Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

In this study, the preparation of the composite 3% Au/graphite-C3N4 (3% Au/g-C3N4) sensing material was prepared by doping 3% Au onto the surface of graphitic carbonitride (C3N4) for detection pimobendan. By the way of sensing materials characterization, the X-ray diffraction analysis (XRD) and transmission electron Microscope (TEM) were performed. The cyclic voltammetry (CV) was used to measure the concentration and redox properties of pimobendan. It can be seen that when the voltage value is 0.05 V, and a reduction peak was appeared and the pimobendan concentration (0 to 55 μM) has a relationship with the reduction current value. At low concentrations of pimobendan concentration from 0.0 to 0.8 μM, the linearity R2 = 0.9642 with a detection limit of 0.28 μM. A possible pimobendan sensing mechanism on 3% Au/g-C3N4 was proposed.

This paper studies the maximum reliability of multi-hop relay UAV, in which UAV provides wireless services for remote users without direct communication link on the ground as a coded cooperative relay. In this paper, the analytical expressions of total power loss and total bit error rate are derived as reliability measures. Firstly, based on the environmental statistical parameters, a LOS probability model is proposed. Then the problem of minimizing the bit error rate of static and mobile UAVs is studied. The goal is to minimize the total bit error rate by jointly optimizing the height, elevation, power and path loss, and subject to the maximum allowable path loss con-straints, transmission power allocation constraints and UAV height and elevation constraints. At the same time the total path loss is minimized to achieve maximum ground communication cov-erage. However, the formulated joint optimization problem is non-convex and generally difficult to solve. Therefore, we decomposed the problem into two subproblems and proposed an effective joint optimization iteration algorithm. Finally, the simulation results are given, and the analysis shows that the optimal height of different reliability measures is slightly different, and using the mobility of UAVs can improve the reliability of communication performance.

In numerical simulations, achieving high accuracy without significantly increasing computational costs is often challenging. To address this, this paper presents an improved finite volume weighted essentially non-oscillatory (WENO) scheme tailored for applicability in computational fluid dynamics (CFD) and implemented in the flow solver NUAA-Turbo for simulating turbomachinery flows using both RANS and RANS/LES coupling. Firstly, the new WENO scheme is validated against classic numerical test cases to assess its stability and reliability in handling discontinuities, the Double problem, and Raleigh-Taylor (RT) instability issues. Compared to the original format, this enhanced finite volume WENO scheme demonstrates superior stability near discontinuities and resolves flow features with the same grid resolution more effectively. Next, for engineering applications related to turbomachinery, such as compressor and turbine characteristics, computations are performed using RANS, and the results obtained using WENO-ZQ3 and WENO-JS3 are compared. Finally, the new fifth-order WENO scheme is applied to RANS/LES coupled simulations of turbine wakes and film cooling. The results show that the enhanced finite volume WENO scheme offers improved stability and accuracy in engineering applications, allowing for high-precision calculations with fewer grid points to capture more detailed flow physics, thereby reducing computational costs in aerodynamic applications.

Direct laryngoscope and videolaryngoscope are the dominant endotracheal intubation tools. Styletubation technique (using a video-assisted intubating stylet) has shown its advantages regarding in short intubation time, high success rate, less stimulation, and operator’s satisfaction. The learning curve can be steep but easy to overcome if the technical pitfalls could be avoided. Conditions make styletubation challenging include secretions/blood, short/stiff neck, restricted mouth opening and cervical spine mobility, anatomical abnormalities over head and neck regions, and obesity, etc. In this clinical report, we present the effectiveness and efficiency of routine use of the styletubation for tracheal intubation in a super-super obese patient (BMI 103 kg/m2) undergoing bariatric surgery with laparoscopic sleeve gastrectomy.

Much has been explored in the individual health issue, and most of them adopt the objective data such as laboratory tests or health services utilization to analyze individual health assessment. However, the factors influencing individuals in self‐assessed health is still unclean. The study considers that self‐assessed health is viewed as catalyst in health management and explores various dimensions associated with self‐assessed health. Totally, 800 participants who were randomly sampled from the citizen of Porter County, Indiana completed the Needs Assessment Citizen Survey in 2007.After adjustment for age, gender, education, income, and health coverage, life quality (β=1.5538, sdandard erro of β=0.8404), and Medicaid assistance (β= -0.7715, sdandard erro of β= 0.3958) are the main determinants of individuals’ self‐assessed health. The results suggest that public health officials should consider improving citizens’ self-assessed health by providing good living and socio-economic environment.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

The aim of this case-series report article is to provide a new topical view of the styletubation (video intubating stylet technique) in obese patients undergoing bariatric surgeries. In contrast to various conventional direct laryngoscopes (DLs), videolaryngoscopes (VLs) have been applied in such obese population with potentially difficult airway populations. The safety and effectiveness of VLs have been repeatedly studied and the superiority of VLs then has been observed and is advocated as a routine use. In this article, among our vast use experiences of the styletubation (more than 54,998 patients since 2016) for routine tracheal intubation, we present such unique experience to apply such intubating technique in obese patient undergoing bariatric surgery. Consistent with the experiences applied in other patient populations, we found the styletubation technique to be swift (the time to intubate from 5 s to 24 s), smooth (first-attempt success rate: 100%), safe (no airway complications), and easy (high subjective satisfaction). The learning curve can be steep but is easily overcome if technical pitfalls are avoided. We, therefore, propose that the styletubation technique can be feasibly applied for tracheal intubation in obese patients undergoing bariatric surgery.

Pulmonary fibrosis is a chronic, progressive and fatal disease of the interstitial lung， there still lack of efficient therapy to reverse the prognosis of patients currently. In this study, a fucoidan from Costaria costata was isolated and its anti-idiopathic fibrosis activity was investigated both in vitro and in vivo. The chemical composition analysis results show that Costaria costata polysaccharide (CCP) is consisting of galactose and fucose as the main monosaccharides with a sulfate group content of 18.54%. The results found that CCP could resist TGF-β1-induced epithelial-mesenchymal transition (EMT) in A549 cells by inhibiting the TGF-β/Smad and PI3K/AKT/mTOR signaling pathways. In vivo data found that CCP treatment alleviated bleomycin (BLM)-stimulated fibrosis and inflammation in mice lung tissue. This study suggests that CCP could protect the lung from fibrosis by relieving the EMT process and inflammation in lung cells.

Lignin is insoluble in water, limiting its use in the synthesis of adhesives. Therefore, in order to increase the amount of lignin raw materials used in the synthesis of adhesives, a kind of aminated lignin compounds was prepared through lignin amination reaction, and conducting structural analysis in this paper. The particle size of the amino lignin is about 100 nm, with the weight average molecular weight of 57,627 g/mol and a water solubility of 0.45g/100ml. The reaction mechanisms were proposed that the phenolic hydroxyl groups of lignin react with ammonia molecules, and thereby successfully introducing amino groups to generate the aminated lignin compounds. Therefore, this article enriches the scientific theory of lignin reactions and provides reference for the widespread application of lignin raw materials in the field of adhesives.

Two major sample configurations are adopted in all the instruments for fabric hand measurement, flat sample as in KES and FAST types machines, and wrinkled sample as in PhabrOmeter. This paper compares the two sample types to examine which one if any offers a better coverage and reflection of the fabric sensory attributes. Fabrics have unique behaviors of drape, wrinkle and tactile sense which are entirely due to the simultaneous occurrence of both in-plane membrane deformation and out-of-plane bending deformation in multiple curvature. Such singular deformation mode cannot be detected by any machines using flat sample, whereas during a PhabrOmeter test, the fabric sample genuinely produces drape, wrinkle in addition to other related deformations. This paper then introduced the theoretical research pertaining to the measurement. Then a split sample experiment is conducted to demonstrate the importance of the internal connections in fabric during drape and wrinkle processes. As such fabric interconnection will be barely disclosed during tests using flat samples, another important advantage of PhabrOmeter is hence clearly shown.

As one of the most promising ablative fillers, multi-walled carbon nanotubes (MWCNTs) have been used to improve the ablative resistance of Ethylene-Propylene-Diene Monomer (EPDM) insulators by facilitating the carbothermal reduction reaction of silica. However, the contribution of MWCNTs to char layer structure of the insulators was unclear. In this work, the effects of MWCNTs on char layer structure and ablative resistance were investigated in different EPDM-based insulators with and without silica. The results showed that adding only 3 phr MWCNTs can reduce the linear ablation rate of EPDM-based insulators without silica by 31.7%, while 6 phr MWCNTs are required to obtain similar results in EPDM-based insulators with silica. Both the char layer morphology of the two insulators gradually evolved into dense porous structure as MWCNTs content increasing, but their formation mechanisms are different. The XRD and Raman spectrum showed that different physicochemical reactions occurred around MWCNTs under different charring components. The proposed ablation mechanism was further verified by designing alternating multilayer distribution of MWCNTs and silica. This work can guide the construction of desirable char layer structure for increasing ablative resistance of EPDM-based insulators.

Abstract: Laryngoscopy for tracheal intubation has been developed for many decades. Among various conventional laryngoscopes, videolaryngoscopes (VL) have been applied in different patient populations, including difficult airways. The safety and effectiveness of VL have been repeatedly studied in both normal and difficult airways. The superiority of VL then has been observed and is advocated as the standard of care. In contrast to laryngoscopy, the development of video-assisted intubating stylet (VS, also named as styletubation) has been noticed two dec-ades ago. Since then, sporadic clinical experiences of use have appeared in literature. In this re-view article, we presented our vast use experiences of the styletubation (more than 55,000 pa-tients since 2016). We found this technique is swift (the time to intubate: from 3 s to 10 s), smooth (first-attempt success rate: 100%), safe (no airway complications), and easy (high subjective satis-faction and fast learning curve for the novice trainees) in both normal and difficult airway sce-narios. We therefore propose styletubation technique can be feasibly applied as universal rou-tine use for tracheal intubation.

Abstract: Toxicity of emerging organic pollutants to photosystems of aquatic plants are still not well clarified. This study aimed to develop a novel ecotoxicological experimental protocol based on nanoscale electrochemical mapping of photosynthetic oxygen evolution of aquatic plants by SECM (scanning electrochemical microscopy). The protocol was also checked by confocal laser scanning microscopy (CLSM), the traditional Clark oxygen electrode method and chlorophyll fluorescence technique. The typical persistent organic pollutant 2,4-dichlorophenol (2,4-DCP) in water environment and the common aquatic Microsorium pteropus (M. pteropus) were chosen as the model organic pollutant and tested plant, respectively. It was found that the SECM method could well discriminated the responses of stoma micromorphology and spatial pattens of photosynthetic oxygen evolution on single stoma. The shape of stoma blurred with increasing 2,4-DCP concentration, which was in good agreement with the CLSM images. The dose-response curves and IC50 values obtained from the SECM data were verified by the data measured by the traditional Clark oxygen electrode method and chlorophyll fluorescence test. The IC50 value of single stoma oxygen emission of 24 h exposed plant leave, which was derived from the SECM current data (32535 μg L-1), was close to those calculated from the maximum photosynthetic efficiency (Fv/Fm) measured by chlorophyll fluorescence test (33963 μg L-1), and the Clark oxygen electrode method photosynthetic oxygen evolution rate (32375 μg L-1). The 72 h and 96 h 2,4-DCP exposure data further confirmed the reliability of the nanoscale stoma oxygen emission mapping methodology for ecotoxicological assessment. In this protocol, the procedures for how to collect effective electrochemical data and how to extract useful information from the single stoma oxygen emission pattern were well established. This study showed that SECM is a feasible and reliable ecotoxicological tool for evaluation of toxicity of organic pollutants to higher plants with unique nanoscale visualization advantage over the conventional methods.

3,4-Dihydroquinolin-2(1H)-ones represent a class of valuable bioactive compounds with six-membered nitrogen-containing heterocyclic structures. The development of simple, mild and efficient synthetic methods has been widely concerned by synthetic chemists. In this review, we have summarized a series of different synthetic strategies for the synthesis of dihydroquinoline-2(1H)-ones via catalytic annulation of α,β-unsaturated N-arylamides in the past decade, including covering electrophilic cyclization, radical initiated cyclization and photochemical cyclization reactions. Besides, the substrate scope and mechanistic details are also discussed. This paper will provide a useful reference for the development of diverse synthesis methodologies of 3,4-dihydroquinolin-2(1H)-ones.

Trueperella pyogenes is a common opportunistic pathogen which is one of the main causes of postpartum endometritis in dairy cows. As a substitute for antibiotics, the probiotic Lactobacillus rhamnosus GR-1 has been used in a wide range of clinical treatments. Our experiments were designed to establish a model of anti-damage which LGR-1 was used to protect bovine endometrial epithelial cells (BEECs) from inflammatory damage and cell destruction caused by T. pyogenes. Increased expression of NLRP3 inflammasomes and cytokines was observed following T. pyogenes challenge, but this increase was relieved by LGR-1 pretreatment. Immunofluorescence and Western blot analyses revealed that T. pyogenes infection also results in the damage of tight junction proteins in BEECs. The expression levels of Claudin-1, Occludin, and ZO-1 were decreased in cells only infected with T. pyogenes but not in cells pretreated with LGR-1. Moreover, the detection of the anti-apoptotic protein Bcl-2 and apoptotic proteins BAX, cytochrome c, as well as the activating effector caspase-3 revealed that T. pyogenes induced apoptosis of BEECs, which was also confirmed by DAPI staining to observe the morphological changes of the nuclei of cell apoptosis and by TUNEL staining to locate the cells undergoing apoptosis. Our data indicate that LGR-1 ameliorates the T. pyogenes–induced barrier dysfunction of BEECs and pre-application of LGR-1 could be an effective strategy for controlling T. pyogenes infection.

With the deepening of the diversification and openness of financial system, financial vulnerability, as an endogenous attribute of financial system, becomes an important measurement of financial security. Based on network analysis, we introduce network curvature indicator improved by Copula entropy as an innovative metric of financial vulnerability. Compared with previous network curvature analysis method, CE-based curvature proposed in this paper can measure market vulnerability and systematic risk with significant advantages.

The electronic, optical, and magnetic properties of Nd-doped ZnO systems were calculated using the DFT/GGA+U method. According to the results, the Nd dopant causes lattice parameter expansion, negative formation energy, and bandgap narrowing, resulting in the formation of an n-type degenerate semiconductor. Overlapping of the generated impurity and Fermi levels results in a significant trap effect that prevents electron-hole recombination. The absorption spectrum demonstrates a redshift in the visible region and improved intensity, leading to enhanced photocatalytic performance. The Nd-doped ZnO system displays ferromagnetic, with FM coupling due to strong spd-f hybridization through magnetic exchange interaction between the Nd-4f state and O-2p, Zn-4s, and Zn-3p states. These findings imply that Nd-doped ZnO may be a promising material for DMS spintronic devices.

Topographic factors are recognized as one of the key factors influencing vegetation distribution patterns, and studying the interactions between them can contribute to enhancing our understanding of future vegetation dynamics. We used the Moderate-resolution Imaging Spectroradiometer Normalized Differential Vegetation Index (MODIS NDVI) image dataset (2000-2019), combined with Digital Elevation Model (DEM), and vegetation type data for trend analysis, and explored NDVI variation and its relationship with topographic factors through an integrated geographically-weighted model in the Three Parallel Rivers Region (TPRR) of southeastern Tibetan plateau in the past 20 years. Our results indicated that there was no significant increase of NDVI in the entire basin between 2000-2019, except for the Lancang River basin. In the year 2004, abrupt changes in NDVI were observed across the whole basin and each sub-basin. During 2000-2019, the mean NDVI value of the whole basin increased initially and then decreased with the increasing elevation. However, it changed marginally with changes in slope and aspect. We observed a distinct spatial heterogeneity in vegetation patterns with elevation, with vegetation in the southern regions showing higher NDVI than the north as a whole. Most of the vegetation cover was concentrated in the slope range of 8~35°, with no significant difference in distribution except flat-land. Furthermore, from 2000 to 2019, the vegetation cover in the TPRR showed an improving trend with the changes of various topographic factors, with the largest improvement area (36.10%) in the slightly improved category. The improved region was mainly distributed in the source area of the Jinsha River basin and the southern part of the whole basin. Geographically weighted regression (GWR) analysis showed that elevation was negatively correlated with NDVI trends in most areas, especially in the middle reaches of Nujiang River basin and Jinsha River basin, where the influence of slope and aspect on NDVI change was considerably much smaller than elevation.

Topographic factors are recognized as one of the key factors influencing vegetation distribution patterns, and studying the interactions between them can contribute to enhancing our understanding of future vegetation dynamics. We used the Moderate-resolution Imaging Spectroradiometer Normalized Differential Vegetation Index (MODIS NDVI) image dataset (2000-2019), combined with Digital Elevation Model (DEM), and vegetation type data for trend analysis, and explored NDVI variation and its relationship with topographic factors through an integrated geographically-weighted model in the Three Parallel Rivers Region (TPRR) of southeastern Tibetan plateau in the past 20 years. Our results indicated that there was no significant increase of NDVI in the entire basin between 2000-2019, except for the Lancang River basin. In the year 2004, abrupt changes in NDVI were observed across the whole basin and each sub-basin. During 2000-2019, the mean NDVI value of the whole basin increased initially and then decreased with the increasing elevation. However, it changed marginally with changes in slope and aspect. We observed a distinct spatial heterogeneity in vegetation patterns with elevation, with vegetation in the southern regions showing higher NDVI than the north as a whole. Most of the vegetation cover was concentrated in the slope range of 8~35°, with no significant difference in distribution except flat-land. Furthermore, from 2000 to 2019, the vegetation cover in the TPRR showed an improving trend with the changes of various topographic factors, with the largest improvement area (36.10%) in the slightly improved category. The improved region was mainly distributed in the source area of the Jinsha River basin and the southern part of the whole basin. Geographically weighted regression (GWR) analysis showed that elevation was negatively correlated with NDVI trends in most areas, especially in the middle reaches of Nujiang River basin and Jinsha River basin, where the influence of slope and aspect on NDVI change was considerably much smaller than elevation.

Earth observation satellites can capture images of specific areas in Earth's orbit based on user requirements. Despite the high demand for satellite imagery, satellites remain a scarce resource. When there are many observation tasks that are large and dense, they may interfere with each other due to satellite mobility. To address this issue, a multi-satellite scheduling algorithm based on a task merging mechanism has been proposed. This paper proposes a two-stage approach to the problem: task merging phase and merging task scheduling phase. The task merging phase introduces two methods based on Mean Shift and Complete Graph to generate the merging task set. In the merging task scheduling phase, a multi-satellite scheduling algorithm based on merging tasks is employed to solve the problem. Finally, certain measurement experiments suggest the effectiveness of the algorithm.

Sensory evaluation has been widely applied in assessing the quality of many consumer products that directly serve human needs such as food, beverages, clothing, etc. This paper first examined the inherent deficiencies in this approach, due mainly to the essentially subjective nature of human sensory preference. It then argued that instinctively designating certain materials attributes as sensory perceptions is unnecessary; considering every scientific concept is in essence the processed results of our sensory organs/brains, i.e., all quantities were initially human perceptions. Scientific advances have inevitably generated gradual transformation of such human perceptions as warmth and heaviness into objective parameters measurable in physical quantities like temperature and kilograms. Then using existing successful examples, it demonstrated firmly how the sensory attributes can be assessed by more reliable instrumental methods, and envisioned the key steps to turning a perception into scientifically measurable parameter(s).

Cloth wearing seems so natural that everyone is self-deemed knowledgeable and has some expert opinions about it. However to clearly explain the physics involved, and hence to make predictions for clothing design or selection, turns out as demonstrated below to be quite challenging even for experts. Cloth is a multiphased, porous and anisotropic material system and usually in multilayers. Unlike ordinary engineering heat transfer problems, the human body acts as an internal heat source in a clothing situation, thus forming a temperature gradient between body and ambient, and the sign of this gradient often changes as the ambient temperature varies. Our body also perspires and the sweat evaporates, an effective body cooling process via phase change. To bring all the variables into analysis quickly escalates into a formidable task. This work attempts to unravel the problem from a physics perspective, focusing on several rarely noticed yet critically important mechanisms involved so as to offer a clear and accurate depiction of the principles in clothing thermal comfort.

Objective: To investigate the efficacy of a magnetic resonance imaging (MRI) radiomics model in predicting colorectal cancer liver metastasis (CRLM). Methods: A total of 120 patients who underwent baseline MRI examination at the Affiliated Hospital of North Sichuan Medical College from June 2016 to August 2022 and were pathologically confirmed to have colorectal cancer (CRC) were randomly divided into a training group and a validation group. The clinical risk factors and MRI data of all patients were collected. Univariate and multivariate analysis were used to screen the clinically independent risk factors for CRLM. The radiomic features of each sequence were extracted from oblique axial or axial fat-free T2-weighted imaging (T2WI) and diffusion-weighted imaging (DWI) sequences. Least absolute shrinkage and selection operator (LASSO) regression was used to screen the optimal radiomic features of each sequence. Logistic regression was used to establish a prediction model of each sequence (T2WI and DWI models), a combined radiomics model (M) integrating the features of T2WI and DWI sequences, and a combined imaging-clinical model (U) combining the radiomic features of each sequence with clinically independent risk factors. The area under the receiver operating characteristic curve (AUC) was calculated to evaluate the predictive performance of each model. Results: Among the 120 CRC patients enrolled, 57 had liver metastasis, and 63 did not. The tumor markers carcinoembryonic antigen and carbohydrate antigen 19-9 were clinically independent risk factors for CRLM. Three optimal radiomic features were screened from T2WI and DWI sequences through LASSO regression analysis, respectively. The AUC values of the T2WI, DWI, M, and U models were 0.811, 0.803, 0.824, and 0.899 in the training group and 0.795, 0.798, 0.813, and 0.889 in the validation group, respectively. The predictive performance of the combined models was better than that of the single-sequence models. The U model performed best at predicting CRLM. Conclusion: An MRI radiomics model based on CRC primary lesions can predict CRLM well. Our combined model integrating the radiomic features of each sequence and clinically independent risk factors had the best predictive performance.

With increasing availability of alternative mobility options for city transportation system, it is necessary to better understand how emerging mobility are impacting the travel demand and consumer-social surplus. However, few study has been conducted to evaluate the social welfare effects of the range of vacant trip in mobility oriented development(MOD) mode. This paper identified the vacant trip and loading rate evaluation model under mobility oriented development mode. recommended solutions to enhance the effective operation of the different mobility services under numerical illustrations, which can offer some beneficial guidance and theoretic basis to the efficiency of MOD in planning and management aspects.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

Formation avoidance is one of the critical technologies for autonomous underwater vehicle (AUV) formations. To this end, a cooperative obstacle avoidance algorithm based on an improved artificial potential field and a consistency protocol is proposed in this paper. A cooperative obstacle avoidance algorithm based on the improved artificial potential field method and consistency protocol is proposed for the local obstacle avoidance problem of AUV formation. Firstly, for the disadvantage that the traditional artificial potential field method is easy to fall into local minima, an auxiliary potential field perpendicular to the AUV moving direction is designed to solve the problem that AUVs are easy to have zero combined force in the potential field and local minima. Secondly, the control law of AUV formation that keeps the speed and position consistent is designed for the problem that the formation will change during the local obstacle avoidance of the formation system. The control conflict problem of the combined algorithm of the artificial potential field law and the consistency protocol is solved by adjusting the desired formation of the consistency protocol through the potential field force. Finally, the bounded energy function demonstrates system convergence's stability. The simulation verification confirmed that the AUV formation could achieve the convergence of the formation state under local obstacle avoidance.

Several observational studies have indicated the potential associations between calcium, vitamin D(Vit-D) and irritable bowel syndrome (IBS). However, the causal relationship deduced from these studies is subjected to residual confounding factors and reverse causation. Therefore, we aim to explore the bidirectional causal effects between serum calcium, Vit-D, PTH and IBS at the genetic level by a two-sample Mendelian randomization (MR) analysis. Sensitivity analyses were performed to evaluate the robustness. The estimates were presented as odds ratio (OR) with their 95% confidence intervals (CIs). The results of the inverse-variance-weighted method did not re-veal any causal relationship shared between genetically predisposed calcium (OR = 0.92, 95% CI: 0.80-1.06, P = 0.25) and Vit-D (OR = 0.99, 95% CI: 0.83-1.19, P = 0.94) level and the risk of IBS. The bidirectional analysis demonstrated that genetic predisposition to IBS was associated with a de-creased level of PTH (beta: -0.19, 95%CI: -0.34 to -0.04, P = 0.01). In conclusion, the present study indicates no causal relationship between the serum calcium and Vit-D concentrations and the risk of IBS. The potential mechanisms by which IBS affects serum PTH need to be further investigated.

Management of chronic inflammation and wounds has always been a key issue in the pharmaceutical and healthcare sector. Curcumin (CCM) is an active ingredient extracted from turmeric rhizomes that has antioxidant, anti-inflammatory, and antibacterial activities, thus showing significant effectiveness toward wound healing. However, its shortcomings such as poor water solubility, poor chemical stability and fast metabolic rate limit its bioavailability and long-term use. In this context, hydrogels appear to be a versatile matrix for carrying and stabilizing drugs due to the biomimetic structure, soft porous microarchitecture, and pleasant biomechanical properties. The drug loading/releasing efficiencies can also be controlled by use of highly crystalline and porous metal organic frameworks (MOFs). Here, a flexible hydrogel composed of sodium alginate (SA) matrix and CCM-loaded MOFs was constructed for long-term drug release and antibacterial activity. The morphology and physicochemical properties of composite hydrogels were analyzed by scanning electron microscopy (SEM), Fourier transform infrared spectroscopy (FT-IR), X-ray diffraction (XRD), ultraviolet visible spectroscopy (UV-Vis), Raman spectroscopy and mechanical property tests. The results showed that the composite hydrogel was highly twistable and bendable to mechanically comply with human skin. The as-prepared hydrogel could capture efficient CCM for slow drug release as well as effective killing of bacteria. Therefore, such composite hydrogel is expected to provide a new management system for chronic wound dressings.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

COVID-19 virus has become a global threat to the human population and society. The virus which originated from China in December, 2019 has swept across continents in the world. Cameroon has been one of the countries with a high infectious rate in the recent period having a majority of the infectious cases in the Littoral region. Lack of awareness play a major role in the rise of COVID-19 cases. This paper examined the perceptions of the existence and spread of the COVID-19 virus in Wouri Division, Littoral Region of Cameroon. The study involved a qualitative survey designed by online questionnaires which were forwarded to the inhabitants of Wouri Division through e-mails and ‘WhatsApp’. The survey included the perception of the origin and existence of the COVID-19 virus, its mode of disease transmission, preventive and control measures. A total of 573 respondents were obtained (317 females and 256 males). From the results, although a greater proportion of the respondents showed knowledge towards the COVID- 19 virus existence, transmission and prevention that could lead to a reduction in the spread of the disease, our findings suggested that there’s more need for public sensitisation of the virus especially its method of transmission, control and prevention.

Theaflavins, the characteristic and bioactive polyphenols in black tea, possess the potential improvement effects on insulin resistance-associated metabolic abnormalities including obesity and type 2 diebetes. However, the molecular mechanisms of theaflavins improving insulin sensitivity are still not clear. In this study, we investigated the protective effects and mechanisms of theaflavins on palmitic acid-induced insulin resistance in HepG2 cells. Theaflavins could significantly increase glucose uptake of insulin-resistant cells at noncytotoxic doses. This activity was mediated by upregulating the glucose transporter 4 protein expression, increasing the phosphorylation of IRS-1 at Ser307, and reduced the phosphor-Akt (Ser473) level. Moreover, theaflavins were found to enhance mitochondrial DNA copy number through down-regulate the PGC-1β mRNA level and up-regulate PRC mRNA expression in insulin-resistant HepG2 cells. These results indicated that theaflavins could improve free fatty acid-induced hepatic insulin resistance by promoting mitochondrial biogenesis, and were promising functional food and medicines for insulin resistance-related disorders.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Persistent land subsidence or uplift can cause serious latent hazards to urban infrastructure. To thoroughly investigate the causes and impacts of land surface deformation, this study examines the case of Wuxi City, focusing on the land fluctuation patterns in the region following the enforcement of the groundwater abstraction prohibition policy in 2005. This research utilizes the PS-InSAR technique to quantify land surface deformations in the Wuxi region from November 2015 to June 2023 and analyzes 100 SAR images to obtain comprehensive spatiotemporal evolution data of the land surface. Furthermore, this study conducts an in-depth analysis of the effects of various factors, including groundwater, precipitation, and soil geology, on the characteristics of land surface deformation. It pioneers the application of the GARCH (Generalized Autoregressive Conditional Heteroskedasticity) model to analyze the time-series displacement in the study area and innovatively introduces the "amplitude factor" index to assess land surface fluctuations. This study investigates the recent land surface deformation patterns and mechanisms in Wuxi City. By integrating the "amplitude factor", it provides a scientific foundation for future urban development and disaster mitigation strategies in Wuxi City, offering valuable insights for related research.

Simple summary: The noninvasive differentiation of hepatocellular carcinoma (HCC) from intrahepatic cholangiocarcinoma (ICC) remains challenging. In recent years, the number of studies on the application of radiomics in liver cancer has grown dramatically. However, there have been very few studies on the differentiation of HCC from ICC based on multisequence magnetic resonance imaging (MRI) radiomics. This study aimed to investigate the efficacy of a radiomic model based on preoperative fat suppression T2-weighted imaging (FS-T2WI) and dynamic contrast-enhanced MRI features in the arterial phase (A) and portal venous phase (P) for the differentiation of HCC from ICC. Abstract: The purpose of this study was to investigate the efficacy of magnetic resonance imaging (MRI) radiomics in differentiating hepatocellular carcinoma (HCC) from intrahepatic cholangiocarcinoma (ICC). The clinical and MRI data of 129 pathologically confirmed HCC cases and 48 ICC cases from April 2016 to December 2021 at the Affiliated Hospital of North Sichuan Medical College were retrospectively analyzed. Included cases were randomly divided at a ratio of 7:3 into a training group of 124 cases (90 HCC cases and 34 ICC cases) and a validation group of 53 cases (39 HCC cases and 14 ICC cases). Radiomic features were extracted from axial fat-suppression T2-weighted imaging (FS-T2WI) and axial arterial-phase (A) and portal-venous-phase (P) dynamic contrast-enhanced MRI sequences, and the corresponding datasets were generated. The least absolute shrinkage and selection operator (LASSO) method was used to select the best radiomic features. Logistic regression was used to establish a radiomic model for each sequence (FS-T2WI, A, and P models) and a joint model (M model) integrating the radiomic features of all the sequences. The performance of each model was evaluated using the area under the receiver operating characteristic curve (AUC). The AUC of the FS-T2WI, A, P, and M models for distinguishing HCC from ICC was 0.693, 0.863, 0.818, and 0.914 in the training group and 0.690, 0.784, 0.727, and 0.802 in the validation group, respectively. The results of this study suggest that MRI-based radiomics may help noninvasively differentiate HCC from ICC. The model integrating the radiomic features of multiple sequences showed further improvement in performance.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

In this study, we aimed to develop a deep learning model for identifying bacterial keratitis (BK) and fungal keratitis (FK) by using slit-lamp images. We retrospectively collected slit-lamp images of patients with culture-proven microbial keratitis between January 1, 2010, and December 31, 2019, from two medical centers in Taiwan. We constructed a deep learning algorithm, consisting of a segmentation model for cropping cornea images and a classification model that applies convolutional neural networks to differentiate between FK and BK. The model performance was evaluated and presented as the area under the curve (AUC) of the receiver operating characteristic curves. A gradient-weighted class activation mapping technique was used to plot the heatmap of the model. By using 1330 images from 580 patients, the deep learning algorithm achieved an average diagnostic accuracy of 80.00%. The diagnostic accuracy for BK ranged from 79.59% to 95.91% and that for FK ranged from 26.31% to 63.15%. DenseNet169 showed the best model performance, with an AUC of 0.78 for both BK and FK. The heat maps revealed that the model was able to identify the corneal infiltrations. The model showed better diagnostic accuracy than the previously reported diagnostic performance of both general ophthalmologists and corneal specialists.

The propagation of electromagnetic waves beyond the line of sight can be caused by atmospheric ducts, which are a significant concerns in the fields of radar and communication. This paper utilizes data from seven automatic stations and five radio-sounding stations to statistically analyze the characteristics of the atmospheric ducts in the northwest region of the South China Sea (SCS). After verifying the practicality of numerical analysis data from NCEP CFSv2 and ERA5 in studying atmospheric ducts using measured data, we analyzed the space-time distribution characteristics of the height of the regional evaporation duct and the bottom height of the elevated duct. Using the parabolic equation model, we simulated electromagnetic propagation loss under different frequencies and radiation elevation angles in both uniform and non-uniform duct environments within a typical atmospheric duct structure. The study found that the NCEP CFSv2 data accurately captures the evaporation duct height and duct occurrence rate in the study area, and the elevated duct bottom height obtained from the inversion of ERA5 and the measured data has a good consistency. The occurrence rate and height of evaporation duct in coastal stations in the northwest of the SCS vary significantly by month, demonstrating clear monthly distribution patterns. Conversely, changes in the Xisha station are minimal, indicating good temporal uniformity. For lower atmospheric ducts, the difference in occurrence rates between 00:00 and 12:00 (UTC) is negligible. The occurrence probability of elevated ducts in the Beibu Gulf area is relatively high, mainly concentrated from January to April, and the Xisha area is dominated by surface ducts without foundation layer, mainly concentrated from June to August. The monsoon plays a critical role in the generation and evolution of atmospheric ducts in the northwest of the SCS, with the height of the evaporation duct increasing and the bottom height of the elevated duct decreasing after the onset of the summer monsoon. Electromagnetic propagation simulations demonstrate that higher frequency and lower elevation angles of radiation sources in the trapping layer of the evaporation duct make it easier to be trapped. As the evaporation duct height decreases, the amplitude of the "sinusoidal fluctuation" of the propagation loss also decreases. Frequency changes of the radiation source in the surface duct environment have minimal impact on electromagnetic propagation loss, but the elevation angle of the radiation source is a critical factor. The frequency of the "sinusoidal fluctuation" in propagation loss is higher in a hybrid duct environment compared to a uniform surface duct. Additionally, the propagation loss increases faster with distance at the height of the evaporation duct, resulting in greater electromagnetic propagation loss.

Urbanization-induced land use transition results in a decline in ecosystem services, which has implications for regional ecological security. In order to explore the relationship between ecosystem services and land use transition, this paper utilizes the InVEST model, geographically weighted regression model to examine the impact of land use transition on ecosystem services in the Dongting Lake area (DLA). The results showed that (1) During the period 2000-2020, the intensity and motivation of land-use transition showed obvious spatial and temporal heterogeneity with the variation of urbanization development. (2) Habitat quality and Carbon sequestrations showed a downward trend. In contrast, food supply followed an upward trend; soil conservation and water yield services initially increased and dropped later. The overall spatial changes in habitat quality and Carbon sequestration appear to be insignificant. Food supply shows significant differences in the plains compared to other areas; while soil conservation and water yield service shows significant changes in places other than the DLA. (3) From 2000 to 2020, land use transition dynamics, population density, GDP density, night lighting and transition intensity had mainly negative effects on ecosystem services. Only the Normalized Vegetation Index (NDVI) showed a positive effect on ecosystem services. The results of the research will provide valuable references for the development and implementation of spatial ecological restoration planning and land use policies in the national territory.

With the rapid development of urbanization and industrialization in China, environmental issues have become a knotty problem, especially issues related to air, water, and solid-waste pollution. These pollutants pose threats to the health of the population and to that of communities and have a vicious influence on the healthcare system. Additionally, pollution also exhibits spill-over effects, which means that pollution in the local region could affect the healthcare services in a neighbouring region. Therefore, it is necessary to explore the relationship between pollution and healthcare. A spatial autocorrelation analysis was conducted and spatial panel econometric models were constructed to explore the characteristics of pollution and healthcare services in China and the relationship between them using data on all 31 provinces over twelve consecutive years (2006-2017). The results showed that the utilization of healthcare services and environmental pollution were not randomly distributed; unsurprisingly, air pollution and solid-waste pollution were mainly found in parts of northern China, while water pollution was highest in southern and coastal China. In addition, environmental pollution exhibited spill-over effects on healthcare services. For example, a 1% increase in solid waste in one specific geographical unit was estimated to increase the inpatient visits per capita in adjacent counties by 0.559%. Specifically, pollution showed different degrees of influence on healthcare services, which means that the impact of environmental pollution on the number of outpatient visits is greater than on the number of inpatient visits. Our results provide the government with evidence for effectively formulating and promulgating policies, especially policies aimed at tackling spill-over effects among different regions.

In recent years, many molecular and environmental factors have been studied to understand how synaptic plasticity is modulated. Sleep, as an evolutionary conserved biological function, has shown to be a critical player for the consolidation and filtering of synaptic circuitry underlying memory traces. Although sleep disturbances do not alter normal memory consolidation, they may reflect fundamental circuit malfunctions that can play a significant role in exacerbating diseases, such as autism and Alzheimer’s disease. Very recently, scientists sought to answer part of this enigma and they identified p75 neurotrophic receptor (p75NTR) as a critical player in mediating impairments in hippocampal-dependent associative plasticity upon sleep deprivation. This paper will review the role of the p75NTR, critically discuss the impact and implications of this research as the bridge for sleep research and neurological diseases.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Scanning electron microscopy (SEM) is a powerful tool in the domain of material science, mining, and geology, owing to its enormous potential to provide unique insights into the micro and nanoscale worlds. This comprehensive review discusses the background development of SEM, basic SEM operation including the specimen preparation and imaging process, and fundamental theoretical calculations underlying the SEM operation. It provides foundational understanding to the engineers and scientists, who never got a chance to dig in-depth into the SEM, to understand the working and development of this robust analytical technique. The present review covers how SEM has been serving as a crucial tool in mineral characterization, with specific discussions on the working and research fronts of SEM-EDX, SEM-AM, SEM-MLA, and QEMSCAN. With automation gaining pace in the development of all spheres of technology, the understanding of uncertainties in SEM measurements is very important. The constraints in mineral phase identification by EDS spectra and sample preparation are conferred. In the end, future research directions for SEM are analyzed with the possible incorporation of machine learning, deep learning, and artificial intelligence tools, for automating the process of mineral identification, quantification, and efficient communication with the researchers, so that the analytical process robustness and objectivity can be improved, and the analysis time and the involved costs can be brought down. This review also discusses the idea of integrating robotics with SEM, to make the equipment portable, so that further mineral characterization insights can be gained not only on earth but also on other terrestrial grounds.

Selective laser melting (SLM) is one of the widely used techniques in metallic additive manufacturing, in which high-density laser powder is utilized to selectively melting layers of powders to create geometrically complex parts. Temperature distribution and molten pool geometry directly determine the balling effect, and concentrated balling phenomenon significantly deteriorates surface integrity and mechanical properties of the part. Finite element models have been developed to predict temperature distribution and molten pool geometry, but they were computationally expensive. In this paper, the three-dimensional temperature distributions are predicted by analytical models using point moving heat source and semi-ellipsoidal moving source respectively. The molten pool dimensions under various process conditions are obtained from the three-dimensional temperature predictions and experimentally validated. Ti-6Al-4V alloy is chosen for the investigation. Good agreements between the predictions and the measurements are observed. The presented models are also suitable for other metallic materials in the SLM process.

Monitoring volatile organic compounds (VOCs) places a crucial role in environmental pollutants control and indoor air quality. In this study, a metal-oxide (MOx) sensor detector (used in a commercially available monitor) was employed to delineate the composition of air containing three common VOCs (ethanol, acetone and hexane) under various concentrations. Experiments with a single component and double components were conducted to investigate how the solvents interact with the metal oxide sensor. The experimental results revealed that the affinity between VOC and sensor was in the following order: acetone > ethanol > n-hexane. A mathematical model was developed, based on the experimental findings and data analysis, to convert the output resistance value of the sensor into concentration values, which in turn can be used to calculate a VOC-based air quality index. Empirical equations were established based on inferences of vapor composition versus resistance trends, and on an approach of using original and diluted air samples to generate two sets of resistance data per sample. The calibration of numerous model parameters allowed matching simulated curves to measured data. As such, the predictive mathematical model enabled quantifying not only the total concentration of sensed VOCs, but also estimating the VOC composition. This first attempt to obtain semi-quantitative data from a single MOx sensor, despite remaining selectivity challenges, is aimed at expanding the capability of mobile air pollutants monitoring devices.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

In the face of pressing global challenges, coupling the synergy of dance arts, sustainability, and marketing communications emerges as a potent catalyst for advancing sustainable behavior within society. Although prior research has examined the emotional stimulations raised by dance performance, it has not systematically demonstrated the role of traditional dance as a vehicle for sustainability marketing communications. This study fills this gap by using the AIDA model (Attention, Interest, Desire, Action) as a foundation, conceptualizing dance performance elements into seven dimensions, and incorporating emotional engagement and environmental consciousness to foster sustainable behavior. Collaborating with Taiwanese dance troupe, the research produced a performance titled, ‘The New Dragon Palace Chronicle’, which focuses on the themes of destruction and preservation of underwater life, enriched with cultural and sustainability symbolism. The hypothesis were tested on a sample of 315 Taiwanese audience who watching the performance. The results confirmed that the seven dimensions of the dance elements have substantial validity and reliability, significantly drawing the attention of the audience as preliminary stage of awareness. This attention fosters emotional engagement and amplified environmental consciousness and significantly influences interest, desire, and ultimately, sustainable behavior action. The findings underscore the vital role of dance art performance in nurturing actions that contribute to social sustainability.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

Suitable soil structure and nutrient security are important for plant growth and development, characteristics of soil fractal dimension and distribution of physical and chemical properties and their interactions play an important role in studying the stability of soil structure and water and fertilizer cycles. As a sustainable management model, intercropping has positive benefits for erosion control, spatial optimization of resources, as well as improving system productivity. The effects of four intercropping methods on soil fractal dimension and physicochemical properties were investigated by intercropping Salvia miltiorrhiza with forage and S. miltiorrhiza with forest under typical karst rock desertification habitats in Guizhou. The results showed that soil nutrient content of intercropping was significantly higher than that of monoculture, the organic carbon content of soil grown under forest is higher than other treatments, and there was a non-significant change in soil water content of intercropping compared with monoculture. The soil fine-grained matter of intercropping was significantly higher than that of monoculture, while the soil fractal dimension showed a tendency to become larger with the increase of fine-grained matter. The intercropping planting, due to its component types and spatial and temporal configurations, leads to differences in soil water and fertilizer interactions, which can be combined with other ecological restoration measures to optimize the composite model and jointly promote the restoration and development of ecologically fragile areas.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

Background: Colorectal cancer (CRC) patients experienced multiple chemotoxicity affecting treatment compliance, survival, and quality of life (QOL). Prior research shows clinician-reported chemotoxicity (i.e., grading scales or diagnostic codes) predicts rehospitalization and cancer survival. However, a comprehensive synthesis of clinician-reported chemotoxicity is still lacking. Objectives: We conducted a systematic review and meta-analysis to determine the chemotoxicity's prevalence and risk factors in CRC. Methods: A systematic search from 2009 to 2024 yielded 30 studies for review, with 25 included in the meta-analysis. Results: Pooled prevalences of overall, non-hematological, and hematological moderate-to-severe toxicities were 45.7%, 39.2%, and 25.3%, respectively. The most common clinician-reported chemotoxicities were gastrointestinal (GI) toxicity (22.9%) and neuropathy or neutropenia (17.9%). Significant risk factors at baseline were malnutritional status, frailty, impaired immune or hepato-renal functions, short telomere lengths, low gut lactobacillus levels, age, female sex, aggressive chemotherapy, and low QOL. Age was associated with neutropenia (β: -1.44) and GI toxicity (β:1.85) (Ps 65 y.o.) had higher prevalences of overall (OR: 1.14) and GI (OR: 1.65) toxicities, but a lower prevalence of neutropenia (OR: 0.65) than younger adults (Ps

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

Dengue hemorrhagic fever is an arboviral infectious disease that has occurred frequently as an extraordinary event due to its fast spread and lethal potential in Indonesia. The vector Aedes aegypti is sensitive to climate variability. This study determines the relationship between climate variability and dengue hemorrhagic fever in Surabaya, East Java, Indonesia from 2009 to 2017. This study used the monthly dengue hemorrhagic fever incidence obtained from the Surabaya Health Office and the monthly climate variability parameters (average temperature, rainfall, humidity) obtained from the Indonesian Agency for Meteorology, Climatology and Geophysics and website www.worldweatheronline.com. Data analysis was done using One-Sample Kolmogorov Smirnov Test and Spearman non-parametric correlation test. The results showed a correlation between all three climate variability parameters with dengue hemorrhagic fever incidence (average temperature p<0.05, r=-0.603; rainfall p<0.05, r=0.407; humidity p<0.05, r=0.7). Average temperature is negatively correlated to dengue hemorrhagic fever incidence, while rainfall and humidity are positively correlated to dengue hemorrhagic fever incidence. This study shows preliminary evidence on the correlation of climate variability and dengue hemorrhagic fever in Surabaya, East Java, Indonesia.

Dengue hemorrhagic fever is an arboviral infectious disease that has occurred frequently as an extraordinary event due to its fast spread and lethal potential in Indonesia. The vector Aedes aegypti is sensitive to climate variability. This study determines the relationship between climate variability and dengue hemorrhagic fever in Surabaya, East Java, Indonesia from 2009 to 2017. This study used the monthly dengue hemorrhagic fever incidence obtained from the Surabaya Health Office and the monthly climate variability parameters (average temperature, rainfall, humidity) obtained from the Indonesian Agency for Meteorology, Climatology and Geophysics and website www.worldweatheronline.com. Data analysis was done using One-Sample Kolmogorov Smirnov Test and Spearman non-parametric correlation test. The results showed a correlation between all three climate variability parameters with dengue hemorrhagic fever incidence (average temperature p<0.05, r=-0.603; rainfall p<0.05, r=0.407; humidity p<0.05, r=0.7). Average temperature is negatively correlated to dengue hemorrhagic fever incidence, while rainfall and humidity are positively correlated to dengue hemorrhagic fever incidence. This study shows preliminary evidence on the correlation of climate variability and dengue hemorrhagic fever in Surabaya, East Java, Indonesia.

This paper uses the spatial analysis software GeoDa as a tool, takes GRP (Gross regional product) of Sichuan Province in 2012 and 2018 as the dependent variable, and takes the city (autonomous prefecture) factor-driven, investment-driven and innovation-driven indicators as the dependent variable to explore the impact of innovation activities on regional economic development and the spatial distribution characteristics of regional economy. Through the comparison of the global correlation and local correlation, this paper explores the crux of the regional economic polarization and unbalanced development, and puts forward some measures to solve the existing economic development problems, such as cultivating and improving the regional industrial dependence, accelerating the regional transportation accessibility and convenience, and constructing the regional collaborative innovation system, So as to achieve the strategic goal of the construction of innovative Province in Sichuan Province.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

A novel and highly pathogenic coronavirus (2019-nCoV)-induced pneumonia spread worldwide in a short time. However, studies on the effects of 2019-nCoV on the male reproductive system are limited. The aim of this study is to describe the clinical characteristics of the male reproductive system of COVID-19 patients and to explore the presence of 2019-nCoV in semen. Retrospective, single-center case series of 112 male patients with confirmed COVID-19 who were admitted to Renmin Hospital of Wuhan University from January 2 to March 7, 2020. Demographic data, symptoms and signs related to the male reproductive system, throat swabs and semen samples were collected and analyzed. 2019-nCoV RNA measured in throat swab and semen samples. The organ distribution of ACE2 mRNA and protein in human tissue on The Human Protein Atlas portal and investigated immunohistochemistry (IHC) images of the testis. The HPA dataset revealed relatively high levels of ACE2 protein and RNA expression in the testis. A total of 3 severe COVID-19 patients (2.7%) presented with orchidoptosis, while no patients experienced other symptoms or signs related to the male reproductive system. The analysis of 2019-nCoV RNA in semen included 17 patients with fertility needs. Among these patients, 9 (52.9%) remained positive for 2019-nCoV according to throat swab analysis, and 8 (47.1%) became negative. In the semen 2019-nCoV analysis, all 17 patients were negative for the N gene and ORF1ab gene. In view of the potential impairment, long-term follow-up for male COVID-19 patients with fertility needs is of great significance.

Tracked vehicles play a vital role in accessing challenging terrains, offering stability, traction, and versatility for various applications, including deep-sea exploration. However, the seafloor and sediment contain valuable but poorly understood resources, making it a significant challenge for tracked vehicles during exploration. Consequently, it is imperative to conduct comprehensive studies before considering these terrains for off-road purposes. In this study, we developed a rigid, flexible track vehicle equipped with various sensors, focusing on monitoring pressure sinkage. Cohesive soils like Bentonite and Diatom soil, particularly when combined with sand and gravel mixtures, were used for the investigation and assessed for ground pressure, bearing capacity, and sinkage in rigid-flexible tracked vehicles on these characterized terrains under varying moisture conditions. Our findings indicated that increased moisture content in bentonite soil resulted in significantly higher track slippage and sinkage compared to diatomaceous earth soil. Regarding soil behavior, diatom soil exhibited notable compaction and sinkage characteristics compared to bentonite soil. These significant variations between these two soil types under changing moisture conditions highlight the complexity of such terrains. Therefore, understanding the soil and its physical properties is crucial before applying them to natural terrains. Furthermore, this study emphasizes the importance of precision in assessing the physical properties of natural terrains for the development of tracked vehicles for off-road exploration. This knowledge contributes to better vehicle design and a deeper comprehension of terrain mechanics.

The rapid spread of the coronavirus disease 2019 (COVID-19) is a serious threat to public health systems globally and is subsequently, a cause of anxiety and panic within human society. Understanding the mechanisms and reducing the chances of having severe symptoms from COVID-19 will play an essential role in treating the disease, and become an urgent task to calm the panic. However, the COVID-19 test developed to identify virus carriers is unable to predict symptom development in individuals upon infection. Experiences from other plagues in human history and COVID-19 statistics suggest that genetic factors may determine the compliance with the virus, i.e., severe, mild, and asymptomatic. Here, a hypothesis is put forward based on the epidemiological characteristics and traits of COVID-19, and our gene expression analysis. It proposes that COVID-19 inactivation in the blood by blocking virus entry into other internal organs for reproduction through the blood circulation after lung cell invasion prevents severe symptoms. Additionally, we investigated a genetic connection between candidate genes and severe COVID-19 symptoms through the utilization of strategies combining hypothesis and data-driven approaches. A list of genes and important SNPs that require further investigation to aid the screening of individuals who may suffer severe illness if exposed to the virus is present. Those individuals should be intensively safeguarded and prioritised for treatment. Concurrently to further research on the COVID-19 pathogenesis, our results also offer a new research strategy for pandemic prevention and health maintenance.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

In the field of engineering, tracked vehicles play a significant role in accessing challenging terrains. Maintaining trafficability is of the utmost importance when it comes to tracked vehicles traversing rugged terrains; it provides stability, traction, and adaptability for a wide range of applications, including deep-sea exploration. The terrain characteristics pertain to the interactions that determine the mobility of tracked vehicles. Traditional Terramechanics models are in-adequate in depicting the correlation between tracks and soil. An important issue is the lack of consideration for the moisture content in the soil and the rate at which sinking occurs in these models. Examining sinkage speed helps describe the ability of tracked vehicles to move at high speeds. The focus is on the critical factors influencing the mobility of tracked vehicles, precisely the sinkage speed and its relationship with pressure. Experimental tests in a soil bin, utilizing Bentonite/Diatom sediment soil, aim to measure these terrain factors. The study introduces a rubber-tracked vehicle, pressure, and moisture sensors to monitor pressure sinkage and moisture, evaluating cohesive soils (Bentonite/Diatom) in combination with sand and gravel mixtures. Findings reveal that higher moisture content in Bentonite soil leads to increased track slippage and sinkage compared to Diatom soil. Regarding soil behavior, diatom soil exhibited notable compaction and sinkage characteristics in contrast to bentonite soil. The distinct behaviors of these soils underscore the complexity of terrains, emphasizing the need for a meticulous understanding of soil properties before applying them in natural environments. Furthermore, this study contributes precision in assessing natural terrains, enhancing tracked vehicle design, and advancing terrain mechanics comprehension for off-road exploration. This knowledge contributes to better vehicle design and a deeper comprehension of terrain mechanics.

In this work, a series of compounds in the CaO-½Er2O3-CoOz ternary oxide system were synthesized in air at 885℃ using high temperature solid-phase synthesis method. Phase boundary of each solid solution region in the CaO-½Er2O3-CoOz system was determined by X-ray powder diffraction technique. The phase diagram of the CaO-½Er2O3-CoOz system at 885℃ includes three series of ternary oxide solid solutions : (Ca3-xErx)Co4O9-z (0≤x≤0.9), (Ca3-xErx)Co2O6-z (0≤x≤1.25) and (Er1-xCax)CoO3-z (0≤x≤0.33). Four three-phase regions and five solid solution tie-line regions were obtained. The structure of perovskite solid solution (Ca3-xErx)Co2O6-z has been analyzed by Rietveld refinements. With the increase of Er content, the cell parameters of (Ca3-xErx)Co2O6-z exhibit an decreasing trend in a and b directions and an increasing trend in c direction.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

The traditional receiver employs scalar tracking loops, resulting in degraded navigation performance in weak signal and high dynamic scenarios. An innovative design of a vector tracking receiver based on nonlinear Kalman filter (KF) tracking loops is proposed in this paper, which combines the strengths of both vector tracking and KF tracking loops. Firstly, a comprehensive description of the vector tracking receiver model is presented, and unscented Kalman filter (UKF) is applied to nonlinear tracking loop. Secondly, to enhance the stability and robustness of the KF tracking loop, we introduce square root filtering and an adaptive mechanism. The tracking loop based on square root UKF (SRUKF) can dynamically adjust its filtering parameters based on signal noise and feedback Doppler error. Finally, the proposed method is implemented on a software-defined receiver (SDR), and the field vehicle experiment demonstrates the superiority of this method over other receivers in complex dynamic environments.

In this paper, we propose a method for the generation of simulation test scenarios for autonomous driving. Based on the requirements of standard regulatory test scenarios, we can generate virtual simulation scenarios and functional scenario libraries for autonomous driving, which can be used for simulation verification of different ADAS functions. Firstly, the design operation domain (ODD) of the functional scenario is selected and the weight values of the ODD elements taken are calculated; then a combination test algorithm based on parameter weights is improved to generate autonomous driving virtual simulation test cases for the ODD elements, which can effectively reduce the number of generated test cases compared with the traditional combination test algorithm; then the traffic participant elements under each test case are Then, the values of the subelements under the traffic participant element in each test case are sampled and clustered to obtain hazard specific scenarios. Finally, the specific scenarios are applied to the automatic emergency braking (AEB) system on the model-in-the-loop (MIL) testbed to verify the effectiveness of this scenario generation method.

Rapid and accurate prediction of residual stress in metal additive manufacturing processes is of great importance to guarantee the quality of the fabricated part to be used in a mission-critical application in the aerospace and automotive industries. Experimentation and numerical modeling are valuable tools for measuring and predicting the residual stress; however, to-date conducting experimentation and numerical modeling is expensive and time-consuming. Thus, herein, a physics-based thermomechanical analytical model is proposed to predict the residual stress of the additively manufactured part rapidly and accurately. A moving point heat source approach is used to predict the temperature field by considering the effects of scan strategies, heat loss, and energy needed for solid-state phase transformation. Due to the high temperature gradient in this process, part experiences a high amount of thermal stress following solidification which may exceed the yield strength of the material. The thermal stress is obtained using Green’s function of stresses due to the point body load. The Johnson-Cook flow stress model is used to predict the yield surface of the part under repeated heating and cooling. As a result of the cyclic heating and cooling and the fact that the material is yielded, the residual stress build-up is predicted based on incremental plasticity and kinematic hardening behavior of the metal according to the property of volume invariance in plastic deformation in coupling with the equilibrium and compatibility conditions. The computational methodology is realized with the laser powder fusion of maraging steel 350 as a material of example. The validation of the predictive models has been presented in terms of the comparison of predicted and measured scan-direction and build-direction residual stress distributions along depth of build under various process parameter combinations. Moreover, for the first time, the Jonson-Cook parameters of maraging steel 350 are predicted using analytical modeling of machining forces and non-linear optimization techniques.

Current instrumental technology in evaluating performance of skin care creams is still rather limited and there are no industrial standard testing equipment, method and performance specifications for it. In this paper, we report our attempt in using an instrument called PhabrOmeter for this purpose. PhabrOmeter is a commercialized instrument for sensory performance evaluation of textiles, leather, paper and nonwoven and has been designated by American Association of Textile Chemists and Colorists (AATCC) as a standard test method for textiles, AATCC TM 202 in 2013. By adopting artificial skin samples treated with skin care creams, we have developed a procedure to apply this instrument for evaluation of skin care creams from sample preparation, measurement to data analysis and interpretation. The results using commercial skin care creams to demonstrate the feasibility and advantages of this instrument are provided.

It is demonstrated in this study that PhabrOmeter creates genuine wrinkle on fabrics comparable to that in AATCC specifications, and measures fabric wrinkle recovery values fast with repeatable and reliable results with high resolution, over wide range of fabric types. It thus provides an appealing alternative to the existing test methods that are known to be slow, insensitive and unreliable. In addition, with enormous varieties of fabrics, we used a new criterion termed fabric linear density λ so that fabrics can in general be divided into relatively homogeneous groups for further study. The calculation and application of this parameter are showed in this report.

With huge varieties of fabrics, the first challenge for any performance evaluation is to categorize the vast types of the products into fewer, more homogeneous and thus akin groups. Classification or sorting is arguably the first step of any scientific investigation, and comparison of product quality is meaningful only when conducted within a group of comparable products. A new criterion termed fabric linear density λ is first proposed in this paper so that fabrics can in general be divided into 4 groups. The derivation and validation of this parameter are provided. The importance of fabric drape is almost self-evident, but there is still no effective ways to measure this fabric attribute. The Cusick Drapemeter suffers from its low repeatability and low sensitivity, and is hence not widely or frequently used. The PhabrOmeter, along with the fabric linear density λ, is proposed and demonstrated in this study as a much more efficient alternative for fabric drape test. By actually testing 40 various fabrics, the principle, procedure and results of this method is presented in this paper.

This study aimed to identify miRNA editing sites during adipose tissue development in Ningxiang pigs and analyze their characteristics and functions. Based on the small RNA-seq data from subcutaneous adipose tissue samples of Ningxiang pigs at four stages (30, 90, 150 and 210 days), we constructed a developmental atlas of the miRNA editome in adipose tissue of Ningxiang pigs. The characteristics and functions of this editome were further explored through bioinformatics analysis. The findings revealed that a total of 505 miRNA editing sites were identified with C-to-U editing types being the most prevalent, followed by U-to-C, A-to-G and G-to-U. Importantly, these four types of miRNA editing exhibited a base preference. The number of editing sites showed obvious differences among age groups, with the highest occurrence of miRNA editing events observed at 90 days of age and the lowest at 150 days of age. In the miRNA seed region, a total of 9 miRNA editing sites were identified with significant differences in editing levels (P &lt; 0.05), and located in ssc-miR-23a, ssc-miR-27a, ssc-miR-30b-5p, ssc-miR-15a, ssc-miR-497, ssc-miR-15b, and ssc-miR-425-5p, respectively. Target gene prediction and enrichment analysis revealed that the editing of miR-497 may potentially regulate fat deposition by inhibiting adipose synthesis via influencing target binding. These results provide new insights into the regulatory mechanism of pig fat deposition.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

In this paper, an adaptive technology and the interconnection and damping assignment passivity-based control method are combined to solve the stabilization problem for underactuated mechanical systems with uncertainties (including matched and unmatched). Uncertainties include unknown friction coefficients and unknown terms in kinetic energy and potential energy. A novel adaptive interconnection and damping assignment passivity-based control scheme is proposed and an adaptive stabilization controller is designed to make the closed-loop system locally stable. Verification is conducted on the ball and beam system, taking into account uncertainties of friction coefficients, kinetic energy, and potential energy. The locally asymptotic stability is demonstrated using the LaSalle’s invariance principle and approximate linearization. The effectiveness of the proposed control law is verified through numerical simulations.

Compliant amplifying mechanisms are used widely in high-precision instruments driven by piezoelectric actuators, and the dynamic and static characteristics of these mechanisms are closely related to instrument performance. Although the majority of existing research has focused on analysis of their static characteristics, the dynamic characteristics of the mechanisms affect their response speeds directly. Therefore, this paper proposes a comprehensive theoretical model of compliant amplifying mechanisms based on the multi-body system transfer matrix method to analyze the dynamic and static characteristics of these mechanisms. The effects of the main amplifying mechanism parameters on the displacement amplification ratio and the resonance frequency are analyzed comprehensively using the control variable method. An iterative optimization algorithm is also used to obtain specific parameters that meet the design requirements. Finally, simulation analyses and experimental verification tests are performed. The results indicate the feasibility of using the proposed theoretical compliant amplifying mechanism model to describe the mechanism’s dynamic and static characteristics, which represents a significant contribution to the design and optimization of compliant amplifying mechanisms.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

It is important to realize the transformation behavior of wüstite because it greatly affects the final structure of the oxide layer and the surface quality of the steel products. In the present study, the transformation behaviors of the wüstite layer are examined under nearly-oxygen-free conditions, to simulate the cooling processes after the hot rolled strip is coiled. As the single phase wüstite was prepared at 950˚C, the 460˚C transformed oxide layer was composed of a mixture of iron and magnetite formed through eutectoid reactions. For the 750˚C-fabricated wüstite, only magnetite was observed after transformation, without iron precipitates and residual wüstite. It is speculated that the unusual transformation behavior of the low-temperature-made wüstite results from the pseudo-structural intermediate phase transformation between wüstite and magnetite. This pseudo-structure is a pre-transformed wüstite and of various concentration of ferrous ion, which is determined by the fabrication conditions. During the hot strip mill process, the so-called wet scale, wüstite, is produced continuously from finish mill to laminar flow sections and ended at 570˚C. Consequently, the final eutectoid transformation below 570˚C is dominantly controlled by the surface temperature ranged from 750˚C to 950˚C for low carbon steel.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

Few-shot object detection (FSOD) aims to address the challenge of requiring a substantial amount of annotations for training in conventional object detection, which is very labor-intensive. However, existing few-shot methods achieve high precision with the sacrifice of time-consuming for exhaustive fine-tuning, or take poor performance in novel-class adaptation. We presume the major reason is that the valuable correlation feature among different categories is insufficiently exploited, hindering the generalization of knowledge from base to novel categories for object detection. In this paper, we propose Few-Shot object detection via Correlation-RPN and Transformer Encoder-Decoder (CRTED), a novel training network to learn object-relevant features of inter-class correlation and intra-class compactness while suppressing object-agnostic features in the background with limited annotated samples. And we also introduce a 4-way tuple-contrast training strategy to positively activate the training progress of our object detector. Experiments over two few-shot benchmarks (Pascal VOC, MS-COCO) demonstrate that, our proposed CRTED without further fine-tuning can achieve comparable performance with current state-of-the-art fine-tuned works. The codes and pre-trained models will be released.

To address the problems of insufficient semantic fusion between text and questions and the lack of consideration of global semantic information encountered in machine reading comprehension models, we proposed a machine reading comprehension model called BERT_hybrid based on BERT and hybrid attention mechanism. In this model, BERT is utilized to separately map the text and questions into the feature space. Through the integration of Bi-LSTM, attention mechanism, and self-attention mechanism, the proposed model achieves comprehensive semantic fusion between text and questions. The probabilities distribution of answers is computed using Softmax. Experimental results on the public dataset DuReader demonstrate that the proposed model achieves improvements in BLEU-4 and ROUGE-L scores compared to existing models. Furthermore, to validate the effectiveness of the proposed model design, we analyze the factors influencing the model’s performance.

The recent outbreak of coronavirus disease 2019 caused by the new coronavirus, SARS-CoV-2, has become an international emergency. Since there is no effective therapy for the treatment of this disease, drugs or vaccine that can prevent or cure the SARS-CoV-2 infection are urgently needed. The viral 3-chymotrypsin-like cysteine protease (3CLpro), which plays a key role in the replication of coronavirus, is a potential drug target for the development of anti-SARS-CoV-2 drugs. With the crystal structure of 3CLpro, we performed virtual screening from a small chemical library of a Traditional Chinese Medicine recipe- FuFang Zhenzhu Tiaozhi (FTZ). Five compounds with the best scores were screened and could be considered as potential hit compounds to be investigated further with bioassays for their anti-virus effects.

We have previously discussed the pathological characteristics, clinical characteristics, detection methods, pathogenesis, and treatment of Epstein–Barr virus (EBV)-positive gastric cancer, but we have not discussed the unique immune microenvironment in EBV-positive gastric cancer. Here, we reviewed studies on the immune microenvironment in EBV-positive gastric cancer and found that CD8+ T lymphocytes and a small number of CD204+ macrophages infiltrate the immune microenvironment in EBV-positive gastric cancer. Moreover, immune checkpoints, such as IDO1 and PD-L1, are expressed at high levels in EBV-positive gastric cancer. Lastly, we also analyzed the mechanisms underlying the formation of the immune microenvironment in EBV-positive gastric cancer. Our findings and conclusions have significance in clinical guidance and provide research direction for basic experiments.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

Gibberella ear rot (GER) caused by Fusarium graminearum (teleomorph Gibberella zeae) is one of the most destructive diseases in maize that severely reduces grain yield and contaminates several potential mycotoxins. However, few efforts had been devoted to dissect the genetic basis of maize GER resistance. In the present study, a genome-wide association study (GWAS) was conducted in a maize association panel consisting of 303 diverse inbred lines. The phenotypes of GER severity were evaluated using kernel bioassay across multiple time points in the laboratory. Then, three models including fixed and random model circulating probability unification model (FarmCPU), general linear model (GLM) and mixed linear model (MLM), were conducted simultaneously in GWAS to identify single-nucleotide polymorphisms (SNPs) significantly associated with GER resistance. A total of four individual significant association SNPs with the phenotypic variation explained (PVE) ranging from 3.51 to 6.42% were obtained. Interestingly, the peak SNP (PUT-163a-71443302-3341) with the greatest PVE value, was co-localized in all models. Subsequently, 12 putative genes were captured from the peak SNP that several of these genes were directly or indirectly involved in disease resistance. Overall, these findings contribute to understand the complex plant-pathogen interactions in maize GER resistance. The regions and genes identified herein provide a list of candidate targets for further investigation, in addition to the kernel bioassay that can be used for evaluating and selecting elite germplasm resources with GER resistance in maize.

Climate and its fluctuations have wide-ranging impacts on the tourism industry. High temperatures, as a typical meteorological and climatic factor, influence tourists' travel intentions and spatial behavior. This study conducted a descriptive analysis and market trend analysis of Chinese tourism during periods of high temperatures, revealing several key findings. Firstly, tourists seeking respite from summer heat exhibit a preference for short-distance trips and resource-rich destinations. Secondly, heat-escape tourism products undergo changes over time, gradually shifting towards mountainous areas and waterfront locations. Furthermore, taking Shanghai Disneyland as a case study demonstrates that the holiday system holds greater significance than temperature constraints. Despite experiencing a significant decline in the quality of their tourist experience in high-temperature environments, long-distance travelers are not deterred from choosing pre-booked tourism products by sudden bouts of hot weather.

The Internet's core network, crucial for key services, lacks a clear definition, hindering Internet development and security research. This study analyzes important Autonomous Systems (ASes) and proposes a rule-filtering, top-down method to infer the Internet's core network. It identifies two core memberships: Tier-1 ASes and Regional Tier-1 ASes. Despite a gap, Regional Tier-1 ASes show potential to join the core. Our proposed core structure, unlike traditional methods that randomly select TOP-K nodes, offers improved rationality and interpretability. Historical data analysis reveals the Internet's core structure as a tightly interconnected network of large provider ASes. Despite some changes, this structure shows remarkable stability and growing influence, potentially encouraging other ASes to establish direct connections with the core ASes, accelerating the trend towards a flattened Internet structure. Furthermore, the core structure may be evolving from a majority to a more minority-centric structure.

Electric heating and solid thermal storage system (EHSTSS) is widely used in district clean heating and the flexibility adjustment of combined heat and power (CHP) unit. It has been an effective way to absorb renewable energy. Aiming at the thermal design calculation and experimental verification of EHSTSS, the thermal calculation and the heat transfer characteristics of the EHSTSS are investigated in this paper. Firstly, a thermal calculation method for the EHSTSS is proposed in the paper. The calculation flow and calculation method for key parameters of heating system, heat storage system, heat exchange system and fan-circulating system in the EHSTSS are studied. Then, the instantaneous heat transfer characteristics of the thermal storage system (TSS) in the EHSTSS are analyzed, and the heat transfer process of ESS is simulated by FLUENT software. The uniform temperature distribution in the heat storage and release process of the TSS verifies the good heat transfer characteristics of the EHSTSS. Finally, EHSTSS test verification platform is built, and the historical operation data of the EHSTSS is analyzed. During the heating and release thermal process, the maximum temperature standard deviation of each temperature measurement point is 28.3℃ and 59℃respectively. The correctness of the thermal calculation of the EHSTSS is verified.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Civic engagement refers to the ways in which citizens participate in the life of a community to help shape its future or improve conditions for others. While it might have been shaped by the COVID-19 pandemic recovery, this study explored how college students perceive civic engagement on selected campuses that were partially locked down. We sampled 1036 student volunteers from six universities in Taiwan by using a self-designed module of civic engagement and transferable capabilities. The Student’s t-test, ANOVA, regression, factor analysis, and structural equation modeling (SEM) were used to interpret the differences and relationships among these variables. This study provides a more detailed example of the current status of civic engagement and its relative to transferable capabilities in a higher education setting. The related programs and institutes should take responsibility for enhancing students’ civic engagement and transferable capabilities during the pandemic. How to ameliorate the situation? The findings suggest that it should consider a student’s academic major, learning experiences in the department, and time spent on related activities during the pandemic recovery. The findings might prove useful to various campuses for enhancing ongoing practices.

To date, viral RNA detection is almost the only way to confirm SARS-CoV-2infectionin practice.However, variousreasons can cause low sensitivity for RNA detection, and thisposes aserious challenge to disease control. We tested the performance of detecting total antibody(Ab) and IgM levels in serum by the methods of chemiluminescence, enzyme-linked immunosorbent assay (ELISA), and colloidal golddetection. The datashowed that the sensitivity and specificity for detecting total Ab and IgM levels were high by all three methods, and the sensitivity was higher for detecting total Ab than for detecting IgM. Evidence from studieshas shown thatviral RNA testingcombinedwith serological testing could increase the diagnostic sensitivity while maintaining a high specificity. Specific serology testsfor SARS-CoV-2 havegreat value for clinical practice and public health.

The latest emergence of a novel coronavirus (COVID-19) had caused an outbreak of respiratory virus infections in Wuhan, China, and other countries so that the world health organization (WHO) declared the COVID-19 epidemic as a Public Health Emergency of International Concern (PHEIC) on January 31, 2020. At present, it is the fact that we have identified the bats as the host, the route of respiratory droplets, contact, and aerosol can accelerate the transmission from person to person. However, it is not well known about the intermediator and other approaches. Identifying and characterizing the origin and host(s) of COVID-19 can help us to evaluate the potential risk of COVID-19 for transmission among humans or cross-species.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.