We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Given the significant role of the Ningxia Urban Agglomeration along the Yellow River in reshaping the urban network and promoting coordinated development in the upper Yellow River region of China, this paper takes enterprise flow as the explicit manifestation of the regional urban network. Based on the data of registered enterprises from 2005 to 2021, combined with the interlocking network model, social network analysis method, and spatial panel econometric model, this paper interprets the evolution of the regional urban network structure and its influencing mechanisms through the different types of enterprise flow. The results indicate the following: (1) The external network is primarily focused on outflow investments towards North China, East China, and Northwest China. The overall inflow sources form a multi-origin structure dominated by North China and East China. The Jinfeng and Xingqing serve as core hubs for enterprise exports in the external network and destinations for incoming enterprises. However, in the Productive manufacturing connections, a spatial organizational pattern driven by multiple cities has formed. (2) In the internal network, a concentric connection structure centered around the Jinfeng and Xingqing has formed. The Productive service connections are relatively active, while the Productive manufacturing connections are relatively concentrated between the Jinfeng, Xingqing, Ningdong, and Lingwu. However, there is an imbalance in the spatial connections within the urban agglomeration network and an incomplete hierarchical system of network nodes. (3) In the external network, the main feature is the absorption of external elements to foster development momentum. In the internal network, the Jinfeng and Xingqing serve as contact and radiation sources, influencing various nodes. However, their driving capacity is weak. (4) The market demand and coordinated development both demonstrate significant promoting effects on the connections within the external and internal networks. The sluggish adjustment and transformation of regional industrial structure have resulted in a temporary negative inhibitory effect on the development of transformation. The negative impact of urban investment activities and the positive impact of government management are reflected within the internal network. (5) The improvement of urban management and service functions, as well as external borrowing, can promote the connection in different network. However, the borrowing economic activity can have a negative impact in different networks. (6) Industrial agglomeration can promote enterprises connections in different networks and generate significant spatial spillover effects.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (<1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

Transcription factors (TFs) are crucial in modulating gene expression and sculpting cellular and organismal phenotypes. The identification of TF-target gene interactions is pivotal for comprehending molecular pathways and disease etiologies but has been hindered by the demanding nature of traditional experimental approaches. This paper introduces a novel web application, utilizing the R programming language, which predicts TF-target gene relationships and vice versa. Our application integrates the predictive power of various bioinformatic tools, leveraging their combined strengths to provide robust predictions. It merges databases for enhanced precision, incorporates gene expression correlation for accuracy, and employs pan-tissue correlation analysis for context-specific insights. The application also enables the integration of user data with established resources to analyze TF-target gene networks. Despite its current limitation to human data, it provides a platform for exploring gene regulatory mechanisms comprehensively. This integrated, systematic approach offers researchers an invaluable tool for dissecting the complexities of gene regulation, with the potential for future expansions to include a broader range of species.

This paper proposes a new approach for multi-focus images fusion based on Region Mosaicing on Contrast Pyramids (REMCP). A density-based region growing method is developed to construct a focused region mask for multi-focus images. The segmented focused region mask is decomposed into a mask pyramid, which is then used for supervised region mosaicking on a contrast pyramid. In this way, the focus measurement and the continuity of focused regions are incorporated and the pixel level pyramid fusion is improved at the region level. Objective and subjective experiments show that the proposed REMCP is more robust to noise than compared algorithms and can fully preserves the focus information of the multi-focus images meanwhile reducing distortions of the fused images.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

In this paper, we investigate the new degenerate Daehee polynomials and numbers which are called the degenerate Daehee polynomials of the second kind, and derive some new and interesting identities and properties of those polynomials.

Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

The Android-based IoT platform just like the existing Android provides an environment that makes it easy to utilize Google's infrastructure services including development tools and APIs through which it helps to control the sensors of IoT devices. Applications running on the Android-based IoT platform are often UI free and are used without the user’s consent to registered permissions. It is difficult to respond to the misuse of permissions as well as to check them when they are registered indiscriminately while updating applications. This paper analyzes the versions of before and after an application the update running on the Android-based IoT platform and the collected permission lists. It aims to identify the same permissions before and after the update, and deleted and newly added permissions after the update were identified, and thereby respond to security threats that can arise from the permissions that is not needed for IoT devices to perform certain functions.

In order to accurately identify the external economic situation in China and analyze the situation of economic development in Northeast China, based on the Strengths, Weaknesses, Opportunities and Threats (SWOT) analysis framework, this article analyses the economy in Northeast China from the four factors of SWOT. To solve the lack of quantitative analysis in SWOT analysis, this article applies Analytic Hierarchy Process (AHP) to the analysis, and finally forms a complete system framework with the combination of qualitative and quantitative factors, through the analysis of the important degree of various factors and the consistency test, the key factors influencing the economic development in Northeast China are analyzed, and constructive countermeasures are proposed.

A new design scheme is proposed for twisting the walls of a microchannel, and its performance is demonstrated numerically. The numerical study was carried out for a T-shaped microchannel with twist angles in the range of 0 to 34π. The Reynolds number range was 0.15 to 6. The T-shaped microchannel consists of two inlet branches and an outlet branch. The mixing performance was analyzed in terms of the degree of mixing and relative mixing cost. All numerical results show that the twisting scheme is an effective way to enhance the mixing in a T-shaped microchannel. The mixing enhancement is realized by the swirling of two fluids in the cross section and is more prominent as the Reynolds number decreases. The twist angle was optimized to maximize the DOM, which increases with the length of the outlet branch. The twist angle was also optimized in terms of the relative mixing. The two optimum twisting angles are generally not coincident. The optimum twist angle shows a dependence on the length of the outlet branch but it is not affected much by the Reynolds number.

In recent years, demand has been increasing for target detection and tracking from aerial imagery via drones using onboard powered sensors and devices. We propose a very effective method for this application based on a deep learning framework. A state-of-art embedded hardware system empowers small flying robots to carry out the real-time onboard computation necessary for object tracking. Two types of embedded modules were developed: one is designed using a Jetson TX or AGX Xavier, and the other is based on an Intel Neural Compute Stick. These are suitable for real-time onboard computing power on small flying drones with limited space. A comparative analysis of current state-of-art deep-learning-based multi-object detection algorithms was carried out utilizing the designated GPU-based embedded computing modules to obtain detailed metric data about frame rates as well as the computation power. We also introduce an effective target tracking approach for moving objects. The algorithm for tracking moving objects is based on the extension of simple online and real-time tracking. It was developed by integrating a deep-learning-based association metric approach (Deep SORT), which uses a hypothesis tracking methodology with Kalman filtering and a deep-learning-based association metric. In addition, a guidance system that tracks the target position using a GPU-based algorithm is introduced. Finally, we demonstrate the effectiveness of the proposed algorithms by real-time experiments with a small multi-rotor drone.

Reinforcement Learning (RL) has demonstrated considerable potential in solving challenges across various domains, notably in autonomous driving. Nevertheless, implementing RL in autonomous driving comes with its own set of difficulties, such as the overestimation phenomenon, extensive learning time, and sparse reward problems. Although solutions like Hindsight Experience Replay (HER) have been proposed to alleviate these issues, the direct utilization of RL in autonomous vehicles remains constrained due to the intricate fusion of information and the possibility of system failures during the learning process. In this paper, we present a novel RL-based autonomous driving system technology that combines Obstacle Dependent Gaussian (ODG) RL, Soft Actor-Critic (SAC), and meta-learning algorithms. Our approach addresses key issues in RL, including the overestimation phenomenon and sparse reward problems, by incorporating prior knowledge derived from the ODG algorithm. We evaluated our proposed algorithm on official F1 circuits, using high-fidelity racing simulations with complex dynamics. The results demonstrate exceptional performance, with our method achieving up to 89% faster learning speed compared to existing algorithms in these environments.

As the global demand for clean and sustainable energy sources intensifies, hydrogen emerges as a promising alternative fuel. The widespread adoption of hydrogen, however, is impeded by the lack of efficient systems for storage and transportation. This review aims to summarize the recent advancements and prevailing challenges within the realm of hydrogen storage and transportation, thereby providing guidance and impetus for future research and practical applications in this domain. Through a systematic selection and analysis of the latest literature, this study highlights the strengths, limitations, and technological progress of various hydrogen storage methods, including compressed gaseous hydrogen, cryogenic liquid hydrogen, organic liquids hydrogen, solid materials hydrogen storage, as well as the feasibility, efficiency, and infrastructure requirements of different transportation modes such as pipelines, road and seaborne transportation. The findings reveal that challenges such as low storage density, high costs, and inadequate infrastructure persist despite progress in high-pressure storage and cryogenic liquefaction. The review also underscores the potential of emerging technologies and innovative concepts, including metal-organic frameworks, nanomaterials, and underground storage, along with the potential synergies with renewable energy integration and hydrogen production facilities. In conclusion, interdisciplinary collaboration, policy support, and ongoing research are essential in harnessing hydrogen’s full potential as a clean energy carrier. This review concludes that research in hydrogen storage and transportation is vital to global energy transformation and climate change mitigation.

In Korea, the underground silo structure for low- and intermediate-level radioactive waste disposal facilities has been constructed and operated since 2014. Large-scale earthquakes occurred in 2016 and 2017, respectively, in Gyeongju and Pohang areas near the underground silo structures, and interest in the stability of the underground silo increased significantly. In this paper, one-dimensional free field analyses have been carried out before the three-dimensional silo dynamic analyses subjected to earthquake loadings. As an additional study, a new form of finite element equilibrium equation is derived in terms of relative motions, which is essentially the same equation as that expressed in terms of total motions where the base shear force is applied for earthquake load. The accuracy of conventional finite element solutions is evaluated by directly comparing them with closed-form solutions by frequency domain analysis such as SHAKE91.

As human activities of the countries in the East Asia have been remarkably expanding over recent decades, various problems in relation to ships, such as oil spill and many other coastal marine pollution, are continuously occurring in the coastal region. In order to conserve marine resources and prepare for possible ship accidents in advance, the need for efficient ship management is increasing over time. Multi-satellite, multi-sensor, multi-wavelength or multi-frequency observations make it possible to monitor a variety of vessels in the coastal region. This study presents the results of ship detection methodology applied to multi-spectral satellite images in the seas around Korean Peninsula based on optical, hyperspectral, and microwave remote sensing. To detect ships from hyperspectral images with a few hundreds of spectral channels, spectral matching algorithms are used to investigate similarity between the spectra and in-situ measurements. In the case of SAR (Synthetic Aperture Radar) images, the Constant False Alarm Rate (CFAR) algorithm is used to discriminate the vessels from backscattering coefficients of Sentinel-1 SAR and ALOS-2 PALSAR2 images. The present ship detection methods can be extensively utilized for optical, hyperspectral, and SAR images for comprehensive coastal management purposes toward perpetual sustainability in the future.

This study examines the negative impacts of dark stores on the urban environment from three perspectives: land use, transportation, and streetscape. It is conducted on B-Mart, a representative dark store in South Korea. First, in terms of land use, we find that dark stores that function as logistics facilities conflict with the surrounding land use. Second, by analyzing the location of dark stores and the hourly traffic volume of delivery vehicles, we find that the impact on the surrounding transportation infrastructure and pedestrian traffic is not as significant as previously claimed. However, during the transportation and loading process of the dark store, several problems such as traffic violations, illegal parking, and illegal loading were observed, posing a risk to nearby vehicles and pedestrians. Third, in terms of streetscapes, the location of dark stores on the ground floor of buildings can harm streetscapes. The current urban planning system in South Korea does not clearly define the status and function of dark stores, making it unclear how to manage them. Therefore, it is necessary to clarify their legal definition and introduce urban planning and design guidelines that are consistent with their appropriate location and appearance.

Our previous studies demonstrated that quercetin (Q) could be ingested and metabolized by macrophages and exerted prophylactic immuno-stimulatory activity and therapeutic anti-inflammatory effects on lipopolysaccharide (LPS)-treated macrophages ex vivo. To further clarify its possible anti-inflammatory mechanism, Q was selected to treat mouse peritoneal macrophages that obtained from female BALB/c mice exposed to LPS i.p. for 12 h. Relative gene expression of pro-/anti-inflammatory (TNF-α/IL-10) cytokines and components of inflammation-related intracellular signaling pathways (TLR2, TLR4, NF-κB, JAK2 and STAT3) was analyzed using two-step reverse transcription (RT) and real-time quantitative polymerase chain reaction (qPCR). STAT3 protein phosphorylation was determined using an in-cell ELISA method. As a result, Q and its metabolite quercetin-3-O-β-D-glucuronide (Q3G) decreased TNF-α gene expression amounts and ratios of pro-/anti-inflammatory (TNF-α/IL-10) cytokine gene expressions, but increased IL-10 gene expression amounts in activated inflammatory macrophages, supporting a substantial anti-inflammatory potential of Q and Q3G treatments. However, Q3G had lower effects than those of Q. Importantly, Q inhibited TLR2 gene expression and phosphorylation of STAT3 protein in the inflamed cells. Our results are the first report to suggest that Q inhibits LPS-induced inflammation ex vivo through suppressing TLR2 gene expression and STAT3 protein phosphorylation in activated inflammatory macrophages. Q has potential to further apply for treating inflammation-associated diseases.

Diatomite (DME) consists of natural ordered porous structures that are excellent candidates as microcontainers. However, to the best of our knowledge, the application of DME loaded with corrosion inhibitors in anti-corrosion coatings has not hitherto been reported. In this study, DME has been used as a source of microcontainers to load benzotriazole (BTA) inhibitor by an immersion method. In order to prevent unwanted early release of the small molecule BTA inhibitor from the DME microcontainers, inspired by the adhesion characteristics of catechol and amine in mussel adhesion protein, polydopamine (PDA) was coated on their surfaces to generate BTA@DME/PDA microcapsules. Because of the depolymerization characteristics of PDA at low pH, the synthesize microcapsules showed a controllable release function. The SEM morphology, chemical structure, and loading capacity of the synthesized BTA@DME/PDA microcapsules were characterized. The corrosion resistances of epoxy coatings with different contents of BTA@DME/PDA microcapsules were compared by saline immersion and electrochemical impedance tests. A scratched coating with 5wt.% BTA@DME/PDA microcapsules showed the best anti-corrosion effect.

In the past decade, it has been discovered that intestinal flora can influence various organ-specific cancers by altering the body's energy balance, increasing obesity, synthesizing genetic toxins and small signaling molecules, initiating and modulating immune responses, and metabolizing indigestible dietary components, exogenous substances, and drugs. In this review, we will focus on elucidating the role of gut flora based on its molecular mechanisms and its potential therapeutic implications in head and neck tumors in the near future.

The number of patients with bone metabolic disorders including osteoporosis is increasing worldwide. These disorders often facilitate bone fractures, which seriously impact the patient’s quality of life and could lead to further health complications. Bone homeostasis is tightly regulated to balance bone resorption and formation. However, many anti-osteoporotic agents are broadly categorized as either bone forming or anti-resorptive, and their therapeutic use is often limited due to unwanted side effects. Therefore, safe and effective therapeutic agents are needed for osteoporosis. This study aims to clarify the bone protecting effects of oat bran water extract (OBWE) and its mode of action. OBWE inhibited RANKL-induced osteoclast differentiation by blocking c-Fos/NFATc1 through the alteration of I-κB. Furthermore, we found that OBWE enhanced BMP-2-stimulated osteoblast differentiation by the induction of Runx2 via Smad signaling molecules. In addition, the anti-osteoporotic activity of OBWE was also evaluated using an in vivo model. OBWE significantly restored ovariectomy-induced bone loss. These in vitro and in vivo results showed that OBWE has the potential to combat bone metabolic disorders including osteoporosis

Intestinal epithelial cell activities during homeostasis and regeneration are well described, but their potential interactions with stromal cells remain unresolved. Exploring the functions of these heterogeneous intestinal mesenchymal stromal cells (iMSCs) remains challenging due to the lack of specific markers for most functionally homogenous subpopulations. In recent years, however, novel clustering techniques such as single-cell RNA sequencing (scRNA-seq), fluorescence-activated cell sorting (FACS), confocal microscope, and computational remodeling of intestinal anatomy have helped identify and characterize some specific iMSC subsets. These methods help researchers learn more about the localization and functions of iMSC populations during intestinal morphogenic and homeostatic conditions. Furthermore, it is imperative to understand their cellular pathways for activation and how they interact with surrounding cellular components, particularly during intestinal epithelial regeneration that follows mucosal injury. This review provides insights into the spatial distribution and functions of some identified iMSC subtypes in intestinal morphogenesis, homeostasis, and regeneration. We reviewed related signaling mechanisms implicated during epithelial and subepithelial stromal cell crosstalk. Future research should focus on elucidating the molecular intermediates of these regulatory pathways to open a new frontier for potential therapeutic targets that can alleviate intestinal mucosa-related injuries.

Spatial crowdsourcing emerges as a new computing paradigm that enables mobile users to accomplish spatio- temporal tasks in order to solve human-intrinsic problems. Existing crowdsourcing systems critically use centralized servers for interacting with workers and making task assignment decisions. These systems are hence susceptible to issues such as the single point of failure and the lack of operational transparency. Prior work, therefore, turns to blockchain-based decentralized crowdsourcing systems, yet still suffers from problems of lacking efficient task assignment scheme, requiring a deposit to an untrusted system, low block generation speed, and high transaction fees. To address these issues, we design a blockchain-based decentralized framework for spatial crowdsourcing, which we call SC-EOS. Our system does not rely on any trusted servers, while providing efficient and user-customizable task assignment, low monetary cost, and fast block generation. More importantly, it frees users from making a deposit into an untrusted system. Our framework can also be extended and applied to generic crowdsourcing systems. We implemented the proposed system on the EOS blockchain. Trace-driven evaluations involving real users show that our system attains the comparable task assignment performance against a clairvoyant scheme. It also achieves 10× cost savings than an Ethereum-based implementation.

Nickel-based Superalloy Inconel 718 is widely used in the aerospace industry for its excellent high-temperature strength and thermal stability. However, milling Inconel 718 presents challenges due to significantly increased cutting force and vibration, which is a typical difficult-to-machine material. This paper focuses on the milling process of Inconel 718, establishing a milling force model to analyze the force trends under various processing parameters. Finite element analysis is employed to study the stress and temperature fields during milling. Dynamic equations for milling Inconel 718 are developed, and stability lobe diagrams are generated based on modal experiments. Milling experiments on Inconel 718 validate the milling force model and finite element analysis results. The fmincon optimization algorithm is utilized to identify the optimal machining parameters for Inconel 718. Through this research, valuable insights into enhancing the efficiency and quality of Inconel 718 machining are provided. This study contributes to a deeper understanding of Inconel 718 milling behavior, offering crucial guidance for more efficient machining processes.

Research has shown that the consumption of herbal teas is linked with positive effects on the regulation of postprandial blood glucose level. In this study, a comparative analysis of aqueous and ethanol extractions is performed on four herbal teas (Mallotus, Cyclocarya, Rubus, Vine) to evaluate their phytochemical profiles and functional activities. Investigations of phytochemical contents, antioxidant activities, α-glucosidase inhibitory activities and chemical compositions are carried out through colorimetric analyses and UPLC-Q-Orbitrap HRMS/MS, respectively. Results showed that among the studied herbal teas, Vine exhibited the highest glucose re-gulating abilities under both aqueous and ethanol extractions. Overall, ethanol extracted samples yielded higher phytochemicals content, but the compositions of the phytochemicals varied. Meanwhile, aqueous extracts showed surprisingly strong antioxidant activities and comparable α-glucosidase inhibitory activities with ethanol extracts. Phytochemicals contents presented a positive correlation with antioxidant activities and α-glucosidase inhibitory activities. Nevertheless, antioxidant activities displayed a weak positive correlation with α-glucosidase inhibitory activities. Results from this study provided evidence that aqueous extracts from herbal teas possessed valuable phytochemicals composition for antioxidants and the hyperglycemic populations, and are promising candidates for potential applications as functional ingredients with health promoting effects and as natural additives to boost the nutritional value of herbal food products.

Cardiovascular disease is the leading cause of death worldwide. A key factor in assessing the risk of cardiovascular disease is left ventricular functional evaluation. Left ventricular (LV) systolic function is evaluated by measuring the left ventricular ejection fraction (LVEF) using echocardiography data. Therefore, quick and accurate left ventricle segmentation is important for estimating the LVEF. However, it is difficult to accurately segment the left ventricle due to changes in the shape and area of the left ventricle during cardiac cycles. In this study, we proposed a framework that considers changes in the shape and area of the left ventricle during the cardiac cycle by applying the convolutional long short-term memory (CLSTM) approach. In addition, we evaluated the left ventricular segmentation and multidimensional quantification of the proposed system in comparison to manual and automated segmentation methods. In addition, to assess the validity of CLSTM, the values of multi-dimensional quantification metrics were compared and analyzed using graphs and Bland–Altman plots on a frame-by-frame basis. We demonstrated that the CLSTM method effectively segments the left ventricle by considering the LV activity. In conclusion, we demonstrated that LV segmentation based on our framework may be utilized to accurately estimate LVEF values.

The construction of reinforced concrete (RC) structures inevitably consumes an excessive number of rebars, leading to significant cutting waste and carbon emissions. Extensive research has been conducted to minimize this issue and its consequences; however, these methods consistently consume a substantial number of rebars. This includes a previous study that utilizes the lap splice position optimization and special-length rebar concept without considering the lapping zone regulation. Moreover, conventional lap splices pose inherent drawbacks that could jeopardize the structural integrity of RC members. In contrast, mechanical couplers eliminate the need for rebar lapping, effectively reducing rebar consumption. This research aims to evaluate the impact of an integrated mechanical coupler and special-length-priority minimization algorithm on the reduction in rebar consumption and cutting waste in RC columns, achieving near-zero cutting waste. To validate the effectiveness of the proposed algorithm, it was applied to the column rebars of an RC building. The results revealed a significant reduction in ordered rebar consumption by 18.25%, accompanied by substantial reductions in cutting waste (8.93%), carbon emissions (12.99%), and total costs (10.81%) compared with a previous study. The outcomes provide the industry with insights into further reducing rebar consumption and its related consequences. Applying the proposed algorithm to various construction projects will further amplify the corresponding benefits.

This study investigated the impact of boron and copper on the microstructure and mechanical properties of Spheroidal graphite Cast Iron (SCI). The addition of boron increased the ferrite content, while copper increased the stability of pearlite. The interaction between boron and copper significantly increased the ferrite content. Differential Scanning Calorimetry (DSC) revealed that boron decreased the enthalpy change of the α + Fe3C -> γ transformation and increased the enthalpy change of the α -> γ transformation. The addition of boron and copper reduced the tensile and yield strength but increased elongation and impact energy. The findings provide valuable insights into the effect of boron and copper on SCI, facilitating the design and development of high-performance SCI materials.

Background: This study aimed to identify the association between occupational stress and depression-well-being by proposing a comprehensive and flexible job burden-capital model with its corresponding hypotheses. Methods: For this research, 1618 valid samples were gathered from the electronic manufacturing service industry in Hunan Province, China; self-rated questionnaires were administered to participants for data collection after obtaining their written consent. The proposed model was fitted and tested through structural equation model analysis. Results: Single-factor correlation analysis results indicated that coefficients between all items and dimensions had statistical significance. The final model demonstrated satisfactory global goodness of fit (CMIN/DF=5.37, AGFI=0.915, NNFI=0.945, IFI=0.952, RMSEA=0.052). Both the measurement and structural models showed acceptable path loadings. Job burden and capital were directly associated with depression and well-being or indirectly related to them through personality. Multi-group structural equation model analyses indicated general applicability of the proposed model to basic features of such a population. Gender, marriage and education led to differences in the relation between occupational stress and health outcomes. Conclusions: The job burden-capital model of occupational stress-depression and well-being was found to be more systematic and comprehensive than previous models.

This study aims to investigate the effects of chest mobilization and breathing exercises on respiratory function, trunk stability, and endurance in chronic stroke patients who have contracted coronavirus disease (COVID-19). Thirty inpatients of a tertiary hospital in South Korea, who had a history of COVID-19 and were diagnosed with stroke within the last 6 months were randomly assigned to either the Chest Mobilization Exercise with Breathing Exercise (CMEBE) or Conservative Physical Therapy with Breathing Exercise (CPTBE) groups. The respiratory function, trunk stability, and endurance were measured at baseline and 6 weeks after the interventions. Both CMEBE and CPTBE groups showed improvements in respiratory function, trunk stability, and endurance after the intervention (p<0.05). However, the CMEBE group showed significantly greater improvements in forced expiratory volume in 1 second (p<0.05), trunk stability (p<0.05), and endurance (p<0.05) than the CPTBE group. No significant intergroup difference was observed in forced vital capacity and peak expiratory flow. Conclusion: The combination of chest mobilization and breathing exercises improved respiratory muscle mobility and endurance, stabilized the trunk, and enhanced balance and transfer of weight. The findings suggest that this intervention could be beneficial in improving respiratory function and endurance in stroke patients.

This article explores the behavioral geography of the Hajj pilgrimage, focusing on the impact of the physical environment on pilgrims' behavior. Using qualitative research and analyzing religious literature and online publications, the study reveals significant findings. The spatial arrangement of the Grand Mosque, including the central courtyard and pillars, influences pilgrims' behavior during the Tawaf ritual. Environmental factors such as crowds and noise affect pilgrims' experiences, evoking anxiety while enhancing the ceremony's spiritual significance. Cultural and religious beliefs also shape pilgrims' behavior during the circumambulation. This study provides valuable insights into the multifaceted factors shaping pilgrims' behavior during the Hajj, including spatial organization, cultural influences, and social interactions. The findings can inform improvements in infrastructure, crowd management, and services to enhance the overall pilgrimage experience.

In the paper, a fully discrete compact difference scheme with $O(\tau^{2}+h^{4})$ precision is established by considering the numerical approximation of the one-dimensional Allen-Cahn equation. The numerical solutions satisfy discrete maximum principle under reasonable step ratio and time step constraint is proved. And the energy stability for the fully discrete scheme is investigated. An example is finally presented to show the effectiveness of scheme.

Acoustic emission (AE) is caused by the sudden release of energy by a material as a result of material degradation related to deformation, crack, or fault within a solid. The same situation also occurs in leaks caused by turbulence in the fluid around the leak. In this study, analytical modeling for AE due to leakage through a circular pinhole in a gas storage cylinder was performed. The displacement fields responsible for AE, excited by the concentrated force (CF) associated with the turbulent flow though the pinhole, were derived by solving the Navier-Lamé equation. The CF as an excitation source was formulated in terms of a fluctuating Reynolds stress (FRS) and spatial Green’s function. In particular, a series of experiments were conducted under different operating conditions to explore the characteristics of the AE signals due to leak in a gas cylinder. Finally, the simulation and experimental results were compared to verify the accuracy of the simulation results.

A series of water diversion projects to address the uneven distribution of water resources in China involve the construction of a large number of hydraulic tunnels. As the lining structure that maintains the stability and durability of the tunnels, it is prone to durability damage during the operation process, which in turn affects the water transmission safety and water supply capacity. Therefore, it is important to evaluate the durability of hydraulic tunnel lining structure. Considering the randomness and fuzziness of the factors affecting the durability of hydraulic tunnel lining structure, this paper proposes a comprehensive evaluation model based on the coupling of set-pair analysis and extension. The G1 method and the simple correlation function method are used to determine the subjective and objective weights of the evaluation indexes respectively, and the combination weight is assigned based on the principle of minimum entropy; the set-pair analysis principle is used to establish the linkage affiliation function, calculate the comprehensive linkage affiliation of the object to be evaluated, and the maximum affiliation principle is used to judge the durability level of the hydraulic tunnel lining structure. Finally, taking a section of hydraulic tunnel as an example, the model proposed in this paper is used to calculate its durability grade as Class III, with the set-pair potential SHI(H) = 7.5856, which is consistent with the actual engineering practice, and a comparative study is done in combination with the AHP-Extenics method. It is verified that the evaluation model can scientifically and reasonably evaluate the durability of hydraulic tunnel lining structure, providing a basis for subsequent maintenance and reinforcement.

Achieving eco-efficiency in agriculture production at low environmental costs is key to sustainable agriculture. Using the DEA-SBM model, this study evaluated the agricultural eco-efficiency of the 77 counties and districts in China’s Jiangsu province from 1999 to 2018 and analyzed its spatio-temporal evolution pattern and influencing factors. The mains conclusions were as follows: (1) The overall agricultural eco-efficiency and its decomposition terms, pure technology efficiency and scale efficiency, exhibited a fluctuating downward trend. The regional inequality in agricultural eco-efficiency had been widening and exhibited a strong positive spatial association. (2) The agricultural eco-efficiency in Jiangsu province presented a “high south and low north” spatial pattern. High-level agricultural eco-efficiency areas were in the Taihu Plain in Sunan, while low-level agricultural eco-efficiency zones are distributed across Subei City. The High-High-type spatial association pattern is concentrated in the Suzhou-Wuxi-Changzhou region, while the Low-Low areas are mainly in the coastal regions of Subei and Suzhong. (3) The spatial pattern of PTE and SE generally exhibited a “high south and low north” distribution. Areas with positive growth in agricultural eco-efficiency, PTE, and SE, were situated in Xuzhou, Nanjing city, and the bordering regions between Yangzhou and Huai’an, and Changzhou and Wuxi. (4) The excessive redundant use and application of pesticides, chemical fertilizer, agricultural diesel, labor, land, and agricultural carbon emission have been the primary factor affecting Jiangsu's agricultural eco-efficiency. Irrigation had also signficantly impacted agricultural eco-efficiency, while mechanical power and agricultural film had minimal effect. The majority of counties and districts in Subei, Suzhong, and Ningzhen Yang Hilly region have issues regarding their excessive usage of chemical fertilizer, pesticide, chemical fertilizer, agricultural diesel, labor, and land. The findings of this study can contribute towards a better understanding of agricultural eco-efficiency and spatial association effect and can help policymakers increase agricultural eco-efficiency.

The purpose of this paper is to explore which financial performance indicators (FPIs) evaluate the level of supply chain capability (SCC) that explicitly touches all of the business functions and processes within and beyond the company. The authors investigated nine FPIs that were selected from the financial statements of 155 companies within nine industries. The authors find that suitable FPIs to measure SCC for shareholders’ value are return-on-assets (ROA), days-sales-outstanding (DSO), and current ratio (CR). This means that higher ROA, shortened DSO, and an appropriate level of CR could reach a sustainable supply chain. These results will help the industry to avert a major disruption in supply chain processes and activities using suitable financial performance indicators.

L-Theanine, a unique non-protein amino acid, is an important bioactive component of green tea. Previous studies have shown that L-theanine has many potent health benefits, such as anti-anxiety effect, regulation of immune response, relaxing neural tension, reducing oxidative damage. However, little is known concerning whether L-theanine can improve the clearance of mitochondrial DNA (mtDNA) damage in organisms. Here, we reported that L-theanine treatment increased ATP production and improved mitochondrial morphology to extend the lifespan of UVC-exposed nematodes. Mechanistic investigations showed that L-theanine treatment enhanced the removal of mtDNA damage and extended lifespan by activating autophagy, mitophagy, mitochondrial dynamics, and mitochondrial unfolded protein response (UPRmt) in UVC-exposed nematodes. In addition, L-theanine treatment also up-regulated the expression of genes related to mitochondrial energy metabolism in UVC-exposed nematodes. Our study provided a theoretical basis for the possibility that tea drinking may prevent mitochondrial related diseases.

In this paper, we present a new concept of the generalized core orthogonality (called the C-S orthogonality) for two generalized core invertible matrices $A$ and $B$. $A$ is said to be C-S orthogonal to $B$ if $A^{\tiny\textcircled{S}}B=0$ and $BA^{\tiny\textcircled{S}}=0$, where $A^{\tiny\textcircled{S}}$ is the generalized core inverse of $A$. The characterizations of C-S orthogonal matries and the C-S additivity are also provided. And the connection between the C-S orthogonality and C-S partial order has been given using their canonical form. Moreover, the concept of the strongly C-S orthogonality is defined and characterized.

The association between the choice of general anesthetic agents and the risk of acute kidney injury (AKI) and long-term renal function after nephrectomy has not yet been evaluated. We reviewed 1087 cases of partial or radical nephrectomy. The incidence of postoperative AKI, new-onset chronic kidney disease (CKD) stage 3a and CKD upstaging were compared between different general anesthetic agent groups: propofol, sevoflurane, and desflurane. Four different propensity score analyses were performed to minimize confounding for each pair of comparison (propofol vs sevoflurane; propofol vs desflurane; sevoflurane vs desflurane; propofol vs volatile agents). Study outcomes were compared before and after matching. Kaplan-Meier survival curve analysis was performed to compare renal survival determined by the development of CKD stage 3a between groups up to 36 months after nephrectomy before and after matching. Propofol was associated with a lower incidence of AKI, CKD upstaging and a higher three-year renal survival after nephrectomy compared to sevoflurane or desflurane group after matching (AKI: propofol 23.2% vs. sevoflurane 39.5%, P=0.004, vs. desflurane 34.3%, P=0.031; CKD upstaging: propofol 27.2% vs. sevoflurane 58.4%, P<0.001, vs. desflurane 48.6%, P=0.017; Log-rank test propofol vs. sevoflurane P<0.001, vs. desflurane P=0.015). Propofol was also associated with a lower incidence of new-onset CKD after nephrectomy compared to sevoflurane after matching (P<0.001). However, there were no significant differences between sevoflurane and desflurane. In conclusion, propofol, compared to volatile agents, may be the reasonable choice of general anesthetic agent for nephrectomy to attenuate postoperative renal dysfunction. Randomized prospective trials are warranted to test this hypothesis.

This study explores the geopolitical dynamics of water conflicts in Central Asia, focusing on Uzbekistan and its neighboring countries. Using a mixed methods approach within the framework of political geography, the research analyzes interactions among regional countries and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. It establishes research objectives, evaluates the water crisis, addresses challenges in water management, and examines contentious issues like hydropower, resource hegemony, and ethnic conflict. Also, the study uncovers historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance. The findings highlight the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes with recommendations to enhance regional cooperation, sustainable water management, and peacebuilding, drawing on soft power theory and advocating for collaborative approaches. This research provides valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges, contributing to informed decision-making, and promoting strategies for sustainable development in the region.

Colorectal cancer (CRC) is the third most commonly diagnosed cancer worldwide, and despite advances in treatment, survival rates are still low; therefore, the development of novel drugs is imperative. Acetylcorynoline (ACN) is derived from Corydalis ambigua. The effect of ACN on colon cancer is still unknown. Therefore, we investigated its potential effects. Our data showed that ACN inhibited cell viability and proliferation. Moreover, ACN induced apoptosis and cell cycle arrest by inhibiting cell growth. In the present study, we hypothesized that ACN regulates c-Myc through CNOT2 or MID1IP1. ACN reduced the protein expression of oncogenic genes, decreased c-Myc half-life, and rapidly inhibited the serum stimulation response. Moreover, knockdown of CNOT2 and MID1IP1 with ACN increased apoptosis and further reduced the expression of oncogenes. In addition, ACN exhibited a synergistic effect with low-dose of 5-fluorouracil (5-FU) and doxorubicin (Dox). Collectively, our data demonstrates that ACN inhibited c-Myc expression through CNOT2 and MID1IP1 and induced apoptosis. These findings indicate the potential of ACN as a therapeutic agent against colon cancer.

Alzheimer’s disease (AD) is a chronic neurodegenerative disease, and typical pathologic findings include abnormally hyperphosphorylated tau aggregation and neurofibrillary tangles. Insulin resistance and hyperglycemia have been assessed as risk factors for AD development. As the maintenance of optimal blood glucose levels is an important indicator of diabetes mellitus (DM) treatment, diet control is essential. AMPK is a crucial sensor of cellular bioenergetics for controlling anabolic and catabolic metabolism. Diet restriction to achieve euglycemia can increase AMPK activity in the liver and heart. Since AMPK is a direct regulator of tau phosphorylation, we hypothesized that strict diet control to achieve euglycemia affects tau protein phosphorylation through increased AMPK activity in the hippocampus of DM rats. To confirm this hypothesis, we generated insulin-deficient DM rats by subtotal pancreatectomy. Animals were categorized into the restriction (R) group, control (C) group and ad libitum (AL) group according to the diet. We found that tau phosphorylation was significantly increased in the R group compared with the C or AL group. AMPK activity in the R group significantly increased compared to that of the C group or AL group, as expected. Furthermore, the R group showed more critical tau pathology in the hippocampus than the other groups. These results suggest that diet control to achieve euglycemia in insulin-deficient DM conditions is harmful because of the increased possibility of AD development through increased tau phosphorylation by AMPK activation in the hippocampus. We propose that not only hyperglycemia but also euglycemia, which is beneficial in DM patients, must be considered a potential risk factor for AD development, especially when euglycemia is achieved by diet control during insulin deficiency.

Suicide is a major public health concern in South Korea, and self-poisoning by pesticides is one of the common methods of suicide. Pesticide ban policies have been successful for suicide prevention; however, no studies have shown their effect according to occupational groups. The present study analyzed suicide and suicide by pesticide rates among South Korean workers age 15-64 in 2003-2017, their associations with occupational groups, and the impact of three major economic indices on these factors. Workers in the agriculture, forestry, and fishery industries have relative risks of 5.62 (95% CI: 5.54-5.69) for suicide overall and 25.49 (95% CI: 24.46-26.57) for suicide by pesticide. The real gross domestic product (RGDP) has a positive association with suicide overall only in the last five-year period investigated in this study, and the unemployment rate consistently has a positive association. The economic status and policy for suicide prevention affect suicide and suicide by pesticide rates differently among occupational groups and different time periods. Policy addressing suicidal risk for different occupational groups should be of concern in South Korea.

Human Pose Estimation (HPE) is a technique in computer vision and AI for detecting and tracking human body parts and poses from images or videos. Widely used in augmented reality, animation, fitness applications, and surveillance, HPE methods using monocular cameras are highly versatile due to their applicability in standard video and CCTV footage. These methods have evolved from 2D to 3D pose estimation. However, current 3D HPE methods trained on laboratory-based motion capture data encounter challenges such as limited training data, depth perception ambiguity, left/right switching, and issues with occlusions when applied in real-world environments. This study compares two representative 3D HPE methods by assessing their strengths and weaknesses with real-world videos. Then, we propose data processing techniques to eliminate and correct anomalies like left/right inversion and false detections of joint positions in daily life motions. Finally, we obtain joint angle trajectories using an optimization method based on a 3D humanoid simulator, taking as input the joint coordinate data corrected by applying the proposed human joint data processing technique. The efficacy of the proposed 3D HPE method is verified by applying it to three-dimensional freehand gymnastics exercises and comparing the joint angle trajectories during the motion.

The aim of this study is to investigate, by means of experimental measurements and full-wave simulations, the dominant factors for the very high-resolution (VHR) radar image speckles from exponential correlated rough surfaces. A Ka-band radar system was used to collect the return signal from such a surface sample fabricated by 3D printing, and that signal was further processed into images at different resolution scales, where the image samples were obtained by horizontally turning around the surface sample. To cross-validate the results and to further discuss the VHR speckle properties, full wave simulations by full 3D Finite Difference Time Domain (FDTD) method were conducted with 1600 realizations for the speckle analysis. At the considered very high resolution, speckle statistics show divergence from the fully developed Rayleigh distribution. The factors that impact on the high-resolution speckle properties from exponential correlated rough surface, are analyzed in views of the equivalent number of scatterers theory and scattering scales, respectively. From the data results and extended discussions, it is evident that both of the above factors matter for VHR speckle of backscattering, from the exponential correlated rough surface as a good representative for the ground surface.

Licochalcone H (LCH), a regioisomer of licochalcone C derived from the root of Glycyrrhiza inflata. CRC treatment has always been challenged by the development of resistance. We investigated the antiproliferative activity of LCH in oxaliplatin (Ox)-sensitive and -resistant CRC cells. LCH significantly inhibited cell viability and colony growth in both Ox-sensitive and Ox-resistant CRC cells. We found that LCH decreased epidermal growth factor receptor (EGFR) and AKT kinase activities and related activating signaling proteins including phospho (p)-EGFR and pAKT. A computational docking model indicated that LCH may interact with EGFR, AKT1, and AKT2 at the ATP-binding sites. LCH induced ROS generation, as verified by N-acetyl-L-cysteine (NAC) treatment, and increased the expression of the ER stress markers. LCH treatment of CRC cells induced depolarization of MMP and increased. Multi-caspase activity was induced by LCH treatment and confirmed by Z-VAD-FMK treatment. LCH increased the number of subG1 cells and arrested the cell cycle at the G1 phase. LCH inhibits the growth of Ox-sensitive and Ox-resistant CRC cells by targeting EGFR and AKT, and inducing ROS generation and ER stress-mediated apoptosis. Therefore, LCH could be a potential therapeutic agent for improving not only Ox-sensitive but also Ox-resistant CRC treatment.

Goal-conditioned reinforcement learning (RL) holds promise for addressing intricate control challenges by enabling agents to learn and execute desired skills through separate decision modules. However, the irregular occurrence of required skills poses a significant challenge to effective learning. In this paper, we demonstrate the detrimental effects of this imbalanced skill(sub-goal) distribution and propose a novel training approach, Classified Experience Replay (CER), designed to mitigate this challenge. We demonstrate that adapting our method to conventional RL methods significantly enhances the performance of the RL agent. Considering the challenges inherent in tasks such as driving, characterized by biased occurrences of required sub-goals, our study demonstrates the improvement in trained outcomes facilitated by the proposed method. In addition, we introduce a specialized framework tailored for self-driving tasks on highways, integrating Model Predictive Control (MPC) into our RL trajectory optimization training paradigm. Our approach, utilizing CER with the suggested framework, yields remarkable advancements in trajectory optimization for RL agents operating in highway environments.

Background Telomere shortening is related to aging and unfavourable health outcomes. Obesity and metabolic diseases are important factors for accelerating aging. This study aimed to find out the association between obesity, metabolic disease, and telomere length in metabolically healthy adults. Methods 237 adults were enrolled with written consents at a health promotion centre of a tertiary hospital from February 2014 to March 2015. After excluding 99 subjects who met the exclusion criterion, a total of 130 metabolically healthy subjects were selected for final analysis. The subjects were divided into quartile groups according to the telomere lengths of their oral mucosal cells. Results The subjects consisted of 66 (50.8%) males with a mean age of 58.59 years. The body mass index (BMI, kg/m2) increased significantly along with the quartile groups (Q1, 23.00; Q2, 23.96; Q3, 23.70; Q4, 25.20; P-for trend=0.008). Waist circumference (WC, P-for trend=0.022), waist-to-hip ratio (WHR, P-for trend=0.005), and waist-to-height ratio (WHtR, P=0.001) also increased along with the quartile groups. Obesity prevalence (BMI ≥25 kg/m2), abdominal obesity (WC ≥90 cm for men, ≥85 cm for women), WHR 〉1.0 for men or 〉0.85 for women, and WHtR ≥0.5 increased significantly as the telomere length increased (P-for trend <0.05). After adjusting for covariates, the ORs for each obesity markers increased as the telomere length increased (P-for trend <0.05); and the ORs of WHtR were especially meaningful (Q1, 1.00; Q2, 2.53; Q3, 2.97; Q4, 7.81; P-for trend = 0.001). There were no significant trends for metabolic syndrome and its components along with the prevalence of fatty liver disease. Conclusion Obesity markers and telomere length had significant positive correlation despite the established theory. The obesity paradox may exist in metabolically healthy adults with regard to telomere length, However, further studies with larger sample sizes for the association between obesity and telomere length are needed.

Based on the multiple coordination framework of “promising government-effective market-ordered society”, this paper takes 68 cases of adding elevators to old buildings as samples, and selects six conditional variables: approval optimization, financial subsidies, financing innovation, technological innovation, capable people leading and neighborhood committee guidance. Using Crisp-Set Qualitative Comparative Analysis (csQCA), this paper discusses the combination of conditions that affect the success or failure. It is found that: approval optimization and neighborhood committee guidance are sufficient conditions for the success; successful cases can be divided into three types: “political and social dual-drive type”, “market and social dual-drive type” and “ternary co-drive type”; lack of approval optimization, lack of financing innovation, and the existence of capable people leading are necessary conditions for the failure. The failure cases can be divided into “government and market double failure type” and “market failure type”.

Reasonable trajectory planning is the precondition for the parafoil airdrop system to achieve autonomous accurate homing and safe landing. In order to successfully realize the self-homing of the parafoil airdrop system, a new trajectory optimization design scheme is proposed in this paper. The scheme is based on the parafoil's unique flight and control characteristics and adopts a segmented homing design. Compared with the current common trajectory design method, its core feature is to avoid the problem that the straight-line flight distance before landing is limited by the radius of the height-reducing area and ensure landing accuracy and safety. Firstly, the different starting states of the parafoil airdrop system and the landing requirements were comprehensively considered, and the homing trajectory is reasonably segmented. Based on the requirements of energy control, stable flight, and landing accuracy, the optimal objective function of the trajectory was established, and the trajectory parameters, calculation methods, and constraints were given. Secondly, the cuckoo search algorithm was applied to optimize the objective function to obtain the final home trajectory. Finally, the trajectory planning under different airdrop conditions was simulated and verified. The results showed that the planned trajectories could reach the target point accurately and meet the flight direction requirements, proving the proposed scheme's correctness and feasibility.

GNSS have been widely used in navigation, positioning and timing. Nowadays, the multipath errors previously considered detrimental may be re-utilized for the remote sensing of geophysical parameters (soil moisture, vegetation and snow depth), e.g. GPS- Multipath Reflectometry (GPS-MR). In this paper, a new element describing bistatic scattering properties of vegetation is incorporated into the traditional GPS-MR model. This new element is the first-order radiative transfer equation model. The new forward GPS multipath simulator is able to explicitly link the vegetation parameters with GPS multipath observables (signal-to-noise-ratio (SNR), code pseudorange and carrier phase observables). The trunk layer and its corresponding scattering mechanisms are ignored since GPS-MR is not suitable for high forest monitoring due to the coherence of direct and reflected signals. Based on this new model linking the GPS observables (SNR, phase and pseudorange) with detailed vegetation parameters, the developed simulator can present how the GPS signals (L1 and L2 carrier frequencies, C/A, P(Y) and L2C modulations) are transmitted (scattered and absorbed) through vegetation medium and received by GPS receivers. Simulation results show that wheat will decrease the amplitudes of GPS multipath observables, if we increase the vegetation moisture contents or the scatters sizes (stem or leaf), the amplitudes of GPS multipath observables (SNR, phase and code) decrease. Although the Specular-Ground component dominates the total specular scattering, vegetation covered ground soil moisture has almost no effects on the final multipath signatures. Our simulated results are consistent with published results for environmental parameter detections with GPS-MR.

Objectives: Essential thrombocythemia (ET) is a chronic myeloproliferative neoplasm characterized by elevated platelet counts and an increased risk of thrombotic events, including ischemic strokes. Methods: We conducted a retrospective analysis of data from consecutive ischemic stroke patients with ET between March 2014 and February 2023. Results: This case series describes the clinical presentation, radiological features, and management of five patients with ET-associated ischemic strokes, all harboring the JAK2 mutation. The diverse radiological findings suggest that both large and small vessel diseases may be influenced by the prothrombotic state induced by ET. A significant elevation in platelet count was observed to correlate with the emergence of new acute infarctions in some cases. Conclusions: The study highlights combined use of antiplatelet and cytoreductive therapy in preventing secondary stroke events in patients with ET and JAK2 mutations. The heterogeneity of stroke patterns in this population necessitates a comprehensive understanding of the underlying pathophysiological mechanisms and tailored therapeutic approaches.

Although health policy resides mainly with the government, industry can play an important role in building a health ecosystem. From March to May, we administered questionnaires to 1,200 individuals from the general Korean population asking about their perception of health-friendly labels, and if they would purchase such labeled products (foods, pharmaceuticals, etc.) and services (purifying water, preventing air pollution, etc.) at extra cost. The participants placed a high value on the importance of mental, social, spiritual, and physical health factors in terms of company’s products and services with a score of about 8 out of 10 (range, 7.74-8.33). Most respondents (72.4%) said they were interested in adopting health-friendly labels. When a health-friendly label is introduced (such as one by the Business for Social Responsiveness), 65.1% of the respondents said they intended to purchase the product or service, while 6.8% said they did not, and 75.0% said they were willing to pay extra for the health-friendly product or service. Multivariate logistic regression models showed urban residence, high education level, and good social health to be significantly associated with positive attitudes toward health-friendly labels. People with high income, no religion, or normal weight were more likely to say they intend to purchase products and services with health-friendly labels. They also had a more positive attitude toward paying more for such products and services, as did people with good spiritual health. This study provides data that illustrate the importance of health-friendly products and services to the general population and companies.

Prompt removal of misfolded membrane proteins and misassembled membrane protein complexes is essential for membrane homeostasis. However, the elimination of these toxic proteins from the hydrophobic membrane environment has high energetic barriers. Transmembrane FtsH is the only known ATP-dependent protease responsible for this task, unlike other well-studied soluble ATP-dependent proteases. The mechanisms by which FtsH recognizes, unfolds, translocates, and proteolyzes its substrates remain unclear. Here, we report the crystal structures of the Thermotoga maritima FtsH periplasmic domain (PD) in an associative trimeric state at a 1.5-1.95 Å resolution. We also describe the pH-dependent oligomerization states of the isolated PD using dynamic light scattering. These observations help us understand how FtsH recognizes membrane-anchored misfolded proteins.

This study focused on the predictive models incorporating machine learning techniques that induce new dynamics for forecasting energy generation, enabling effective planning, financing, and system monitoring. The research developed a machine learning-based power generation prediction model tailored explicitly for Kenya's Garissa solar power plant. The selected model demonstrated a root mean squared error of 5.23 during evaluation, resulting in a prediction accuracy of 90.42%. This high accuracy indicates that the model can be relied upon for precise generation prediction, facilitating effective planning, and system performance monitoring

Using the 2011-2020 digital inclusive finance data released by Peking University and the index system constructed by the Blue Book of China Rural Revitalization and Development Index (2018), this paper analyzes the dynamic evolution of the digital inclusive finance and the rural revitaliza-tion from time and space dimensions with the help of kernel density estimation, Markov chain and Moran index. Using The Gini coefficient decomposition method to analyze the source of differ-ences in digital inclusive finance, and then using the spatial autoregressive (SAR) model and ge-ographically weighted regression (GWR) model to study the boosting effect of digital inclusive finance on rural revitalization from the perspective of spatial aggregation and spatial differentia-tion, respectively. The results show that: (1) The growth rate of China's digital inclusive finance slows down year by year, and the inter-provincial differences increase year by year and show gradient characteristics, indicating that there may be a trend of multipolar differentiation. The overall level of Rural Revitalization shows an increasing trend, and the gap between provinces is still apparent. (2) The evolution of digital inclusive finance and rural revitalization is a slow ad-justment process, and there has been no cross-level jump in the past ten years. In digital inclusive finance, the liquidity from the highest and lowest levels to the medium level is high. However, the liquidity in the states of rural revitalization development level is not high. (3) Rural revitalization has a positive spatial spillover effect. The level of rural revitalization in the western area is signif-icantly lower than in the eastern area. At the same time, there is no significant difference between the east and central areas. The depth of the use of digital inclusive finance has a significant positive impact on the revitalization and development of rural areas, indicating that the further promotion of digital inclusive finance business in rural areas can substantially boost the revitalization of rural areas. (4) The boosting effect of digital inclusive finance on rural revitalization shows prominent spatial differentiation characteristics. The depth of use and the degree of digitization generally show a positive impact. The central and eastern coastal cities have the highest impact, decreasing toward the southwest and northeast. The areas with the lowest usage depth impact are clustered in the northeast, and the areas with the lowest digitization impact are clustered in the southwest.

Purpose: To clarify the mechanism of state anxiety on intertemporal decision-making, two studies were conducted to investigate the role of trait anxiety and inhibitory control. Study 1 examined the moderating effect of trait anxiety. Study 2 continued to investigate the mediating effect of inhibition control on the basis of study 1. Methods: A total of 266 Chinese college students participated. Participants’ state anxiety, trait anxiety and intertemporal decision-making were measured by questionnaires (scales) respectively. And inhibition control was evaluated by two-choice oddball paradigm. Results: The results of Study 1 indicated that state anxiety could predict intertemporal decision-making and that the moderating effect of trait anxiety on this relationship was significant. Study 2 found that inhibitory control could completely moderate the relationship between state anxiety and intertemporal decision-making and that this indirect effect was affected by trait anxiety. Conclusion: 1)Individuals with higher trait anxiety are more inclined to make more impulsive and intertemporal decisions when they have a high level of state anxiety; 2)state anxiety allows inhibitory control ability to have a further effect on intertemporal decision-making; and 3)the higher trait anxiety in individuals, the stronger mediating effect of inhibitory control on the relationship between state anxiety and intertemporal decision-making.

Outdoor lighting is becoming increasingly widespread, and residents are suffering from serious light pollution as a result. Residents’ awareness of their rights to protection has gradually increased. However, due to the sometimes-inaccessible nature of residential vertical light incidence intensity data and the high cost of obtaining specific measurements, there is no appropriate hierarchic compensation for residents suffering from different degrees of light pollution. It is therefore important to measure light pollution levels and their damage at the neighborhood scale to provide residents with basic materials for proper protection and to create more politically suitable solutions. This article presents a light pollution assessment method that is easy to perform, is low-cost, and has a short data-processing cycle. This method can be used to monitor residential zone light pollution in other cities. We chose three open areas to test the spatial variation pattern of light intensity. The results are in accordance with spatial interpolation patterns and can be fit, with high precision, using the IDW method. This approach can also be used in 3 dimensions to quantitatively evaluate the distribution of light intensity distribution. We use a mixed-use zone in Beijing known as The Place as our case study area. The vertical illumination at the windows of residential buildings ranges from 2 lux to 23 lux; the illumination in some areas is far higher than the value recommended by CIE. Such severe light pollution can seriously interfere with people's daily lives and has a serious influence on their rest and health. The results of this survey will serve as an important database to assess whether the planning of night-time lighting is scientific and whether it provides residents with a basis for the protection of their rights.

In this paper we take China’s one child policy as an example and investigate its environmental impact. We develop a model for an economy using a standard overlapping generation model extended with human capital, endogenous fertility, and changing life expectancy. To model the environmental impact of economic activities, we use a modified IPAT model. We show that China’s one child has a very strong positive impact on the environment, particularly if we consider the whole human legacy.

Additive manufacturing (AM) processes, including stereolithography (SL), can fabricate complex ceramic parts layer by layer using computer-aided design (CAD) models. A ceramic slurry with high solid loading is usually used in SL to fabricate the desired shape, which is further sintered to produce the final part. The traditional SL system utilizes a tank filled with printable material, known as a vat, which for ceramic slurry contributes several limitations and operational difficulties, and further renders it non-recyclable mainly due to its high viscosity and the fragility of the green state. In this study, we utilized a continuous film supply (CFS) printer integrated with a tape casting system using in-house-designed ceramic slurry to print standard prototype specimens. Various printing parameters, including viscosity, layer thickness control, and slurry recycling efficiency, were studied. In addition, post-processing optimizations of the prototype, characterizations, and the microhardness of sintered samples were studied to determine their properties and compare them with traditional methods. The effectiveness of slurry reusability was demonstrated by printing with original and recycled slurry to produce consistent densification of final parts. Post-processing was optimized to achieve a relative sinter density of 99.02% and microhardness of 12.59 GPa. This method provides new opportunities to realize dense complex ceramic features with final properties comparable to those produced by subtractive machining and traditional SL. Furthermore, slurry recycling helps to reduce the overall cost and material consumption.