The aim of this study is to investigate, by means of experimental measurements and full-wave simulations, the dominant factors for the very high-resolution (VHR) radar image speckles from exponential correlated rough surfaces. A Ka-band radar system was used to collect the return signal from such a surface sample fabricated by 3D printing, and that signal was further processed into images at different resolution scales, where the image samples were obtained by horizontally turning around the surface sample. To cross-validate the results and to further discuss the VHR speckle properties, full wave simulations by full 3D Finite Difference Time Domain (FDTD) method were conducted with 1600 realizations for the speckle analysis. At the considered very high resolution, speckle statistics show divergence from the fully developed Rayleigh distribution. The factors that impact on the high-resolution speckle properties from exponential correlated rough surface, are analyzed in views of the equivalent number of scatterers theory and scattering scales, respectively. From the data results and extended discussions, it is evident that both of the above factors matter for VHR speckle of backscattering, from the exponential correlated rough surface as a good representative for the ground surface.

This paper takes the VR animation display of the Ming Xiao Mausoleum General stone statue life as an example to study the advantages of VR animation in the display of material heritage. Combined with literature and pictures, the digital restoration of the Ming Xiao Mausoleum stone statue is carried out in MAYA and Z brush, and the construction of the scene and the output of the final effect are realized in UE4.

As an implementation of inverse Radon transform, the Second-order Divided-difference Back Projection (SDBP) technique has been proposed in this paper, by which the accurate CT reconstruction can be theoretically realized. A computational model for CT reconstruction filter expressions has been derived on the basis of SDBP technique. The method reveals the correlation between the convolution kernel for data restoration and the filter expression. By substituting kernel functions into the computational model, the amplitude sequences of a variety of filters can be calculated. On the proposed filter construction method, the decomposition form of filters has been discovered, where a series of basic filters have been acquired. The properties of any filter depend on the decomposed basic filters. Basic filters can be used to compose filters in actual needs.

Ming-style round-backed armchairs as a classic Chinese chair design are renowned for the blend of ergonomics, practicality, and elegance. Although the Chinese armchair furniture industry has made strides in sustainability, there is still a need for further improvements in material selection, manufacturing processes, and supply chain management to fully support the development of sustainable furniture. Laminated bamboo lumber as new sustainable materials are becoming a popular option for furniture designers in the era of "sustainable design". This research aims to investigate the feasibility and application of laminated bamboo lumber in the design of Chinese armchair furniture and proposes innovative ideas for optimizing the armchair's design. First, an empirical study was conducted to comprehensively understand the classification of Ming-style round-backed armchairs’ structure to develop a 3D model. Secondly, an experimental research method was then employed to explore the parameters of laminated bamboo lumber for future studies. Additionally, a validation experiment was conducted to compare real-world scenarios with simulations using finite element analysis in Ansys. Finally, finite element analysis was used to test the feasibility and application of laminated bamboo lumber in furniture design, focusing on the material’s mechanical properties. Results indicated that laminated bamboo lumber has excellent mechanical properties as furniture design materials, subsequently, using the optimized results, the use of 0.6319 kg of steel was successfully reduced by 23.68% to ensure the armchair’s stability. This provides a reference for the future compter-assist and standardized innovative design of Chinese armchair. By incorporating compter-assist design and lightweight optimization, it is possible to save materials and make more efficient use of resources, thereby contributing to sustainable development goals in the field of furniture design.

Transition metal dichalcogenides (TMDs) monolayers exhibit unique valleytronics properties due to the dependency of the coupled valley and spin state at the hexagonal corner of the first Brillouin zone. Precisely controlling valley spin-polarization via manipulating the electron population enables its application in valley-based memory or quantum technologies. This study uncovered the uncompensated spins of the antiferromagnetic oxide (NiO) serving as the ferromagnetic (FM) order to induce valley spin-polarization in molybdenum disulfide (MoS₂) monolayers via the magnetic proximity effect (MPE). A spin-resolved photoluminescence spectroscopy (SR-PL) was employed to observe MoS₂, where the spin-polarized trions appear to be responsible for the MPE, leading to a valley magnetism. Results indicate that local FM order from the uncompensated surface of NiO could successfully induce significant valley spin-polarization in MoS₂ with the depolarization temperature approximately at 100 K, which is relatively high compared to related literature. This study reveals new perspectives and potential of AFM materials in the field of exchange-coupled van der Waals heterostructures.

An efficient stereoselective three-component reaction for the synthesis of spiro[4H-chromene-3,3’-oxindole] derivatives was realized through an organocatalyzed cascade Knoevenagel/Michael/cyclization reaction using a quinidine-derived squaramide as the catalyst. Under the optimized conditions, the reactions of isatins, malononitrile, and sesamol yield the desired spirooxindoles in good yields (75–87%) and moderate to high ee values (up to 90% ee). Two pairs of selected enantiomers were subjected to evaluate their antiproliferative activities on three types of human cancer cell lines using the MTT assay. The results indicated that stereoselectivity and electrical effect showed significant impact on activity. Enanotiomer R-3f exhibited optimal cytotoxic activity against U2OS cell line, which was close to the inhibitory activity of positive control, Adriamycin.

The mammalian STE 20-like protein kinase 4 (MST4) gene is highly expressed in several cancer types, but little is known on the role of MST4 in breast cancer and the function of MST4 during epithelial-mesenchymal transition (EMT) has not been fully elucidated. Here, we report that overexpression of MST4 in breast cancer results in enhanced cell growth, migration, and invasion, whereas inhibition of MST4 expression significantly attenuates these properties. Further study shows that MST4 promotes EMT by activating Akt and its downstream signaling molecules such as E-cadherin/N-cadherin, Snail, and Slug. MST4 also activates AKT and its downstream pro-survival pathway. Furthermore, by analyzing breast cancer patient tissue microarray and silicon datasets, we found that MST4 expression is much higher in breast tumor tissue compared to normal tissue, and significantly correlates with cancer stage, lymph node metastasis and a poor overall survival rate (p<0.05). Taken together, our findings demonstrate the oncogenic potential of MST4 in breast cancer, highlighting its role in cancer cell proliferation, migration/invasion, survival, and EMT, suggesting a possibility that MST4 may serve as a novel therapeutic target for breast cancer.

Temperature and pressure sensors currently encounter challenges such as slow response times, large sizes, and insufficient sensitivity. To address these issues, we developed tetraphenylethylene (TPE)-doped polyvinylidene fluoride (PVDF) nanofiber membranes using electrospinning, with process parameters optimized through a convolutional neural network (CNN). We systematically analyzed the effects of PVDF concentration, spinning voltage, tip-to-collector distance, and flow rate on fiber morphology and diameter. The CNN model achieved high predictive accuracy, resulting in uniform and smooth nanofibers under optimal conditions. Incorporating TPE enhanced the hydrophobicity and mechanical properties of the nanofibers. Additionally, the fluorescent properties of the TPE-doped nanofibers remained stable under UV exposure and exhibited significant linear responses to temperature and pressure variations. The nanofibers demonstrated a temperature sensitivity of -0.976 gray value/°C and pressure sensitivity with an increase in fluorescence intensity from 537 a.u. to 649 a.u. under 600 g pressure. These findings highlight the potential of TPE-doped PVDF nanofiber membranes for advanced temperature and pressure sensing applications.

Influenced by geological, climatic, and natural weathering factors, the Great Wall heritage is sus-ceptible to deformations, posing significant challenges to the comprehensive preservation of the Great Wall sites. To investigate techniques for monitoring deformations in extensive linear cultural heritage sites, such as the Great Wall, this study utilizes the SBAS-InSAR technique for deformation monitoring and analysis. A dataset comprising 161 Sentinel-1A images spanning from March 2017 to January 2022 was chosen for SBAS-InSAR processing, yielding a deformation velocity field. To verify result credibility, a typical mountainous segment spanning approximately 896.53 km within the Great Wall landscape corridor underwent analysis. The findings suggest that around 75.8% of the landscape corridor along the Shanxi section of the Ming Great Wall maintain relative stability, displaying deformation rates varying from -10 to 10 mm/year. The remaining 24.2% of the land-scape corridor experiences notable deformations, including a maximum subsidence rate of 33.1 mm/year and a maximum subsidence of 148.6 mm. This study illustrates the potential utility of the SBAS-InSAR technique for monitoring and evaluating surface deformations in extensive linear cultural heritage sites.

The resilience of towns and cities refers to their ability to adapt and recover when confronted with pressures or challenges. This study employs ten variables as indicators to assess the resilience of urban areas by analyzing official data and constructing a multilevel mixed-effects structural equation model. The empirical findings demonstrate that enhancing resilience significantly influ-ences urban service functions, such as strengthening healthcare systems, stabilizing the real estate market, and addressing socio-economic challenges. Specifically, factors such as healthcare re-sources, housing demand, population structure, and social security exhibit varying levels of resil-ience, which profoundly impact the spatial distribution of these factors and socio-economic de-velopment. Disparities in healthcare resource allocation, demographic aging trends, and shifts in the housing market closely correlate with resilience levels in different regions. Additionally, the study emphasizes that improving resilience not only boosts the reliability and security of urban services but also ensures that communities receive necessary support and protection during times of adversity. Consequently, policymakers should recognize the pivotal role of urban resilience in resource allocation and social equity, devising corresponding strategies to enhance the resilience of these areas.

Agriculture is an industry that heavily relies on the environment. The increasing frequency of ex-treme disasters attributable to climate change has adversely affected agricultural land and dis-rupted the stability of the supply of agricultural products. Therefore, we implemented a research program focused on current strategies for adapting to agricultural meteorological disasters. The primary goal was to actively promote disaster prevention information and techniques through information platforms and applications and to provide refined forecasting and an early warning system to enhance preparedness for and recovery from agricultural disasters. This initiative can transform passive mitigation into dynamic action by disseminating crucial information to farmers. We integrated meteorological data and crop characteristics to develop disaster prevention strate-gies for the predisaster, during-disaster, and postdisaster stages to empower farmers to implement autonomous disaster prevention, ensuring their profitability and minimizing the impact of disas-ters. This paper presents an agricultural disaster prevention system involving cross-disciplinary collaboration to establish an early warning system for crop disasters. However, the effectiveness of the early warning system relies on the availability of complete meteorological and crop infor-mation, necessitating high-density agricultural meteorological stations, refined weather forecast services, historical crop damage data, and ongoing research and development on disaster preven-tion technology. In the system, a diversified social media interface is used to provide local farmers with weather forecast information. When impending disasters are identified, the platform acti-vates disaster prevention measures to reduce agricultural losses. This article paper introduces Taiwan’s agricultural disaster prevention system as a complete disaster prevention strategy.

The present study analyzed light emitting diodes (LEDs) as an output load and used a Taylor series to describe the characteristic curve based on the exponential characteristic of voltage and current. A prototype circuit of a flyback LED driver system was established to verify whether the theory is consistent with actual results. This study focused on the exponential relationship of LED voltage and current. Conventional simulations usually used linear models to present LED loads. However, the linear model resulted in considerable error between simulation and actual characteristics. Therefore, this study employed a Taylor series to describe the nonlinear characteristic of an LED load. Through precise calculations with Mathcad computation software, the error was effectively reduced. Moreover, the process clarified the influence of temperature on LEDs, which benefited the characteristic analysis of the entire system. Finally, a realized circuit of 120-W flyback LED drivers was established for conducting theory verification, including theoretic analysis and evaluation of the system design process of the flyback converter. The circuit simulation software SIMPLIS was used to demonstrate the system model, which enabled quick understanding of the system framework established in this study. Regarding LEDs, a commercially available aluminum luminaire was used as the output load. The measured results of the actual circuit and the simulation results were remarkably consistent. For the same system at the same temperature, the error between the simulation and actual results was less than 3%, which proved the reliability of the Taylor series simulation.

The article presents a literature review of three Chinese manuscripts containing natural dyes recipes and three containing synthetic dyes from the Ming Dynasty to the Republican Period. The manuscripts mentioned were exclusively used as references and sources. Four databases were used to access the original documents, then, a translation from old mandarin to Spanish was made. For natural dyes, the results show four dyestuffs were commonly used to produce colors, sappanwood (Caesalpinia sappan L.), followed by safflower (Carthamus tinctorius L.), indigo (Indigofera tinctoria L.), and sophora (S. japonicum L.). While the synthetic dyes exported to or produced in China were mainly bluish, greenish, and violet probably because they were difficult to obtain from natural ones. The literature review of the dyes and their recipes can be a key factor in any art history or conservation study, improving the understanding of how the colors were achieved and as complementary information for analytical analyses. It provides useful details that contribute to the preservation of Chinese dye history on silk heritage.

Abstract: NFinFET transistors with fin channel length 90nm and a planar MOSFET transistor with channel length 180nm and 90nm are presented with characteristic curves at various gate biases. A finalized algorithm with kink effects is effectively responsible for addressing the field effect transistors. The algorithm includes the modified conventional current-voltage formula and a nonlinear heat-associated kink solution which is simplified as a Gaussian form. Three parameters in modified model includes kN (related with channel width, channel length, and gate oxide capacitor, and proportional to the mobility of carriers)Vth(Threshold Voltage), and (the inverse of Early Voltage). Those parameters are determined to minimize the discrepancies between the measured data and the fitting values, but leave kinks located at around (VGS－Vth), which are deliberately eliminated by the Gaussian form because of the agitation of thermal kink effects. The whole fitting is made to be as close as the as-measured IDS-VDS. In the mean time, those determined parameters are physically meaningful after the analysis has been done.

Multicellular organisms organize themselves according to two principles; first, the equilibrium between the driving force of unstable state cells and apoptosis or senescence; and second, the mutual equilibrium between the functional requirements of different types of cells. For the first principle, we deduce that stem cells at different levels have their own growth limits, which are determined by two factors: the ability of the stem cells to enter an unstable state (specifically, the ability of cells to divide and differentiate); and the rate of cellular senescence, loss of function, and finally, apoptosis. The superposition of stem cell limits at different levels over each other can amplify small differences at the genetic level. Moreover, the growth limits of different organs are different, which lead to different individuals having completely different appearances. The second principle is that the sum of the specific output functions of an organ must be equal to the overall demand for the function to be provided by the organ. If negative entropy input can meet this equilibrium, defects in certain genes will cause these defective individuals to become larger or develop other morphology.

The bridge crane is often used in a complex environment, often subject to interference of all loads. Some uncertainties factors often have an inevitable impact on its swing. So the force situation of the bridge crane during a working cycle is analyzed, and a three-dimensional dynamic mathematical model of the bridge crane is built. Through the simulation analysis of the model under the action of driving force and wind load, the change law of the swing angle of the bridge crane is studied. Then, the fuzzy control theory is used to determine the control parameter in the anti sway control process. The position, swing angle deviation and deviation rate of the bridge crane are taken as the input, and the parameter correction is obtained after the fuzzification by using the center of gravity method, the anti sway fuzzy control system of the bridge crane is designed and simulated. The research results show that the fuzzy PID anti sway controller can not only improve the adaptability of the control system, but also overcome the large overshoot, quickly restrain the swing, and effectively realize the anti sway function of the bridge crane.

The utilization of Artificial Intelligence (AI) in biotechnology is widespread, addressing challenges such as elucidating disease pathophysiology and novel therapeutic approaches. AI plays a critical role in tasks such as drug manufacturing, chemical analysis, RNA and DNA sequencing, and enzyme studies by automating processes and expediting data collection and analysis. AI has particularly transformed the analysis of omics data for researchers, providing tools to handle complex and multifaceted datasets effectively. Through AI, integrative analysis of multi-omics data can be conducted in efficient ways. This article discusses the application of multi-omics and AI technologies in studying various diseases related to infection (COVID-19), mutation (cancer), and senescence (alopecia) to understand their pathophysiology. The applications of AI were performed as the aspect of the diagnosis, prognosis, and treatment for each disease. We introduce AI-driven analysis of pathophysiology can overcome traditional limitations in pathology, with diverse features showing potential in defining the causes of diseases, and potentially enhancing primary omics data in the distinguish the subtype of diseases. In this context, integrated approaches using multi-omics data and AI technology could provide fresh biological insights by comprehending the molecular mechanism of diseases and is instrumental in advancing precision medicine. We anticipate that the rapidly advancing AI-based multi-omics data analysis will significantly contribute to promoting healthy longevity.

Using lightweight fire-rated board (LFRB) presents cost-effective opportunities for various passive fire protection measures. The aim of the project is to develop a LFRB with enhanced fire resistance, acoustic properties, and mechanical properties. These properties were determined using the Bunsen burner, furnace, energy dispersive X-Ray, impedance tube instrument, and Instron universal testing machine. To fabricate the LFRBs, vermiculite and perlite were blended with flame-retardant bind-ers, and four types of LFRBs were produced. A fire test was conducted to compare the fire-resistance performance of the LFRBs with a commercially available flame retardant board. The B2 prototype showed exceptional fire-resistant properties, with a temperature reduction of up to 73.0 °C as compared to the commercially available fire-rated magnesium board. Incorporating nano chicken eggshell into the specially formulated flame-retardant binder preserved the LFRBs’ structural integrity, enabling them to withstand fire for up to 120 minutes with an equilibrium temperature of 92.6 °C. This approach also provided an absorption coefficient of α = 2.0, a high flexural strength of 3.54 MPa, and effective flame retardancy properties with a low oxygen/carbon ratio of 2.60. These results make the LFRBs valuable for passive fire protection applications in the construction and building materials industry.

Aiming at the problems of inaccurate segmentation of long object and information loss of small object in real-time semantic segmentation algorithm, this paper proposes a lightweight multi-branch real-time semantic segmentation network based on BiseNetV2. The new auxiliary branch makes full use of spatial details and context information to cover the long object in the field of view. Meanwhile, in order to ensure the inference speed of the model, the asymmetric convolution is used in each stage of the auxiliary branch to design a structure with low computational complexity. In the multi-branch fusion stage, the alignment and fusion module is designed to provide guidance information for deep and shallow feature mapping, so as to make up for the problem of feature misalignment in the fusion of information at different scales, and thus reduce the loss of small target information. In order to further improve the model’s awareness of key information, a global context module is designed to capture the most important features in the input data. The proposed network uses NVIDIA GeForce RTX 3080 Laptop GPU experiment, on the road street view data set Cityscapes and CamVid average occurring simultaneously ratio reached 77.1% and 78.4% respectively, with running speed of 127 frames/s respectively and 112 frames/s. The experimental results show that the proposed algorithm can achieve real-time segmentation and improve the accuracy significantly, showing good semantic segmentation performance

Nutrients are the driving force of plant and herbivore interactions. Different elements and fertilization levels in soil, or artificially fertilized substrates can have a direct impact on plant defense responses. Meanwhile, nutrient levels mediated by root associated microbes can indirectly affect plant-herbivore interactions. Nutrient uptake promoted by beneficial mycorrhizal fungi or rhizobacteria interacting with roots can stimulate plant tolerance to herbivore attack, as evidenced by herbivore performance, plant nutrient status, plant biomass allocation and compensatory growth. In return, herbivory affects nutrient fluxes between plants and their associated beneficial microbes. Furthermore, aboveground and belowground herbivory can affect the nutrient exchange between plants and soil microbial communities, mainly for carbon-and nitrogen-based resources supporting herbivores´ life cycles. These ecological interactions are governed by jasmonic acid (JA) and key enzymes on the molecular level. This review summarizes the current scientific literature on the role of nutrients in plant-herbivore interactions. This will support efforts to optimize plant defense strategy via managing nutrient variance.

The purpose of this paper is to construct an evaluation system for AI painting software based on generative adversarial network technology, which optimizes the performance of the related software in terms of functionality, ease of use, system performance and safety. The results of the questionnaires are statistically analyzed. In addition, exploratory factor analysis was supported to extract the data of the study, which was ultimately used to calculate the weight and importance of each index through fuzzy hierarchical analysis method. The study constructed an evaluation system for AI painting software based on generative adversarial network technology, including 16 indicators of functionality, 16 indicators of ease of use, 7 indicators of system performance, and 8 indicators of safety respectively that their alpha coefficients were 0.882, 0.962, 0.932, 0.932, and 0.932, respectively. In addition, the accumulated explanatory variances of their coefficients were 84.405%, 84.897%, 84.013%, and 72.606%, respectively, 73.013%, and 72.606%, respectively. It is clear that the items included in each of the indicators are homogeneous, with a high degree of internal consistency. This paper suggests that the development of AI painting software focusing on functionality, ease of use, system performance and safety can enhance the market competitiveness of the software.

Chemical investigation of the Chinese soft coral Lobophytum sp. has resulted in the isolation of six new compounds, namely lobosteroids A–F (1–6), along with four known compounds. Their structures were determined by extensive spectroscopic analysis and comparison with the spectral data reported in the literature. Among them, the absolute configuration of 1 was determined by X-ray diffraction analysis. These steroids characterized by either the presence of an α,β-αꞌ,βꞌ-unsaturated carbonyl or an α,β-unsaturated carbonyl moiety in ring A, or the existence of a 5α,8α-epidioxy system in ring B, as well as diverse oxidation sites of side chains. The prelimi-nary antibacterial bioassay showed all compounds exhibited significant antibacterial activities against the fish pathogenic bacteria Streptococcus parauberis FP KSP28 and Phoyobacterium damselae FP2244 with all inhibition rates more than 90% at the concentration of 150 µM. And at the same concentration, compounds 2, 6–10 also displayed potent inhibitory effects against vancomy-cin-resistant Enterococcus faecium bacteria G7 with all inhibition rates more than 90%.

Spectacular shifts have been led to by The COVID-19 crisis in consumer behavior. Retailers will have to work hard to meet ever-evolving customer service experience with respect to the ways in which it may be differently affected by offline or online transactions in order to win and stay relevant. We suggest an integrative framework and construct customer service experience hypotheses, based on its antecedents and consequences that will contribute to academic study as well as managerial implications. The hypotheses are tested by a simultaneous equation model employing two data sets of the retail industry's offline and online customers. In this study, 571 samples of these businesses, 319 and 252 respondents from offline and online retail channels, respectively, were collected by means of an online web survey of consumers. The results show that the impact of consequences and antecedents of CSX differs based on the media utilized. The integrative framework of CSX in its online medium is far more effective than its explanatory power offline. The outcomes are reasonably counterintuitive in so far as they demonstrate that while most elements of CSX where a service is selected offline is the same in terms of customer loyalty and value equity, the emotional element related to the service provider is higher when the service is selected offline rather than online. These outcomes indicate that, contrary to popular fears, the online medium enables firms to develop a loyal customer foundation. These findings offer perceptivity into how an online channel could be used to better complement the offline channel, contributing towards new knowledge and understanding on CSX and how it may be utilized for managerial decision-making.

It is desirable to upgrade previous evolutionary theories, which have remained incomplete and controversial for decades. Here we employ the concept of carbon-based entities (CBEs), which include methane, amino acids, proteins, organisms, and other entities containing relatively many carbon atoms. We deduce the driving force, mechanisms, steps, modes, tempos of CBE evolution, through integration of biology, physics, and chemistry using logics for complex issues. We hence establish the Carbon-Based Evolutionary Theory (CBET). The CBET suggests that evolution is the increase in hierarchy, diversity, fitness of CBEs under natural selection and driven by thermodynamics due to the chemical effect of the thermodynamic features of the Earth on CBEs. It provides better explanations for life origin, macroevolution events, natural selection, sympatric speciation, and evolution tempos than previous evolutionary theories. It reveals the evolutionary basis of multiple important social notions, including diversity, collaboration, altruism, obeying rules, and proper increase in freedom. It refutes some wrong notions in thermodynamics, including negative entropy (negentropy) and that biological order is equal to thermodynamic order, which have misled many people. The CBET is supported by its deduction and application. It could be a rare bridge linking laws of thermodynamics, evolution of life, and development of human society, and could have great significance in various sciences.

This paper reports the efforts made and experiences gained in developing the Flood Prevention and Emergency Response System (FPERS) powered by Google Earth Engine, with focus on its applications at the three stages of floods. At the post-flood stage, FPERS integrates various remote sensing imageries, including Formosat-2 optical imagery, to detect and monitor barrier lakes, synthetic aperture radar imagery to derive an inundation map, and high-spatial-resolution photographs taken by unmanned aerial vehicles to evaluate damage to river channels and structures. At the pre-flood stage, a huge amount of geospatial data are integrated in FPERS and are categorized as typhoon forecast and archive, disaster prevention and warning, disaster events and analysis, or basic data and layers. At the during-flood stage, three strategies are implemented to facilitate the access of the real-time data: presenting the key information, making a sound recommendation, and supporting the decision-making. The example of Typhoon Soudelor in August of 2015 is used to demonstrate how FPERS was employed to support the work of flood prevention and emergency response from 2013 to 2016. The capability of switching among different topographic models and the flexibility of managing and searching data through a geospatial database are also explained, and suggestions are made for future works.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

A case-crossover study examined how PM_2.5 from Asian Dust Storms (ADS) affects the number of emergency room (ER) admissions for cardiovascular diseases (CVDs) and respiratory diseases (RDs). Our data indicated that PM_2.5 concentration from ADS was highly correlated with ER visits for CVDs and RDs. The odds ratios (OR) increased by 2.92 (95% CI: 1.22-5.08) and 1.86 (95% CI: 1.30-2.91) per increase 10 µg/m³ in PM_2.5 levels, for CVDs and RDs, respectively. A 10 µg/m³ increase in PM_2.5 from ADSs was significantly associated with increase in ER visits for CVDs among those 65 years of age and older (an increase of 2.77 in OR) and for females (an increase of 3.09 in OR). In contrast, PM_2.5 levels had a significant impact on RD ER visits among those under 65 years of age (OR=1.77). The risk of ER visits for CVDs increased on the day when the ADS occurred in Taiwan and the day after (lag 0 and lag 1); the corresponding risk increase for RDs only increased on the fifth day after the ADS (lag 5). In Taiwan’s late winter and spring, the severity of ER visits for CVDs and RDs increases. Environmental protection agencies should employ an early warning system for ADS to reduce high-risk groups’ exposure to PM_2.5.

Triple-negative breast cancer (TNBC), characterized by deficiency in estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor2 (HER2), is among the most lethal subtypes of breast cancer (BC). Nevertheless, the molecular determinants that contribute to its malignant phenotype such as tumor heterogeneity and therapy resistance remain elusive. In this study, we sought to identify the stemness-associated genes involved in TNBC progression. Using bioinformatics approach, we found 55-up and 9-down regulated genes in TNBC. Out of the 55 upregulated genes, a 5 gene-signature (CDK1, EZH2, CCNB1, CCNA2, and AURKA) involved in cell regeneration, was positively correlated with status of tumor hypoxia and clustered with stemness-associated genes, as recognized by Parametric Gene Set Enrichment Analysis (PGSEA). Also, enhanced infiltration of immunosuppressive cells was positively correlated with the expression of these 5 genes. Moreover, our experiments showed that depletion of the transcriptional co-factor nucleus accumbens-associated protein 1 (NAC1), which is highly expressed in TNBC, reduced the expressions of these genes. Thus, the five genes signature identified by this study warrants further exploration as a potential new biomarker of TNBC heterogeneity/stemness characterized by high hypoxia, stemness enrichment, and immune-suppressive tumor microenvironment.

Effective prediction of wastewater treatment is beneficial for precise control of wastewater treatment processes. The nonlinearity of pollutant indicators such as COD and TP makes the model difficult to fit and has low prediction accuracy. The classical deep learning methods have been shown to perform nonlinear modeling. However, there are enormous numerical differences between multi-dimensional data in the prediction problem of wastewater treatment, such as COD above 3000 mg/L and TP around 30 mg/L. It will make current normalization methods challenging to handle effectively, leading to the training failing to converge and the gradient disappears or exploding. This paper proposes a multi-factor prediction model based on deep learning. The model consists of a combined normalization layer and a codec. The combined normalization layer combines the advantages of three normalization calculation methods: z-score, Interval, and Max, which can realize the adaptive processing of multi-factor data, fully retain the characteristics of the data, and finally cooperate with the codec to learn the data characteristics and output the prediction results. Experiments show that the proposed model can overcome data differences and complex nonlinearity in predicting industrial wastewater pollutant indicators and achieve better prediction accuracy than classical models.

In the present work, a predictive modelling and optimization with the adaptive network based fuzzy inference system(ANFIS) modelling of mechanical properties of laser-coated NB/SiC/Ni welds was studied based on Taguchi design by laser cladding. An ANFIS model based on a Sugeno type fuzzy inference system was developed for predicting the hardness properties of SiC/BN/Ni welds by laser cladding with experimental data required for network training and prediction. Based on analysis of variance, three important factors were taken as inputs for the fuzzy logic inferences, while the hardness properties was taken as the output of the ANFIS. The microstructure of welds were analysed using scanning electron microscopy with an energy dispersive X-Ray spectrometer. Highly developed leaf-like dendrites and eutectic crystals were found in some areas of the melting zone for the BN/SiC/Ni weld, which was significantly hardened. The ANFIS model based on Taguchi's design provides a better pattern of response because the predicted and experimental values were highly similar. As a result, a satisfactory result was achieved between the predicted and experimental values of hardness in laser-coated NB/SiC/Ni welds, whereby the success and validity of the method was verified.

Based on collected power generation data associated with solar irradiance, PV system conversion efficiency and cell temperature, an hourly solar PV power estimation model by a parallel artificial neural network (ANN) and particle swarm optimization (PSO) algorithm is proposed. Weight matrices related to different seasons and geographic areas for estimation power generations have been trained by real measured operation data. The parallel PSO algorithm with heuristic global optimization technique assists the ANN training process to get near optimal solutions precisely. The accuracy and reliability of estimation is audited by actual details of photovoltaic power stations in various regions and scales. The results of estimation model can not only assist the electricity dispatcher to explicitly monitor the trend of solar power generation in different areas, but also coordinate with traditional power plants to meet load demand more accurately. The presented model will bring benefits to power dispatching for larger scales of intermittent and unstable solar power generation.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Affective computing has emerged as a prominent technology in recent years, driven by the increasing demand for machines capable of understanding and interpreting emotions. The COVID-19 pandemic has intensified this need by reducing physical interactions and increasing reliance on digital communication, which often involves complex emotional exchanges. To enhance social interactions by identifying and addressing negative emotions, an interactive emotion-perception system based on multi-sensing interfaces and affective computing has been proposed. Integration of gesture, voice, and brainwave sensors is employed to provide users with a rich sensory experience and immersive environment. Design principles and system development processes are derived from the affinity diagram method and prototype development approach. The proposed system was constructed, and experiments were conducted with 60 participants. Interpersonal interaction scenarios were explored to understand emotional transmission mechanisms, aiming to enhance user satisfaction and positive interpersonal experiences. Data were collected through indirect observation and questionnaires, followed by evaluation and statistical analysis. Findings include: (1) The emotion-perception system enhances positive interpersonal interactions by identifying 36 distinct emotions, with overall user emotions being positive but exhibiting notable individual variations; (2) The system effectively stimulates positive emotions and strengthens interpersonal interactions, with affective computing technology fostering enjoyable emotional resonance and high-quality relationships; (3) A positive correlation was observed between semantic analysis and brainwave metrics of relaxation and concentration, showing increased concentration and enhanced positive emotional interactions during message transitions; and (4) The multi-sensing and affective computing technology provides a pleasant and relaxing emotional journey, with interactions shifting from enthusiasm to comfort, demonstrating the system’s capacity for a satisfying and enjoyable experience.

Shrews (Soricidae) are common small wild mammals. Some species of shrews, such as Asian house shrews (Suncus murinus), have a significant overlap in their habitats with humans and domestic animals. Currently, over 190 species of viruses in 32 families, including Adenoviridae, Arenaviridae, Arteriviridae, Astroviridae, Anelloviridae, Bornaviridae, Caliciviridae, Chuviridae, Coronaviridae, Filoviridae, Flaviviridae, Hantaviridae, Hepadnaviridae, Hepeviridae, Nairoviridae, Nodaviridae, Orthoherpesviridae, Orthomyxoviridae, Paramyxoviridae, Parvoviridae, Phenuiviridae, Picobirnaviridae, Picornaviridae, Polyomaviridae, Poxviridae, Rhabdoviridae, Sedoreoviridae, Spinareoviridae, and three unclassified families, have been identified in shrews. Diverse shrew viruses, such as Borna disease virus 1, Langya virus, and severe fever with thrombocytopenia syndrome virus, cause diseases in humans and/or domestic animals, posing significant threats to public health and animal health. This review compiled fundamental information about shrews and provided a comprehensive summary of the viruses that have been detected in shrews, with the aim of facilitating a deep understanding of shrews and the diversity, epidemiology, and risks of their viruses.

The United Nations' sustainable development goals have underscored the importance of enhancing supply chain sustainability while appropriately distributing orders. This study proposes a novel framework involving Z-number, game theory, indifference threshold-based attribute ratio analysis (ITARA), and combined compromise solution method (CoCoSo) to evaluate the sustainability of suppliers and order allocations. To better reflect the decision makers’ current choices for the sustainability of assessed suppliers and order allocations; enhance the comprehensiveness of decision-making, the importance parameter of the supplier is obtained through game theory objectively for transforming supplier performance into order allocation performance. The Z-numbers are involved in ITARA (so-called ZITARA) and CoCoSo (so-called ZCoCoSo) to overcome the issue of information uncertainty in the process of expert evaluation. ZITARA and ZCoCoSo are applied to assess the objective weight of criteria and the ranking of assessed order allocations, respectively. Afterwards, a case study of China’s company is illustrated the utility of the proposed framework and inform their decision-making process regarding the orders to be assigned to the assessed suppliers.

Objective: This study investigated the effect of the hierarchical medical system under the national health insurance program on resident’s healthcare-seeking behavior in Taiwan. Background: Healthcare authorities in Taiwan initiated the allowance reduction of outpatient visits at regional hospitals and higher hierarchical hospitals from 2018. The ultimate goal is to implement a hierarchical medical system and provide the residents accessible as well as consistent medical services. Methods: This research was conducted through the questionnaire survey method and data were collected between August and December 2018 from the records of subjects who had recently sought medical attention. A total of 1,340 valid questionnaires were returned. Results: Regarding the effect on healthcare-seeking behavior, the following factors were significant: being aged between 40 to 49 (p＜.1), subjects with an educational background of junior high school (p＜.05), those who were not aware of the policy (p＜.001), and an awareness about both the hierarchical medical system and the policy to reduce outpatient visits to large hospitals (p＜.001). Conclusion: The public should be made aware about the hierarchical medical system to improve healthcare.

Gastric inflammation-related disorders are commonly observed digestive system illnesses char-acterized by the activation of proinflammatory cytokines, particularly tumor necrosis factor-α (TNF-α). This results in the induction of cyclooxygenase-2 (COX-2)/prostaglandin E2 (PEG2) and matrix metallopeptidase-9 (MMP-9). These factors contribute to the pathogenesis of gastric in-flammation disorders. We examined the preventive effects of Lonicera japonica Thunb. ethanol ex-tract (Lj-EtOH) on gastric inflammation induced by TNF-α in normal GES-1 cells. The GES-1 cell line was used to establish a model that simulated the overexpression of COX-2/PGE2 and MMP-9 proteins induced by TNF-α, to examine the anti-inflammatory properties of Lj extracts. The re-sults indicated that Lj-EtOH exhibits significant inhibitory effects on COX-2/PEG2 and MMP-9 ac-tivity, attenuates cell migration, and provides protection against TNF-α-induced gastric inflam-mation. The protective effects of Lj-EtOH are associated with the modulation of COX-2/PEG2 and MMP-9 through activation of TNFR–ERK 1/2 signaling pathways as well as the involvement of c-Fos and nuclear factor kappa B (NF-κB) signaling pathways. Based on our findings, Lj-EtOH ex-hibits a preventive effect on human gastric epithelial cells. Consequently, it may represent a novel treatment for the management of gastric inflammation.

Global dust events have become more frequent due to climate change and increased human activity, significantly impacting air quality and human health. Previous studies have often focused on simulating cross-regional dust transport based on atmospheric parameters; however, comprehensive monitoring of dust events remains challenging. Therefore, this study utilized Fengyun-4A (FY-4A) satellite Advanced Geostationary Radiation Imager (AGRI) imagery, Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observation (CALIPSO) lidar, and other auxiliary data to conduct three-dimensional spatiotemporal monitoring and cross-regional transport analysis of two typical dust events in the Beijing–Tianjin–Hebei (BTH) region of China using four dust intensity indices (Icsd, Dust Detection Index (DDI), Dust value (DV), and Dust Strength Index (DSI)) and the HYSPLIT model. We found that among the four indices, DDI was the most suitable for studying dust in the BTH region, with a detection accuracy (POCD) of > 88% at all times and reaching a maximum of 96.14%. Both the 2021 and 2023 dust events originated from large-scale deforestation in southern Mongolia and the border area of Inner Mongolia, with dust plumes distributed between 2 and 12 km being transported across regions to the BTH area. Further, when dust aerosols are primarily concentrated below 4 km and PM10 concentrations consistently exceed 600 µg/m³, large dust storms are more likely to occur in the BTH region. The findings of this study provide valuable insights into the sources, transport pathways, and environmental impacts of dust aerosols.

Regeneration of biological tissues in medicine is challenging, and 3D bioprinting offers an innovative way to create functional multicellular tissues. One common way in bioprinting is bioink which is one type of the cell-loaded hydrogel. For clinical application, however, the bioprinting still suffers from satisfactory performance, e.g. in vascularization, effective antibacterial, immunomodulation and regulation of collagen deposition. Many studies have incorporated different bioactive materials into the 3D printed scaffolds to optimize the bioprinting. Here, we review a variety of additives added to the 3D bioprinting hydrogel. The underlying mechanisms and methodology for biological regeneration are important and will provide useful basis for future research.

Ensuring optimal performance and reliability in rotor-bearing systems is crucial for industrial applications. Imbalance and shaft bow in these systems can lead to decreased efficiency and increased vibrations. Early detection and mitigation of a rotor’s faults are essential, and model-based fault identification has gained much attention in the manufacturing industry for years. Over the past two decades, however, the development of fault diagnosis rules with data-driven and artificial intelligence (AI) has become a trend, and in the foreseeable future, AI combined with big data will become mainstream. Nevertheless, the critical role of rotating machinery in manufacturing introduces a challenge, as the availability of fault data is often insufficient. This limitation renders the establishment of diagnostic rules using data-driven methods and AI technologies impractical. In light of these challenges, this study proposes a novel hybrid approach, that combines a physical model with machine learning (ML) techniques for the diagnosis of multi-faults (imbalance and shaft-bow demonstrated) in a Jeffcott rotor. To overcome the lack of real-world faulted, labeled datasets, a physics-based Jeffcott rotor model is first derived and then used to generate abundant fault datasets for ML. Subsequently, simulated data are employed for the training of an artificial neural network (ANN), enabling the network to learn from and analyze the vast array of generated data. The results prove that a well-trained feed-forward neural network (FNN) can accurately isolate and diagnose the imbalance and shaft-bow faults using the simulated data and the real data from the Jeffcott rotor experiment. These physics-based and ML approaches prove effective particularly for multi-fault, offering new possibilities for advanced rotor system monitoring and maintenance strategies in industrial applications.

P-band radar remote sensing applied during the Airborne Microwave Observatory of Subcanopy and Subsurface (AirMOSS) mission has shown great potential for estimation of root zone soil moisture. When retrieving the soil moisture profile (SMP) from P-band radar, a mathematical function describing the vertical moisture distribution is required. Because only a limited number of observations are available, the number of free parameters of the mathematical model must not exceed the number of observed data. For example, a second order polynomial that contains 3 free parameters was presumed based on in-situ SMP data. The polynomial is currently parameterized based on 3 backscatter observations provided by AirMOSS (i.e. one frequency at three polarizations of HH, VV and HV). In this paper, a more realistic, physically-based SMP model containing 3 free parameters is derived based on a solution to Richards’ equation for unsaturated flow in soils. Evaluation of the new SMP model based on both numerical simulations and measured data revealed that it exhibits greater flexibility for fitting measured and simulated SMPs than the currently applied polynomial. It is also demonstrated that the new SMP model can be reduced to a second order polynomial at the expense of fitting accuracy.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

In Taiwan, remote healthcare was initially limited to telemedicine services, and the systematic development of remote care was relatively delayed. It was not until 2007 that the Department of Health of the Executive Yuan first initiated the 'Remote Care Pilot Program,' followed by the 'Remote Care Service Improvement and Quality Enhancement Plan' in the subsequent year. In 2010, Taiwan officially launched the 'Remote Health Care Services Development Plan' and established a dedicated project office, marking the comprehensive start-up of remote care services. This stage saw significant contributions from artificial intelligence aids and ICT remote transmission technologies, greatly promoting the application of smart healthcare in home care. This study aims to explore the strategic gaps in the application of smart healthcare in home remote care. By analyzing gaps in 'legal regulations,' 'economic factors,' 'user behavior habits,' 'policy and culture,' and 'environment and technology,' this study employs a mixed-methods approach. Particularly, it uses the Analytic Hierarchy Process (AHP) to construct a weighted ranking of these strategic gaps. Through in-depth interviews with doctors and smart healthcare experts and the collection of 16 valid AHP questionnaire samples, which cover both industry and academia with a balanced distribution, the survey results are ensured to be representative and reliable. The findings indicate that 'legal regulations' are considered the most critical strategic gap that needs to be addressed first, followed by 'user behavior habits.' This suggests that when designing smart healthcare applications, greater consideration needs to be given to user acceptance and habits. By systematically analyzing and addressing these strategic gaps, this study not only provides solutions to issues in the application of smart healthcare in home remote care but also offers valuable references for future research and practice, aiming to make home remote care services more comprehensive and efficient.

Based on the perspective of complex directed weighted network analysis, this paper constructs a static resilience evaluation framework for trade networks from two dimensions: structural resilience and node resilience. It studies the evolution of static resilience in the upstream, midstream, downstream, and recycling trade networks of global wood forest products from 2002 to 2021. The study finds that the total trade volume of global wood forest products has increased by 58.0%, 77.3%, 71.2%, and 77.2% in the upstream, midstream, downstream, and recycling sectors, respectively. The downstream trade network exhibits efficient information transmission and resource mobility capabilities. All four types of trade networks exhibit scale-free characteristics, with core countries such as China, the United States, and Germany playing a dominant role in the network and playing a crucial role in network robustness, but also increasing network vulnerability. In terms of unweighted assortativity, all four networks exhibit the characteristic of "small countries relying on hubs," while the weighted assortativity of the downstream network is positive, indicating enhanced network resilience. In terms of node resilience, countries exhibit significant differences and dynamic changes. China demonstrates strong resilience and adaptability, while the United States maintains its core position. China's influence in the downstream network has significantly increased, and India has rapidly emerged in the recycling network. To enhance network resilience, it is necessary to increase diversity and redundancy, establish effective emergency response mechanisms, and promote the diversification and green transformation of the supply chain.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

We estimated the daily intakes of chlorpyrifos and cypermethrin via ingestion of indoor dust and outdoor soils using the Stochastic Human Exposure and Dose Simulation Model on a probabilistic approach for Taiwan’s homes. Variable information for the daily intake estimation, such as concentration, ingestion rate, body weight, was adopted from previous studies. Monte Carlo simulation was performed with 1,000,000 iterations to simulate a single daily intake, which was shown in terms of percentage of the Acceptable Daily Intake (ADI) of either insecticide. The daily intakes were minimal with a 99% probability; at 99.9th percentile, however, the total intakes leaped to 13.1% and 20.0% of the respective ADIs of chlorpyrifos and cypermethrin. The sensitivity analysis indicated that concentration was the most determinant variable. Compared to the data of daily intakes via dietary ingestion of vegetables derived from a previous study, the estimated intakes by this study were considerable at the highest percentile, which referred to insecticide residues few days after insecticide application. Consequently, the non-dietary ingestion exposure to either insecticide was negligible in most cases; nevertheless, for those with indoor insecticide applications, the daily intakes for young children could be of concern. Frequently home cleaning is recommended to reduce the exposure.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

This paper uses the complex regression analysis method to establish the customer’s load regression models, which consider economic indicators, temperature and rainfall. Furthermore, the proposed models are used to study the forecasting feasibility of the future energy sales and summer peak load demand. At first, this paper used least-squares techniques to derive regression models for considering economic indicators and temperature of 34 customer energy sales and total energy sales. Besides, the AMI high voltage customer demand data and system generating capacity for 24 hours were adopted to forecast summer peak load. The above-mentioned data analysis tool is used by EViews software to achieve, in order to verify the feasibility of the research framework. The study found that although its forecasting model accuracy is low only when mixed with temperature and high voltage demands. So, when mixed with high voltage demand data and system generating capacity for 24 hours to forecast peak load, the average error is ± 0.87% and in the majority of its energy sales forecasting model of average error is ±3%. This result can provide power company as future reference.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

Wind energy is a kind of renewable energy with great potential for development. This study mainly investigated the application of shock waves generated by high-pressure gases (wind energy) for generating energy. In this study, we designed a new supersonic shock wave generator that can be reused without disassembling and assembling bolts and developed a supersonic shock wave monitoring system. This system monitored the velocity of the generated shock waves, which was Mach 3-5, and the output pressure was more than 100 times higher than the input pressure of the shock wave generator tank.Then, we developed a power generation system driven by supersonic shock waves based on the characteristics of the new shock wave generator, which can generate high-pressure and high-speed blast waves and can be reused. The shock wave generator can repeatedly generate high-pressure waves to drive the Tesla turbine and then the magnetic energy generator for power generation. We established a complete control process for power generation driven by shock waves by controlling the valve stem. The system can detect the tank pressure, output pressure, gas flow, rotation speed, voltage, and current during the control process for the performance analysis of power generation.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Teachability has been extensively studied under the context of making industrial robots to be programmable and reprogrammable. However, it is only recently that the artificial intelligence (AI) research community is accelerating the research works with the objective of making humanoid robots and many other robots to be teachable under the context of using natural languages. We human beings spend many years to learn knowledge and skills despite our extraordinary mental capabilities of being teachable with the use of natural languages. Therefore, if we would like to develop human-like robots such as humanoid robots, it is inevitable for us to face the issue of making future humanoid robots to be teachable with the use of natural languages as well. In this paper, we present the key details of a top-down design for achieving a teachable mind which consists of two major processes: the first one is the process which enables humanoid robots to gain innate mental capabilities of transforming incoming signals into meaningful crisp data, and the second one is the process which enables humanoid robots to gain innate mental capabilities of undertaking incremental and deep learning with the main focus of associating conceptual labels in a natural language to meaningful crisp data. These two processes consist of the two necessary and sufficient conditions for future humanoid robots to be teachable with the use of natural languages. In addition, this paper outlines a very likely new finding underlying human brain’s neural systems as well as the obvious mathematics underlying artificial deep neural networks. These outlines provide us the strong reason to separate the study of mind from the study of brain. Hopefully, the content discussed in this paper will help the AI research community to venture into the right direction which is to make future humanoid robots, non-humanoid robots, and many other systems to achieve human-like self-intelligence at cognitive level with the use of natural languages.

The heavy metal lead (Pb) can irreversibly damage the human nervous system. To help understand Pb-induced damage, we applied a genetically encoded Förster resonance energy transfer (FRET)-based Pb biosensor Met-lead 1.44 M1 to two living systems to monitor the concentration of Pb: induced pluripotent stem cell (iPSC)-derived cardiomyocytes as a semi-tissue platform, and Drosophila melanogaster fruit flies as an in vivo animal model. Different FRET imaging modalities were used to obtain FRET signals, which represented the presence of Pb in the tested samples in different spatial dimensions. Using iPSC-derived cardiomyocytes, the relationship between beating activity (20–24 beats per minute, bpm) determined from the fluctuation of fluorescent signals and the concentrations of Pb represented by the FRET emission ratio values of Met-lead 1.44 M1 was revealed from simultaneous measurements. Pb (50 μM) affected the beating activity of cardiomyocytes, whereas two drugs that stop the entry of Pb differentially affected this beating activity: verapamil (2 μM) did not reverse the cessation of beating, whereas 2-APB (50 μM) partially restored this activity (16 bpm). The results clearly demonstrate a potential of this biosensor system as an anti-Pb drug screening application. In the Drosophila model, Pb was detected within the adult brain or larval central nervous system (Cha-gal4>UAS-Met-lead 1.44 M1) using fast epifluorescence and high-resolution two-photon 3D FRET ratio image systems. The tissue-specific expression of Pb biosensors provides an excellent opportunity to explore the possible Pb-specific populations within living organisms. We believe that this integrated Pb biosensor system can be applied to the prevention of Pb poisoning and advanced research on Pb neurotoxicology.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

The chitin synthase B gene is a key enzyme in the chitin synthesis of insect peritrophic matrix (PM), affecting insects' feeding behavior. The chitin synthase B gene has been cloned from the transcription library of Heortia vitessoides Moore. RT-qPCR showed that HvChsb was highly expressed in the larval stage of H. vitessoides, especially on the first day of the prepupal stage, and in the midgut of larvae and the abdomen of adults. After starvation treatment, HvChsb was found to be significantly inhibited with time. After 48 h of starvation, the feeding experiment showed that HvChsb increased with the prolongation of the refeeding time. The experimental data showed that feeding affected the expression of HvChsb. HvChsb was effectively silenced by RNA interference, so its function was lost, significantly decreasing the survival rate of H. vitessoides. The survival rate from larval-to-pupal stages was only 43.33%, accompanied by abnormal phenotypes. It can be seen that HvChsb plays a key role in the average growth and development of H. vitessoides.

This study uses a recently developed theory and technique to examine post-acquisition evidence as to the motives for mergers and acquisitions(M&As), and decomposed the M/B ratio into three components: firm-specific error, time-series sector error, and long-run value-to-book. We make a multidimensional grouping according to the frequency of M&As , payment method, proportion of shares acquired, M/B ratio before the merger and total assets of the acquirers before the merge. The results confirm that M&As involve multiple motives, such as market timing, industry and economic shocks, agency and hubris. Using a sample of 2,035 M&As in China, we find that 59% are related to market timing, 68% are related to agency and hubris, 21% are related to industry and economic shocks, 51% are related to multiple motives. Our empirical research finds that the main motives for M&As of listed companies in China are value-decreasing, which have negative impact on the acquirers‘ sustainable development.

Interferon regulatory factor 5 (IRF5) is known to be involved in the innate immune response and pro-inflammatory cytokines. However, the roles of IRF5 in immune responses in Malabar grouper (Epinephelus malabaricus) have not been extensively explored. In this study, IRF5 gene was identified and characterized from M. grouper. The full-length IRF5 cDNA consisted of a 5’ terminal untranslated region (5’-UTR) of 289 bp and a 3’-UTR of 542 bp, an open reading frame (ORF) of 1500 bp encoding a polypeptide of 499 amino acids with a predicted molecular mass of 56.28 kDa and isoelectric point (pI) of 5.2. The putative MgIRF5 protein consists of four important conserved domains: a helix DNA-binding domain (DBD) at the N-terminus, a middle region, an IRF association domain (IAD) and a virus activated domain (VAD) at the C-terminus. Sequence alignment and phylogenetic analysis showed that highest sequence similarity of IRF5 was observed between the IRF5 genes from Oplegnathus fasciatus and Miichthys miiuy. The mRNA transcripts of IRF5 were detected in a wide range of tissues types from healthy M. grouper with highest expression in muscle, liver and skin. After treatment with poly (I: C), it was significantly up-regulated in spleen and liver tissues. When infected with NNV, the expression level of MgIRF5 was up-regulated in spleen and head kidney and their transcriptional responses to IRF5 increased in the grouper kidney cells. This approach suggests that MgIRF5 is important in the underlying mechanism of the innate immune responses against antiviral response.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Estimates of extreme water level return periods in river systems are crucial for hydraulic engineering design and planning. Recorded historical water level data of Taiwan’s rivers are not long enough for traditional frequency analyses when predicting extreme water levels for different return periods. In this study, the integration of a one-dimensional flash flood routing hydrodynamic model with the Monte Carlo simulation was developed to predict extreme water levels in the Danshuei River system of northern Taiwan. The numerical model was calibrated and verified with observed water levels using four typhoon events. The results indicated a reasonable agreement between the model simulation and observation data. Seven parameters, including the astronomical tide and surge height at the mouth of the Danshuei River and the river discharge at five gauge stations, were adopted to calculate the joint probability and generate stochastic scenarios via the Monte Carlo simulation. The validated hydrodynamic model driven by the stochastic scenarios was then used to simulate extreme water levels for further frequency analysis. The design water level was estimated using different probability distributions in the frequency analysis at five stations. The design high-water levels for a 200-year return period at Guandu Bridge, Taipei Bridge, Hsin-Hai Bridge, Da-Zhi Bridge, and Chung-Cheng Bridge were 2.90 m, 5.13 m, 6.38 m, 6.05 m, and 9.94 m, respectively. The estimated design water levels plus the freeboard are proposed and recommended for further engineering design and planning.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

A practical method is presented to estimate rare earth elements (REE) concentrations in magmatic vapour phase (MVP) in equilibrium with water-saturated granitic melts based on empirical fluid-melt partition coefficients of REE (k_P^REE). The values of k_P^REEcan be calculated from a set of new polynomial equations linking to the chlorine molality (m_Cl^v) of the MVP associated with granitic melts, which are established via a statistical analysis on the existing experimental dataset. These equations may be applied to the entire pressure range (0.1 to 10.0 kb) within the continental crust, suggesting that light REEs behave differently in magmatic fluids, i.e. either being fluid compatible with higher m_Cl^v or fluid incompatible with lower m_Cl^v values. In contrast, heavy REEs are exclusively fluid incompatible and partition favourably into granitic melts. Consequently, magmatic fluids tend to be rich in LREE relative to HREE, leading to REE fractionation during the evolution of magmatic hydrothermal systems. Maximum k_P^REEvalue for each element is predicted and presented in a REE distribution diagram constrained by the threshold of m_Cl^v. REE contents of the granitic melt is approximated by whole-rock analysis, so that REE concentrations in the associated MVP would be estimated from the value of k_P^REE given chemical equilibrium retains. Two examples are provided respectively, to show the use of this method as a REE tracer to fingerprint the source of ore-fluids responsible for the Lake George intrusion-related Au-Sb deposit in New Brunswick (Canada), and for the Bakircay Cu-Au (-Mo) porphyry systems in northern Turkey.

Pure titanium is limited to be used in biomedical applications due to its lower mechanical strength compared to its alloy counterpart. To enhance its properties and improve medical implants feasibility, advancements in titanium processing technologies are necessary. One such technique is equal channel angular pressing (ECAP) for its severe plastic deformation (SPD). This study aimed to surface modify commercially pure titanium using micro arc oxidation (MAO) technology and mineral solutions containing Ca and P. The composition and shape of the changed surface were characterized using X-ray diffraction (XRD) and scanning electron microscope (SEM), respectively. The weight % of Ca and P in the coating was determined using Energy Dispersive Spectroscopy (EDS), and the corrosion resistance was evaluated through potentiodynamic measurement. The behavior of human dental pulp cell and periodontal cell behavior was also studied through a biomedical experiment over a period of 1-, 3-, and 7-days using trypsin as the culture medium and ELISA as the observation method. This study showed that the mechanical grain refinement method and surface modification significantly improved the biomechanical properties of commercially pure (CP) Titanium. Although the results showed variations in the absorbance values of cells cultured on different surfaces, this study provides valuable insights into pulp cell behavior and advances the field of biomedical research.

Shrews (Soricidae) are common small wild mammals with a significant overlap in their habitats with humans and domestic animals. Currently, viruses from 24 families have been identified in shrews, including Adenoviridae, Arenaviridae, Arteriviridae, Astroviridae, Bornaviridae, Caliciviridae, Circoviridae, Coronaviridae, Filoviridae, Flaviviridae, Hantaviridae, Hepadnaviridae, Hepeviridae, Nairoviridae, Orthoherpesviridae, Paramyxoviridae, Parvoviridae, Phenuiviridae, Picornaviridae, Polyomaviridae, Poxviridae, Rhabdoviridae, Sedoreoviridae, and Spinareoviridae, which pose potential threats to humans and domestic animals. This review compiled fundamental information about shrews and provided a comprehensive summary of the viruses that have been detected in shrews, with the aim to facilitating a deeper understanding of shrews and the diversity and risks of their viruses for researchers and the general public.

The spin-torsion theory is a gauge theory approach to gravity that expands upon Einstein's general relativity (GR) by incorporating the spin of microparticles. In this study, we further develop the spin-torsion theory to examine spherically symmetric and static gravitational systems that involve free-falling macroscopic particles. We posit that the quantum spin of macroscopic matter becomes noteworthy on cosmic scales. We further assume that the Dirac spinor and Dirac equation adequately capture all essential physical characteristics of the particles and their associated processes. A crucial aspect of our approach involves substituting the constant mass in the Dirac equation with a scale function, allowing us to establish a connection between quantum effects and the scale of gravitational systems. This mechanism ensures that the quantum effect of macroscopic matter is scale-dependent and diminishes locally, a phenomenon not observed in microparticles. For any given matter density distribution, our theory predicts an additional quantum term, the quantum potential energy (QPE), within the mass expression. QPE induces time dilation, distance contraction, and thus mimics a gravitational well. When applied to cosmology, our theory yields a static cosmological model. The QPE serves as a counterpart to the cosmological constant introduced by Einstein to balance gravity in his static cosmological model. The QPE also offers a plausible explanation for the origin of the Hubble redshift (traditionally attributed to the universe's expansion). The predicted luminosity distance-redshift relation aligns remarkably well with SNe Ia data from the cosmological sample of SNe Ia. In the context of galaxies, QPE functions as the equivalent of dark matter. The predicted circular velocities align well with the rotation curve data from the SPARC (Spitzer Photometry and Accurate Rotation Curves database) sample. Importantly, our conclusions in this paper are reached through a conventional approach, with the sole assumption of the quantum effects of macroscopic matter on large scales, without the need for additional modifications or assumptions.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

This paper aims the automatic ball balancers (ABBs) used in passive balancing devices for suppressing vibration of the eccentric rotor. The system model describes which equipped with a skew-mounted ABB with angular deviation. The dynamic equilibrium equations of the system are deduced from the perspective of three-dimensional (3D) dynamics. The results obtained are consistent with those derived from the Euler-Lagrange equations. It is exciting that the spatial dynamics method reveals the spatial geometric characteristic of dynamic balance positioning of the balls when the system is balanced with vibration suppression. The spatial property emerges the perpendicular line from each ball to the rotating spindle of the system must pass through the central axis of the orbit perpendicular to the ABB plane. This characteristic is a general rule that can be used to explain the phenomenon of the stable equilibrium positions of the balls in all previously studied cases.

In recent years, the taxonomy of the families of Phenuiviridae, Nairoviridae, and Peribunyavidae in Bunyavirales was updated frequently, because many novel viruses in these families have been identified and the species demarcation criteria of these families have been changed. As per these criteria and sequence analysis, we found that the taxonomy of 19 species in these families should be revised. We presented six proposals for optimizing virus species taxonomy using the examples from these families. First, the species demarcation criteria for the same family (e.g., Peribunyavidae) should be unified. Second, the methods and parameters for the taxonomic calculation in the same order (e.g., Bunyavirales) should be unified. Third, virus species taxonomy should be based on phylogenetic relationships, rather than a cutoff value of sequence identities that is a self-contradictory demarcation criterion, although sequence identities aid virus taxonomy greatly. Fourth, virus species taxonomy should be based on the phylogenetic relationship of a key viral gene (e.g., the RdRp gene of Bunyavirales), which is important for the taxonomy of virus recombinants or reassortants. Fifth, a virus can be demarcated without a species before its biomedical significance has been revealed. Sixth, names of all viruses and virus species should be constituted exclusively with common characters (English letters and Arab numbers), to minimize difficulty in spelling and communication. These proposals are rational, flexible, and can accommodate all known viruses. They can also bridge the taxonomy history and the future demands due to their flexibility.

In all areas of medicine, especially in radiology, computers are increasing year by year. Filmless radiology, speech recognition software, electronic application forms, and teleradiology are recent developments that have greatly improved radiologists' performance. This research explores radiology software trends, predictions, and the challenges posed by informatics and historical trend analysis. The rationale behind this research is that information technology (IT) is overgrowing almost every day. We must continuously seek new ways to apply IT to make more use of resources. Consequently, IT becomes increasingly crucial to radiology organizations' innovative thinking, workflow, and business models. This study aimed to analyze all radiology software publications in the Science Citation Index (SCI). From 1991 to July 2021, SCI was used to search for publications systematically. We have also widely used this historical method in radiology software research. The findings and discussions are base on an assessment of trends, predictions, contributions, and challenges in radiology software, and we are exploring radiology software with six evolutionary stages. The gift of this research is that radiology managers realize that the use of new information technologies is closely related to survival in a competitive environment. Radiology companies can review these new technologies to develop more innovative business models and services to improve operational deficiencies.

3D printing is a non-traditional additive manufacturing process. It is different from the traditional subtractive manufacturing process. It offers exceptional rapid prototyping capabilities and results that traditional subtractive manufacturing methods cannot attain, especially in applications involving curved or intricately shaped components. Despite its advantages, metal 3D printing will face porosity, warpage, and surface roughness issues. These issues will affect the future practical application of the parts indirectly, for example, the structural strength and the parts assembly ca-pability. Therefore, this study compares the qualities of the warpage, weight, and surface rough-ness after milling and grinding processes under the same materials (316L stainless steel) between general rolled steel and 3D additive steel. Experimental results show that 3D printing parts are approximately 13% to 14% lighter than the general rolled steel. The surface roughness performance of 3D printing steel is better than general rolled steel under the same material after milling or grinding processing. The hardness of the 3D printing steel is better than that of the gen-eral rolled steel. The research verifies that 3D additive manufacturing can use surface processing to optimize surface performance and achieve the functions of lightness and hardness.

This paper revisits the analytical theory of fractional vibrations with the highlights in five aspects. First, we address the cases of structures with frequency dependent mass or damping or stiffness in Sections 2-4. Second, we introduce the theory based on the general second-order vibration motion equation with frequency dependent elements (mass, damping, stiffness) in Sections 5-7. Third, we present the analytical theory of seven specific classes of second-order vibration systems with frequency dependent mass or damping or stiffness in Sections 8 and 9. Fourth, we bring forward the analytical theory of seven classes of fractional vibration systems in Sections 10-12. Finally, as an application, we give the closed form expression of the forced response to multi-fractional Euler-Bernoulli beam in Section 13. The explanation of the nonlinearity of fractional vibrations is given in Section 14.

The objective of person re-identification (ReID) tasks is to match a specific individual across different times, locations, or camera viewpoints. The prevalent issue of occlusion in real-world scenarios affects image information, rendering the affected features unreliable. The difficulty and core challenge lie in how to effectively discern and extract visual features from human images under various complex conditions, including cluttered backgrounds, diverse postures, and the presence of occlusions. Some works have employed pose estimation or human keypoint detection to construct graph-structured information to counteract the effects of occlusions. However, this approach introduces new noise due to issues such as the invisibility of keypoints. Our proposed module, in contrast, does not require the use of additional feature extractors. Our module employs multi-scale graph attention for the reweighting of feature importance. This allows features to concentrate on areas genuinely pertinent to the re-identification task, thereby enhancing the model's robustness against occlusions. To address these problems, a model that employs multi-scale graph attention to re-weight the importance of features is proposed in this study, significantly enhancing the model’s robustness against occlusions. Our experimental results demonstrate that, compared to baseline models, the method proposed herein achieves a notable improvement in mAP on occluded data sets, with increases of 0.5%, 31.5%, and 12.3% in mAP scores.

This paper considers the Hermitian solutions of a new system of commutative quaternion matrix equations, we establish both necessary and sufficient conditions for the existence of solutions. Furthermore, we derive an explicit general expression when it is solvable. To illustrate our main findings, we present two numerical algorithms and examples in this paper.

This study aimed to investigate the relationship between sleep duration, dementia severity, age, and ANS regulation. This cross-sectional pilot study included 27 older patients with probable Alzheimer’s disease, hospitalized at a psychiatric center. We measured heart rate variability to assess ANS regulation at night, evaluated dementia severity using the Clinical Dementia Rating scale, and obtained sleep duration data from sleep diaries maintained by psychiatric nurses. The data were analyzed using repeated-measures generalized linear models with age, sex, dementia severity, and medication (antipsychotics) as covariates. A sleep duration of 7–8 h per night was associated with better ANS regulation than other sleep durations, as indicated by sympathovagal balance (p = 0.005). ANS dysregulation was characterized by a 20.7% increase in sympathetic nervous system activity and a 14.8% decrease in parasympathetic nervous system (PSNS) activity. We found a significant correlation between dementia severity and PSNS activity (p = 0.04) and observed an inverted U-shaped association between sleep duration and ANS regulation. This pilot study demonstrated that a sleep duration of 7–8 h per night may be critical in maintaining optimal ANS regulation. Bidirectional associations between sleep duration, inadequate sleep duration, aging, and ANS regulation warrant further investigation.

Microcystis aeruginosa is a common cyanobacteria found in water blooms and often causes ecological harm. Antibiotics are also increasingly used for the prevention and treatment of bacterial infections in aquaculture. However, since most antibiotics cannot be fully metabolized, they enter the water environment and cause ecological impacts. In this paper, the effects of the two quinolone antibiotics (enrofloxacin and ciprofloxacin) on the population density and microcystins (MCs) production of Microcystis aeruginosa were studied. It is of great significance for the ecological risk assessment of antibiotics to the water environment. The results showed that the 96h EC50 values of enrofloxacin and ciprofloxacin to Microcystis aeruginosa were 56.10mg/L and 49.80mg/L respectively, and the toxicity of ciprofloxacin to Microcystis aeruginosa was slightly stronger than that of enrofloxacin. With the increase of the two quinolone antibiotic concentration, the growth inhibition rate (IR) increased, but when the concentration reached a certain height, the IR would reach its threshold. Long-term exposure to low concentrations of these two quinolone antibiotics is not only more likely to lead to the outbreak of Microcystis aeruginosa, but also increase its toxin production capacity. The highest contents of MCs in enrofloxacin and ciprofloxacin groups were 95.539 μg/g and 93.720 μg/g, respectively. The MCs value of these three enrofloxacin treatment groups was more than above 51.8 times that of control group (CK) on the 4th day; from 8th day to 14th day, the MCs value of these three enrofloxacin treatment groups was more than above 3.2 times that of CK group. For another ciprofloxacin, the MCs value of the treatment group was more than 64.98 times that of the CK group on the 4th day, and from 8th day to 14th day, the MCs value of the treatment group was more than 2.7 times that of the CK group. These findings provide crucial management rationale.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

AgW materials exhibit excellent properties and are widely used as contact materials in low- and medium-voltage switches. In this study, a pre-sintering and infiltration method was employed to pre-sinter W powder with Cu, Ni, and (Cu+Ni) addition in the low temperature range of 950–1050 °C. The low-temperature sintering behaviours of W skeletons with different additives were investigated. Subsequently, AgW70, AgW75, AgW80, and AgW85 materials were prepared through infiltration at 1050 °C. The microstructure morphology and physical properties of high-W contact materials were investigated using a metallographic microscope and scanning electron microscope. The mechanism of low-temperature sintering-infiltration of high-W contact materials was elucidated. The results indicated that pure W and 1% Cu-added W skeletons experience minimal linear shrinkage within the temperature range of 950–1050 °C. The linear shrinkage curves of W skeletons with different additives coincided under the conditions of 950–1000 °C/90 min. At 1050 °C, after sintering for 150 min, the particle boundaries in the W skeleton were fully spheroidised, with a dihedral angle of 120°. At 1050 °C and after 150 min of infiltration, cross-sectional micrographs of the AgW material revealed the presence of irregular Ni layers, where Ni spatially enveloped/encapsulated Ag. With an increase in the W content, the electrical conductivity and relative density of AgW(70–85) materials decreased, whereas the hardness of the materials increased.

Prevalence of overweight and obesity are escalating globally among the general population. However, there are limited evidence on the trends and prevalence of overweight /obesity in the military setting. Increased rates of injuries, low work productivity, incurred higher healthcare costs and prematurely discharge from service are consequences of overweight/obesity among the military. Therefore, we aimed to systematically describe the trends and prevalence of overweight and obesity in the military population, by regions and military service branches. Databases including PubMed, Scopus, Web of Science and Google Scholar were used. Inclusion criteria were military population (inclusive of all service branches) with BMI reported as the overweight/obesity indicator. Population related to military but not exclusively military personnel such as the retirees, the veterans and their dependents were excluded. From the 27 included studies, 13 were published between year 2010 to 2014 and half were conducted in the United States. Overall, studies showed increasing trend in the prevalence of overweight (30% to 50%) and obesity (2% to 30%); only one study showed a decreasing trend of 0.9% and 0.6% for the prevalence of overweight and obesity respectively. However, the rates of increment differed between countries, where Asian countries demonstrated lower overweight prevalence compared to the United States and the European countries. In conclusion, the military population is not protected from overweight and obesity. Interventions should be implemented to prevent overweight / obesity among the military personnel.

In this review, the following information describes the manifestation of sleep deprivation by human beings and its adverse effect on their health. Sleep deprivation has been demonstrated into namely two types known as REM sleep and NREM sleep affecting our health in so a problematic way that it is making our body immune to many diseases leading to lethal problems. Therefore, great research by many scientists has discovered that the turmeric “Curcuma longa” which is been used in every Indian kitchen since ancient times, has shown a remarkable effect on the problem caused by sleep deprivation but due to its poor solubility and low bioavailability drawn it into a great disadvantage. But the help of the study of nanotechnology and the evolution of curcumin into nano–curcumin made the possibility of the remarkable effect by making the curcumin more potent and enhancing its stability. Immunological changes due to sleep deprivation lead to Alzheimer’s disease, glioma, neuropathic pains, and many more. Therefore, this review has been summarized as it is been providing information related to curcumin and its affection for sleep deprivation.

In a 2014 paper by C. Fulton, D. Pearson, and S. Pruess, a new characterization of the spectral density function is given for a Sturm-Liouville equation. These authors provide spectral theory showing that the Appell system, a companion linear system of ordinary differential equations, can be utilized to obtain a spectral density function. Though this new method is both elegant for its simplicity and fully viable (as is shown in this work), it has largely been ignored in the literature since its discovery with no citations yet logged in the MathSciNet database. To motivate greater attention towards this 2014 paper, the new spectral theory within it, and its potential applications, work is given here by this author demonstrating a nontrivial example of this new spectral method being applied towards the Bessel Equation in its Liouville-Normal (L-N) form. Validations of results obtained in this paper are also given, showing full agreement with the classical results obtained by E.C. Titchmarsh.

Objective: The aim of this study is to explore what inside the lipid lump obtained from skin. Try to understand the reasons for these physiological functions. In this paper, the lipid droplets or lumps was aimed to shed light on, figuring out what kind of cracks from metabolism were embedded inside. Results: A novel method was introduced for the detection of pathogens within lipid droplets extracted from acne or inflamed pores, as well as normal pores, using microscopic analysis. Through this technique, the presence of cracks from our body within these lipid droplets were identified. Methods: Observations were conducted using a microscope, with samples placed on slides and grind like blood smear. To enhance the transparency of the samples, tween-20 was utilized. This reagent was first time to be used for observing such big lipid lump of skin secretion. The evidences were recorded using the DMi8 camera from Leica.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Separation Distances are used throughout the world to protect people and assets from the potential hazardous effects from propellants, explosives, and pyrotechnics. The current separation distances for Hazard Division (HD) 1.3 substances and articles used in the United States, in some cases, may not adequately protect against the effects from heat flux and debris when those substances and articles are ignited in a confined structure. Multiple tests in such a confined scenario with HD 1.3 substances have shown that the heat flux and debris hazards could result in injury at distances beyond the current specified explosives safety separation distance (ESSD). Herein are recommended ESSD’s for confined as well as unconfined HD 1.3 articles and substances based on the analysis of hundreds of tests. Recommended ESSD’s include a smaller value for unconfined quantities less than 145 kilograms and ESSD’s that are consistent with NATO distances for confined substances and articles.

Imbalanced classes can cause machine learning models to classify positive class instances poorly, and the models require hyperparameter sets to optimal values. This study aims to develop random forest (RF) and support vector machine (SVM) models that use the optimal hyperparameters obtained through 5-fold cross-validation data. Both models were trained using optimal hyperparameter pairs that fit two data scenarios, the original and oversampling training sets, to produce the benchmark and best models. The model's performance was evaluated using six metrics, including training and testing data. The acquired optimal RF hyperparameter pair was (500, 10) for the minimum number of instances and tree depth level. In contrast, the acquired optimal SVM hyperparameter pair was (0.001, 500) for the gamma and constant values. The benchmark model performed approximately 98% on Accuracy, Precision, Recall, and F1 score metrics but failed to deliver any performance on Mathew's Correlation Coefficient (MC) and Area under Curve (AUC) metrics. The best RF and SVM perform less than both benchmark models in four famous metrics. Both best models have performance improvements of approximately 6% and 11% for the MCC and AUC metrics, respectively. The best RF performance was slightly better than the best SVM performance.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (&gt;90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

In this paper, we present a full coverage path planning (CPP) algorithm for the marine surveys conducted in the convex polygon shaped search area. The survey is supposed to carry out by torpedo-type AUVs (autonomous underwater vehicles). Due to their nonholonomic mechanical characteristics, these vehicles have nonzero minimum turning radius. For any given polygon shaped search area, it can always be partitioned into one or more convex polygons. With this in mind, this paper proposes a novel search algorithm called CbSPSA (Calculation based Shortest Path Search Algorithm) for full coverage of any given convex polygon shaped search area. By aligning the search inter-tracks alongside the edge with the minimum height, we can guarantee the minimum number of the vehicle’s turns. In addition, the proposed method can guarantee the planned path is strictly located inside the polygon area without overlapped or crossed path lines, and also has the total path length as short as possible. Considering the vehicle’s nonzero minimum turning radius, we also propose a sort of smoothing algorithm to smooth the waypoint path searched by CbSPSA so as for the vehicle to exactly follow it. The smoothed path is also guaranteed to be strictly located inside the polygon. Numerical simulation analyses are also carried out to verify the effectiveness of the proposed schemes.

We investigate numerically the interactions of in-phase Airy beams modulated by a fundamental Gaussian beam and fourth-order diffraction in Kerr nonlinear media. Directly numerical simulations show that normal (anomalous) fourth-order diffractions and in-phase (out-of-phase) Gaussian beam affect the interactions of solitons generated from Airy beams in unique manners. Different from previous results that interactions between in-phase (out-of-phase) conventional beams are always attractive (repulsive), many anomalous interactions of Airy beams are obtained. Stable bound states of breathing Airy soliton pairs can be formed with the help of fourth-order diffraction and fundamental Gaussian beam.

Vitamin D has important anti-inflammatory, anti-microbial properties and plays a central role in host immune response. Due to the crucial role of the kidneys in the metabolism of vitamin D, patients with chronic kidney disease (CKD), are prone to vitamin D deficiency. The resultant reduction in the production of calcitriol, the activated form of vitamin D in patients with CKD is responsible for exacerbating the existing renal impairment and periodontal inflammation. Recent evidence suggests a bidirectional, causal relationship between periodontitis and renal functional status. Both conditions have shared pathophysiologic mechanisms including oxidative stress, increases in the systemic inflammatory burden and impaired host response. This review explores the association between vitamin D, CKD and periodontitis. The review summarises the current evidence base for the classical and non-classical vitamin D metabolic pathways, the biological mechanisms linking vitamin D deficiency, CKD and periodontitis, as well as the bidirectional relationship between the two chronic inflammatory conditions. Finally, the paper explores the impact of vitamin D deficiency on CKD, periodontitis, and related co-morbidities.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The root extracts of Symphytum officinale (comfrey) are commonly used in traditional medicine to treat muscle, joint, skin and bone disorders. However, little information is available on the biomedical functions of comfrey leaves. In this study, sequencing results of Internal Transcribed Spacer and trnL-trnF genes showed that plants purchased from the local market were comfrey and named as S. officinale WL (WL). The optimal extraction conditions of WL leave with the highest extract yield and contents of total phenols and flavonoids by microwave-assisted extraction were identified. The antioxidative and anti-inflammatory activities and possible molecular mechanism(s) of the WL leaf extract (WLE) were evaluated. Furthermore, the major component of WLE was identified as rosmarinic acid by HPLC. Results showed that the optimal extract condition was obtained with 750W microwave power, 50℃, 75% methanol, the solid-to-solvent ratio of 1:10, and 15 minutes. Results of all DPPH, ABTS and superoxide radical scavenging activities, reducing power, ferrous ion chelating activity, and ferric reducing antioxidant power showed high antioxidative capacities of WLE. Furthermore, WLE showed obvious DNA protecting activity. WLE attenuated lipopolysaccharides-stimulated inflammation by suppressing iNOS, COX-2, IL-1β, IL-6, and TNF-α expressions in RAW264.7 macrophages. These attenuations involved in inactivations of lipopolysaccharides-induced NF-κB and MAPK signaling pathways.

In Taiwan, mountainous areas account for approximately two-thirds of the total area. The steep terrain and concentrated rainfall during typhoons cause landslides, which pose a considerable threat to mountain settlements. Therefore, models for analyzing rainfall-induced landslide hazards are urgently required to ensure adequate land use in mountainous areas. In this study, focusing on Pingtung County in southern Taiwan, we developed a landslide hazard index (IRL) to land use. Using FORMOSA-2 and SPOT-5 satellite images, data were collected before and after four typhoons (one in 2009 and three in 2013). The ArcGIS random tree classifier was used for interpreting satellite images to explore surface changes and disasters, which were used to analyze slope disturbances. The product of the maximum 3-h rolling rainfall intensity and effective accumulated rainfall was used as a rainfall trigger index (IRT). Considering environmental and slope disturbance factors, an index of slope environmental strength potential (ISESP) was developed through logistic regression (LR). Landslide hazard to land use was estimated using IRT and ISESP. The average coefficient of agreement (Kappa) was approximately 0.71 (medium to high accuracy); the overall accuracy of slope environmental strength potential analysis was approximately 80.4%. At a constant ISESP, IRT increased with the increasing hazard potential of rainfall-induced landslides. Furthermore, IRT and ISESP were positively correlated with landslide occurrence. When large ISESP values occur (e.g., fragile environment and high land development intensity), small IRT values may induce landslides.

As the leader of the largest economy, President of the United States has substantive influence on addressing the global climate change problem. However, presidential election is often dominated by issues other than energy problems. This paper focuses on the on-going 2016 presidential election, examining the energy plans proposed by the leading Democrat and Republican candidates. Our data from the Iowa caucus survey in January 2016 suggests that voters are more concerned about terrorism and economic issues than environmental relative issues. We then compare the Democratic and Republican candidate’s view of American’s energy future, and evaluate their proposed renewable energy targets. We find that the view on renewable energy is polarized between Democratic and Republican candidates, while candidates from both parties agree on the need for energy efficiency. Results from our ordinal least squares regression models suggest that Democratic candidates have moderate to ambitious goals for developing solar and other renewable energy. The Republican candidates favor fossil fuel and they neglect to provide any plan for renewable energy. In addition, this trend of polarization has grown more significant when compared with the past three presidential elections. Our observation suggests that energy issues need to be discussed more to draw broader attention to salient issues of diversifying and decarbonizing the nation’s energy system.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Background: Neurological disorders are the leading cause disability in Australia and the world. Combating the perceived difficulty of neurology or “neurophobia” and improving physician education is a key component in addressing this problem. We aim to conduct the first study to identify whether neurophobia exists in medical students and junior doctors in an Australian population and try to identify factors that may contribute to this in this population. Methods: A 24 question online validated survey was distributed via email broadcast to all medical students and junior doctors at a metropolitan tertiary care centre in Australia. Responses were collected over 6 weeks with weekly reminder emails for 4 weeks after the initial invitation email. Results: 114 medical students and junior doctors participated in the study. Participants perceived neurology as the most difficult medical speciality compared to 10 other medical specialties (p=0.001). The top three factors contributing to this perceived difficulty were: a lack of understanding of neuroanatomy, lack of diagnostic certainty and lack of clinical exposure. 65% of the participants stated that they had too little planned teaching in neurology with only 36% of the participants having performed a neurology rotation during medical school. Conclusion: The prevalence of neurophobia in this Australian cohort of medical students and junior doctors is consistent with previous findings from around the world. This concerning finding requires further examination into the contributing factors in order to created trials of targeted interventions in order to resolve this.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

Background: Boron Neutron Capture Therapy (BNCT) is an emerging radiotherapy. There are ongoing efforts to develop a Canadian accelerator-based BNCT center. However, it remains unclear how Canadian radiation oncologists (RO), medical physicists (MP), and their trainees perceive BNCT and its impact on radiation oncology as a discipline. Methods: A survey was created to explore knowledge of BNCT, its clinical role, and support for Canadian research. It was distributed through the Canadian Association of Radiation Oncology (CARO) and Canadian Organization of Medical Physicists (COMP). Results: We received 118 valid responses from all 10 provinces, from 70 RO (59.3%) and 48 MP (40.7%), including 9 residents. Most knew of BNCT and its indications (60.2%). Although many were unaware of reasons behind early failures (44.1%), common reasons were lack of clinical trials and inaccessibility of neutron sources (42.4%) and reactor unsuitability (34.7%). Additionally, 90.6% showed definite (66.9%) or possible (23.7%) support for Canadian BNCT research, while 89% indicated definite (56.8%) or possible (32.2%) willingness for BNCT referrals. Conclusions: Most RO and MP supported Canadian BNCT research and would refer patients. However, limited awareness and lack of experiences remain a challenge. Educational sessions are needed to realize this innovative cancer treatment in Canada.