This is the first study to provide a systematic monetary benefit matrix, including greenhouse gas (GHG) emissions reduction benefits and air pollution reduction health co-benefits, for a change in on-the-road transport to low-carbon types. The benefit transfer method is employed to estimate the social cost of carbon and the health co-benefits via impact pathway analysis in Taiwan. Specifically, the total emissions reduction benefits from changing all internal combustion vehicles to either hybrid electric vehicles, plug-in hybrid electric vehicles, or electric vehicles would generate an average of US$760 million from GHG emissions reduction and US$2,091 million from health co-benefits based on air pollution reduction, for a total benefit of US$2,851 million annually. For a change from combustion scooters to light- or heavy-duty electric scooters, the average GHG emissions reduction benefits would be US$96.02 million, and the health co-benefits from air pollution reduction would be US$1,008.83 million, for total benefits of US$1,104.85 million annually.

This is the first study to comprehensively evaluate the benefit of urban open spaces and cropland with different adjacent public facilities seen as locally undesirable (“not in my backyard,” NIMBY) or desirable (“yes in my backyard,” YIMBY). The total benefit increases or decreases for urban open space and cropland with adjacent NIMBY or YIMBY facilities in a municipality in Taiwan. The results show that for the city as a whole, the current arrangement of NIMBY and YIMBY in different zones decreases the total benefit of urban open spaces in highly urbanized zones and increases the total damage to cropland in extremely rural zones. This indicates a need to avoid further installing NIMBY or YIMBY facilities in already occupied urban open spaces. The results also demonstrate that locating NIMBY or YIMBY facilities near cropland fails to highlight the benefit of YIMBY facilities and magnifies opposition to NIMBY facilities. For individual housing units, the total damage is 1.87% of the average housing price for cropland-type open space with adjacent NIMBY or YIMBY facilities, and the total benefit is 7.43% of the average housing price for urban-type open space in a highly urbanized area. In contrast, the total benefit for open space with adjacent NIMBY or YIMBY facilities is a 2.95%-13.80% increase in the average housing price for areas with mixed urban open space and cropland.

In the study of rough sets, there are many covering approximation spaces, how to classify covering approximation spaces has become a hot issue. In this paper, we propose concepts covering approximation $T_{1}$-space, $F-$symmtry, covering rough continuous mapping, covering rough homeomorphism mapping to solve this question. We also propose a new method for constructing topology in Theorem 5.1, and get the following properties: (1) For each $x\in U$, $\{X_{i}:i\in I\}\subseteq \mathcal{P}(U)$ is all the subsets of $U$ which contains $x$ and $*$ is a reflexive relation on $U$. If $V\in \tau$ is a subset of $U$ and $x\in V$, then $\underline{*}(\bigcap \limits_{i\in I}X_{i})$ is the smallest subset of $U$ and $x \in \underline{*}(\bigcap \limits_{i\in I}X_{i})\subseteq V$. Denoted by $C(x)=\bigcap \{\underline{*}(X_{i}):x\in \underline{*}(X_{i}),i\in I\}$. (2)If $V\in \tau$ is a subset of $U$, then $V =$ $\bigcup \limits_{x\in V} C(x)$. (3) Let $\{\underline{*}(X_{i}):x\notin \underline{*}(X_{i}), i\in I\}$, then $\overline{\{x\}}$ $=$ $U \setminus \bigcup \limits_{x\notin \underline{*}(X_{i}), i\in I}\underline{*}(X_{i})$; (4) Let $*$ be a reflexive relation on $U$. For every $X\subseteq U$, we have $int(\underline{*}(X))=\underline{*}(X)$. Where $int(\underline{*}(X))$ represents the interior of $\underline{*}(X)$. (5) Let $\{\underline{*}(X_{i}):x\in \underline{*}(X_{i}),i\in I\}$ be a family subsets of $U$, then $\{\underline{*}(X_{i}):x\in \underline{*}(X_{i}),i\in I\}$ is a base for $(U,\tau)$ at the point $x$. \\

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

The universal health insurance system in Taiwan was formed with good intentions to help vulnerable groups. However, the possibility of bankrupting the system due to wasted medical resources. In this study, using the medical expenditures of the Taiwanese Government and gross domestic product (GDP) as variables, the wavelet analysis method was used to empirically study the correlations and leading-lagging relationships in quarterly data in the period from 1996 to 2016. In addition, the dependent population of the insured was used as the control variable. This population had no income and had high medical demands. Results: After the dependent population was included as a control variable, there was a period of low-frequency (one to four years short-term) linkage correlation, as well as a period of high-frequency (four to eight years long-term) linkage correlation. In addition, for more than eight years, there was also a high degree of linkage correlation, indicating that the linkage between medical expenditures and GDP occurred over the long term. Moreover, since medical expenditures positively affected GDP, one-way causality was observed. However, after 2008, regardless of whether a long or short term was examined, there was almost no linkage correlation. Before 2008, the medical expenditures of the government were positively correlated with economic growth; i.e., they enhanced economic growth. But, after 2008, this effect had already disappeared. The universal health insurance system has long been denounced as a waste of medical resources, and the waste must be immediately stopped. The government urgently needs to find a new solution.

In this paper, we propose a new covering-based set in which the lower and the upper approximation operations are defined by neighborhood systems. We discuss this new type of covering-based set systematically in two steps. First, we study the basic properties of this covering-based set, such as the properties of normality, contraction, and monotone. Second, we discuss the relationship between the new type of covering-based set and the other ten sets proposed.

In this paper, we propose a new covering-based set in which the lower and the upper approximation operation are defined by neighborhood systems. We discuss this new type of covering-based set systematically in two steps. First, we study the basic properties of this covering-based set, such as the properties of normality, contraction, and monotone. Second, we discuss the relationship between the new type of covering-based set and the other ten sets proposed.

The purposes of this study are based upon the theory of planned behavior (TPB) to examine the impact of past experiences of contract farming on selecting a specific type of contract farming in the future and then compare different psychological factors in the TPB for different potential contract farmer statuses. These statuses include homesteaders, farmers from cooperative farms, farmers from production and sales teams, professional farmers, and brokers. The impact of factors in the TPB for a particular contract type on potential contract farmers is further to compute. To this end, data are collected in three major sweet potato production areas in Taiwan. The results show that the farmers’ past contract farming experience does not influence the selection of the contract in the future. As for the selection of contract type, strengthening the perception and motivating the behavioral intention of contract farming for cooperative farms will increase the probability of selecting an unclassified sweet potato size contract. On the other hand, enhancing perceived behavioral control factors and behavioral intention factors for professional farmers and brokers is apt to have a relatively high probability of selecting those types involving the highest amount or the best price to obtain the best deal.

In hepatocellular carcinoma (HCC), recurrence usually occurs after curative surgical resection. Currently, no approved adjuvant therapy has been shown to reduce recurrence rates. In this report, the in vivo mouse effect of sequential combination treatment with recombinant mouse interferon-alpha (rmIFN-α) and an anti-mouse-PD1 antibody on hepatitis B virus (HBV) clearance was evaluated. A phase I clinical trial was then conducted to assess the safety, tolerability, and inhibitory activity of sequential therapy with ropeginterferon alfa-2b and nivolumab in HCC recurrence in patients who have undergone curative surgery for HBV-related HCC. In animal modeling, HBV suppression was significantly greater with rmIFN-α and anti-PD1 sequential combination treatment than with their treatment alone. In the Phase I study, eleven patients completed the sequential therapy with ropeginterferon alfa-2b every two weeks at the dose of 450 µg for six doses, followed by three doses of nivolumab every two weeks up to 0.75 mg/kg. A notable decrease or clearance of HBV surface antigen was observed in two patients. Dose-limiting toxicity of grade 3 alanine transaminase and aspartate aminotransferase increases was observed in one patient. The maximum tolerated dose was determined. Currently no HCC recurrence has been observed. The treatment modality was well tolerated. The data support further clinical development of sequential combination therapy as a post-surgery prophylactic measure against the recurrence of HBV-related HCC.

Although oncolytic viruses are currently being evaluated for cancer treatment in clinical trials, systemic administration is hindered by many factors that prevent them from reaching the tumor cells. When administered systemically, mesenchymal stem cells (MSCs) target tumors, and therefore constitute good cell carriers for oncolytic viruses. Methods: MSCs were primed with trichostatin A under hypoxia, which upregulated the expression of CXCR4, a chemokine receptor involved in tumor tropism, and coxsackievirus and adenovirus receptor that plays an important role in adenoviral infection. After priming, MSCs were loaded with conditionally replicative adenovirus that exhibits limited proliferation in cells with a functional p53 pathway and encodes Escherichia coli nitroreductase (NTR) enzymes (CRAdNTR) for targeting tumor cells. Results: Primed MSCs increased tumor tropism and susceptibility to adenoviral infection, and successfully protected CRAdNTR from neutralization by anti-Adenovirus antibodies both in vitro and in vivo, and specifically targeted p53-deficient colorectal tumors when infused intravenously. Analyses of deproteinized tissues by UPLC-MS/QTOF revealed that these MSCs converted the co-administered prodrug CB1954 into cytotoxic metabolites, such as 4-hydroxylamine and 2-amine, inducing oncolysis and tumor growth inhibition without being toxic for the host vital organs. Conclusion: This study shows that the combination of oncolytic viruses delivered by MSCs with the activation of prodrugs is a new cancer treatment strategy that provides a new approach for the development of oncolytic viral therapy for various cancers.

The mutton sheep breeding industry has transformed significantly in recent years, from traditional grassland free-range farming to a more intelligent approach. As a result, automated sheep face recognition systems have become vital to modern breeding practices and have gradually replaced ear tagging and other manual tracking techniques. Although sheep face datasets have been introduced in previous studies, they have often involved pose or background restrictions (e.g., fixing of the subject’s head, cleaning of the face), which restrict data collection and have limited the size of available sample sets. As a result, a comprehensive benchmark designed exclusively for the evaluation of individual sheep recognition algorithms is lacking. To address this issue, this study develops a large-scale benchmark dataset, Sheepface-107, comprised of 5,350 images acquired from 107 different subjects. Images were collected from each sheep at multiple angles, including front and back views, in a diverse collection that provides a more comprehensive representation of facial features. In addition to the dataset, an assessment protocol is developed by applying multiple evaluation metrics to the results produced by three different deep learning models: VGG16, GoogLeNet, and ResNet50, which achieved F1-scores of 83.79%, 89.11%, and 93.44%, respectively. A statistical analysis of each algorithm suggested that accuracy and the number of parameters were the most informative metrics for use in evaluating recognition performance.

The central goal of few-shot scene classification is to learn a model that can generalize well to a novel scene category (UNSEEN) from only one or a few labeled examples. Recent works in the remote sensing (RS) community tackle this challenge by developing algorithms in a meta-learning manner. However, most prior approaches have either focused on rapidly optimizing a meta-learner or aimed at finding good similarity metrics while overlooking the embedding power. Here we propose a novel Task-Adaptive Embedding Learning (TAEL) framework that complements the existing methods by giving full play to feature embedding’s dual roles in few-shot scene classification - representing images and constructing classifiers in the embedding space. First, we design a lightweight network that enriches the diversity and expressive capacity of embeddings by dynamically fusing information from multiple kernels. Second, we present a task-adaptive strategy that helps to generate more discriminative representations by transforming the universal embeddings into task-specific embeddings via a self-attention mechanism. We evaluate our model in the standard few-shot learning setting on two challenging datasets: NWPU-RESISC4 and RSD46-WHU. Experimental results demonstrate that, on all tasks, our method achieves state-of-the-art performance by a significant margin.

China is a large agricultural country that produces a large amount of crop straw every year. Thus, the development of cost-effective and economic application of invasive plants is warranted. Biochars derived from crop straw has been proven to be promising for adsorbent materials. However, less studies have focused on biochar derived from different types of crop straw as adsorbent under the same conditions to compare their adsorption performance. Here, we characterized the five biochars in the same system (600 ℃). In results, GBC has higher ash content, pH, CEC, specific surface area, mineral composition and oxygen-containing functional groups. The adsorption kinetics can be explained adequately by pseudo-second-order model and Langmuir model, indicating that the adsorption behavior of the biochar is both physical adsorption and chemical adsorption, the adsorption process includes complexation reaction, cationic π bond, ion precipitation and electrostatic adsorption. In conclusion, GBC exhibited higher metal equilibrium adsorption capacities (125 mg·g-1 for Pb2+, 29 mg·g-1 for Cd2+). The solution pH, biochar dosing, pyrolysis temperature and the properties of these heavy metals were responsible for adsorption capacity, thus showing stronger affinity and better adsorption effect. Our results are important for the selection and utilization of plant-based biochar for different heavy metals.

The cross-linkable PCL-PEG analogues block-graft copolymer was designed and synthesized, which with the copolymer of the MEO₂MA and OEGMA as graft chains to improve the mPEG-b-PCL-b-mPEG copolymer the aqueous solution properties. And successfully prepared two hydrogels via a copper-catalyzed 1, 3-dipolar azide-alkyne cycloaddition reaction of alkyne-terminated poly[glycidyl methacrylate-co-2-(2-methoxyethoxy) ethyl methacrylate-co-oligo (ethylene glycol) methacrylate] [P(GMA-co-MEO₂MA-co-OEGMA)] with azide end-functionalized PCL-PEG analogues block-graft copolymer, and tetrakis (2-propynyloxymethyl) -methane (TPOM) and with azide end-functionalized PCL-PEG analogues block-graft copolymer. The copolymer's chemical structure was characterized by proton nuclear magnetic resonance spectroscopy and fourier transform infrared spectroscopy. The molecular weights of the copolymers were decided with gel permeation chromatography. The water solubility and temperature sensitivity of the copolymers were studied by taking digital photos and transmittance change measured by UV spectrophotometer at different temperatures. Fluorescence probes, surface tension, dynamic light scattering and transmission electron microscopy were used to analyze the micelles that copolymers self-assembly in aqueous solution. The sol-gel behavior of copolymer solutions at high concentrations was explored by vial inversion experiments. Finally, the network structure of the gels was observed by scanning electron microscopy. These conclusions indicate that these hydrogels are expected to be used as a new material in the field of biomedicine.

Bamboo plastic composites have become a hot research topic and a key focus of research. However, the many strong, polar, hydrophilic hydroxyl groups in bamboo flour (BF) results in poor interfacial compatibility between BF and hydrophobic polymers. Maleic anhydride-esterified (MAH-e-BF) and lactic acid-esterified bamboo flour (LA-e-BF) were prepared using an in situ solid-phase esterification method with BF as the raw material and maleic anhydride or lactic acid as the esterifying agent. Fourier transform infrared spectroscopy results confirmed that BF esterification with maleic anhydride and lactic acid was successful, with the esterification degrees of MAH-e-BF and LA-e-BF at 21.04 and 14.36%%, respectively. Esterified BF was characterized by scanning electron microscopy, contact angle testing, X-ray diffractometry, and thermogravimetric analysis. The results demonstrated that esterified BF surfaces were covered with graft polymer and the surface roughness and bonding degree of MAH-e-BF clearly larger than those of LA-e-BF. The hydrophobicity of esterified BF was significantly higher than BF and the hydrophobicity of MAH-e-BF better than LA-e-BF. The crystalline structure of esterified BF showed some damage, with MAH-e-BF exhibiting a greater decrease in crystallinity than LA-e-BF. Overall, the esterification reaction improved BF thermoplasticity, with the thermoplasticity of MAH-e-BF appearing better than LA-e-BF.

Innovation is an essential key factor in the technology development history. Past research on innovation focused more on the innovation behavior of technology, but seldom described knowledge assets which also influence innovation behavior greatly. The effect of knowledge assets attribute and result on disruptive innovation is therefore regarded as the research topic in this study, where disruptive innovation is divided into outbound and inbound to combine combination-embeddednessandmajor business specificityof knowledge assets as the research model. Manufacturing enterprises in China are proceeded the questionnaire survey, and 173 valid copies are collected. The empirical analysis shows that combination-embeddedness of knowledge assets presents significantly positive effects on major business specificity and outbound innovationof an enterprise but reveals remarkably negative effects on inbound innovation. Enterprises are suggested to constantly accumulate knowledge assets with low major business specificity before disruptive innovation in order to reduce ineffective inbound innovation.

Pastes containing reduced graphene oxide (rGO) and LiCl-Mn(NO3)2·4H2O are screen-printed on a carbon cloth substrate and then calcined using a nitrogen atmospheric-pressure-plasma jet (APPJ) for conversion into rGO-LiMnOx nanocomposites. The APPJ processing time is within 300 s. RGO-LiMnOx on carbon cloth is used to sandwich H2SO4, LiCl, or Li2SO4 gel electrolytes to form hybrid supercapacitors (HSCs). The areal capacitance, energy density, and cycling stability of the HSCs are evaluated using electrochemical measurement. The Li2SO4 gel electrolyte HSC exhibits the highest areal capacitance and energy density but lower cycling stability. By contrast, the H2SO4 gel electrolyte HSC exhibits better cycling stability but lower areal capacitance and energy density.

Consumption of refined foods and beverages high in sugar make the teeth susceptible to the formation of biofilm, and lead to dental caries and diseases of the oral cavity such as periodontitis and periodontal disease. The aim of the present study was to determine the ability of selected probiotics to inhibit growth and biofilm formation by the cariogenic bacterium Streptococcus mutans in vitro. We screened strains of latic acid bacteria (LAB) (n=120) from the Bioresources Collection and Research Center (BCRC), saliva of healthy adults and infant stool. The antimicrobial activity of LAB in vitro was evaluated by agar spot culture and co-culture of the S. mutans strains. We determined the effect of heating and dilution factors (2- and 4-fold) on the antagonistic activity of LAB. Antagonistic substances in the spent culture suspensions (SCS) of LAB were precipitated by extraction with ammonium sulphate and chloroform to characterise the protein and lipophilic fractions. Results of co-culturing show that the SCS of the three LAB strains (Lactobacillus pentosus 13-1, 13-4 and Lactobacillus crispatus BCRC 14618) subjected to heat treatment showed significantly high antimicrobial activity. We found that substances produced by L. pentosus 13-4 which have the potential to exhibit antimicrobial properties might be lipophilic proteins. Additionally, we infer that the mechanism of reducing biofilm formation by Lactobacillus strains is associated with sucrose-dependent cell–cell adhesion and the gtfC level of glucosyltransferases (Gtfs) in the biofilm. Native LAB strains screened in our study may be used in chewing gums and other processed foods for preventing tooth decay.

The major histocompatibility complex (MHC) genes are the most polymorphic genes in vertebrates, and their proteins play a critical role in adaptive immunity for defense against a variety of pathogens. MHC diversity was lost in many species after experiencing a decline in size. To understand the variation and evolution of MHC genes in the Siberian ibex, Capra sibirica, which has undergone a population decline, we analyzed the variation of the second exon of MHC class II DRB genes in samples collected from five geographic localities in Xinjiang, China, that belong to three diverged mitochondrial clades. Consequently, we identified a total of 26 putative functional alleles (PFAs) with 260 bp in length from 43 individuals, and found one (for 27 individuals) to three (for 5 individuals) PFAs per individual, indicating the presence of one or two DRB loci per haploid genome. The Casi-DRB1*16 was the most frequently occurring PFA, Casi-DRB1*22 came after found in only seven individuals, 14 PFAs occurred once (7 PFAs twice), implying high frequency of rare PFAs. Interestingly, more than half of the (15) PFAs were specific to clade I, only one and three PFAs were specific to clades II and III, respectively. So, we assume that the polygamy and sextual segregation nature of this species likely contributed to the allelic diversity of DRB genes. Genetic diversity indices showed that PFAs of clade II were lower in nucleotide, amino acid, and supertype diversity compared to those of the other two clades. The way of allele sharing and FST values between three clades were to some extent in agreement with pattern observed in mitochondrial DNA divergence. In addition, recombination analyses revealed no evidence for significant signatures of recombination events. Alleles shared by clades III and the other two clades diverged 6 million years ago, and systematic neighbor grids showed cross-species polymorphisms. Together with the PAML and MEME analyses, the results indicated that the DRB gene in C. sibirica evolved under balancing and positive selection. However, by comparison, it can be clearly seen that different populations were under different selective pressures. Our results are valuable in understanding the diversity and evolution of the DRB gene in a mountain living C. sibirica and in making decisions on future long-term protection strategies.

Infectious keratitis (IK) represents a major cause of corneal blindness. This study aims to investigate the demographics, risk factors, microbiological characteristics and antibiotic susceptibility patterns of IK in Taiwan over the past 15 years. A retrospective population-based study was conducted using the Chang Gung Research Database. Patients with IK were identified by diagnostic codes for corneal ulcer from 2004 to 2019. Of 7807 included subjects, 45.2% of patients had positive corneal cultures. The proportion of contact lens-related IK declined, while that of IK related to systemic diseases grew. The percentage of isolated gram-positive bacteria surpassed that of gram-negative bacteria in the 15-year period. The prevalence of Pseudomonas aeruginosa showed a decreasing trend (p = 0.004), whereas coagulase-negative Staphylococcus (CNS) and Propionibacterium species were increasingly detected (p < 0.001). Overall, the trend of antibiotic susceptibility of both gram-positive and gram-negative bacteria did not change throughout the study period. The susceptibility to the test antibiotics maintained over 90% in gram-negative isolates during 15 years. Vancomycin preserved 100% susceptibility to all gram-positive isolates. Since most tested antibiotics exhibited stable susceptibility over decades, this study reinforced that fluoroquinolones and fortified vancomycin continue to be good empiric therapies for treating bacterial keratitis in Taiwan.

Although some alternative metrics have been proposed in classical gravity, the singularity problem remains unresolved perfectly. To satisfy the super-gravitational requirement of a black hole without singularities, we propose some possible finite-size structure to avoid the confused one. In this research, the degenerate Fermi electron gas is first used to reveal that the Fermi electron gas cannot shrink to a point regardless of how much energy it obtains; therefore, the singularity existing at the center becomes very unreasonable. To avoid these problems, a finite-size nucleus of the black hole is proposed and explained by the behaviors of the Fermi electron gas and Fermi neutron gas for this finite-size nuclear model. We construct the Kerr-Newman black hole by using a non-rotating but charged finite-size nucleus, a compact-like star, which is surrounded by counter-rotating and corotating electrons. Based on this model, the super-gravity the same as the one from a black hole is presented, and the speed of light observed at far-away places can be nonzero at the event horizon.

Adult mesenchymal stem cells (MSCs) are a promising cell source for tissue regeneration. However, ex vivo expansion results in cell senescence; cells lose their proliferation and differentiation capacity. Fetal MSCs can be an alternative due to their robust proliferation and differentiation capacities as well as immune privilege properties. Given the rejuvenation effect of decellularized extracellular matrix (dECM) on adult MSCs, it remains unknown whether dECM influences the regenerative potential of fetal stem cells. In this study, passage five fetal nucleus pulposus cells (fNPCs) and fetal synovium-derived stem cells (fSDSCs) were expanded on dECMs deposited by fNPCs (NECM) and fSDSCs (SECM) for one passage with expansion on tissue culture plastic (Plastic) as a control. We found that dECM expanded fNPCs and fSDSCs exhibited both similarities and differences in expression of stemness genes and surface markers. Expanded fNPCs yielded more differentiated pellets after chondrogenic induction but no adipogenic differentiation following adipogenic induction in both Plastic and dECM groups than the corresponding fSDSC group. Despite a significant increase in fNPCs, dECM expanded fSDSCs exhibited no increase in chondrogenic potential; however, compared to the Plastic group, dECM expanded fSDSCs exhibited a small increase in osteogenic potential and a great increase in adipogenic potential. These results suggest that fNPCs are more sensitive to NECM rejuvenation for cartilage tissue engineering and regeneration; in contrast, dECMs exhibited limited effects on fSDSC rejuvenation in chondrogenic capacity except for enhanced adipogenic capacity following expansion on SECM.

Two-dimensional (2D) transition metal dichalcogenides (TMDCs) nanosheets have shown extensive applications due to their excellent physical and chemical properties. However, the low light absorption efficiency limits their application in optoelectronics. By rolling up 2D TMDCs nanosheets, the one-dimensional (1D) TMDCs nanoscrolls are formed with spiral tubular structure, tunable interlayer spacing and opening ends. Due to their increased thickness of scroll structure, the light absorption is enhanced. Meanwhile, the rapid electron transportation is confined along the 1D structure. Therefore, the TMDCs nanoscrolls show improved optoelectronic performance compared to 2D nanosheets. In addition, the high specific surface area and active edge site from bending strain of basal plane make them promising materials for catalytic reaction. Thus, the TMDCs nanoscrolls have attracted intensive attention in recent years. In this review, the structure of TMDCs nanoscrolls is firstly demonstrated and followed by various preparation methods of the TMDCs nanoscrolls. Afterwards, the applications of TMDCs nanoscrolls in the fields of photodetection, hydrogen evolution reaction, and gas sensing are discussed.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

The high interest in N-heterocyclic platinum carbene complexes in cancer research stems from their high cytotoxicity to human cancer cells, their stability, as well as their ease of functionalization. However, the development of these new molecules as anticancer agents still faces multiple challenges, in particular solubility in aqueous media. Here, we synthesized platinum-NHC bioconjugates that combine water-solubility and cytotoxicity by using polyethyleneimine as polymer carrier. We showed that the activity of these conjugates is modulated by the size of the polymer and the overall density of metal ions onto polymer chains. They displayed an effective activity after only 45 minutes of exposure in vitro correlated with a quick uptake by the cells as shown by the use of various fluorescent-tagged derivatives.

Foliage-feeding fall armyworm (Spodoptera frugiperda) and root-feeding western corn rootworm (Diabrotica virgifera virgifera) are maize (Zea mays L.) pests that cause significant yield losses. Jasmonic acid (JA) play pivotal defense role against insects. 12-oxo-phytodienoic acid (12-OPDA) is converted into JA by peroxisome-localized OPDA reductases (OPR). However, little is known about the physiological functions of cytoplasmic OPRs. Here, we show that disruption of ZmOPR2 reduced wound-induced JA production and defense against FAW while accumulating more JA catabolites. Overexpression of ZmOPR2 in Arabidopsis enhanced JA production and defense against beet armyworm (Spodoptera exigua). In addition, lox10opr2 double mutants were more susceptible than either single mutant, suggesting that ZmOPR2 and ZmLOX10 uniquely and additively contributed to defense. In contrast to the defensive role of ZmOPR2 and ZmLOX10 in leaves, single mutants did not display any alteration in root herbivory defense against WCR. Feeding on lox10opr2 double mutants resulted in increased WCR mortality associated with greater herbivory-induced production of insecticidal death acids and ketols. Thus, ZmOPR2 and ZmLOX10 cooperatively inhibit synthesis of these metabolites during herbivory by WCR. We conclude that ZmOPR2 and ZmLOX10 regulate JA-mediated resistance in leaves against FAW while suppressing insecticidal oxylipin synthesis in roots during WCR infestation.

In this research, the other reasonable explanations for the cosmic microwave background radiation is revealed. Due to the microwave resolution, it very roughly shows the image of galaxies in the universe. Moreover, the intensity measurement on each pixel of the image is the sum of the incident microwaves from different directions, so the microwave image cannot represent the microwave sources clearly far away from the Earth. Hence, we propose a simulation after removing several strongest microwave sources, the remaining microwave radiation sources can establish a very uniform intensity distribution over a range of several ten light years. On the other hand, Sloan Digital Sky Survey reveals 200 million galaxies in the universe and, in fact, only to eliminate the contributions of all galaxies from the microwave image is impossible. The way to further obtain the fine-scale structure by only removing the few strongest microwave sources as the foreground effect will keep the other contributions from all the rest galaxies and stars. Therefore, the Cosmic Microwave Background cannot be uniquely explained the radiation which was left after the initial formation of the universe. Moreover, it is the mainly residual radiation from the un-calculated galaxies and inaccurate estimation of the microwave source strength.

The co-occurrence of depression and obesity has become a significant public health concern worldwide. Recent studies have shown that metabolic dysfunction, which is commonly observed in obese individuals and characterized by inflammation, insulin resistance, leptin resistance, and hypertension, is a critical risk factor for depression. This dysfunction may induce structural and functional changes in the brain, ultimately contributing to depression's development. Given that obesity and depression mutually increase each other's risk of development by 50-60%, there is a need for effective interventions that address both conditions. The comorbidity of depression with obesity and metabolic dysregulation is thought to be related to chronic low-grade inflammation, characterized by increased circulating levels of pro-inflammatory cytokines, and C-reactive protein (CRP). As pharmacotherapy fails in at least 30-40% of cases to adequately treat major depressive disorder, a nutritional approach is emerging as a promising alternative. Omega-3 polyunsaturated fatty acids (n-3 PUFAs) are a promising dietary intervention that can reduce inflammatory biomarkers, particularly in patients with high levels of inflammation, including pregnant women with gestational diabetes, patients with type 2 diabetes mellitus, and overweight individuals with major depressive disorder. Further effort directed to implement these strategies in clinical practice could contribute to improved outcomes in patients with depression and comorbid obesity and/or metabolic dysregulation.

In response to injury, vascular smooth muscle cells (VSMCs) of the arterial wall dedifferentiate into a proliferative and migratory phenotype, leading to intimal hyperplasia. The ERK1/2 pathway participates in cellular proliferation and migration while dual-specificity phosphatase 6 (DUSP6, also named MKP3) can dephosphorylate activated ERK1/2. We showed that DUSP6 was expressed in low baseline levels in normal arteries; however, arterial injury significantly increased DUSP6 levels in the vessel wall. Compared with wild-type mice, Dusp6-deficient mice had smaller neointima. In vitro, IL-1β induced DUSP6 expression and increased VSMC proliferation and migration. Lack of DUSP6 diminished IL-1β-induced VSMC proliferation and migration. DUSP6 deficiency did not affect IL-1β-stimulated ERK1/2 activation. Instead, ERK1/2 inhibitor U0126 prevented DUSP6 induction by IL-1beta, indicating that ERK1/2 functions upstream of DUSP6 to regulate DUSP6 expression in VSMCs rather than downstream as a DUSP6 substrate. IL-1β decreased levels of cell cycle inhibitor p27 and cell-cell adhesion molecule N-cadherin in VSMCs whereas lack of DUSP6 prevented their downregulation, revealing novel functions of DUSP6 in regulating these two molecules. Taken together, our results indicate that lack of DUSP6 attenuated neointima formation following arterial injury by reducing VSMC proliferation and migration, which were likely mediated via maintaining p27 and N-cadherin levels.

Composite polymolecular separation membranes were prepared by combining multi-branched ZIF-L with high porosity electrospinning nanofibers PI. Meanwhile, PDA and PEI were introduced into the membrane in order to improve its adhesion. The new membrane is so called “PI@PDA@PEI/ZIF-L-4” composite membrane; compared with PI@PDA@PEI/ZIF-8 composite membrane, the new membrane’s filtration rates for heavy metal ions such as Cd2+, Cr3+ and Pb2+ were increased by 7.0%, 6.6% and 9.3%, respectively. Furthermore, the new membrane has a permeability up to 1,140.0 L·m−2·h−1·bar−1, and were presenting a very stable performances after four repeated uses. The separation mechanism of PI@PDA@PEI/ZIF-L composite membranes was further analyzed in order to provide a base support for producing separation membranes with high barrier rate and high flux.

Although corporate social responsibility (CSR) initiatives have gained increased significance within the restaurant industry during the pandemic, there is a lack of understanding of how customers’ perceived risks influence their dining intentions for effective crisis response. This study investigates the relationship between perceived CSR, restaurant image, and dining intentions during the crisis. In addition, the study examines three types of perceived risks (quality, health, and environmental) associated with restaurants and their influence on perceived CSR, restaurant image, and dining intentions during this period. The results demonstrate that perceived CSR positively impacts a restaurant’s image and concurrently reduces perceived risks among consumers during the coronavirus disease 2019 (COVID-19) pandemic. Furthermore, perceived health risks have a negative influence on customers’ dining intentions. This study offers valuable insights into the theoretical foundations and managerial implications of CSR’s effects and risk management, particularly in the context of future pandemics within the restaurant industry.

In the field of computational fluid dynamics (CFD) for rotorcraft, two significant challenges are resolving the complex vortex structures in rotor wakes, and representing the moving rotor blades in the ambient airflow. This study addresses the first challenge by using a third-order unstructured finite volume solver, which, compared to its second-order counterpart, has substantially lower dissipation. Consequently, even relatively coarse meshes are capable of resolving small vortices. With this background flow field solver, the second challenge is addressed by modeling each rotor as an Actuator Disk Model (ADM), or describing individual rotor blades as actuator lines, designated as the Actuator Line Model (ALM). Both of these models are equipped with an improved correction for aerodynamic losses at blade tips, which is thoroughly presented in the methodology section. The numerical experiments section centers on analyzing errors linked to various sampling approaches. Additionally, the article discusses comparisons between vortex theory and ALM, specifically regarding calculations for fixed-wing aircraft. Furthermore, high-order precision and parallel efficiency are exemplified in scenarios encompassing rotors engaged in both hovering and forward flight rotors. The results in this paper demonstrate that the combination of the ALM/ADM with the improved tip loss correction and the third-order finite volume solver presents a new way of developing efficient tools for the aerodynamic analysis of helicopter rotors.

The paper investigates experimentally the influence of the Fused Filament Fabrication (FFF) pre-processing strategy on the tribological properties of parts made of PEI (polyetherimide), investigating the difference in the weight loss of the samples caused by abrasive wear before and after the test. The samples were tested for abrasive wear resistance on a tribometer constructed according to ASTM G65/16 (dry sand). Two types of specimen printing orientation along X-axis (lengthwise) and along Z-axis (heightwise) were tested in the study. Three types of path generation strategies were used for manufacturing "X" and "Z" specimens and totally 18 samples were made and tested. Path deposition strategy was carried out with path deposition width of 0.5mm and parallel paths in all slicing layers. In order to reduce the voids in volume, deposition path axes in subsequent layers were shifted by 0.25mm offset. Garnet abrasive Fe3Al2(SiO4)3 was used for this test. The analysis of the experimental data shows the relationship between the samples building direction (X, Z), applied deposition strategies (1X - 3X and 1Z - 3Z) on the resulting resistance to abrasive wear.Keywords: PEI, FFF, path generation strategy, abrasive wear

Acute myeloid leukemia (AML) is the second common hematologic malignancy in children. The incidence of childhood AML is much lower than acute lymphoblastic leukemia (ALL), which makes the childhood AML a rare disease in children. The role of genetic abnormalities in AML classification, management and prognosis prediction is much more important than before. The WHO classification of myeloid neoplasms and the European LeukemiaNet (ELN) classification were both revised in 2022. The application of the new information in childhood AML will be upcoming in the next few years. The frequency of each genetic abnormality in adult and childhood AML is different, therefore, in this review we emphasize in well-known genetic subtypes in childhood AML, including Core-binding factor AML (CBF AML), KMT2Ar (KMT2A/11q23 rearrangement) AML, normal karyotypes AML with somatic mutations, unbalanced cytogenetic abnormalities AML, NUP98 11p15/NUP09 rearrangement AML and acute promyelocytic leukemia (APL). Current risk group classification, management algorithm in childhood AML and novel treatment modalities, such as targeted therapy, immune therapy, chimeric antigen receptor (CAR) T-cell therapy are reviewed. Finally, the indications of hematopoietic stem cell transplantation (HSCT) in AML are discussed.

An upsurge in global population over the years and rapid urbanization have accelerated huge dependence on petroleum-derived fuels and consequent environment concerns owing to green-house gas emissions in the atmosphere. An integrated biorefinery uses lignocellulosic feedstock as raw material for the production of renewable biofuels, and other fine chemicals. The sustain-able bio-economy and the biorefinery industry would benefit greatly from the effective use of lignocellulosic biomass obtained from agricultural feedstocks to replace petrochemical products. Lignin, cellulose, hemicellulose, and other extractives, which are essential components of ligno-cellulosic biomass, must be separated or upgraded into useful forms in order to fully realize the potential of biorefinery. The development of low-cost and green pretreatment technologies with effective biomass deconstruction potential is imperative for an efficient bioprocess. The abun-dance of microorganisms along with their continuous production of various degradative en-zymes makes them suited for the environmentally friendly bioconversion of agro-industrial wastes into viable bioproducts. The present review highlights the concept of biorefinery, ligno-cellulosic biomass and its valorization by green pretreatment strategies into biofuels and other biochemicals. The major barriers and challenges in bioconversion technologies, environmental sustainability of the bioproducts and promising solutions to alleviate those bottlenecks are also summarized.

In order to evaluate the economy of superhighway, on the basis of the analysis of the cost of the ordinary expressway and high speed railway, the cost of superhighway is estimated. On this basis, the standard of the toll of superhighway at all levels is determined by reference to the standard of the construction cost and the toll collection standard of the ordinary expressway. According to the toll collection standard of superhighway and the fuel consumption cost of superhighway at all levels, the cost of single car and the single person cost of superhighway are calculated. Based on the analysis of highway passenger transport, railway passenger transport and civil aviation ticket price, the single person cost per kilometer of the above travel modes is calculated and compared with the single person travel cost per kilometer of superhighway. The results show that the single person cost of superhighway is between 0.29 and 0.47 yuan /km, which is 0.28 yuan /km higher than the highway bus, 0.18 yuan /km higher than the ordinary expressway self driving and 0.23 yuan /km higher than the express train, but 0.78 yuan/km lower than that of the first class seat of high-speed train, and is 0.92 yuan/km far lower than that of civil aviation flight economy class and 2.42 yuan/km lower than the business class. Therefore, the superhighway trip has certain advantages in economy.

Background: With a rapid rise in our older adult population globally and due to their multimorbidities, our older adults are more likely to engage in the services provided in the emergency department at a higher rate than younger adults. The current emergency service delivery model may be ineffective against such an ageing phenomenon. Research reports most older adults having one or more co-morbidities including functional decline, dementia, and frailty. Studies have shown that older adults have been undertriaged with physicians not being able to comprehend their complex needs related to their presenting complaints in the emergency department. Geriatric emergency departments have incepted worldwide to better manage this care deficiency in the rapidly ageing society around the world. Data Sources: A search of published literature from 2010-2020 using (keywords) as described below was undertaken of which, relevant literature were selected for an informed review. Implications for Nursing: Understanding geriatric emergencies can enable healthcare workers to reduce undertriaging and provide appropriate care that improves patient's health outcomes currently and in the future in the emergency department. Further education in gerontology can also be a platform for our nurses to enhance their care and thought process, likewise upskilling themselves for the future geriatric population seeking treatment. Older healthcare workers will also be able to enhance their current job scope before retirement. In-house teachings from trained gerontologists or certified programs can shed light on the special care needs of our senior citizens globally. Conclusion: With our rapidly increasing population, we can expect an influx of our older patients both from home and long-term care facilities to present to the emergency department with a wide range of geriatric emergencies. By being able to create a geriatric screening process and tailored care models, healthcare workers will be able to understand their care process and in turn, improve patients' health outcomes and provide a quicker transition of care.

Taiwan's bed and breakfast (B&B) development has been more than 25 years ago, from the first generation of retirement to the B&B industry, serving tourists from all over the world accom-modation, providing breakfast and accommodation mode to the present, after the change of employees from the second generation, more and more attention is paid to the cultivation and cultivation of business ability. With the advent of the era of AI technology networking, the ca-pabilities required for B&B operation are more focused on all aspects of service, and the good marketing ability of B&B can promote a green chimney-free tourism economy, which is also a favorite industry of various governments and the public. This study explores the basic vocational competency indicators required for running a B&B, with (1)EQ emotion management skills, (2)Financial management ability, (3)(SK) technical skills, and (4)Marketing and promotion management capabilities. Through the study method, the K-S Z test was determined by the con-sensus conclusion of expert reliability and validity p value

In this paper, we present an extended version of the Hadi-Vencheh model for multiple criteria ABC inventory classification. The proposed model is a nonlinear weighted product model (WPM) which determines a common set of weights for all the items. Our proposed nonlinear WPM incorporates multiple criteria with different measure units, without converting the performance of each inventory item in terms of each criterion into a normalized attribute value, thereby providing an improvement over the model proposed by Hadi-Vencheh. Our study mainly includes various criteria for ABC classification, and demonstrates an efficient algorithm for solving nonlinear programming problems in which the feasible solution set does not have to be convex. The algorithm presented in this study improves the solution efficiency of the Canonical Coordinates Method (CCM) algorithm substantially when applied to large scale, nonlinear programming problems. The modified algorithm was tested to compare our proposed model results to the results derived using the Hadi-Vencheh model and demonstrate the algorithm's efficacy. The practical implications of the study are to develop an efficient nonlinear optimization solver by optimizing the quality of existing solutions, thus improving time and space efficiency.

Background: The target volume for post-mastectomy radiation therapy (PMRT) in breast cancer patients with reconstruction has been a subject of debate. This study aimed to assess the radiation dose distribution and treatment outcomes associated with different chest wall (CW) delineation according to ESTRO ACROP guideline for patients underwent implant-based reconstruction. Methods: We conducted a retrospective review of breast cancer patients who underwent mastectomy followed by two-stage implant-based breast reconstruction and adjuvant radiation therapy (RT) between 2007 and 2022. The expanders/implants were positioned retropectorally. The chest wall target volumes were categorized into two groups: the prepectoral group, which excluded the deep lymphatic plexus, and the whole expander group. Results: The study included 26 patients, 15 in prepectoral group and 11 in whole expander group. No significant differences were observed in normal organs exposure between the two groups. There was a trend toward a lower ipsilateral lung mean dose in the prepectoral group (10.2 vs. 11.1 Gy, p=0.06). Both groups exhibited limited instances of reconstruction failure and local recurrence. Conclusions: For patients undergoing two-stage expander-implant retropectoral breast reconstruction and PMRT, our data have provided comparable outcomes and normal organs exposure for those omitting the deep lymphatic plexus.

Insulated Gate Bipolar Transistor (IGBT) may convey high current and sustain high breakdown voltages; it may provide high power control. In a sense, how IGBT demonstrates the capability of power control was not specifically described, and the equivalent bipolar junction transistors (BJT) activated by an applied bias to the insulated gate is intriguing. As seen in Figure 1, IGBT shows an equivalent circuit structure containing two types of BJT, (NPN-type Bipolar transistor and PNP-type Bipolar transistor), which can be modeled as diode-associated transistor. Apparently, as a bias applies to the controlling gate, the channel beneath the gate oxide gets strongly inversed and turns out to be conductive just like what happens on metal-oxide-silicon field effect transistor (MOSFET), which provides necessary igniting currents to both BJTs and thus causes high current gain flowing through them-selves from the bottom. A proposed and renewed formula provides addressing the above scenario and successfully fitting the measured data that forms the characteristic curves. Some parameters in the proposed formula, which includes size and mobility associated constant, threshold voltage, and Early-Voltage-related lambda for MOSFET, explain and explore the underlying physics. IGBT thus enjoy high input impedance and high current gain due to MOSFET (Insulated Gate) and BJT, respectively. This formula combines both merits of MOSFET and BJT in order to fit the measured data. Indeed, the formula intimately fits IGBT electrical characteristic curves, and thus may be qualified and served as a model. The new model is then advisable for designing power integrated circuit to exactly achieve power saving, power control, and power efficiency.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Electricity consumption is often the hotspot of life cycle assessment (LCA) of products, industrial activities, or services. The objective of this paper is to provide a consistent, scientific, region-specific electricity-supply-based inventory of electricity generation technology for national and regional power grids. Marginal electricity generation technology is pivotal in assessing impacts related to additional consumption of electricity. China covers a large geographical area with regional supply grids; these are arguably equally or less integrated. Meanwhile, it is also a country with internal imbalances in regional energy supply and demand. Therefore, we suggest an approach to achieve a geographical subdivision of the Chinese electricity grid, corresponding to the interprovincial regional power grids, namely the North, the Northeast, the East, the Central, the Northwest, and the Southwest China Grids, and the China Southern Power Grid. The approach combines information from the Chinese national plans on for capacity changes in both production and distribution grids, and knowledge of resource availability. The results show that nationally, marginal technology is coal-fired electricity generation, which is the same scenario in the North and Northwest China Grid. In the Northeast, East, and Central China Grid, nuclear power gradually replaces coal-fired electricity and becomes the marginal technology. In the Southwest China Grid and the China Southern Power Grid, the marginal electricity is hydropower towards 2030.

Improving access to sexual health services is critical in light of rising sexually transmitted infections (STIs). We evaluated a Hub and Spoke model for improving access to sexual health services in three general practices in Victoria, Australia. The primary outcome was the impact on HIV and STI (chlamydia, gonorrhoea, syphilis) testing. Segmented linear regression analysis was conducted to examine the trends in the total HIV/STI tests before (from January 2019 to June 2020) and post-implementation (from July 2020 to July 2021). We evaluated the feasibility and acceptability of integrating this model into the general practices using semi-structured individual interviews. There was a statistically significant rise in testing for HIV and STIs in all general practices: post-implementation, there was an increase of an average of 11.2 chlamydia tests per month (p=0.026), 10.5 gonorrhoea tests per month (p=0.001), 4.3 syphilis tests per month (p=0.010), and 5.6 HIV tests per month (p=0.010). Participants reported increases in knowledge level and confidence in offering STI testing and managing more variety of sexual health cases. This study demonstrated the feasibility of implementing a hub and spoke model to enable GPs to deliver sexual health care with support from a sexual health specialist service.

Photodynamic therapy has been applied endoscopically to treat early esophageal cancer. However, the long-term survival outcome of this treatment option is unknown in literature. Patients and Method: The patients of early esophageal cancer (clinical stage I) treated with photophrin based photodynamic therapy were analyzed for their long-term survival outcome and compared to those patients undergoing esophagectomy by a single surgeon for stage I disease. Results: There were 15 and 16 patients undergoing PDT and esophagectomy enrolled in the current study respectively. Complete response was achieved in 10 (66.7%) patients after PDT. After adjuvant chemoradiation (CCRT) complete response was achieved in 13 patients (86%). There is no mortality after PDT. Severe complication was detected in 3 patients including trachea-esophageal fistulae, esophageal stenosis and skin photosensitivity respectively. With a median follow-up duration of 110.2 months (+9.6 months) for the patients after PDT, there were 4 and 3 recurrence in the primary tumor site and regional lymph node respectively with 73.3% of successful local control rate of the primary tumor. There were 7 (46.7%) patients died during clinical follow-up of this cohort with 5 (33.3%) from disease progression of esophageal cancer and two from other diseases respectively. The five-year survival rate after PDT is 64.3%, whereas 70.9% of the patients after esophagectomy without significant difference of these two group of patients (P=0.72). Conclusion: Our preliminary results suggested that PDT might provide an equivalent long-term oncological outcome as compared to that done by esophagectomy for early esophageal cancer. A prospective randomized clinical trial comparing the results with esophagectomy and other endoscopic abrasive therapies is warrant in the future.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

Pediatric brain tumors are the most common solid tumors in children, causing the highest number of cancer-related deaths at young ages. Although existing therapies have improved the 5-year overall survival rate of PBT patients, some high-risk brain tumors continue to resist current treatments. Additionally, the survivors endure devastating long-term side effects, including cognitive defects and sensory and endocrinal dysfunctions. In the past two decades, immunotherapies have evolved significantly, with great success in many cancers. Immunotherapies developed specifically for PBTs also show promising results. Currently, scores of clinical trials are underway to evaluate the safety and feasibility of a wide-range of immunotherapeutics for PBTs, and this review overviews the most recent advances, including the exciting progress made toward treating medulloblastoma, pediatric glioma, and ependymoma. We summarized the cutting-edge immunotherapies under development, including immune checkpoint blockade, chimeric antigen receptor (CAR)-T cell therapy, natural killer (NK)-cell therapy, cancer vaccines, and oncolytic virus therapy. We find that the results from the recently concluded or ongoing clinical trials on safety and feasibility are very encouraging; however, non-responsiveness and tumor recurrence still haunt them. While this review judges the scope of the current immunotherapies, it also lays out strategies to find alternate solutions for persisting issues.

A new covered yarn system is proposed in this manuscript by controlling the tension of the spandex elastic yarn drawing.. By analyzing the relationship between the draw ratio and yarn tension, it has been verified that the new tension controlled drawing system is feasible and results in yarns with superior quality and process stability.

In kidney, epithelial barrier has diverse functions in body fluid and electrolyte homeostasis, and urine production. Maintaining epithelial integrity fundamentally builds up physiological functionality of the renal epithelial barrier (REB). Specially, the REB) states regularly in osmotic dynamics. The osmotic dynamics gives rise of osmotic pressure that is a physical force. Overloading of osmotic pressure can crack epithelial integrity and damage REB. How REB endures the osmotic pressure force yet remains enigmatic. LMO7 (LIM domain only 7) is a protein associated with cell-cell junctional complex and cortical F-actin. LMO7 upregulation was observed in cells cultured in hypertonic condition. In kidney, LMO7 predominantly distributes in epithelial cells in renal tubules. Hypertonic stimulation leads to assembly of LMO7 and F-actin in cortical stress fibers in renal epithelial cells. Hypertonic-isotonic alternation as pressure force pushing plasma membrane inward/outward was set as osmotic disturbance and was applied to test FAK signaling and LMO7 functioning in maintaining junctional integrity. Along with junctional integrity, LMO7 depleted cells resulted in loss of junctional integrity in the epithelial sheet cultured hypertonic medium or hypertonic-isotonic alternation. On the other hand, FAK inhibited by PF-573228 leads to failure in robust cortical F-actin assembly and association of LMO7 with cortical F-actin in epithelial cells responding upon hypertonic stress. Epithelial integrity in context of osmotic stress, LMO7 and FAK signaling both involves in assembling robust cortical F-actin and maintaining junctional integrity. The LMO7 elaborately manages FAK activation in renal epithelial cells, which was evidently demonstrated in NRK-52E cells who have excessive FAK activation and lost epithelial integrity when cells with LMO7 depletion exposed to hypertonic environment. Our data suggests that LOM7 manages FAK activation and is responsible for maintaining REB under osmotic disturbance.

An outbreak of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) occurred in China towards the end of 2019, and has spread rapidly ever since. Previous studies showed that some virus could affect the reproductive system and cause long-term complications. Recent studies exploring the source of SARS-CoV-2 using genomic sequencing have revealed that SARS-CoV-2 enters the host cells via the angiotensin-converting enzyme II (ACE2), the receptor that recognizes SARS-CoV. To investigate the expression of ACE2 and to explore the potential risk of infection in the reproductive system, we performed a thorough bioinformatic analysis on data from public databases involving RNA expression, protein expression, and single-cell RNA expression studies. The analyzed data showed high levels of ACE2 mRNA and protein expression in the testis and spermatids and equal levels of ACE2 expression in the uterus and lung. Comprehensive single-cell analysis identified ACE2 expression in the lung, testis, spermatids, and uterus. In conclusion, this study revealed the potential risk associated with the SARS-CoV-2 infection in the reproductive system and predicted that long-term complications might have a significant impact on the prevention and management of COVID-19, the disease caused upon infection with SARS-CoV-2.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

The fluctuations in both time and space of the fish larvae community in relation to hydrographic characteristics in the waters surrounding the Taiwan Bank were studied in October 2021 (autumn) and March 2022 (spring). Throughout the study period, we identified a total of 149 taxa of fish larvae, encompassing 96 genera and 71 families. Engraulis japonicus, Diaphus slender type, unidentified Gobiidae, Apogon sp., unidentified Clupeidae, and Benthosema pterotum were the six most dominant taxa, together constituted 47.39% of the total catch. No significant temporal difference in abundance of fish larvae was found, but the species number of fish larvae was more diverse in spring than in autumn. There was a notable difference in species composition between the cruises, and the cluster analysis unveiled a distinct temporal structure in the assemblage of fish larvae. The dynamics of prevailing currents induced by seasonal monsoons play an important role in the transport of fish larvae. The distribution of fish larvae was closely linked to hydrographic features, where seawater temperature and salinity emerged as the primary explanatory factors influencing the composition of fish larvae assemblages in the waters surrounding the Taiwan Bank. While the increased influx of nutrients from upwelling ensures abundant food availability, the hydrographic conditions may not be suitable for every fish larva.

A new model for risk assessment of urban rainstorm disasters, based on information diffusion method and variable fuzzy sets (IDM-VFS) was proposed. In addition, an integrated index system of urban rainstorm risk was established. In the proposed model, IDM was employed to calculate the classification standards of urban rainstorm risk levels, then the VFS was adopted to assess the dangerousness, sensitivity, vulnerability and comprehensive risk of urban rainstorm disasters. In the present study, the urban rainstorm risk of Jiangsu province was evaluated with the proposed model. The results show that Wuxi, Changzhou, Nanjing and Suzhou have higher dangerousness, due to sustained rainfall and strong rainfall intensity in short duration; Wuxi, Changzhou and Nanjing have higher sensitivity because of lower disaster resistance ability; and Wuxi and Suzhou have higher vulnerability because these cities have higher potential losses in face of urban rainstorm disasters. The comprehensive risk zoning map of urban rainstorm shows apparent regional characteristics: the northwestern cities have lower risk than the southern cities. Moreover, most cities of the Jiangsu province are of the moderate urban rainstorm risk level. The results are consistent with the actual situation of Jiangsu province, and the study can provide some decision-making references for the urban rainstorm management.

As an important carrier of urban residents' public life, urban public open space plays an indispensable role in improving the quality of life of urban residents. Accessibility is an important indicator to characterize the publicity and service level of a public open space. This study optimized the GIS-based, Gaussian two-part mobile search method to quantitatively calculate and evaluate the accessibility of public open space within a 5-minute walking distance for residents in Nanshan District, Shenzhen. On this basis, social survey methods, including the questionnaire survey method via a field survey and the interview method, were used to conduct field research on residents' accessibility satisfaction. Comparing the results of the survey on residents' accessibility satisfaction to the GIS quantitative evaluation results of accessibility, the results of the field research show that current residents of Nanshan are more satisfied with the accessibility of public open space. In view of the similarities and differences between the two sets of results, the influencing factors of public open space accessibility were analyzed, corresponding countermeasures were proposed for the construction of public open spaces in the future.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Taiwan developing offshore wind power to promote green energy and self-electricity production. In this study, a Light Detection and Ranging (Lidar) was set up at Chang-Hua development zone one on the sea and 10km away from the seashore. At Lidar location, WRF (3.33km & 2km grid lengths) model and WAsP were used to simulate the wind speed at various elevations. Three days mean wind speed of simulated results were compared with Lidar data. From the four wind data sets, developed five different comparisons to find an error% and R-Squared values. Comparison between WAsP and Floating Lidar was shown good consistency. Lukang meteorological station 10 years wind observations at 5m height were used for wind farm energy predictions. The yearly variation of energy predictions of traditional and TGC wind farm layouts are compared under purely neutral and stable condition. The one-year cycle average surface heat flux over the Taiwan Strait is negative (-72.5 (W/m2) and 157.13 STD), which represents stable condition. At stable condition TGC (92.39%) and 600(92.44%), wind farms were shown higher efficiency. The Fuhai met mast wind data was used to estimate roughness length and power law exponent. The average roughness lengths are very small and unstable atmosphere.

Transcranial direct current stimulation (tDCS) is acknowledged for its non-invasive modulation of neuronal activity in psychiatric disorders. However, its application in insomnia research yields varied outcomes depending on different tDCS types and patient conditions. Our primary objective is to elucidate its efficiency and uncover the underlying mechanisms in insomnia treatment. We hypothesized that anodal prefrontal cortex stimulation activates glutaminergic projections from the infralimbic cortex (IL) to ventrolateral preoptic area (VLPO) to promote sleep. After administering 0.06 mA of electrical currents for 8 minutes, our results indicate significant non-rapid eye movement (NREM) enhancement in naïve mice within the initial 3 hours post-stimulation, persisting up to 16-24 hours. In the insomnia group, tDCS enhanced NREM sleep bout numbers during acute stress response and improved NREM and REM sleep duration in subsequent acute insomnia. Sleep quality, assessed through NREM delta powers, remains unaffected. Interference of the IL-VLPO pathway, utilizing designer receptors exclusively activated by designer drugs (DREADDs) with the cre-DIO system, partially blocked tDCS's sleep improvement in stress-induced insomnia. This study elucidated that the activation of the IL-VLPO pathway mediates tDCS's effect on stress-induced insomnia. These findings support the understanding of tDCS effects on sleep disturbances, providing valuable insights for future research and clinical applications in sleep therapy.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

Retrogressive thaw slumps (RTSs) are becoming more common on the Qinghai-Tibet Plateau as permafrost thaws, but the hydraulic characteristics of these slumps have not been extensively studied. To fill this knowledge gap, we used the ''space-for-time substitution method'' to differentiate three stages of RTSs: original grassland, collapsing, and collapsed. Our study included on-site investigations, measurements, and simulated analyses of soil water characteristics, environmental factors, and hydrological properties. Our findings show that the measurements and simulated analyses of soil water characteristics were highly consistent across RTSs, indicating the accuracy of the V-G model in reproducing soil hydraulic parameters for different stages of RTSs. The original grassland stage had the highest soil water retention and content due to its high SOM content and fine-textured micropores. In contrast, the collapsed stage had higher soil water retention and content compared to the collapsing stage, primarily due to increased proportions of soil micropores, SOM content, and lower bulk density (BD). Freeze-thaw cycles had a significant impact on the soil texture and structure of RTSs, resulting in a decrease in SOM content and an increase in BD. However, the absence of soil structure and compaction led to the subsequent accumulation of organic matter, increasing SOM content. Changes in field capacity (FC), permanent wilting point (PWP), and soil micropore distribution aligned with variations in SOM content and water content.These findings highlight the importance of managing SOM content and water content to mitigate the adverse effects of freeze-thaw cycles on soil structure and stability at different stages of RTSs. Effective management strategies may include incorporating organic matter, reducing soil compaction, and maintaining optimal water content. Further research is needed to determine the most suitable management practices for different soil types and environmental conditions.

Photocatalytic processes offer promising solutions for environmental remediation and clean energy production, yet their efficiency under visible light remains a significant challenge. Here, we report a novel silver-graphene (Ag-G) modified TiO2 (Ag-G-TiO2) nanocomposite photocatalyst that demonstrates remarkably enhanced photocatalytic activity for both dye wastewater degradation and hydrogen production under visible and UV light irradiation. Through comprehensive characterization and performance analysis, we reveal that the Ag-G modification narrows the TiO2 bandgap from 3.12 eV to 1.79 eV, enabling efficient visible light absorption. The nanocomposite achieves a peak hydrogen production rate of 191 μmolesg-1h-1 in deionized water dye solution under visible light, significantly outperforming unmodified TiO2. Intriguingly, we observe an inverse relationship between dye degradation efficiency and hydrogen production rates in dye solutions with tap water versus deionized water, highlighting the critical role of water composition in photocatalytic processes. Our findings demonstrate sustained hydrogen production under visible light and rapid initial rates under UV irradiation, underscoring the versatility of Ag-G-TiO2 catalyst. This work not only advances our understanding of fundamental photocatalytic mechanisms but also presents a promising material for solar-driven environmental and energy applications, potentially contributing to the global transition towards sustainable technologies.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Recent studies have indicated that several anti-hypertensive drugs may delay the development and progression of Alzheimer’s disease (AD). However, the relationships among AD, hypertension, and oxidative stress remain to be elucidated. In the present study, we aimed to determine whether treatment with resveratrol reduces reactive oxygen species (ROS) generation in the brain, thereby reducing cognitive impairment in rats with angiotensin II (Ang-II)-induced early AD. Male WKY rats with Ang-II-induced AD were treated with losartan or resveratrol for 2 weeks. Our results revealed that treatment with resveratrol (10 mg/kg/day) decreased blood pressure, increased levels of brain-derived neurotrophic factor (BDNF) in the hippocampus, and decreased ROS production in the nucleus tractus solitarius (NTS) in the Ang-II groups. In addition, inhibition of Tau^T231 phosphorylation in the hippocampus using resveratrol significantly abolished Ang-II-induced expression of Ab precursors, active caspase 3, and glycogen synthase kinase 3b (GSK-3b)^Y216 while increasing Akt^S473 phosphorylation. Notably, resveratrol reversed impairments in hippocampal-dependent contextual memory induced by deleting NADPH oxidase and NOX2. Overall, our results suggest that resveratrol exerts neuroprotective effects against memory impairment and hippocampal damage in a rat model of early stage AD by reducing oxidative stress. These novel findings indicate that resveratrol may represent a pharmacological option for patients with hypertension at a risk of AD during old age.

In this paper, a method of charging lead acid battery with solar power by flyback converter is proposed. The basic system consists of a buffer circuit, auxiliary power circuit, control circuit, voltage feedback circuit and current feedback circuit. The system is capable of monitoring battery voltage and the current, charging the coupling inductor and automatic control of output duty cycle, overcharging and over-discharging protection. The experiment proves that the charging efficiency is improved by about 83% at full load.

The eutrophication caused by excessive total nitrogen(TN) and total phosphorus(TP) emissions has been widely concerned by the whole society. Studies have revealed the relationship between land use and TN and TP, but the relationship between land use compound topographic position and TP and TN was seldom studied. Therefore, Spearman correlation and redundancy analyses were used to reveal the relationship between land use compound topographic position and TN and TP based on the monthly data of 28 water quality sampling sites and the land use data of 2013 and 2016 in the lakes of Guizhou Plateau. The results show that the nutritional state of the HBA watershed is medium. The trophic level index (TLI) value and TN concentration were high during flood, while TP concentration was high in dry period. The TN concentration in the tributaries was higher than that in the reservoir area. Construction and valley were the sources of the pollution, whereas forest land and gentle slope were the sink. According to the”source-sink”effect, the optimal zoning of land use was completed, and the urban land pollution govern area should be strengthened firstly. This paper can provide decision support for water environment management and sustainable development decision-making.

: Tunnel instability and lining integrity are intimately tied to the creep properties of the surrounding rock. The acquisition of rock mass creep parameters is critical in ascertaining the appropriate timing for lining construction. Nevertheless, creep tests on rock specimens conducted in a controlled setting cannot be straightforwardly extrapolated to rock mass creep analysis. This study performs laboratory-based creep tests on mudstone samples and establishes the corresponding creep constitutive model. Integration of a Mohr-Coulomb element with the Burgers model in series serves to characterise the yield creep behaviour of the rock mass. Additionally, the research outlines a series of 100 orthogonal experiments utilising randomised creep parameters, and formulates a GA-BP neural network inversion model. Employing long-term deformation measurements from the crown and sidewalls of the project site, this study deduces the creep parameters of the mudstone in the investigated tunnel section and examines the prolonged deformation traits of the surrounding rock. Drawing on the deformation traits of the surrounding rock and the forces impacting the primary support and lining structures, this paper evaluates the earliest and latest viable lining casting periods and pinpoints an optimal timing interval for lining implementation. The methodologies employed herein can serve as a benchmark for analogous endeavors internationally.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

The unsafe behavior of frontline workers at construction sites is the most important cause of construction accidents. This study proposed a comprehensive model of frontline workers' unsafe behaviors based on a systems perspective and used structural equation modeling (SEM) to explore the influence mechanisms between Objective Conditions (e.g., work environment, work climate, task complexity), Safety Management (e.g., safety education and training, safety reward and punishment regulations, safety inspection, safety technology disclosure, safety warning signs), Group Influence (propagation of unsafe behaviors among workers), Personal Perception (subjective judgment of operators on their safety knowledge and skills), and Unsafe Behaviors. Data from 460 frontline workers were collected through questionnaires and the correlation hypotheses were tested using SPSS 26.0 and Amos 26.0 software. The following conclusions were obtained: (1) Objective Conditions directly positively influence Safety Management, Group Influence, and Personal Perception, but indirectly negatively influence Unsafe Behavior; (2) Safety Management not only directly positively affects Personal Perception but also directly negatively affects Unsafe Behavior. However, the direct effect of Safety Management on Group Influence is not significant; (3) Group Influence has a direct positive effect on Unsafe Behavior, but the direct effect on Personal Perception is not significant; (4) The direct effect of Personal Perception on Unsafe Behavior is insignificant. These findings can be used as preliminary data to guide decision-makers or managers in construction companies to develop reasonable management plans to curb unsafe behaviors of frontline workers.

Pedestrian multi-target tracking technology plays an important role in artificial intelligence, driverless, virtual reality and other fields. The pedestrian multi-target tracking algorithm DeepSORT based on detection is widely used in industry. It mainly tracks multiple pedestrian targets continuously and keeps their ID unchanged. In order to improve the applicability and tracking accuracy of DeepSORT algorithm, this paper improved the IOU distance measurement in the matching process. At the same time, ResNet50 is used as the feature extraction backbone network, and combined with FPN (Feature Pyramid Network), the appearance features of multi-layer pedestrians are fused to improve the tracking accuracy of DeepSORT algorithm. The proposed algorithm is verified on the public data set MOT-16 and it’s tracking accuracy is enhanced to 4.1%.

CNN-based methods have dominated the field of aerial scene classification for the past few years. While achieving remarkable success, CNN-based methods suffer from excessive parameters and notoriously rely on large amounts of training data. In this work, we introduce few-shot learning to the aerial scene classification problem. Few-shot learning aims to learn a model on base-set that can quickly adapt to unseen categories in novel-set, using only a few labeled samples. To this end, we proposed a meta-learning method for few-shot classification of aerial scene images. First, we train a feature extractor on all base categories to learn a representation of inputs. Then in the meta-training stage, the classifier is optimized in the metric space by cosine distance with a learnable scale parameter. At last, in the meta-testing stage, the query sample in the unseen category is predicted by the adapted classifier given a few support samples. We conduct extensive experiments on two challenging datasets: NWPU-RESISC45 and RSD46-WHU. The experimental results show that our method yields state-of-the-art performance. Furthermore, several ablation experiments are conducted to investigate the effects of dataset scale, the impact of different metrics and the number of support shots; the experiment results confirm that our model is specifically effective in few-shot settings.

This paper systematically discusses the application of reinforcement learning in automatic driving system. Reinforcement learning frameworks show significant advantages in optimizing decision making, predictive perception, path planning, and controller design, exceeding the limitations of traditional supervised learning methods. The paper highlights the critical role of components such as scene understanding, positioning, and map making in autonomous driving systems, which provide reliable environmental awareness through deep learning and sensor fusion technologies to support intelligent decision-making in complex urban environments. In addition, the paper discusses innovative approaches to safety reinforcement learning to reduce risk in autonomous driving and ensure that systems adhere strictly to safety constraints while maximizing expected rewards. These findings provide an important theoretical and practical basis for further improving algorithm robustness, managing multi-agent interactions, and integrating ethical considerations in the future.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Fabrication of durable materials with excellent oil adsorption capacity and separation performance for the treatment of oily wastewater is meaningful based on smart responsiveness. Herein, a solvent-responsive melamine sponge (MS) was developed via silanization followed by the in-situ growth of zeolitic imidazolate framework-8 (ZIF-8). Detailed characterization of the resultant composite MS was conducted using scanning electron microscopy (SEM), energy dispersive spectrometer (EDS), X-ray diffraction (XRD), and Fourier transform infrared spectroscopy (FTIR). The multiscale hierarchical MS substrate exhibited highly hydrophobic property in the pH range of 1-11, along with a satisfactory adsorption capacity in the range of 65.4-134.2 g/g for different oils. The modified surface transformed from superhydrophobicity/superlipophilicity to superhydrophilicity/underwater superoleophobicity upon ethanol wetting, reverting to its original superhydrophobic state upon drying. The separation flux of the MS substrate was above 1.5×104L/m2h for both oil and water removal, along with the separation efficiency more than 98.7%. No obvious changes of the separation performance after 50 successive immiscible oil/water separation indicated the excellent durability and robustness of the anchored ZIF-8 nanoparticles on the surface of modified MS substrate. More importantly, oil-in-water emulsion separation was successfully carried out via the ZIF-8 MS composite with a high separation efficiency over 99.1%. The developed smart sponge with high oil absorption capacity, excellent chemical stability and fire resistance exhibited a wide range of potential practical applications in the convenient treatment of oily wastewater.

In this paper, a method of direct spinning is proposed for direct spinning of heterogeneous spun wire-blown holes standard parts and the motherboard mounted on the spin board assemblies. The standardization of the spinneret hole was conducive to improving the machining accuracy and efficiency of the pores, and the spinneret holes could be replaced in time when a hole in the spinneret fails. Moreover; on the other hand, according to the needs of the process of spinning, the spinnerets with various cross-sections were combined and installed on the same motherboard for spinning, and the spinning obtained different bionic new functional products. Based on the results, a finite element model of the standard part of the spinneret hole was developed, and the spinnability of the combinable spinnable spinneret board was verified by simulating the melt flow in the spinneret channel through POLYFLOW software. Further, by the processing of the spinneret, the motherboard was installed into a combined spinneret, and the spinneret assembly was installed on the spinning machine for the experiments. Furthermore, the tow section was observed using a microscope, and the results showed the feasibility of the proposed method.

In order to improve the operation performance of the multi-stage double-suction centrifugal pump and reduce the internal energy loss of the pump, this paper proposes a single-objective optimization design method based on non-hierarchical response surface model (RSM) and the multi-island genetic algorithm (MIGA). Nine parameters, such as the blade outlet width and blade wrap angle, were used as design variables, and the optimization objective was the efficiency under design conditions. In total, 149 sets of valid data were obtained under the latin hypercube sampling method (LHS), the corresponding thresholds were set for efficiency and head, and 99 sets of valid data were obtained. A cross-validation analysis of the sieved data was carried out based on non-hierarchical RSM, global optimization of the efficiency was carried out using MIGA, and numerical verification was carried out via CFD. The research results show that compared with hierarchical RSM, non-hierarchical RSM can approximate the nonlinear relationship between the objective function and the design variables with higher accuracy, and the model fitting R2 value was 0.919. The efficiency was improved by 3.717% after optimization. The overall prewhirl of the impeller inlet after optimization decreased, the internal speed of the volute significantly improved, the large-area vortex at the volute and the outlet pipe was eliminated, the impact loss at the volute separating tongue disappeared, and the overall hydraulic performance of the pump was improved. The total entropy output value of the optimized pump was reduced by 4.79 (W/K), mainly concentrated in the reduction in the entropy output value of the double volute, and the overall energy dissipation of the pump was reduced.

Multi-chiplet technique is expected to be a promising solution to achieve high-density system integration with low power consumption and high usage ratio. This technique can be integrated with glass interposer to accomplish a competitive low fabrication cost compared with the silicon-based interposer architecture. In this study, process-oriented stress simulation is performed by the element activation and de activation technique in finite element analysis architecture. Submodeling technique is also utilized to mainly conquer the scale mismatch and difficulty in mesh gridding design. It is used as well to analyze the thermomechanical responses of glass interposer with chiplet arrangement and capped epoxy molding compound (EMC) during curing. A three-factor, three-level full factorial design is applied using the analysis of variance method to explore the significance of various structural design parameters on stress generation. Analytic results reveal that the maximum first principal stresses of 130.75 and 17.18 MPa are introduced on the sidewall of Cu-filled via and the bottom of glass interposer, respectively. Moreover, the EMC thickness and through glass via pitch are the dominant factors in the adopted vehicle. They significantly influence the stress magnitude during heating and cooling.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

This study investigated the efficacy of carvone, abscisic acid (ABA), gibberellin (GA3), and variable temperature in managing dormancy and sprouting in aeroponically grown mini-tuber potato seeds. Results showed that carvone treatment effectively reduced weight loss rate by 12.25% and decay rate by 3.33% at day 25, compared to control. ABA treatment significantly enhanced germination rate to 97.33%. GA3 treatment resulted in the longest sprouts of 14.24 mm and reduced MDA content by 23.08% at day 30, indicating its potential in shortening dormancy and maintaining membrane integrity. Variable temperature treatment showcased a balanced performance in reducing weight loss and maintaining a lower relative conductivity, indicating less cellular damage. Enzymatic activities of α-amylase, CAT, and SOD were modulated by the treatments, ensuring a balanced enzymatic environment for seed vitality. These findings provide a robust foundation for refining post-harvest management strategies to optimize germination uniformity and preserve the quality of aeroponic potato seeds during extended dormancy, promising enhanced yield and productivity in potato cultivation.

Soil-borne Trichoderma spp. have been extensively studied for their biocontrol activities against pathogens and growth promotion ability with plants. However, the beneficial effect of Trichoderma on inducing resistance against insect herbivores has been considered only recently. Among diverse Trichoderma species, consistent with previous reports, we showed that root colonization by T. virens triggered induced systemic resistance (ISR) to leaf-infecting fungal pathogens. Whether T. virens induces ISR to insect pests has not been tested before. In this study, we investigated whether T. virens affects jasmonic acid (JA) biosynthesis and defense against fall armyworm (FAW) and western corn rootworm (WCR). Unexpectedly, the results showed that T. virens colonization of maize seedlings grown in autoclaved soil suppressed wound-induced production of JA, resulting in reduced resistance to FAW. Similarly, the bacterial endophyte Pseudomonas chlororaphis 30-84 suppressed systemic resistance to FAW due to reduced JA. Further comparative analyses of the systemic effects of these endophytes when applied into sterile or non-sterile field soil showed that both T. virens and P. chlororaphis 30-84 triggered ISR against hemibiotrophic fungal pathogen Colletotrichum graminicola in both soil conditions, but only suppressed resistance to FAW in sterile soil. In contrast to the effect on FAW defense, T. virens colonization of maize roots suppressed WCR larvae survival and weight gain. This is the first report suggesting the potential role of T. virens as a biocontrol agent against WCR.

In our article in Genome Biology Ecology six years ago, one complete plastid genome of Belian was assembled for comparative analyses of the plastomes in Lauraceae. However, Ariati et al. (2023) concluded that our sequenced Belian individual could be located in the clade of Myristicaceae instead of that of Lauraceae. Here, we performed re-analyses of additional two Belian plastomes, along with 42 plastomes from plants spanning ten families of the Magnoliids. The plastomes of the three Belian individuals range from 157,535 to 157,577 bp in length. Comparative genomic analysis revealed 170 mutation sites in their plastomes, which include 111 substitutions, 53 indels, and six microinversions. Phylogeny was reconstructed using maximum likelihood and Bayesian approaches for 44 magnoliids species indicated that our three Belian individuals are nested among the species in the family Lauraceae rather than Myristicaceae.

Due to the rapid developments in aquaculture industry, Artemia franciscana, originally an American species, has been intentionally introduced to the Eurasia, Africa and Australia. In the present study, we used a partial sequence of the mitochondrial DNA Cytochrome Oxidase subunit I (mt-DNA COI) gene and genomic fingerprinting by Inter-Simple Sequence Repeats (ISSRs) to determine the genetic variability and population structure of Artemia populations (indigenous and introduced) from 14 different geographical locations in Western Asia. Based on the haplotype spanning network, Artemia urmiana has exhibited higher genetic variation than native parthenogenetic populations. Although A. urmiana represented a completely private haplotype distribution, no apparent genetic structure was recognized among the native parthenogenetic and invasive A. franciscana populations. Our ISSR findings have documented that despite invasive populations have lower variation than source population in Great Salt Lake (Utah, USA), they have significantly revealed higher genetic variability compare to the native populations in Western Asia. According to the ISSR results, the native populations were not fully differentiated by the PCoA analysis, but the exotic A. franciscana populations were geographically divided in four genetic groups. We believe that during the colonization, invasive populations have experienced substantial genetic divergences, under new ecological conditions in the non-indigenous regions.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

A common spinal condition, spondylolisthesis is the presence of a relative back or forth displacement between the upper and lower vertebra due to one vertebra being oriented away from the smooth curvature of a normal spine. Aging-related illnesses such as degenerative spondylolisthesis are especially burdensome on social welfare and health-care systems in an aging society, especially radiologists and clinical physicians. Therefore, we proposed a computer aided diagnosis algorithm, named LumbarNet, for vertebral slippage detection on clinical X-ray images. Collaborating with i) a P-grade, ii) a piecewise slope detection scheme, and iii) a dynamic shift detection routine, LumbarNet was thus specialized for analyzing complex structural patterns in lumbar spine X-ray images and outcompeted other U-Net based methods. Extensive experiments on lumbar spine X-ray images in standard clinical practices showed that LumbarNet achieved a mean intersection over union value of 0.88 in vertebral region detection and an accuracy of 88.83% in vertebral slippage detection.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

Transforaminal lumbar interbody fusion (TLIF) is a commonly used technique for treating lumbar degenerative diseases. Here, we developed a fully computer-supported pipeline to predict the cage height and the degree of lumbar lordosis subtraction from the pelvic incidence (PI-LL) after TLIF surgery through preoperative X-ray images. The automated pipeline included two primary stages. First, a deep learning model was used to extract essential features from X-ray images. Second, five machine learning algorithms were trained to identify the optimal models to predict the interbody cage height and postoperative PI-LL. Lasso regression and support vector regression exhibited superior performance for predicting the interbody cage height and postoperative PI-LL, respectively. For cage height prediction, the root mean square error (RMSE) was calculated as 1.01, and the model achieved the highest accuracy at a height of 12 mm, with exact prediction achieved in 54.43% (43/79) of cases. In most of the remaining cases, the prediction error of the model was within 1 mm. In addition, the model demonstrated adequate performance for predicting PI-LL, with an RMSE of 5.19 and an accuracy of 0.81 for PI-LL stratification. In conclusion, the interbody cage height and postoperative PI-LL can be reliably predicted using artificial intelligence and ML models.

In this paper we study a class of impulsive delayed neural networks with parameter uncertainties and reaction-diffusion terms. Using the properties of M-matrices and some inequality techniques, some sufficient conditions are derived to guarantee the global exponential stability of the given system. The results obtained are presented by simple algebraic inequalities, which are certainly more concise than previous methods. Finally, the validity and usefulness of our results are illustrated by arithmetic examples.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Recommender Systems (RecSys) are crucial in managing information overload and enhancing user satisfaction across various digital platforms, including e-commerce and entertainment. Evolving from traditional models to Deep Neural Networks (DNNs) and, more recently, Large Language Models (LLMs), these systems leverage sophisticated algorithms to analyze user behaviors and preferences. LLMs, such as GPT-4, are trained on extensive datasets to comprehend and generate natural language, significantly advancing their ability to deliver personalized recommendations. This tutorial explores the transformative impact of LLMs on RecSys, discussing their development, application in handling complex datasets, and the integration of contextual insights. Real-world examples illustrate how LLMs enhance recommendation accuracy and user experience, highlighting challenges and future directions in the field.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

This paper proposed emotion recognition methods for consecutive facial images, and implements the inference of neural network model on a field-programmable gate array (FPGA). The proposed emotion recognition methods are based on a neural network model architecture that combines convolution neural networks (CNNs), long short-term memory (LSTM), and fully connected neural networks (FCNNs), called CLDNN or ConvLSTM-FCN. This type of neural network mod-el can analyze the local feature sequences obtained through convolution of data, making it suita-ble for processing time-series data such as consecutive facial images. In this paper, sequences of facial images are sampled from videos corresponding to various emotional state of subjects. The sampled images are then pre-processed with the processes includes facial detection, greyscale conversion, resize, and data augmentation if necessary. The 2-D CNN in ConvLSTM-FCN is used for feature extraction for these pre-processed facial images. These sequences of facial im-age features are time sequences with dependent properties between the elements within them. The LSTM is then used to model these time sequences followed by fully connected neural net-works (FCNNs) for classification. The proposed consecutive facial emotion recognition method achieves an average recognition rate of 99.51% on RAVDESS dataset, 87.80% on BAUM-1s dataset and 96.82% on eNTERFACE’05 data set, using 10-fold cross-validation on the PC. Some com-parisons of recognition accuracies between the proposed method and the other existing related works are conducted in this paper. According to the comparisons, the proposed emotion recog-nition methods outperform the existing related researches. The proposed emotion recognition methods are then implemented on an FPGA chip using the neural network model inference algo-rithms in this paper, and the accuracies of the experiments conducted on the FPGA chip are iden-tical to those obtained on the PC. This verifies that the proposed neural network model imple-mented on the FPGA chip performs well.

Hepatic encephalopathy (HE) reduces survival in cirrhotic patients and correlates with systemic inflammation and gut-liver disequilibrium. We investigated the association between propranolol treatment and outcomes for cirrhotic patients with HE. Using data from the Taiwan National Health Insurance Research Database, we identified 4,754 cirrhotic patients newly diagnosed with HE. Among them, 519 patients received propranolol treatment and the other 519 patients without exposure to propranolol were enrolled into our study, both of which were matched by sex, age, and propensity score. The median overall survival (OS) was longer in the propranolol-treated cohort than in the untreated cohort (3.46 versus 1.88 years, p<0.001). A dose-dependent increase in survival was observed (median OS: 4.49, 3.29, and 2.46 years in patients treated with propranolol >30mg/day, 20–30mg/day, and <20mg/day, respectively [p<0.001, p=0.001, and p=0.079 versus the untreated group]). In addition to reduce the risk of mortality (adjusted hazard ratio, 0.58; p<0.001), propranolol also diminished the risk of sepsis-related death (adjusted hazard ratio, 0.31; p=0.006) according to the multivariate analysis. However, the risk of circulatory or hepatic failure was non-significantly altered by propranolol treatment. In conclusion, propranolol treatment was associated with a better OS in cirrhotic patients with HE and its effects were dose-dependent.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.