanning over a full FSR is fabricated using photolithography assisted chemo-mechanical etching (photolithography assisted chemo-mechanical etching, PLACE).

Fusarium spp. are commonly associated with the root rot complex of soybean (Glycine max). Previous surveys identified six common Fusarium species from Manitoba, including F. oxysporum, F. redolens, F. graminearum, F. solani, F. avenaceum and F. acuminatum. This study aimed to determine their pathogenicity, assess host resistance and evaluate the genetic diversity of Fusarium spp. isolated from Canada. Pathogenicity was tested on two cultivars, ‘Akras’ (moderate resistance) and ‘B150Y1’ (susceptible), under greenhouse conditions. The virulence of the fungal isolates varied, with root rot severities ranging from 1.5 to 3.3 on a 0-4 scale. The six species were used to screen a panel of 20 Canadian soybean cultivars for resistance in a greenhouse. Cluster and principal component analyses were conducted based on the same traits as for the pathogenicity study. Two of the cultivars, ‘P15T46R2’ and ‘B150Y1’, were consistently found to be tolerant to F. oxysporum, F. redolens, F. graminearum and F. solani. To investigate the incidence and prevalence of Fusarium spp. in Canada, fungi were isolated from 106 soybean fields surveyed across Manitoba, Saskatchewan, Ontario and Quebec. Two-hundred twenty-one Fusarium isolates were identified, with phylogenetic analyses indicating diversity of the isolates in the major soybean production regions of Canada.

Relapsed leukemia following initial therapeutic response and remission is difficult to treat and causes high patient mortality. Leukemia relapse is due to residual quiescent leukemia cells that escape conventional therapies and later reemerge. Eliminating not only growing but quiescent leukemia cells is critical to effectively treating leukemia and preventing its recurrence. Such therapeutic agents, however, are lacking in the clinic. Here we report that a 4-arylmethyl derivative of the natural anticancer compound curcumin demonstrates a dual effect in eliminating both growing and quiescent leukemia cells. This curcumin derivative, C212, on the one hand, inhibits growing leukemia cells at a higher efficacy than curcumin by inducing apoptosis and cell cycle arrest; it, on the other hand, kills quiescent leukemia cells that are resistant to conventional chemotherapy drugs. Furthermore, C212 drives leukemia cells into and kills them at deep quiescence, avoiding the potential risk associated with awaking therapy-resistant subpopulation of quiescent leukemia cells. Lastly, we show that C212 induces apoptosis and drives cells into deep dormancy at least partially by binding to and inhibiting Hsp90, leading to client protein degradation and protein aggregation. Further elucidating the molecular mechanisms underlying the dual function of C212 in eliminating both growing and quiescent leukemia cells will aid the development of novel therapies against leukemia relapse.

To accurately and non-destructively monitor the growth of spring wheat in the Hetao Irrigation Area, UAV remote sensing was employed during various fertility stages. Digital image indices from diverse fertilization treatments were calculated and compared with physiological indices to identify the most sensitive digital image indices corresponding to these indices. The study underscored the critical importance of the flowering stage in the growth of spring wheat, thus highlighting the necessity of focusing on this stage. This finding reiterated that the flowering stage was pivotal for spring wheat development in the Hetao Irrigation Area. Several digital image indices, such as GLA, R, G, INT, g, GRVI, MGRVI, RGBVI, EXG, and GRRI, exhibited a high frequency of significant correlations with physiological indices during the four primary reproductive stages of wheat. Consequently, these sensitive digital image indices during the flowering stage can more effectively characterize the physiological indices of spring wheat.

In the mold machining process, the cutting tool is worn with machining time, thereby affecting the surface accuracy, leading to poor workpiece dimensions, even fracture. At present, many studies have used multiple sensors to detect the machining conditions of cutting tool and workpiece, including indirect measurement method and direct measurement method. The indirect measurement method, which has been studied widely, mainly uses sensors to capture signals for subsequent data analysis; the direct measurement method mainly analyzes the state of cutting shear zone. Due to the cut-in of cutting tool in the machining process, the workpiece is dislocated rapidly, generating considerable amount of heat, which is transferred to the chips, inducing color change on the surface of chips. Many engineers with machining experience often judge the machining state and tool life according to the chips. The engineers' experience is digitized in this study, and indirect measuring sensors are used to predict the tool life, so as to attain the objective for smart manufacturing, the average percentage error of MAPE using single vibration and voltage eigenvalues as input features is 10%, the voltage signal characteristic values and vibration signal characteristic values are combined. Finally, the chip surface chromaticity eigenvalue is combined with signal characteristic value. The average prediction error of BP-LM method is 7.85%, the average prediction error of GRNN method is 6.59%. Therefore, when the eigenvalue of chip surface chromaticity is added to the prediction result, it can enhance the accuracy of cutting tool wear value prediction more effectively than single sensor signal characteristic value.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Hepatocellular carcinoma (HCC) is one of the most common cancers and the main cause of cancer-related death globally. Immune dysregulation of CD4+ T cells has been identified as a role in the development of HCC. Nevertheless, the underlying molecular pathways of CD4+ T cells in HCC are not completely known. Thus, a better understanding of the dysregulation of lncRNA-miRNA/mRNA network might yield novel insights into the etiology or progression of HCC. In this study, circulating CD4+ T cells were isolated from the whole blood of 10 healthy controls and 10 HCC patients for next-generation sequencing of the expression of lncRNAs, miRNAs, and mRNAs. Our data showed that there was different expression of 34 transcripts (two lncRNAs, XIST and MIR222HG, 29 mRNA, and 3 other types of RNA) and 13 miRNAs in the circulating CD4+ T cells of HCC patients. The expression of the lncRNA XIST-related miRNAs and their target mRNAs was confirmed using real-time quantitative polymerase chain reaction (qPCR) on samples from 100 healthy controls and 60 HCC patients. The lncRNA–miRNA/mRNA regulation network was created using interaction data generated from ENCORI and revealed there are positive correlations in the infiltration of total CD4+ T cells and negative correlations in the infiltration of Th1 CD4+ T cells.

Interface solar steam generation (ISSG) are charming for its applications in desalination and wastewater treatment. Biomass is an attractive substrate for utilizing solar vapor evaporators because of its natural pore structure and water transportability. Polymers like polydopamine (PDA) and polypyrrole (PPy) with broadband spectrum absorption are fascinating in photothermal materials (PTMs). Herein, PDA coated daikon-based (PDA-DK) and PPy coated daikon-based (PPy-DK) PTMs have been exploited for solar steam generation. When polyethylene foam (PEF) was used as an insulating layer to limit heat loss from the PTMs to bulk water, the evaporation rate of PDA-DK and PPy-DK was raised from 0.82 kg m–2 h–1 and 0.96 kg m–2 h–1 to 1.50 kg m–2 h–1 and 1.60 kg m–2 h–1, respectively. Meanwhile, the corresponding photothermal conversion efficiency was increased to 89.01% and 98.97%, which was increased by nearly 40% under 1-sun irradiation. In addition, PDA-DK and PPy-DK exhibited remarkable stability for the solar steam generation without significant change through 15 cycles. Furthermore, PDA-DK and PPy-DK could effectively desalt seawater and purify dyeing wastewater. All the results indicate that PDA-DK and PPy-DK have great potential in real-world applications for solar steam generation.

A simple approach to enable water-management agencies employing free data to achieve the goal of using a single set of predictive equations for water-quality retrievals with satisfactory accuracy is proposed. Multiple regression-derived equations based on surface reflectance, band ratios, and environmental factors as predictor variables for concentrations of Total Suspended Solids (TSS), Total Nitrogen (TN), and Total Phosphorus (TP) were derived using a hybrid forward-selection method that considers Variance Inflation Factor (VIF) in the forward-selection process. Landsat TM, ETM+, and OLI/TIRS images were jointly utilized with environmental factors, such as wind speed and water surface temperature, to derive the single set of equations. The coefficients of determination of the best-fitting resultant equations varied from 0.62 to 0.79. Among all chosen predictor variables, ratio of reflectance of visible red (Band 3 for Landsat TM and ETM+, or Band 4 for Landsat OLI/TIRS) to visible blue (Band 1 for Landsat TM and ETM+, or Band 2 for Landsat OLI/TIRS) has a strong influence on the predictive power for TSS retrieval. Environmental factors including wind speed, remote sensing-derived water surface temperature, solar altitude, and time difference (in days) between the image acquisition and water sampling were found important in water-quality parameter estimation.

During the high-speed flight of a vehicle in the atmosphere, surface friction with the air generates aerodynamic heating. The aerodynamic heating phenomenon can create extremely high temperatures near the surface. These high temperatures impact material properties and the structure of the aircraft, so thermal deformation measurement is essential in aerospace engineering. This paper revisits high-temperature deformation measurement using the digital image correlation (DIC) technique under high-intensity blackbody radiation with a precise speckle pattern fabrication and a heat haze reduction method. The effect of speckle pattern on the DIC measurement has been thoroughly studied at room temperature, but high-temperature measurement studies have not reported such effects so far. We found that the commonly used methods to reduce the heat haze effect could produce incorrect results. Hence, we propose a new method to mitigate heat haze effects. An infrared radiation heater was employed to make an experimental setup that could heat a specimen up to 950 ℃. First, we mitigated image saturation using a short-wavelength bandpass filter with blue light illumination, a standard procedure for high-temperature DIC deformation measurement. Second, we studied how to determine the proper size of the speckle pattern under a high-temperature environment. Third, we devised a reduction method for the heat haze effect. As proof of the effectiveness of our developed experimental method, we successfully measured the deformation of stainless steel 304 specimens from 25 ℃ to 800 ℃. The results confirmed that this method can be applied to the research and development of thermal protection systems in the aerospace field.

This study compared condylar volume, length, and articular eminence (AE) characteristics in normal individuals and those with unilateral and bilateral juvenile idiopathic osteoarthritis (JOA). The 116 patients were divided into four groups: control (n=16), affected condyle of unilateral JOA (Aff-Uni) (n=36), non-affected condyle of JOA (NonAff-uni) (n=36), and bilateral JOA (Bi-JOA) (n=28). Volume and length differences in the condyle and AE were analyzed using ANOVA and Bonferroni post hoc tests. The results showed that Bi-JOA had significantly different condylar volume, especially in the condylar head (p<0.01), specifically the middle, anterior, and medial parts (p<0.05). Condylar length also differed among the groups, with differences observed between the control group and the other three groups, as well as between the bilateral group and the other three groups (p<0.01). AE total volume differed between the control group and Aff-Uni. In the detailed comparison, Aff-Uni and NonAff-Uni were smaller than the control group in the posterior, lateral, and medial sections (p<0.05). In conclusion, depending on the involvement of unilateral or bilateral JOA, there were differences in condylar volume and AE compared to the normal control group. Therefore, prognosis should be evaluated by distinguishing between patients with unilateral and bilateral JOA.

Histone demethylases, enzymes responsible for removing methyl groups from histone proteins, have emerged as critical players in regulating gene expression and chromatin dynamics, thereby influencing various cellular processes. LSD2 and LSD1 have attracted considerable interest among these demethylases because of their associations with cancer. However, while LSD1 has received significant attention, LSD2 has not been recognized to the same extent. In this study, we conduct a comprehensive comparison between LSD2 and LSD1, with a focus on exploring LSD2's implications. While both share structural similarities, LSD2 possesses unique features. Functionally, LSD2 shows diverse roles, particularly in cancer, with tissue-dependent roles. Additionally, LSD2 extends beyond histone demethylation, impacting DNA methylation and DNA damage repair pathways. This study underscores the distinct roles of LSD2, providing insights into their contributions to cancer and other cellular processes.

We report fabrication of crystalline microresonators of high quality (Q) factors with a controllable wedge angle on lithium niobate on insulator (LNOI). Our technique relies on femtosecond laser assisted chemo-mechanical polish which allows us to achieve ultrahigh surface smoothness as critically demanded by high Q microresonator applications. We show that by refining the polish parameters, Q factors as high as 4.7 × 10⁷ can be obtained and the wedge angle of the LNOI can be continuously tuned from 9° to 51°.

We report fabrication of a multifunctional photonic integrated chip on lithium niobate on insulate (LNOI), which is achieved by femtosecond laser assisted chemo-mechanical polish. We demonstrate a high extinction ratio beam splitter, a 1 × 6 optical switch, and a balanced 3 × 3 interferometer on the fabricated chip by reconfiguring the microelectrode array integrated with the multifunctional photonic circuit.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

The layer-by-layer (LBL) fabrication method allows for controlled microstructure morphology and vertical component distribution, and also offers a reproducible and efficient technique for fabricating large-scale organic solar cells (OSCs). In this study, polymer D18 and PYIT-OD are employed to fabricate all-polymer solar cells (all-PSCs) using the LBL method. Morphological studies reveal that the use of additives optimizes the microstructure of the active layer, enhancing the crystallinity and charge transport capability. The optimized device with 2% CN additive significantly reduces bimolecular recombination and trap-assisted recombination. All-PSCs fabricated by the LBL method based on D18/PYIT-OD deliver a power conversion efficiency (PCE) of 15.07%. Our study demonstrates the great potential of additive engineering via LBL fabrication method in regulating microstructure of active layers, suppressing charge recombination, and enhancing the photovoltaic performance of devices.

We generalize the idea of quantum clock time to quantum spacetime reference frame via physical realization of a reference system by quantum rulers and clocks. Omitting the internal degrees of freedom (such as spins) of the physical rulers and clocks, only considering their metric properties, the spacetime reference frame is described by a bosonic non-linear sigma model (NLSM). We study the quantum behavior of the system under approximations, and obtain (1) a cosmological constant valued (2/π)ρ_c0 (ρ_c0 the critical density at near current epoch) which is very close to the observations; (2) an effective Einstein-Hilbert term; (3) the ratio of variance to mean-squared of spacetime interval tends to a universal constant 2/π in the infrared region. This effect is testable by observing a linear dependence between the inherent quantum variance and mean-squared of the redshifts from cosmic distant spectral lines. The proportionality is expected to be the observed percentage of the dark energy. The equivalence principle is also generalized to the quantum level.

Performance of flow through orifices on a perforated distribution pipe between periods with and without partial clogging (submersion of part of the distribution pipe) was compared. The distribution pipe directly receives runoff and delivers it to an underground infiltration bed. Partial clogging appeared in winter but reduced in summer. Performance was defined as flow rate divided by l_eff (h_(d,mean)^0.5) where h_(d,mean) is the mean pressure head that drives flow and l_eff is the effective pipe length (length of water column with pipe water volume and the pipe cross-sectional area). ANCOVA (ANalysis of COVAriance) was adopted to examine the clogging effects with flow rate plotted against l_eff (h_(d,mean)^0.5) . Partial clogging had a significant effect on pipe performance during periods of low or no rainfall. However, if only data during larger storms was considered, little evidence showed that partial clogging had effects on pipe delivery performance. Partial clogging might be caused by leaves accumulated in the lower section of the pipe in winter, and its effect was insignificant when water level rose in the pipe, utilizing significantly more orifices on the distribution pipe, thus the effect from the clogged portion had negligible impact on system performance. Larger storms might also provide the required flow rate to move the debris block thus exposing the orifices. Partial clogging did not increase the tendency of overflow; therefore, current maintenance schedule was sufficient to keep the distribution pipe at satisfactory performance even though partial clogging can exist.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Human influenza A viruses (IAVs) cause global pandemics and epidemics, which remain serious threats to public health because of the shortage of effective means of control. To combat the surge of viral outbreaks, new treatments are urgently needed. Developing new virus control modalities requires better understanding of virus-host interactions. Here we describe how IAV infection triggers cellular apoptosis, and how this process can be exploited towards development of new therapeutics, which might be more effective than the currently available anti-influenza drugs.

The rapid growth of the sharing economy has propelled shared mobility to the forefront of attention. The continuous advancement of autonomous driving technology also brings new opportunities and challenges to the shared mobility market. This study comprehensively analyzes the market potential concerning autonomous vehicles (AVs) to provide shared mobility services, utilizing SWOT analysis, PESTLE analysis, and Porter’s Five Forces. The findings reveal that AVs can provide improved shared mobility services by increasing transportation safety, reducing emissions, reducing costs, enhancing traffic efficiency, and increasing customer satisfaction and the profitability of shared mobility services. However, challenges such as technological and policy uncertainties, safety concerns, high initial costs, inadequate public communication infrastructure, and the absence of standardized regulations can hinder the widespread adoption of AVs. The benefits are also restricted with a low market penetration rate of AVs. To promote AVs in the shared mobility market, this study also provides implications for AV stakeholders tailored to the evolving shared mobility market dynamics.

We demonstrate fabrication of single-mode optical waveguides on lithium niobate on insulator (LNOI) by optical patterning combined with chemo-mechanical polishing. The fabricated LNOI waveguides have a nearly symmetric mode profile of a mode field size of ~2.5 µm (full-width at half maximum). We develop a high-precision measurement approach by which the single mode waveguides are characterized to have a propagation loss of ~0.042 dB/cm.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

Currently, peptic ulcers are widely studied as an infectious disease caused by Helicobacter pylori primarily due to 3 supporting evidences, and this etiology may explain the other 3 observations, but cannot confront the challenges of the 15 major characteristics and the other 75 observations/phenomena of peptic ulcers. To address the challenges, a recently published Complex Causal Relationship with its accompanying methodologies was applied to analyze existing data. Peptic ulcers are identified as a psychosomatic disease triggered by psychological stress, where Helicobacter pylori plays a secondary role in only the late phase of ulceration. This new etiology elucidated all the 15 major characteristics and 81 observations/phenomena of peptic ulcers in a series of 6 articles. This sixth article focuses exclusively on the controversies surrounding the role of Helicobacter pylori in peptic ulcers. In-depth analyses find that all the 3 evidences supporting “peptic ulcers are an infectious disease caused by Helicobacter pylori” are deceiving, and 2 of the 3 explainable observations may have been misinterpreted. Meanwhile, the definitions of ‘etiological factor’ and ‘causality’ do not support ‘H. pylori infection is an etiological factor of peptic ulcers’, and existing literatures have presented a controversial view on the role of Helicobacter pylori in peptic ulcers. Interestingly, if “peptic ulcers are an infectious disease caused by Helicobacter pylori” is considered an illusion, all the characteristics of the disease, along with all the clinical, epidemiological, and laboratory observations/phenomena, can be fully understood. This illusion has misguided peptic ulcer research over the past 36 years with little progress in the field, and that may represent a widespread situation in modern medical research, resulting in a direct interference with the true understanding of disease. Evidently, keeping the concept “illusion” in mind may help remove a huge obstacle that impedes medical advance, thereby facilitating the in-depth study of disease.

This paper studies the evaporative heat transfer characteristics of R744 at low temperatures in a horizontal smooth tube as a cascade refrigeration system (CRS) among hybrid cascade refrigeration systems (HCRSs). There is a lack of research on the low-temperature evaporative heat transfer characteristics of R744 under the operating conditions of evaporators used in actual CRSs used in supermarkets. Therefore, this study aims to provide basic data on the evaporative heat transfer characteristics of R744 in the evaporators of refrigerators used in supermarkets. The tube used in the evaporation experiment conducted herein was a smooth horizontal copper tube with an inner diameter and length of 11.46 mm and 8000 mm, respectively. The experimental pa-rameters were as follows: heat fluxes of 12–21.5 kW/m2, mass fluxes of 75–225 kg/(m2·s), and saturation temperatures of −50–−30 °C. The main results are summarized as follows. (1) When designing the R744 evaporator, the mass and heat fluxes must be maximized within the operating conditions, and the saturation temperature must be designed to be as low as possible. (2) The evaporative heat transfer coefficient of R744 can be predicted well by using the correlation formula of Chen at the evaporation temperature of −40 °C in the CRS.

With the rapid spread of carbon trading in the global economy, the interactions of prices between carbon (or clean/renewable energy) and traditional fossil energies such as coal and oil have raised growing attention, but little research have discussed their dynamic volatility spillover and time-varying correlation. The purpose of this study is to investigate these issues, for the weekly data of EUA futures, Biofuel and Brent oil prices from 25 October 2009 to 5 July 2020. We employ the VAR-GARCH model with the BEKK specification. Our results are summarized as follows. At first, we identified the sudden changes and the volatility persistence in the three markets, and also confirmed that the volatility of the markets has changed significantly over time. Secondly, we find that there are a weak volatility spillover effect among the three markets, while a strong spillover effect between the EUA and Brent oil markets. Lastly, in financial markets, the EUA can be used as a hedging portfolio for the Biofuel and Brent oil markets. These results can help investors to well compose their portfolios and manage their investment risks, and help potential pollutant emission sources to join in carbon market in a cost-effective way.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

With the increased emphasis on competition in academic settings, anxiety is becoming more common, which inevitably has some impact on students’ learning process and result. This study aimed to explore how competition-induced anxiety influences the subjective cognitive load (SCL), attention level and test score. Meanwhile, we investigated the mediating role of the behavioral inhibition system/behavioral activation system (BIS/BAS) in those processes. A total of 101 college students were recruited in Study 1 to learn five micro-lectures from massive open online courses (MOOC) under with and without competitive conditions. The results showed that participants’ state anxiety (SA) scores were higher after the experiment, participants in the competition condition had higher test scores, and the relationship between SA/ trait anxiety (TA) and SCL could be mediated by the BIS. To obtain more objective data on learning processes (attention levels), we conducted Study 2, which collected behavioral and EEG data from 42 college students during the online learning. The results showed that the competition group had higher SA, lower attention levels, and worse test scores, and the relationship between SA/TA and attention levels could be mediated through the BIS. The present study not only expands previous research by finding that BIS functioning plays an important role in the effects of anxiety on cognitive load and attention, but also offers implications for using competitive strategies to motivate students according to their aptitude.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

Selenium nanoparticles (SeNPs) can mitigate cadmium (Cd2+) toxicity in crop cultivation and aquaculture. This study investigates the impact of SeNPs on Cd-induced toxicity in Chlamydomonas reinhardtii, a model organism, aiming to mitigate Cd damage in crops. SeNPs were synthesized using sodium carboxymethyl cellulose (CMC) as a dispersant and vitamin C to reduce H2SeO3. Characterization by transmission electron microscopy (TEM) and nanoparticle granulator revealed uniform, stable spherical SeNPs. Cd2+ and SeNPs of varying concentrations were introduced into culture media of wild type (CC125mt+) and cell wall defect type (CC400mt+) Chlamydomonas reinhardtii. Growth curves, photosynthetic pigment content, enzyme activities (T-SOD and CAT), MDA content, and ROS levels were assessed. Fluorescence induction kinetics, QA oxidation kinetics, and Cd2+ content in cells were measured to evaluate SeNPs' effect on Cd toxicity. Results showed SeNPs exacerbated Cd2+ toxicity in CC125mt+ by inhibiting growth and increasing catalase activity, indicating enhanced oxidative damage. SeNPs intensified PSII damage by Cd2+ and increased intracellular Cd2+ content, possibly exacerbating toxicity. SeNPs had no effect on Cd2+ toxicity in CC400mt+. Overall, SeNPs exacerbated Cd2+ toxicity in wild type CC125mt+ but not in cell wall defective CC400mt+. These findings caution against indiscriminate use of nano-selenium to mitigate Cd damage, stressing the importance of careful target selection, dosage, and range considerations.

In this paper, we present a full coverage path planning (CPP) algorithm for the marine surveys conducted in the convex polygon shaped search area. The survey is supposed to carry out by torpedo-type AUVs (autonomous underwater vehicles). Due to their nonholonomic mechanical characteristics, these vehicles have nonzero minimum turning radius. For any given polygon shaped search area, it can always be partitioned into one or more convex polygons. With this in mind, this paper proposes a novel search algorithm called CbSPSA (Calculation based Shortest Path Search Algorithm) for full coverage of any given convex polygon shaped search area. By aligning the search inter-tracks alongside the edge with the minimum height, we can guarantee the minimum number of the vehicle’s turns. In addition, the proposed method can guarantee the planned path is strictly located inside the polygon area without overlapped or crossed path lines, and also has the total path length as short as possible. Considering the vehicle’s nonzero minimum turning radius, we also propose a sort of smoothing algorithm to smooth the waypoint path searched by CbSPSA so as for the vehicle to exactly follow it. The smoothed path is also guaranteed to be strictly located inside the polygon. Numerical simulation analyses are also carried out to verify the effectiveness of the proposed schemes.

The surface velocity of the Amery Ice Shelf (AIS) is vital to assessing its stability and mass balance. Previous studies have shown that the AIS basin has a stable multi-year average surface velocity. However, spatiotemporal variations in the surface velocity of the AIS and the underlying physical mechanism remain poorly understood. This study combined offset tracking and DInSAR methods to extract the monthly average surface velocity of the AIS and obtained the inter-annual surface velocity from the ITS_LIVE product. An uneven spatial distribution in inter-annual variation of the surface velocity was observed between 2000–2022, although the magnitude of variation was small at less than 20.5 m/yr. The increase and decrease in surface velocity on the eastern and western-central sides of the AIS, respectively, could be attributed to the change in the thickness of the AIS. There was clear seasonal variation in monthly average surface velocity at the eastern side of the AIS between 2017–2021, which could be attributed to variations in the area and thickness of fast-ice and also to variations in ocean temperature. This study suggested that changes in fast-ice and ocean temperature are the main factors driving spatiotemporal variation in the surface velocity of the AIS.

This paper systematically discusses the application of reinforcement learning in automatic driving system. Reinforcement learning frameworks show significant advantages in optimizing decision making, predictive perception, path planning, and controller design, exceeding the limitations of traditional supervised learning methods. The paper highlights the critical role of components such as scene understanding, positioning, and map making in autonomous driving systems, which provide reliable environmental awareness through deep learning and sensor fusion technologies to support intelligent decision-making in complex urban environments. In addition, the paper discusses innovative approaches to safety reinforcement learning to reduce risk in autonomous driving and ensure that systems adhere strictly to safety constraints while maximizing expected rewards. These findings provide an important theoretical and practical basis for further improving algorithm robustness, managing multi-agent interactions, and integrating ethical considerations in the future.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Ral-interacting protein 76 (RLIP76) is a potential factor with vascular endothelial growth factor (VEGF) in the corpus luteum and tumor angiogenesis. RLIP76, VEGF, and hypoxia-inducible factor-1 (HIF-1) are proteins that activate angiogenic functions in tumor and endothelial cells. RLIP76 is a main factor in tumor growth, and VEGF is a major endothelial cell protein for angiogenesis. Also, RLIP76 regulates a small GTPase (R-Ras, oncogene) in cell survival, spreading, and migration. HIF-1 is important in the corpus luteum, tumor angiogenesis, and tumor growth. VEGF and HIF-1 regulate the angiogenic function of RLIP76, and RLIP76 controls vascular growth in endothelial and tumor cells. RLIP76, R-Ras, VEGF, and HIF-1 may be useful in the research of corpus luteum and cancer therapy and the study of mechanisms of tumor angiogenesis. This review will help to elucidate the roles of RLIP76/R-Ras and VEGF via HIF-1 in corpus luteum and tumor angiogenesis, tumorigenesis, and the specific regulation of RLIP76 in luteal, tumor, and endothelial cells. Thus, we reviewed the angiogenesis of the corpus luteum and tumor in the ovarian and tumor microenvironment.

(1) Background: This study aimed to compare the effect of polyetheretherketone (PEEK) and titanium abutments on implant prosthetic systems and supporting bone using three-dimensional finite element analysis (FEA); (2) Methods: A three-dimensional finite element analysis was conducted using CATIA and Abaqus software to model mandibular first molar implant systems with titanium and PEEK abutments. Under external loading conditions, finite element analysis was conducted for the stresses in implant components and surrounding bones of each group; (3) Results: The implant fixture of the PEEK model exhibited the highest von Mises stress (VMS). The lowest VMS was observed in the abutment screw of the titanium model. Both implant systems demonstrated similar stress distribution and magnitudes in cortical and cancellous bones; (4) Conclusion: PEEK abutments show similar stress distribution in surrounding bone compared to titanium. However, PEEK absorbs the stresses within the implant system and exhibits the highest VMS values due to its low mechanical and physical properties. Therefore, PEEK abutments need improved mechanical properties for better clinical application.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

We develop a technique for realizing lithium niobate on insulator (LNOI) waveguides of a multi-centimeter-length with a propagation loss as low as 0.027 dB/cm. Our technique relies on patterning a chromium (Cr) thin film coated on the top surface of LNOI into a hard mask with a femtosecond laser followed by the chemo-mechanical polishing for structuring the LNOI into the waveguides. The surface roughness on the waveguides is determined to be 0.452 nm with an atomic force microscope (AFM). The approach is compatible with other surface patterning technologies such as optical and electron beam lithographies or laser direct writing, enabling high-throughput manufacturing of large-scale LNOI-based photonic integrated circuits.

Major depressive disorder (MDD) and generalized anxiety disorder (GAD) exert significant burdens on individuals and society, underscoring the importance of accurate predictions using advanced machine learning (ML) algorithms. Leveraging electronic health records (EHRs) and survey data, these algorithms offer potential in forecasting such mental health conditions. Yet, the precision of these predictions can be compromised by biases or inaccuracies inherent in subjective survey responses. In this research, we assess the reliability of four prominent ML algorithms—Random Forest, XGBoost, Logistic Regression, and Naïve Bayesian—in predicting MDD and GAD. Our dataset encompasses a rich array of information, from biomedical metrics and demographic details to self-reported survey insights. A focal point of our investigation is the algorithms' performance under scenarios with varying degrees of subjective response inaccuracies, such as memory recall biases or subjective interpretation. Our findings reveal that while all algorithms exhibit commendable accuracy with pristine survey data, their performance diverges when faced with erroneous or biased responses. Notably, XGBoost remains stable and excels in identifying true positive cases, even in the presence of such noise. These observations underscore the criticality of algorithmic resilience in mental health prediction, especially when relying on subjective data. The robustness of certain algorithms to noisy inputs positions them as more reliable choices for predicting mental health conditions based on self-reported data, emphasizing the need for careful algorithm selection in such contexts.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Pseudolysimachion nakaianum (Ohwi) T.Yamaz. is an endemic species that is an important species in the forest ecosystems of South Korea. This study aimed to develop an in vitro propagation system for P. nakaianum, to enhance the availability of this rare and endemic plant for commercial horticulture and restoration efforts. We utilized cotyledon explants from in vitro germinated seeds and two types of explants (petiole and leaf) from in vitro seedlings to assess the impact of five different cytokinins on adventitious shoot organogenesis in P. nakaianum. The half-strength Murashige and Skoog (MS) medium, supplemented with 10 µM thidiazuron (TDZ) for both cotyledon and petiole explants, yielded the highest shoot induction rates (61.1 ± 9.6% and 26.7 ± 8.8%, respectively) and the greatest number of shoots (3 ± 0.6 and 4.4 ± 0.5, respectively). Responses from leaf explants were variable, with none showing in vitro regeneration. Successfully acclimatized P. nakaianum plantlets in a greenhouse demonstrated normal growth. This protocol outlines an effective method for the direct in vitro regeneration from cotyledon and petiole explants of P. nakaianum, providing valuable information for the conservation of this species.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

Using traditional methods based on detection rules written by human security experts, there is a significant challenge in accurately detecting many network threats that are increasingly becoming sophisticated. In order to deal with the limitation of the traditional methods, network threat detection techniques utilizing artificial intelligence technologies such as machine learning are being extensively studied. Research has also been conducted on analyzing various string patterns in network packet payloads through natural language processing techniques to detect attack intent. However, due to the nature of packet payloads containing binary data as well as text data, a new approach is needed that goes beyond typical natural language processing techniques. In this paper, we study a token extraction method optimized for payloads using n-gram and byte pair encoding techniques. Furthermore, we generate embedding vectors that can understand the context of the packet payload using algorithms such as Word2Vec and FastText. We also compute the embedding of various header data associated with packets, such as IP addresses and ports. Given the combination of these features, we ensemble a text 1D-CNN and a multi-head attention network in a novel fashion. We validated the effectiveness of our classification technique with the CICIDS2017 open dataset and over half a million data collected by The Education Cyber Security Center (ECSC) currently operating in South Korea. The proposed model showed remarkable progress compared to previous studies, demonstrating a highly accurate classification performance with an F1-Score of 0.998. Our model can also preprocess and classify 150,000 network threats per minute to help security agents in the field divert their time to analyzing more complex attack patterns.

Changes in crude oil price affect the shipping freight market in three different channels. This study explores the dependence structure between oil prices and maritime freight rates to identify the strongest channel. Therefore, it investigates the relationship between oil prices and three major maritime freight rates; the Baltic Dry Index (BDI), the Baltic Dirty Tanker Index (BDTI), and the Baltic Clean Tanker Index (BCTI). We employ the decomposition method, not studied in the existing literature. The copula approach identifies the time-varying effects and asymmetry in the tail dependence structure between oil prices and freight rates. The main results of this analysis are as follows. The decomposed components display different conditional dependence patterns, and asymmetry is revealed in the upper and lower tail dependence. In the long run, we find more dependence in extreme periods like the financial crises. In short-run fluctuations, we find the dependence increases in an economic boom. The implications of the results suggest that dependence can vary over time and may change depending on extreme events, implying that the complementary strategies of the long run and short run should be different.

Gracilaria lamaneiformis, a red seaweed, is an abundant source of bioactive polysaccharides with significant health-promoting properties. Nevertheless, the broad application of G. lamaneiformis in the nutraceutical and pharmaceutical sectors remains constrained due to the absence of comprehensive data. This review provides a detailed examination of the preparation methods, structural characteristics, and biological activities of G. lamaneiformis polysaccharides (GLP). We explore both conventional and advanced extraction techniques, highlighting the efficiency and yield improvements achieved through methods such as microwave-, ultrasonic-, and enzyme-assisted extraction. The structural elucidation of GLP using modern analytical techniques, including high-performance liquid chromatography, gas chromatography, and nuclear magnetic resonance spectroscopy, is discussed, providing comprehensive insights into their molecular composition and configuration. Furthermore, we critically evaluate the diverse biological activities of GLP, including their antioxidant, anti-inflammatory, antitumor, and gut microbiota modulation properties. This review underscores the therapeutic potential of GLP and suggests future research directions to fully harness their health benefits.

In this paper we study a class of impulsive delayed neural networks with parameter uncertainties and reaction-diffusion terms. Using the properties of M-matrices and some inequality techniques, some sufficient conditions are derived to guarantee the global exponential stability of the given system. The results obtained are presented by simple algebraic inequalities, which are certainly more concise than previous methods. Finally, the validity and usefulness of our results are illustrated by arithmetic examples.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Various therapeutic approaches have been developed for neglect. Many studies have demonstrated the effect of Digital therapeutics(DTx) on neglect. By contrast, only a few studies have reported on the effects of DTx on egocentric and allocentric neglect. In this article, seven studies on DTx of egocentric and allocentric neglect were reviewed. DTx, which was employed in these studies, could be classified as follows: 1) software adaptation in traditional treatment, 2) VR game using the head-mount display as treatment, and 3) development of new digital program like ReMoVES. In addition, more studies and effective results were reported on egocentric neglect than allocentric neglect. In future studies, each effect on egocentric and allocentric neglect should be identified in detail through the appropriate use of differential evaluation and long-term application of independent digital therapeutics.

Purpose：Herein, aimed to explore routines to improve students' physical health.Methods:We explored the integration of extracurricular fitness running "Lerun" into college physical education curriculum. Firstly, experimental and the referring groups were selected by experimental method, in which only the experimental group was intervened in combination with extracurricular fitness running "Lerun". After two experiments, the experimental and referring groups were compared in terms of physical fitness (speed, strength, endurance, flexibility, explosive force, etc.), sports skills, body shape, cardiopulmonary function, etc. Results:After T-test, significant differences (p<0.05) between these two groups prove that the students' physical health status of experimental group is better than that of the referring group. Conclusion：It manifests that integrating extracurricular fitness running "Lerun" into college physical education curriculum is an effective means to improve students' physical health.

Gymnema sylvestre is a pharmacological plant which has a rich source of bioactive compounds specifically gymnemic acid (GA) and phenolic compounds (PC) that used for pharmaceutical industries. Sources for naturally occurring bioactive compounds are limited, due to geographical and seasonal variations; on the other hand, it is commercially in demand. Biosynthesis of G. sylvestre phytochemicals through in vitro culture often enhanced by elicitation. The use of cell suspension cultures (CSC) has interested serious attention on the production of essential phytochemicals. The current study is aimed at improving the contents of GA and PC in G. sylvestre CSC using the copper oxide nanoparticles (CuO NPs). Callus was obtained on MS medium with 2.0 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.1 mg/L kinetin (KIN), phytoagar (8.0 g/L), and sucrose (30 g/L). The above medium devoid of agar was used for the initiation of CSC. The CSC was treated with three levels of CuO NPs (1, 3 or 5 mg/L) to enhance the production of GA and PC. The greatest amount of GA (89.25 mg/g dry cell mass, DCM), total phenolic (245.10 mg/g), and flavonoid (4.57 mg/g) in CSC were achieved when G. sylvestre cells were treated for 48 h with 3 mg/L CuO NPs. Also, the biomedical potential (antioxidant, antidiabetic, anti-inflammatory, antibacterial, antifungal and anticancer activities) were also high in the CuO NPs (3 mg/L) treated CSC extracts of G. sylvestre. CuO NPs elicitation of CSC significantly increased production of GA (9-fold), and PC than non-elicited CSC in G. sylvestre.

This study aimed to evaluate the level of skill in observing teaching competency in pre-service physical education (PE) teachers and provide basic data to cultivate teaching competency. A total of 21 third-year pre-service PE teachers were selected as participants. The study derived descriptive statistics to analyze the participants’ observation skills regarding teaching competency in different class stages using evaluation results of class demonstrations by pre-service teachers. Mann–Whitney U test was conducted to verify the statistical significance of the evaluation between in-service and pre-service teachers. Compared with in-service teachers, pre-service teachers reported high agreement with intuitive teaching behaviors. However, pre-service teachers indicated low agreement with skills that required complex teaching behaviors depending on various situations. Based on theories by Schon (1983), pre-service teachers showed high “knowledge for practice” and low “knowledge in practice.” Thus, pre-service education must balance practical knowledge and theory rather than focus on theory-based education. This study provided directions for pre-service teacher education to enhance the competency of pre-service teachers for leading and analyzing classes.

(1)Background:The purpose of the study was conducted to investigate the recovery of heart rate according to the performance level and rest interval conditions during 65%1RM bench press exercise;(2)Methods:The subjects of this study were eight healthy male college studentsin their 20 (years) attending University C. 1RM was measured before theexperiment, and the exercise sequence of six rest intervals (30sec, 1, 2, 3, 4,5min) was randomly selected and cross-distribution experiment. The experimental measurement was conducted a total of six times according to the rest interval condition (six conditions) once every 3 days to minimize the learning effect. The data was verified with repeated measures Two-way ANOVA and Contrast's repeated method was applied for post-comparison;(3)Results: First, the amount of exercise and the number of repetitions statistically substantially dropped (p&lt;.001) as the number of sets rose, and a greater decline was shown when the rest periods got shorter. Second, the heart rate after exercise was increased significantly (p&lt;.01) as the set progressed in the long rest interval conditions (4, 5min), and the heart rate after rest was increased statistically significantly (p&lt;,05) as the set progressed in the short rest interval conditions (30sec, 1min). Third, the heart rate recovery rate (%) was able to perform more repetitions than in the short rest interval condition due to the relatively high physiological recovery of the neuromuscular and circulatory system under the long rest interval condition;(4)Conclusions: Therefore, according to the rest conditionduring the 65%1RM bench press exercise conducted in this study, the restinterval condition of 2~3min may be effective in improving muscular endurance,and the rest interval condition of 4~5min may be effective in improving muscular hypertrophy. As a result of this study, there was a significant difference in exercise performance (repetition) and physiological recovery depending on the rest interval condition according to the set progress during the same intensity resistance exercise. Through this, it is judged that it is possible to adjust the amount of exercise appropriate for the purpose of training by adjusting not only the intensity during resistance exercise but also the rest interval between sets.

Osteoporosis is a common metabolic bone disease in patients with diabetes, which can develop simultane-ously with Type 2 diabetes (T2D) in postmenopausal women. Bisphosphonate (BP) is administered to pa-tients with both the conditions and may cause medication-related osteonecrosis of the jaws (MRONJ). It affects the differentiation and function of osteoclasts as well as thickness of cortical bone through bone mineralization. Therefore, this study aimed to investigate the effects of T2D on osteoclast differentiation and activity as well as cortical bone formation in postmenopausal patients with MRONJ. Tissue samples were collected from 10 patients diagnosed with T2D and Stage III MRONJ in the experimental group and from 10 patients without T2D in the control group. Histological examination was conducted, and expres-sion of dendritic cell-specific transmembrane protein (DC-STAMP) and tartrate resistant acid phosphatase (TRAP) was assessed. Cortical bone formation was analyzed using CBCT images. The number of TRAP-positive osteoclasts and DC-STAMP-positive mononuclear cells were significantly less in the experi-mental group (p < 0.05). Furthermore, the thickness and ratio of cortical bone were significantly greater in the experimental group (p < 0.05). In conclusion, T2D decreased the differentiation and function of osteo-clasts, and increased cortical bone formation in postmenopausal patients with MRONJ.

Often, engineers with machining experience often judge machining state and tool life according to chips’ features. Engineers' experience is digitized in this study. During the cutting process, the cutting tool coming in contact with the workpiece produces a shear zone, which causes plastic deformation and shear slip. The chips closest to the shear zone can directly show the state of the tool and workpiece when the material is SKD61. This study used chip color, vibration, and current signal integration for prediction of machining state and cutting tool life. When the cutting tool wears increased, the chip surface color changed in the following way: purpleè purple blueè blue ècyan, or even green and yellow. When the cutting tool was in the accelerating wear phase, the color change was particularly obvious. The Back-Propagation Levenberg–Marquardt (BP-LM) predictive methodology was used to compare the predictive ability of voltage, vibration signal, and chip color. The Mean Absolute Percentage Error (MAPE) for the voltage signal was 12.28%, for the vibration signal it was 11.38%, and for the chip color combined with multi-sensor characteristics it was 7.85%. The MAPE of the chip color was the smallest. Using the General Regression Neural Network (GRNN) methodology, the MAPE for the voltage signal was 10.74%, for the vibration signal 7.96%, and for the chip color combined with multi-sensor characteristics was 6.59%. The MAPE of the chip color was the smallest. Obviously, the chip color combined with multi-sensor signals provided better predictive results than the vibration signal or voltage signal alone. There is currently no research on the usefulness of monitoring chip color for tool life prediction.

Recommender Systems (RecSys) are crucial in managing information overload and enhancing user satisfaction across various digital platforms, including e-commerce and entertainment. Evolving from traditional models to Deep Neural Networks (DNNs) and, more recently, Large Language Models (LLMs), these systems leverage sophisticated algorithms to analyze user behaviors and preferences. LLMs, such as GPT-4, are trained on extensive datasets to comprehend and generate natural language, significantly advancing their ability to deliver personalized recommendations. This tutorial explores the transformative impact of LLMs on RecSys, discussing their development, application in handling complex datasets, and the integration of contextual insights. Real-world examples illustrate how LLMs enhance recommendation accuracy and user experience, highlighting challenges and future directions in the field.

The purpose of this study is to explore the effects of dual-task training, including cognitive tasks, on cognitive and bodily functioning and β-amyloid levels in Alzheimer's dementia patients. The subjects were 34 inpatients diagnosed with Alzheimer's dementia at a nursing hospital located in Gyeongsansi, South Korea. The patients were randomly divided into a dual-task group (n = 16) and a single-task group (n = 18). The dual-task group performed cognitive tasks at the same time as exercising tasks, while the single-task group performed only exercise tasks. Each group was trained for 30 minutes three times a week for eight weeks. The Mini-Mental State Examination was used to measure the patients’ cognitive function. Static and dynamic balance were measured to evaluate bodily functioning. Static balance was measured using Biorescue, while dynamic balance was measured using the Berg Balance Scale. Blood analysis was performed to measure levels of β-amyloid, which is known to cause Alzheimer's dementia. Both groups exhibited statistically significant improvements in gait function after the training (p < .05). The dual-task group exhibited statistically significant differences in cognitive function, static and dynamic balance function, and β-amyloid levels after training (p < .05). A significant difference was observed between the two groups (p < .05). Dual-task activities were found to be effective in improving cognitive and bodily functioning and reducing β-amyloid levels in Alzheimer's dementia patients. Therefore, dual-task training is thought to be an effective method of treating and preventing Alzheimer's dementia.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Fe-(9, 19, 28, 37)wt.% Cr alloys were corroded at 700 and 800 ^oC for 70 h under 1 atm of N₂, 1 atm of N₂/3.2%H₂O-mixed gas, and 1 atm of N₂/3.1%H₂O/2.42%H₂S-mixed gas. The corrosion rate of Fe-9Cr alloy increased with the addition of H₂O, and furthermore with the addition of H₂S in N₂ gas. Fe-9Cr alloy was always nonprotective. In contrast, Fe-(19, 28, 37) wt.%Cr alloys were protective in N₂ and N₂/H₂O-mixed gas because of formation of the Cr₂O₃ layer. They were, however, nonprotective in N₂/H₂O/H₂S-mixed gas because sulfidation dominated to form the outer FeS layer and the inner Cr₂S₃ layer containing some FeCr₂S₄.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Background: The seasonal variation of peptic ulcers is a rhythmic phenomenon reported worldwide, exhibiting diverse patterns and controversies. Unfortunately, it has remained an unresolved mystery for more than 90 years. Numerous studies have found that this phenomenon was closely associated with multiple environmental factors, but the underlying mechanism has never been elucidated. Objectives: This study aims to elucidate the seasonal variation of peptic ulcers and identify the role of environmental factors in the disease. Methods: Based on a recently identified etiology of peptic ulcers, two inverse operations in calculus, differentiation and integration, are iterated to analyze the existing data. First, the fluctuation curve in the seasonal variation is differentiated twice into the monthly incidences caused by multiple individual environmental factors, and the fluctuation curve due to each individual environmental factor is generated separately. Second, the monthly incidences caused by the individual environmental factors are integrated twice to reproduce the fluctuation curves in the seasonal variation of peptic ulcers. Results: The differentiations of the fluctuation curves in the season variation reveal a parallel relationship between the psychological impacts of each individual environmental factor and the monthly incidences of peptic ulcers. The integrations of the monthly incidences caused by 3 environmental factors reproduce the fluctuation curves in 3 representative seasonal patterns of peptic ulcers but make the parallel relationships invisible. Discussion: The parallel relationships revealed a causal role of environmental factors in peptic ulcers, whereas the reproduction of the fluctuation curves elucidated that multiple environmental factors cause the seasonal variation of peptic ulcers by Superposition Mechanism. The regional differences in environmental factors result in the diverse patterns, as well as the controversy questioning the seasonality of peptic ulcers. Significantly, the data analyses exemplify the application of a new concept, Superposition Mechanism, which might be an indispensable methodological complement to life science and medicine.

Background: In 1962, Susser and Stein observed that the mortality rates of peptic ulcers in England and Wales increased markedly in the 1910s, maintained at a high level during the 1910s-1940s, and began to decline steadily since the early 1950s. They termed this epidemic pattern a birth-cohort phenomenon, but its mechanism has never been elucidated. Susser and Stein speculated that the occurrences of extraordinary social environmental factors roughly fit the fluctuations, but the role of environmental factors in peptic ulcers has never been identified. Objectives: This study aims to elucidate the mechanism of the birth-cohort phenomenon of peptic ulcers and identify the role of environmental factors in the disease. Methods: Starting from an etiology identified recently, this study uses the two inverse operations in calculus, differentiation, and integration, to analyze the existing data. First, a fluctuation curve in the birth-cohort phenomenon is differentiated into multiple annual mortality rates caused by individual environmental factors. Second, these annual mortality rates are integrated to reproduce the fluctuation curve in the birth-cohort phenomenon. Results: The differentiation reveals a parallel relationship between the psychological impacts of environmental factors and the mortality rates of peptic ulcers, whereas the integration reproduces a representative fluctuation curve in the birth-cohort phenomenon. The successive occurrences of multiple social environmental factors from the 1910s to 1940s maintained the increase in mortality rates, while the sustained improvements in living environments explained the steady decline of the mortality rates from the early 1950s. Conclusion: The parallel relationship suggests a causal role of environmental factors in peptic ulcers, whereas the reproduction of a representative fluctuation curve indicates that multiple environmental factors caused the birth-cohort phenomenon by Superposition Mechanism. Significantly, this study challenges the current reductionist approach used to study disease in modern medicine by demonstrating the effectiveness of an opposite methodological concept focused on integration.

In this study, the microbial community during the barley yeast fermentation of stevia leaves and its correlation with antioxidant, antiobesity, and anti-inflammatory properties, as well as metabolites, were investigated using UPLC-Q-TOF-MS. Stevia was fermented using commercial TSB media (TSB 1, TSB 2, and TSB 3) and sucrose (Sucrose 1, Sucrose 3, and Sucrose 3) for 1, 3, and 5 days, respectively. Stevia ferments showed higher DPPH and ABTS radical scavenging capacity compared to samples incubated with sucrose for 5 days, and all six ferments inhibited nitric oxide production in a concentration-dependent manner in LPS-induced mouse macrophages. Furthermore, UPLC-QTOF-MS analysis identified 23 related substances, including 10 terpenoids, including rubusoside, steviolbioside, and rebadioside derivatives; dulcoside A; and phlomisoside II, which are indicators of stevia, as well as five flavonoids, four phenolic acids, and four fatty acids. We also identified the microbial community during fermentation via the next-generation sequencing of the 16S rRNA gene for bacteria and the internal transcribed spacer (ITS) gene for fungi. The results showed that TSB 1 and Sucrose 1 ferments were dominated by the pathogens Enterococcus hirae (58.93%) and Cronobacter sakazakii (80.92%), while samples fermented for more than 3 days were pathogen-free and dominated by lactic acid bacteria such as Pediococcus stilesii (73.37%). Microbial community analysis using the ITS region showed that Saccharomycopsis fibuligera, classified as a yeast rather than a mold, dominated the stevia fermentation regardless of the fermentation duration. In particular, the microbial community of the fermentation with a sugar solution was dominated by S. fibuligera by more than 99% throughout the fermentation periods of 1, 3, and 5 days. Finally, to apply the stevia ferments topically to human skin, skin irritation tests were performed on 30 volunteers. The results showed that the highly concentrated extracts (1 mg/mL) of all six stevia ferments were hypoallergenic. Taken together, these findings suggest that brewer's yeast fermented from stevia leaves with a sugar solution offers promise as a natural ingredient for use in functional foods and cosmetics.

This paper proposed emotion recognition methods for consecutive facial images, and implements the inference of neural network model on a field-programmable gate array (FPGA). The proposed emotion recognition methods are based on a neural network model architecture that combines convolution neural networks (CNNs), long short-term memory (LSTM), and fully connected neural networks (FCNNs), called CLDNN or ConvLSTM-FCN. This type of neural network mod-el can analyze the local feature sequences obtained through convolution of data, making it suita-ble for processing time-series data such as consecutive facial images. In this paper, sequences of facial images are sampled from videos corresponding to various emotional state of subjects. The sampled images are then pre-processed with the processes includes facial detection, greyscale conversion, resize, and data augmentation if necessary. The 2-D CNN in ConvLSTM-FCN is used for feature extraction for these pre-processed facial images. These sequences of facial im-age features are time sequences with dependent properties between the elements within them. The LSTM is then used to model these time sequences followed by fully connected neural net-works (FCNNs) for classification. The proposed consecutive facial emotion recognition method achieves an average recognition rate of 99.51% on RAVDESS dataset, 87.80% on BAUM-1s dataset and 96.82% on eNTERFACE’05 data set, using 10-fold cross-validation on the PC. Some com-parisons of recognition accuracies between the proposed method and the other existing related works are conducted in this paper. According to the comparisons, the proposed emotion recog-nition methods outperform the existing related researches. The proposed emotion recognition methods are then implemented on an FPGA chip using the neural network model inference algo-rithms in this paper, and the accuracies of the experiments conducted on the FPGA chip are iden-tical to those obtained on the PC. This verifies that the proposed neural network model imple-mented on the FPGA chip performs well.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

ST-segment elevation myocardial infarction (STEMI), a major cause of mortality worldwide, has been shown through epidemiological studies to have a relationship with short-term exposure to air pollutants; however, the association between air pollutants and the outcome of STEMI has not been well studied. The aim of this study was to estimate the impact of air pollutants on the outcomes of STEMI. Data on particulate matter <2.5 μm (PM2.5), <10 μm (PM10), nitrogen dioxide (NO2), and ozone (O3) at each of the 11 air monitoring stations in Kaohsiung City were collected between January 1, 2012, and December 31, 2017. Medical records of non-trauma patients aged > 20 years who had visited the ED with a principal diagnosis of STEMI were extracted. The primary outcome measure was in-hospital mortality. After adjusting for potential confounders and meteorological variables, we found that an increase in the interquartile range (IQR) in NO2 was associated with an elevated risk of in-hospital mortality in patients with STEMI. Moreover, during the warm season, an IQR increase in NO2 corresponded to a higher risk of in-hospital mortality in patients with STEMI on lag 3 (OR=3.266; 95% CI:1.203–8.864, p=0.02). Conversely, an IQR increase in PM10 was associated with an increased risk of in-hospital mortality in patients with STEMI on lag 3 (OR=2.792; 95%CI:1.115–6.993, p=0.028) during the cold season. Our study suggests that exposure to NO2 (during warm season) and PM10 (during cold season) may contribute to a higher risk of poor prognosis in patients with STEMI.