The paper discusses the classification of fuzzy metrics based on their continuity conditions, dividing them into Erceg, Deng, Yang-Shi, and Chen metrics. It explores the relationships between these types of fuzzy metrics, concluding that a Deng metric in [0,1]-topology must also be Erceg, Chen, and Yang-Shi metrics. The paper also proves that the product of countably many Deng pseudo-metric spaces remains a Deng pseudo-metric space, and demonstrates some σ-locally finite properties of Deng metric space. Additionally, the paper constructs two interrelated mappings based on normal space and concludes that if a [0,1]-topological space is T1 and regular, and its topology has a σ-locally finite base, then it is Deng metrizable, and thus Erceg, Yang-Shi, and Chen metrizable as well.

Manual traffic surveillance can be a daunting task as Traffic Management Centers operate a myriad of cameras installed over a network. Injecting some level of automation could help lighten the workload of human operators performing manual surveillance and facilitate making proactive decisions which would reduce the impact of incidents and recurring congestion on roadways. This article presents a novel approach to automatically monitor real time traffic footage using deep convolutional neural networks and a stand-alone graphical user interface. The authors describe the results of research received in the process of developing models that serve as an integrated framework for an artificial intelligence enabled traffic monitoring system. The proposed system deploys several state-of-the-art deep learning algorithms to automate different traffic monitoring needs. Taking advantage of a large database of annotated video surveillance data, deep learning-based models are trained to detect queues, track stationary vehicles, and tabulate vehicle counts. A pixel-level segmentation approach is applied to detect traffic queues and predict severity. Real-time object detection algorithms coupled with different tracking systems are deployed to automatically detect stranded vehicles as well as perform vehicular counts. At each stages of development, interesting experimental results are presented to demonstrate the effectiveness of the proposed system. Overall, the results demonstrate that the proposed framework performs satisfactorily under varied conditions without being immensely impacted by environmental hazards such as blurry camera views, low illumination, rain, or snow.

The need for cross-modal retrieval (CMR) among users is growing because of the swift advancements in computer vision and natural language processing. Promoting home operating systems is greatly aided by the openKylin home operating system. It is focused on enhancing the functionality of the operating system with safe and dependable operating technologies. Practical implications abound for integrating computer vision research into home operating systems. A multimodal retrieval approach based on openKylin is presented to improve the usability of text search graphs, audio, and video. The overview of pertinent domestic and international research is the main topic of this article. This technological advancement. It then offers details on the design, implementation procedure, and final implementation outcomes for demonstration. The works of natural operations show that this strategy has excellent accuracy and performance.

A phenomenological constitutive model is developed to describe the uniaxial transformation ratcheting behaviors of super–elastic shape memory alloy (SMA) by employing a cosine–type phase transformation equation with the initial martensite evolution coefficient that can capture the feature of the predictive residual martensite accumulation evolution and the nonlinear hysteresis loop on a finite element (FE) analysis framework. The effect of the applied loading level on transformation ratcheting are considered in the proposed model. The evolutions of transformation ratcheting and transformation stresses are constructed as the function of the accumulated residual martensite volume fraction. The FE implementation of the proposed model is carried out for the numerical analysis of transformation ratcheting of the SMA bar element. The integration algorithm and the expression of consistent tangent modulus are deduced in a new form for the forward and reverse transformation. The numerical results are compared with those of existing model and the experimental results to show the validity of the proposed model and its FE implementation in transformation ratcheting. Finally, a FE modeling is established for a repeated preload analysis of SMA bolted joint

Exploring effective oxygen reduction reaction (ORR) electrocatalysts is crucial for progress in solid-state alkaline zinc-air batteries (ZAB). In this paper, silver-manganese dioxide-carbon nanotubes (SMC) ternary composites, which function as Electrocatalyst for air Electrodes, was produced via the pyrolysis of silver permanganate under microwave irradiation in one step. A scanning electron microscope (SEM), X-ray diffraction (XRD), and an energy dispersion spectrometer (EDS) have consistently determined that SMC consists of silver and alpha-manganese dioxide, which anchored on the surface of CNTs. Through polarization and chronoamperometery curves, the electrocatalytic activity of SMC for ORR was examined. The results reveal that SMC has higher catalytic activity than the chemically produced electrocatalyst for ORR in alkaline condition. Finally, a solid-state zinc-air cell with an electrocatalyst was constructed and tested. Constant current discharge curve of the zinc-air cell with SMC has a long discharge voltage plateau and a 60.03 mAh capacity at 30 mA · cm−2 . The mechanism of improvement in electrocatalytic activity was also discussed. In a summary, the strategy described in this study and the electrocatalyst produced can be regarded as an effective method for making a robust oxygen reduction catalyst toward solid-state zinc-air batteries.

The very slow anodic oxygen evolution reaction (OER) greatly limits the development of large-scale hydrogen production via water electrolysis. By replacing OER with easier urea oxidation reaction (UOR), developing a HER/UOR coupling electrolysis system for hydrogen production can significantly save energy and costs. Al doped cobalt ferrocyanide (Al-Co2Fe(CN)6) nanocube array was in-situ grown on nickel foam (Al-Co2Fe(CN)6/NF). Due to the unique nanocube array structure and regulated electronic structure of Al-Co2Fe(CN)6, the as-prepared Al-Co2Fe(CN)6/NF electrode exhibited outstanding catalytic activities and long-term stability to both UOR and HER. The Al-Co2Fe(CN)6/NF electrode needed potentials of 0.169 V and 1.118 V (vs. reversible hydrogen electrode) to drive 10 mA cm−2 for HER and UOR, respectively, in alkaline condition. Applying the Al-Co2Fe(CN)6/NF to a whole urea electrolysis system, 10 mA cm−2 was achieved at a cell voltage of 1.357 V, which saved 60% electricity energy comparing to that of tranditional water splitting. Density functional theory calculations demonstrated that the boosted UOR activity comes from Co sites with Al doped electronic environments. This promoted and balanced the adsorption/desorption of main intermediates in UOR process. This work indicates that Co based materials as efficient catalysts have great prospects for application in urea electrolysis systems, and are expected to achieve low-cost and energy-saving H2 production.

In an effort to enhance the efficiency and safety of open-pit mines, this study explores the optimization of end slope road parameters and slope structures, specifically focusing on unmanned driving lanes.A significant aspect of the study is the development of a truck trajectory offset model, which considers the different reaction times between automated sensors and human drivers in adapting to environmental changes. To test these concepts, the study uses numerical simulations to confirm the stability of the proposed end slope designs. Using Victory West Mine No. 1 as a case study, the research determines the optimized width for unmanned driving lanes and the maximum angle for safe steepening of end slopes. The findings indicate that the optimized unmanned lane width for NTE240 mining dump trucks is 1743 mm, allowing for a 2-degree increase in the slope angle at the south end slope. This optimization leads to a steep mining stripping volume of 3.2735 million m³ and a coal output of 2.49628 million tons, maintaining a stripping ratio of 1.31m³/t. These results demonstrate that the unmanned driving road width optimization not only ensures slope safety but also significantly boosts the economic benefits of steep mining in open-pit mines.

We assessed the growth performance, physiological traits, and gene expressions in steers fed with dietary rumen-protected L-tryptophan (RPT) under cold environment. Eight Korean native steers were assigned to two dietary groups, no RPT (Control) and RPT (0.1% RPT supplementation on a dry matter basis), 6 wks. Maximum and minimum temperatures throughout the experiment were 6.7°C and -7.0°C, respectively. Supplementation of 0.1% RPT to a total mixed ration did not increase body weight but had positive effects of elevating average daily gain (ADG) and reducing the feed conversion ratio (FCR) at day 27 and 48. Metabolic parameter showed higher glucose level (at day 27) in the 0.1% RPT group compared to the control group. Real-time PCR analysis showed no significant differences in the expression of muscle (MYF6, MyoD, and Desmin) metabolism genes between the two groups, whereas the expression of fat (PPARγ, C/EBPα, and FABP4) metabolism genes was lower in the 0.1% RPT group than in the control group. Thus, we demonstrate that long-term (6 wks) dietary supplementation of 0.1% RPT was beneficial owing to enhanced growth performance by increasing ADG and glucose level, decreasing FCR, and maintaining homeostasis in immune responses in beef steers during cold environment.

Dissolved organic matter (DOM) derived from organic fertilizers may increase soil phosphorus (P) availability. However, the frequently observed correlation between soil P availability and dissolved organic carbon (DOC) content has led to an excessive focus on DOC content at the expense of DOM properties. The present study investigated the influence of DOM characteristics on soil P availability by using a 6-year field experiment and microcosms of P sorption in paddy soil. Our results showed that partial replacement of chemical P fertilizer with manure or crop straw increased P fertilizer-use efficiency, even when decreasing chemical P input by 34 %, compared to normal chemical fertilization. The microcosm experiment demonstrated that DOM properties, rather than total DOC content, determine soil P sorption capacity, despite the significant correlation between DOC content and P availability observed in the field experiment. Manure-DOM exerted stronger inhibitory effects on P sorption than straw-DOM, and high molecular weight (HMW)-fractionated DOM exerted stronger inhibitory effects on P sorption than low-molecular-weight-fractionated DOM by 16-20%. The mechanism was rooted in the HMW DOM with unique characteristics (e.g., strong aromaticity, hydrophobicity, abundant humic-like components, carboxyl groups, and benzene ring structures) competing for soil P sorption sites (e.g., reduction in specific surface area and micropore volume), decreasing the soil surface charge (e.g., zeta potential), and thereby suppressing P sorption in paddy soil. Our study points out a promising avenue for regulating organic matter properties with organic fertilization to improve P use efficiency in agricultural soils.

During their growth, bacteria respond to complex environmental changes through equally com-plex and orderly regulatory mechanisms. sRNA has an important role as a post-transcriptional regulator in the environmental adaptation of Bacillus. In this study, we identified an sRNA Bvs091 located in the intergenic region of the Bacillus velezensis, which is widely present in the genus Bacillus and whose expression is upregulated by salt treatment. The deletion of bvs091 in B. ve-lezensis PEBA20 led to a reduced growth rate and a change in the phenotypes, with simple colony structures and low and easily degradable biofilm. Salt tolerance tests indicated that the deletion of bvs091 results in a reduced salt tolerance. galT2 mRNA is supposed to be a direct target of Bvs091 according to results obtained by using the bioinformatic method and performing qRT-PCR analysis. The microscale thermophoresis (MST) analysis showed that Bvs091 could directly bind 28‒51 bases in front of the promoter of galT2. Subsequently, the deletion of galT2 in B. velezensis resulted in increased salt tolerance. Based on the techniques of double plasmids and a half-life period, sRNA Bvs091 is confirmed as a trans-encoded sRNA that negatively regulates the mRNA expression of galT2. In brief, the trans-encoded sRNA Bvs091 acts by pairing the incomplete complementary bases of galT2 mRNA, reducing galT2 mRNA’s stability and affecting the trans-lation efficiency.

Flavonoids are major secondary metabolites in plants, which play important roles in maintaining the cellular redox balance in cells. Chalcone synthase (CHS) is the key enzyme in the flavonoids biosynthesis pathway, and has been proved to monitor the changes to drought stress tolerance. In this work, we overexpressed a CHS gene in tobacco (Nicotiana tabacum). The transgenic tobacco plants were more tolerant than the control plants to drought stress. The transcription levels of the key genes involved in the flavonoids pathway and the contents of seven flavonoids were also significantly raised in the transgenic tobacco plants. In addition, overexpression of the CHS gene lead to a lower concentration of the oxidative stress product malondialdehyde. Overall, the NtCHS gene studied in this work was considered as a candidate gene for genetic engineering to enhance drought tolerance of plants and improve response to oxidative stress.

Currently there are fewer depth models applied to pepper picking detection, while the existing generalized neural networks have problems such as large model parameters, long training time, and low model accuracy.In order to solve the above problems, this paper proposes a Yolo-chili target detection algorithm for chili pepper detection. First, the classical target detection algorithm yolov5 is used as a benchmark model, and an adaptive spatial feature pyramid structure combining the attention mechanism and the idea of multi-scale prediction is introduced to improve the model's detection effect on occluded peppers and small target peppers. Secondly, a three-channel attention mechanism module is introduced to improve the algorithm's long-distance recognition ability and reduce the interference of redundant testers. Finally, the quantized pruning method is used to reduce the model parameters and realize the lightweight processing of the model. Applying the method to the homemade chili pepper dataset, the AP value of chili pepper reaches 93.11%; the accuracy rate is 93.51% and the recall rate is 92.55%.The experimental results show that yolo-chili is able to achieve accurate and real-time pepper detection under complex orchards.

Abstract: Plant types and soil bacterial communities had a close relationship, understanding the profound association between them contributes to better learn bacterial ecological function for plant growth. In this study, rhizosphere soil of six different chemotype Cinnamomum camphora trees were collected, including C. bodinieri var. citralifera, [C. camphora (Linn.) Presl], camphora-type, cineole-type, linalool-type and isoborneol-type. Soil properties content and bacterial communities were analyzed. Two chemotype C. camphora, including [C. camphora (Linn.) Presl] and linalool-type, shaped similar bacterial community structure, decreased Firmcutes relative abundance. richness estimators (Chao1 index and Ace index) of [C. camphora (Linn.) Presl] were decreased compared with the others. Furthermore, soil bacterial community structure was also similar among bodinieri var. citralifera, camphora-type, cineole-type and isoborneol-type. Hence, different chemotype C. camphora altered soil nutrient and shaped rhizosphere bacterial communities.

In order to correct attenuated millimeter-wavelength (Ka-band) radar data and address the problem of instability, an attenuation correction methodology (attenuation correction with variation trend constraint; VTC) was developed. Using synchronous observation conditions and multi-band radars, the VTC method adopts the variation trends of reflectivity in X-band radar data captured with wavelet transform as a constraint to adjust reflectivity factors of millimeter-wavelength radar. The correction was evaluated by comparing reflectivities obtained by millimeter-wavelength cloud radar and X-band weather radar. Experiments showed that attenuation was a major contributory factor in the different reflectivities of the two radars when relatively intense echoes exist, and the attenuation correction developed in this study significantly improved data quality for millimeter-wavelength radar. Reflectivity differences between the two radars were reduced and reflectivity correlations were enhanced. Errors caused by attenuation were eliminated, while variation details in the reflectivity factors were retained. The VTC method is superior to the bin-by-bin method in terms of correction amplitude and can be used for attenuation correction of shorter wavelength radar assisted by longer wavelength radar data.

Silicon carbide single crystal (SiC) has been widely used in the field of power devices, while it is difficult to fabricate ultra-flat surface by traditional manufacturing technologies due to its difficult-to-machine property. This paper investigates the interaction process during femtosecond laser ablation of crystalline silicon carbide based on the two-temperature model simulation and experimental study. The findings reveal that parameters such as laser pulse energy, scanning interval, and defocus amount exert significant influence on ablation depth, roughness, and surface morphology. The femtosecond laser proves effective in removing surface defects from cut SiC substrates, albeit resulting in increased surface roughness. However, subsequent polishing treatment of the laser-ablated silicon carbide surface can mitigate this roughness, underscoring the feasibility of laser surface ablation for silicon carbide single crystals.

Industrial process control systems commonly exhibit features of time-varying, strong coupling, and strong nonlinearity. Obtaining accurate mathematical models of these nonlinear systems and achieving satisfactory control performance is still a challenging task. In this paper, data-driven modeling techniques and deep learning methods are used to accurately capture a category of smooth nonlinear system’s spatiotemporal features. The operating point of these systems may change over time, and their nonlinear characteristics can be locally linearized. We established the LSTM-CNN-ARX model by utilizing a fusion of long short-term memory (LSTM) network and convolutional neural network (CNN) to fit the coefficients of the state-dependent exogenous variable autoregressive (SD-ARX) model. Compared to other models, the hybrid LSTM-CNN-ARX model is more effective in capturing the nonlinear system’s spatiotemporal characteristics due to its incorporating the strengths of LSTM for learning temporal characteristics and CNN for capturing spatial characteristics. The model-based predictive control (MPC) strategy, namely LSTM-CNN-ARX-MPC, is developed by utilizing the model's local linear and global nonlinear features. The control comparison experiments conducted on a water tank system (WTS) show the effectiveness of the developed models and MPC methods.

Introduction The Pericapsular Nerve Group (PENG) block is a novel technique that allows for analgesia of the anterior hip capsule via the articular branches of the accessory obturator nerve and femoral nerve, which have a significant role in the innervation of the hip capsule. PENG blockade is effective in both adult and pediatric patients. However, there are no studies in the available literature on patients under five years of age. Herein, we describe our experience with two pediatric patients with hip dysplasia. Purpose This study aimed to evaluate the analgesic effect of the pericapsular nerves group (PENG) in small children undergoing hip surgery. Patients and methods This study included two patients, aged 2 and 4 years old, who qualified for hip surgery. General or spinal anesthesia with the addition of a PENG block was performed. During the procedure, the basic hemodynamic parameters were monitored. After the surgery, the patients received 15mg/kg-1 iv paracetamol every 6 hours to prevent rebound pain. The pain was assessed using the FALCC score. The 15mg/kg-1 metamizole was administered if the FLACC score was 3. In the FLACC score 4, the application of 0,2mg/kg-1 Nalpain was ordered. Results The patient's hemodynamic parameters were stable and within normal range. FLACC scores from all patients ranged from 0 and 3 in the first 24 h period. One patient required metamizole 12 hours after surgery. No evidence of block complications was observed. Conclusions This case series showed that PENG block provided adequate postoperative analgesia and assured opioid-free pain management. However, we are convinced that future randomized, controlled trials are needed in this field.

The uncertainty in the secondary path of an Active Noise Control (ANC) headphone affects the waterbed effect and stability of the feedback system. This study focuses on the uncertainty of the secondary path when real users wear headphones, and proposes a new uncertainty constraint based on the measured results of the secondary path transfer function under different wearing conditions of dummy head and limited subjects. This constraint and a cascaded second-order infinite impulse response filter with fixed coefficients are used to formulate a control strategic function, which is optimized by the Improved Grey Wolf Optimizer (IGWO) algorithm to obtain the optimal controller with better noise reduction performance. The proposed method and simulation model are validated based on the experimental test results. The results demonstrate that the safety factor and waterbed suppressing factor contained in the proposed uncertainty constraint ensures more stable noise reduction and effective suppression of the waterbed effect for new subjects without a priori data.

In this paper, a class of nonlinear ordinary differential equations with impulses at variable times is considered. The existence and uniqueness of solution are given. At the same time, modifying the classical definitions of continuous dependence and Ga^teaux differentiability, some results on continuous dependence and Ga^teaux differentiable of solution relative to the initial value also are presented in new topology sense. For the autonomous impulsive system, the periodicity of solution is given. As an application, properties of solution for a type of controlled nonlinear ordinary differential equation with impulses at variable times is obtained. These results are foundation to study optimal control problems of systems governed by the differential equations with impulses at variable times.

The Shimensi super-large tungsten polymetallic deposit is located in Late Jurassic- Early Cretaceous Porphyry-Skarn tungsten ore belt in the south Yangtze metallogenic belt. There are 3 types of mineralization: veinlet-disseminated type, thick quartze vein type and hydrothermal crypto-explosive breccia type. Based on geological studies, this paper presents new petrographic, microthermometric, laser Raman spectroscopic and hydrogen and oxygen isotope research of the fluid inclusions from the deposit. The results show that there are five different types of fluid inclusions: liquid-rich inclusions, vapor-rich inclusions, pure liquid inclusions, pure vapor inclusions, and fluid inclusions containing a solid crystal. The homogenization temperatures of the fluid inclusion range from 140℃-270℃, the salinities are 3%-5% NaCleq and the densities of ore-forming fluid range from 0.64 g/cm3 to 0.99 g/cm3. For the analyses of Laser Raman spectroscopic, the ore-forming fluids can be approximated by a Ca2+-Na+-SO42--Cl- fluid system with small amount of CO2, CH4 and N2. Otherwise, the datas of the pressure, pH and Eh show a fluid metallogenic environment of low pressure, weak acid and weak reduction. The values of the homogenization temperature in 3 types of orebodies suggest that the mineralization is characterized by the decrease of the temperature under the condition of the fluid immiscibility. The H-O isotope values are interpreted to indicate that the ore-forming fluids are mainly composed of magmatic water, and also the meteoric water was added with the process of the magma rising.

Buckling defect will appear on the outer surface of the deformed ring during constrained ring rolling (CRR) of aluminum alloy thin wall conical ring with inner high ribs (AATWCRIHR), if the geometrical dimension of the ribs doesn't match the wall thickness. To avoid the buckling defect, a quantitative method for characterizing the degree of the buckling defect is proposed using the area of buckling profile. Then an orthogonal experimental scheme was designed taking the width of the middle rib, thickness of wall, and height of the middle rib as design variables and defining the area of buckling profile as optimization objective. Subsequently, a quadratic polynomial response surface model was established by combining the optimization algorithm with the finite element method (FEM), and the geometrical dimension of the middle ribs of the deformed AATWCRIHR is optimized. Also the optimal parameter combination to minimize the area of buckling profile is obtained and verified using FE simulation. Results show that the AATWCRIHR after optimization doesn’t generate the buckling defect during constrained ring rolling, and it is proved that the quantitative buckling defect representation method and the optimization design method based on the response surface model and the finite element simulation results are feasible for the constrained ring rolling process of the AATWCRIHR.

The intestinal microbiota, comprised of bacteria, archaea, and phages, inhabits the gastrointestinal tract of the organism. Male reproductive sterility is currently a prominent topic in medical research. Increasing research suggests that gut microbiota dysbiosis can result in various reproductive health problems. This article specifically investigates the impact of gut microbiota dysbiosis on male reproductive infertility development. Gut microbiota imbalances can disrupt the immune system and immune cell metabolism, affecting testicular growth and sperm production. This dysfunction can compromise the levels of hormones produced and secreted by the endocrine glands, affecting male reproductive health. Furthermore, imbalance of the gut microbiota can disrupt the gut-brain-reproductive axis, resulting in male reproductive infertility. This article will explore how the imbalance of the gut microbiota impacts male reproductive infertility through immune regulation, endocrine regulation, and interactions of the gut-brain-reproductive axis, concluding with recommendations for prevention and treatment.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

With the increasingly stringent airworthiness standards, the noise generated during the rotorcraft flight is gradually attracting people’s attention. It widely operated helicopters at low altitudes because of their maneuverability. The way to reduce the noise caused by the complex airflow of the helicopter rotor system has progressively become a hot topic for researchers. Using a hybrid acoustic analysis method, this paper investigates the improvement of the noise and thrust of the helicopter’s tail rotor through the tail rotor structural parameters. For the basic model, the turbulence simulation is performed using an incompressible detached eddy simulation (DES) method, and the Lighthill acoustic analog equation is calculated using the finite element method (FEM). We verified the accuracy of the method through wind tunnel tests. We chose a series of structural parameters for sound simulation and fluid simulation calculations. The results indicate that the modified tail rotor noise reduced by 16.5 dBA and the total thrust increased by 19.9% from the prototype model. This work can enhance the duct tail rotor design to improve aerodynamic and aeroacoustic performance.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

The intricate relationship between physical and social environments within organizations plays a pivotal role in shaping sustainable innovation endeavors. This paper presents a comprehensive analysis of two key dynamics that have garnered substantial scholarly attention for promoting sustainable innovation: the physical environment and the organizational climate. To elucidate the intricate interplay between these dynamics, we propose a novel three-dimensional framework that guides the modeling of the intricate processes through which the physical environment and innovation climate synergistically influence innovation outcomes. Building on this framework, we delve into an in-depth literature review concerning physical environments that exert a significant impact on innovation. Through this review, we identify and elaborate on four pivotal elements of the physical environment: communality, personalization, comfort, and healthiness. Leveraging insights gleaned from this review, we outline two promising avenues for future research in the realm of the physical environment's interaction with the innovation climate. Furthermore, we underscore the critical importance of adopting an interdisciplinary approach that seamlessly integrates insights from both the physical and social domains to comprehensively understand the sustainable innovation landscape.

The rapid urbanization has exerted tremendous pressure on natural systems in mountains. As a measure of sustainable use of natural resources, ecological footprint is an important basis for judging whether the development of a country or region is within the biocapacity. Taking Dali Bai Autonomous Prefecture as an example, this study comprehensively analyzes the impact of human activities on mountain resources and environment from the three aspects of urbanization, land use and ecological carrying capacity. The results show that Dali Prefecture with the urbanization rate of 33% is still in the accelerated stage of urbanization. The urban space presents the core-periphery feature, and the central city is the focus of human existence and living activities. The per capita ecological footprint is 1.14 hm2/person higher than the ecological carrying capacity, meaning Dali Prefecture is in an ecological deficit state. This indicates that there is an uncoordinated state between urbanization and environment. Arable land is the main source of per capita ecological footprint in the prefecture. However, the urban expansion overly occupies the arable land in the plain sub-region, leading the arable land to an ecological deficit state. In the future, the development of the mountainous area should focus on the protection of arable land and choose a new sustainable path.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Reasonable allocation of production plans and saving the overall electricity cost are crucial for large manufacturing conglomerates, which is an effective way for conglomerates to realize open-source and cost-saving. This paper develops an optimization model of off-site industrial production scheduling for enterprises in response to the problems of high electricity costs due to the irrational allocation of production schedules on the demand side of China's electric power and the difficulty of promoting industrial and commercial distributed photovoltaic (PV) projects in China. The model makes full use of the conditions of different PV resources and different electricity prices in different places to optimize the scheduling of industrial production in different places. The model is embedded with two sub-models of the electricity price prediction model and distributed photovoltaic kWh cost model to complete the model parameters, in which the electricity price prediction model utilizes the LSTM neural network. The integrated model is then solved by the particle swarm algorithm. To verify the effectiveness of the model in solving the problem of off-site production scheduling on the demand side of electricity, the research team researched two off-site pharmaceutical factories belonging to the same large pharmaceutical company. Finally, the research data were substituted into the model for solving, and it was concluded that the optimization model could significantly reduce the cost of electricity consumption of the enterprise by about 7.9 %.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Information encryption and anti-counterfeiting play an important role in many aspects of daily life, such as in minimizing economic losses, protecting secure communication and public security, and so on. Owing to the high information capacity and ease of operation, luminescent materials for advanced information encryption and anti-counterfeiting are essential to meet the increasing demand on encryption security. Herein, we summarize two emerging luminescent materials for information encryption and anti-counterfeiting, the AIE materials and room-temperature phosphorescent materials. At last, we discuss the opportunities and anticipations of these two information encryption and anti-counterfeiting materials.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (>90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

Machine learning is a fundamental aspect of artificial intelligence that involves the development of algorithms and models that allow computers to learn and make predictions or decisions without explicit programming. With the development of neural networks, back-propagation algorithms and deep learning, machine learning has made breakthroughs in the fields of image recognition, natural language processing and handwriting recognition using machine learning techniques. The advent of deep learning has revolutionized the field of handwriting recognition, using convolutional neural networks, recurrent neural networks, and sequence-to-sequence models to provide solutions that go beyond machine learning methods and significantly improve the accuracy and robustness of handwriting recognition systems. But challenges remain, including the need for large labelled datasets, computational resources and addressing potential biases. As research in deep learning techniques continues to drive handwriting recognition closer towards realisability, machine learning approaches remain at the forefront.

Formal Calculation uses an auxiliary form to calculate various nested sums and provides results in three forms. In addition to computation, it is also a powerful tool for analysis, allowing one to study various numbers in a unified way. This article contains many results of two types of Stirling numbers, associated Stirling numbers, and Eulerian numbers, making a great generalization of Euler polynomials, Wilson's theorem, and Wolstenholme's theorem, showing that they are just special cases. Formal Calculation provides a novel method for obtaining combinatorial identities and analyzing q-binomial.This article has obtained a large number of results in q-analogues, including inversion formulas for q-binomial coefficients. This article also introduces a theorem on symmetry.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

This study uses a recently developed theory and technique to examine post-acquisition evidence as to the motives for mergers and acquisitions(M&As), and decomposed the M/B ratio into three components: firm-specific error, time-series sector error, and long-run value-to-book. We make a multidimensional grouping according to the frequency of M&As , payment method, proportion of shares acquired, M/B ratio before the merger and total assets of the acquirers before the merge. The results confirm that M&As involve multiple motives, such as market timing, industry and economic shocks, agency and hubris. Using a sample of 2,035 M&As in China, we find that 59% are related to market timing, 68% are related to agency and hubris, 21% are related to industry and economic shocks, 51% are related to multiple motives. Our empirical research finds that the main motives for M&As of listed companies in China are value-decreasing, which have negative impact on the acquirers‘ sustainable development.

A highly efficient reduction process of Cr (VI) with biochar was conducted in this paper. The results showed that nearly 100% Cr (VI) was reduced at selected reaction conditions: the dosage of biochar at m (C)/m(Cr) = 3.0, reaction temperature of 90 ℃, reaction time at 60 min and concentration of H2SO4 of 20 g/L, respectively. The reduction kinetics analysis demonstrated that the reduction of Cr (VI) fitted well with the pseudo-first-order model and the apparent activation energy was calculated to 40.24 kJ/mol. Response surface methodology confirmed that all the experimental parameters had positive effect on the reduction of Cr (VI). The influence of each parameter on the reduction process followed the order: dosage of biochar> Concentration of H2SO4 > Reaction Temperature > Reaction Time. This paper provided a versatile strategy for treatment of wastewater containing Cr (VI) and showed a bright tomorrow for wastewater treatment.

The time-dependent behavior and long-term stability of deep-buried tunnels in soft rocks have received lots of considerations in tunnel engineering and allied sciences. To better explore and deepen the engineering application of rock creep, extensive research studies are still needed, although fruitful outcomes have already obtained in many related investigations. In this article, the Weilai Tunnel in China’s Guangxi province is studied taking its host rocks as the main research object. In fact, aiming at forecasting the time-varying deformation of this tunnel, a novel elasto-visco-plastic creep constitutive model with two variants is proposed, by exploiting the typical complex load-unload process of rock excavation. The model is well validated and good agreements are found with the relevant experimental data. Moreover, the time-dependent de-formation rules are properly established for the surrounding rocks, by designing two new closed-form solutions based on the proposed creep model and the Hoek-Brown criterion. The convergence deformations calculated from the closed-form solutions conform well to the on-site monitoring data. In only 27 days after excavation, the creep deformation of the Weilai tunnel overtakes 400 mm, which is enormous. To guarantee the long-term stability of this tunnel, a ro-bust support scheme and its long-term monitoring with appropriate remote sensors are strongly suggested.

This work investigated the isothermal holding time dependence of the densification, microstructure, weight loss and tensile properties of Fe-Mn-Si powder compacts. Elemental Fe, Mn and Si powder mixtures with a nominal composition of Fe-28Mn-3Si (in weight percent) were ball milled for 5h and subsequently pressed under a uniaxial pressure of 400 MPa. The compacted Fe-Mn-Si powder mixtures were sintered at 1200 ℃ for 0, 1, 2 and 3 h, respectively. In general, the density, weight loss and tensile properties increased with the increase of isothermal holding time. A significant increase in density, weight loss and tensile properties occurred in the compacts isothermally holding for 1 h, as compared to those with no isothermal holding. However, further extension of isothermal holding time (2 and 3 h) only played a limited role in promoting the density and tensile properties. The weight loss of the sintered compacts was mianly caused by the sublimation of Mn in Mn depletion region on the surface layer of the sintered Fe-Mn-Si compacts. The length of the Mn depletion region increased as isothermal holding time increased. A single α-Fe phase was detected on the surface of all the sintered compacts, and the locations beyond the Mn depletion region were comprised of a dual dominant γ-austenite and minor ε-martensite.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

The effect of wave forces on the structural safety of fixed oscillating water-column (OWC) devices is critical. In this study, a three-dimensional numerical model of an oscillating water column (OWC) device is constructed using the computational fluid dynamics software OpenFOAM. Subsequently, the hydrodynamic performance of the numerical model is comprehensively validated. Finally, the hydrodynamic performance data are analyzed in detail to obtain meaningful conclusions. The results indicate that the horizontal wave force on the OWC device is approximately 6.6 to 7.9 times greater than the vertical wave force, whereas the lateral wave force is relatively small. Both the horizontal and vertical wave forces decrease as the relative water depth increases under a constant wave period and height. The horizontal wave force increases linearly with the wave height, whereas the vertical wave force increases with the square of the wave height. In addition, the highest dynamic water pressure is observed at the interface between the water surface and device, both within and outside the front wall of the gas chamber. The dynamic water pressure at different locations on the front chamber increases and subsequently decreases as the wave frequency increases.

Nicotine exposure may affect NSCLC is associated with lung cancer in humans. Whether nicotine exhibits carcinogenesis promoted activities in tumor growth still unknown. Nicotine is known to have dichotomous effects on cancer biology, acting like a pro- or anti-carcinogenesis agent. There are different functions between adenocarcinoma and squamous NSCLC cancer cells. Excess generation of nicotine may inhibit mitochondrial metabolism, protein modification, and DNA cleavage. Materials and Methods: We used the H520 NSCLC line obtained from human lung epithelial cells to detected nicotine growth and toxicity using MTT assay and western blotting. The concentration of nicotine stimulated cell growth to correspond to low concentration, while high concentration was cytotoxic. Results: According to MTT assay results, at 1.0 μM nicotine has significantly enhanced the H520 cell viability (%). Nicotine induced lung cancer carcinogenesis through mechanisms of α7nAchR, EGFR, HDAC2/4/5, Cyclin D/Cyclin E, Bcl-2, p-Akt, and inflammatory proteins of NF-KappaB and COX2 increases at 1.0 μM. Apoptosis proteins were decreases at 1.0 μM nicotine by p21, p27, c-jun, and p38α using western blotting. Nicotine stimulates tumor growth is mediated through α7nicotinic-acetylcholine receptors (α7nAChR), possibly involving inflammation. On the other hand, at high nicotine concentrations (> 1.0 μM) with consistent cytotoxic effects and appeared to be due to direct cell kill. Nicotine can prevent apoptosis induced by NSCLC. Conclusion: Therefore, the effects on chemotherapeutics by NSCLC malignant cell lines, nicotine in concentrations as low as 1.0 μM decreased. These mechanisms are responsible for the genotoxic effects caused by nicotine. This leads to downstream effects on decreased apoptosis, increased cell proliferation and transformation. The malignant NSCLC cells respond to the treatment with nicotine in lung cancer, the nicotine-mediated induction of growth may provide one of its links to α7nAchR or EGFR.

The ongoing outbreak of the novel coronavirus pneumonia (also known as COVID-19) has triggered a series of stringent control measures in China, such as city closure, traffic restrictions, contact tracing and household quarantine. These containment efforts often lead to changes in the contact pattern among individuals of the population. Many existing compartmental epidemic models fail to account for the effects of contact structure. In this paper, we devised a pairwise epidemic model to analyze the COVID-19 outbreak in China based on confirmed cases reported during the period February 3rd--17th, 2020. By explicitly incorporating the effects of family clusters and contact tracing followed by household quarantine and isolation, our model provides a good fit to the trajectory of COVID-19 infections and is useful to predict the epidemic trend. We obtained the average of the reproduction number $R=1.494$ ($95\%$ CI: $1.483-1.507$) for Hubei province and $R=1.178$ ($95\%$ CI: $1.145-1.158$) for China (except Hubei), suggesting that some existing studies may have overestimated the reproduction number by neglecting the dynamical correlations and clustering effects. We forecasted that the COVID-19 epidemic would peak on February 13th ($95\%$ CI: February $9-17$th) in Hubei and 6 days eariler in the regions outside Hubei. Moreover the epidemic was expected to last until the middle of March in China (except Hubei) and late April in Hubei. The sensitivity analysis shows that ongoing exposure for the susceptible and population clustering play an important role in the disease propagation. With the enforcement of household quarantine measures, the reproduction number $R$ effectively reduces and epidemic quantities decrease accordingly. Furthermore, we gave an answer to the public concern on how long the stringent containment strategies should maintain. Through numerical analysis, we suggested that the time for the resumption of work and production in China (except Hubei) and Hubei would be the middle of March and the end of April, 2020, respectively. These constructive suggestions may bring some immeasurable social-economic benefits in the long run.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

Transverse momentum spectra of +, p, Λ, Ξ or ¯Ξ+, Ω or ¯Ω+ and deuteron (d) in different centrality intervals in Gold-Gold (Au-Au) and Lead-Lead (Pb-Pb) collisions at 62.4 GeV and 2.76 TeV respectively, are analyzed by the blast wave model with Boltzmann Gibbs statistics. We extracted Kinetic freeze out temperature,transverse flow velocity and kinetic freezeout volume from the transverse momentum spectra of the particles. It is observed that the non-strange and strange (multi-strange) particles freezeout separately due to different reaction cross-sections. While the freezeout volume and transverse flow velocity are mass dependent which decrease with the rest mass of the particles. The present work reveals the scenario of double kinetic freezeout in collisions at STAR and ALICE Collaborations. Furthermore, the kinetic freezeout temperature and freezeout volume are larger in central collisions than the peripheral collisions and they decrease from central to periphery. However the transverse flow velocity remains almost unchanged from central to peripheral collisions.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In this study, a 5vol. % (TiBw+TiCp)/Ti composite pancake with a diameter of 260mm was prepared by casting followed by open die forging in (α+β) phase region. The microstructures of the composite pancake are inhomogeneous, in terms of both matrix microstructure and distribution of reinforcements. The matrix microstructures were gradually refined from the periphery to centre of the pancake. The TiBw and TiCp reinforcements tend to be uniformly distributed in the centre region and. It is suggested that the microstructure difference can be mainly ascribed to the temperature variation from the periphery to the centre. Additionally, tensile testing results showed that the centre region of the composite pancake exhibits higher strength than the peripheral region. The strengthening mechanism and the softening behavior of the composite pancake with temperature is discussed.

With the increasingly online exposure of urban public spaces, the new concept of "Internet-celebrity cities" has emerged in China. The online internet-famous sites are the main characteristics of "Internet-celebrity cities". To fully understand online users' preferences in such kind of public spaces, this article took 27 typical riverfront internet-famous sites (RIFS) in Changsha city (China), as an example. Through the online images and review comments on social media platform "Xiaohongshu", the study analyzed users’ perception of RIFS specially on visual and emotional preferences. It revealed the following findings:(1) The popularity of RIFS had a significant head effect and there were far more positive emotions than neutral and negative emotions in review comments. (2) According to 5 different categories of RIFS: modern buildings with river views, restaurants with strong visual impact became the main attractions on commercial RIFS. The art exhibition RIFS attracted visitors to experience traditional culture and highlight their aesthetic pursuits. In the historical and cultural RIFS, people preferred to see the historical buildings with surrounding natural environment, as well as river and mountains views. Ecological Recreational RIFS showed the similar results with the uncultivated RIFS, for the main focus was on the ecological environment, a broader vision and the specific atmosphere. Moreover, the uncultivated RIFS showed more diversified attraction points. This study can provide a new perspective on the waterfront vitality and can offer a targeted and attractive manner for waterfront regeneration that are different from traditional methods.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

The COVID-19 pandemic has profoundly changed the world and human society in various ways. Infection-related figures are key indicators of the direct impact of the pandemic. In addition to the virus, many vulnerable populations (e.g. patients with complex health conditions) have suffered direct or indirect health impacts, such as delayed treatment or diagnosis of cancer and severe mental illness due to stay-at-home restrictions, or financial issues. Studying these kinds of impacts can provide the community with insights and understanding of how the pandemic has affected patients with health conditions and help inform decision-makers design policies that support various vulnerable populations. This paper surveys analytical work conducted on how COVID-19 has impacted patients with complex health conditions. We categorise vulnerable populations into three specific cohorts: patients with chronic disease, patients with cancer and patients with end-of-life care. We then investigate how each of these cohorts has been impacted by the pandemic. We also identify each cohort from an analytics perspective by leveraging various data collection strategies and analytical methods. The goals of this paper are to provide evidence on how to improve the quality of life for vulnerable populations and to inform a national response strategy for future pandemics, which seems inevitable in a highly globalised economy.

In order to enhance the accuracy of the relative velocity measurement for the Mars explorer formation flight, we develop a relative velocity measurement method. In this method, the spectrometers at two Mars explorers are adopted to measure the starlight frequency shift and to estimate the velocity with respect to the star. Unfortunately, the instantaneous velocity of star can not be predicted accurately, which results in a large error in the velocity measurement. The difference of these two velocities, which does not include the proper motion of star, is the relative velocity between a pair of Mars explorers at the direction of the star. However, this navigation method can not work alone because of unobservability. To make the navigation system observable and improve the accuracy of both absolute and relative navigation for the Mars explorer formation flight, we combine it with X-ray pulsar navigation and the inter-satellite links, and propose an autonomous integrated navigation method with observability. In this integrated navigation scheme, the extended Kalman filter is adopted to deal with the relative velocity, the inter-satellite links and the pulse time-of-arrival, and estimate the absolute and relative navigation information for the Mars explorer formation flight. The simulation results demonstrate that both absolute and relative navigation accuracy of the proposed method are higher than that of the pulsar navigation, especially the relative one.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Mulberry is an economically significant crop for the sericulture industry worldwide. Stresses such as drought exposure have a significant influence on plant survival. Metabolome directly reflects plant physiological status; thus, a way to assess this impact is to perform a global metabolomic analysis. This study investigated the effect of drought stress on mulberry Yu-711 metabolic balance using a liquid chromatography-mass spectrometry (LC-MS) based on an untargeted metabolomic approach. For this objective, Yu-711 leaves were subjected to two weeks of drought stress treatment and control without drought stress. Multivariate and univariate statistical analyses highlighted numerous differentially-accumulated metabolic elements as a function of time and treatment. Drought stress led to a more differentiated metabolites response than the control. We found that the levels of total lipids and galactolipids, and phospholipids (PC, PA, PE) were significantly altered, producing 48% of the total differentially expressed metabolites. Fatty acyls were the most abundant lipids expressed and decreased considerably by 73.6%. Prenol lipids class of lipids increased in drought leaves. Other classes of metabolites, including polyphenols( flavonoids and cinnamic acid), organic acid (amino acids), carbohydrates, benzenoids, and organoheterocyclic, all had a dynamic trend in response to the drought stress. However, their levels under drought stress generally decreased significantly compared to the control. These results provide an overview of the metabolic profile of the mulberry plant through differentially-accumulated compounds and provide a better understanding of global plant metabolic changes in defense mechanisms.

High density of buildings and the large traffic volume of cities give rise to narrow spaces and high passenger flows in most subway stations. When evacuation is required during an emergency, these problems may trigger issues in operational safety. Therefore, it is imperative to comprehensively assess subway station emergency evacuation times and capacities during the operating process to ensure the design is safe, science-based, and rational. To further enhance safe evacuation capacity, this paper proposes an overall evacuation time model that considers the multielement charac-teristics of subway stations in multiple segments. The evacuation route is decomposed into five stages according to the critical nodes in the evacuation process. An overall emergency evacuation time model is established based on the diversity of bottlenecks in the five stages, integrating elements such as the horizontal movement velocity of passengers, subway equipment parameters, and human density. Taking Xi’an Wulukou Subway Station as an example, this paper verifies the outcomes of the theoretical model against the Pathfinder software and conducts additional anal-yses of the evacuation conditions of stairs and exits. The results show that the error between the theoretical emergency evacuation time and simulation evacuation time was 5.4%, The emergency evacuation model established in this study boasts strong robustness and stability.

Structural information of biological macromolecules is crucial and necessary to deliver predictions about the effects of mutations—whether polymorphic or deleterious (i.e., disease causing), wherein, thermodynamic parameters, namely, folding and binding free energies potentially serve as effective biomarkers. It may be emphasized that the effect of a mutation depends on various factors, including the type of protein (globular, membrane or intrinsically disordered protein) and the structural context to which it occurs. Such information may positively aid drug-design. Furthermore, due to the intrinsic plasticity of proteins, even mutations involving radical change of the structural and physico-chemical properties of the amino acids (native vs. mutant) can still have minimal effects of protein thermodynamics. However, if a mutation causes significant perturbation of either folding or binding free energies, it is quite likely to be deleterious. Mitigating such effects is a promising alternative to the traditional approaches of designing inhibitors. This can be done by structure-based in silico screening of small molecules for which binding to the dysfunctional protein restores its wild type thermodynamics. In this review we emphasize on the effects of mutations on two important biophysical characteristics, stability and binding affinity, and how structures can be used for structure-based drug design to mitigate the effects of disease-causing variants on the above biophysical characteristics.

Properties of time domain parameters of the vibration signal have been extensively studied for the fault diagnosis of rolling element bearings (REB). Parameters like kurtosis and Envelope Harmonic-to-Noise Ratio are most widely applied in this field and some important progress has been made. However, since only one-sided information is contained in these parameters respectively, problems still exist in practice when the signals collected are of complicated structure and/or contaminated by strong background noises. A new parameter, named Shock pulse index (SPI), is proposed in this paper. It integrates the mutual advantage of both parameters above and can help effectively identify fault related impulse components under the interference of strong background noises, unrelated harmonic components and random impulses. The SPI optimizes the parameters of Maximum Correlated Kurtosis Deconvolution (MCKD), which is used to filter the signals under consideration. Finally, the interested transient information contained in the filtered signal can be highlighted through demodulation with Teager Energy Operator (TEO). Fault related impulse components can therefore be extracted accurately. Simulations and experiment analyses verify the effectiveness and correctness of the SPI.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (<1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

Machinery degradation assessment can offer meaningful prognosis and health management in-formation. Although numerous machine prediction models based on artificial intelligence have emerged in recent years, they still face a series of challenges: (1) Many models continue to rely on manual feature extraction. (2) Deep learning models still struggle with long sequence prediction tasks. (3) Health indicators are inefficient for remaining useful life (RUL) prediction with cross-operational environments when dealing with high-dimensional datasets as inputs. This research proposes a health indicator construction methodology based on a transformer self-attention transfer network (TSTN). This methodology can directly deal with the high-dimensional raw dataset and keep all the information without missing when the signals are taken as the input of the diagnosis and prognosis model. First, we design an encoder with a long-term and short-term self-attention mechanism to capture crucial time-varying information from a high-dimensional dataset. Second, we propose an estimator that can map the embedding from the encoder output to the estimated degradation trends. Then, we present a domain dis-criminator to extract invariant features from different machine operating conditions. The case studies with the FEMTO-ST bearing dataset and the Monte Carlo method for RUL prediction during the degradation process are conducted. The experiment results fully exhibited the signif-icant advantages of the proposed method compared to other state-of-the-art techniques.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

A composite flocculant P(AM–DMDAAC) was synthesized by the copolymerization of acrylamide (AM) and dimethyl diallyl ammonium chloride (DMDAAC). Using microwave (MV) assistance with ammonium persulfate as initiator, the synthesis provided short reaction time and better solubility product. Nuclear magnetic resonance spectroscopy (1H NMR and 13C NMR), Fourier-transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM) and differential thermal analysis-thermo gravimetric analyzer (DTA-TGA) were used to determine the structure and morphology of P(AM–DMDAAC). Parameters affecting the intrinsic viscosity ([η]) of P(AM–DMDAAC), such as microwave time, mass ratio of DMDAAC to AM, initiator ammonium persulfatedosage, sodium benzoate dosage, bath time, reaction temperature and pH value were examined. Results showed that the optimum synthesis conditions were microwave time 1.5 min, m(DMDAAC): m(AM) is 4:16, 0.5 wt‰ initiator, 0.4 wt‰ EDTA, 0.3 wt‰ sodium benzoate, 2 wt‰ urea, 4 h bath time, 4.0h reaction time and pH 2. To study the removal of phenol by P(AM–DMDAAC), the influence of flocculant dose, pH value and the stirring speed were investigated, with optimization providing 99.8 % removal.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

In recent years, there has been significant growth in the ubiquity and popularity of three dimensional(3D) point clouds, with an increasing focus on the classification of 3D point clouds. To extract richer features from point clouds, many researchers have turned their attention to various point set regions and channels within irregular point clouds. However, this approach has limited capability in attending to crucial regions of interest in 3D point clouds and may overlook valuable information from neighboring features during feature aggregation. Therefore, this paper proposes a novel 3D point cloud classification method based on global attention and adaptive graph convolution. The method consists of two main branches: the first branch com-putes attention masks for each point, while the second branch employs adaptive graph convolu-tion to extract global features from the point set. It dynamically learns features based on point interactions, generating adaptive kernels to effectively and precisely capture diverse relationships among points from different semantic parts. Experimental results demonstrate that the proposed model achieves 93.8% in overall accuracy and 90.8% in average accuracy on the ModeNet40 dataset.

The taxonomy of trilobites Abadiella Hupé, 1953 and Parabadiella Zhang, 1966 from the lower Cambrian of Gondwana has long been a controversy. Based on newly-collected and formerly-reported materials, 94 trilobite cranidia within 21 species are selected for morphometric analyses: principal components analysis (PCA) and canonical variates analysis (CVA). The integrated morphological characters are successfully accounted for by two principal components in PCA. The further validations for the presupposed qualitative groupings are indispensable to detect and calibrate the ultimate taxonomic results in CVA. By this way, all specimens distributed in a consistent morphospace in PCA and the short distances between them demonstrate their close morphological affinity, supporting their congeneric status within Abadiella. Additionally, three morphotypes were recognized from all selected specimens and they were eventually revised and incorporated into A. bourgini Hupé, 1953, A. huoi Zhang, 1966, and A. yunnanensis Luo, 1981, through stepwise test-calibration to get a high correct rate as far as possible in CVA. From this, it is certain that A. huoi is conspecific in South Australia and South China. Its occurrence allows to correlate the Australian A. huoi Range Zone to the identical zone in South China (in platform), having an approximately consistent stratigraphic range in the two regions. In comparison with A. huoi, A. bourgini was reported from fewer localities in South China. Nevertheless, its presence in the Daguinaspis Zone of Issendalenian Stage in Morocco permits a correlation with Chinese and Australian A. huoi Zone. As an auxiliary marker for A. huoi, the occurrence of A. bourgini in Morocco, South Australia and South China reinforce the correlation potential and resolution in species-level for the Cambrian Stage 3 in Gondwana region.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

Mobile software applications (apps) have transformed how individuals oversee and maintain their own health. One way that girls can monitor their menstrual cycles is through the increasingly widespread use of mobile menstrual tracking apps. This study aims to examine menstrual symptom tracking for adolescents in English and Chinese apps, exploring menstrual literacy, cross-cultural differences, and framing, or presentation, of symptoms. The mixed methods content analysis involved 15 popular free menstrual tracking apps in English (n = 8) and Chinese (n = 7). Quantitative analysis of qualitative data was conducted through manual coding of content and automatically analyzing sentiment, or emotional tone, using a computational approach. We found that: (1) Menstrual literacy on symptom management or treatment was generally insufficient, (2) There were more available emotional than physical symptoms in English than Chinese apps, (3) Symptoms were framed more negatively than positively, somewhat more in Chinese than English apps. Findings emphasize the importance of improving information in digital menstrual trackers. Our findings further reflect cultural differences in emotional expression and negative attitudes toward menstruation. Since adolescence is a critical developmental stage that requires ample support, digital menstrual trackers can uniquely shape attitudes and experiences, ultimately, empowering teenagers to better manage their menstrual health.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

This research aims to investigate psychological anxiety factors, particularly Music Performance Anxiety (MPA), that influence the sustainability of music learning systems. This study employs an innovative integration of qualitative and quantitative methodologies, marking the first use of a nonlinear system paired with a comprehensive data framework for analyzing questionnaire responses. This approach allows for a detailed examination of the effects of these factors on academic outcomes. Previous research has primarily focused on the fragmented music learning system from the perspective of teachers' instructional strategies, emphasizing phased teaching methods and learning objectives which focus often neglected a significant subset of music learners. Addressing this oversight, the current study specifically centers on the emotional aspects of anxiety within music learning systems, with a particular emphasis on students, who play a crucial role in music education. This perspective enables a deep exploration of how MPA and other related emotional factors affect music learning systems. A notable innovation of this research is the development of a stochastic nonlinear system designed to model the psychological factors impacting student music learning, complemented by a quantitative model that assesses actual learning outcomes. By analyzing this nonlinear system, the research identifies weight values for various negative emotions, particularly those related to MPA, that significantly influence the music learning process. The integration of MPA and other anxiety related emotional factors with practical learning outcomes provides a comprehensive understanding of their combined impact on the music learning system. These insights are invaluable for educators and policymakers aiming to enhance both the effectiveness and emotional well-being within music education. This comprehensive approach offers a novel perspective in understanding and improving the dynamics of music education through a more empathetic and scientifically grounded lens.

In this paper, we investigate the new degenerate Daehee polynomials and numbers which are called the degenerate Daehee polynomials of the second kind, and derive some new and interesting identities and properties of those polynomials.

This retrospective study aimed to assess coronary artery calcium (CAC) progression in serial computed tomography measurements according to risk factor changes. In 448 asymptomatic adults who underwent CAC measurements with more than one-year intervals, CAC progression was assessed according to age, sex, variable traditional risk factors (diabetes mellitus, hypertension, hyperlipidemia, and smoking), and initial CAC score (0, 0.1–100, and >100). Univariate and multivariate logistic regression analyses were assessed for independent predictors of rapid CAC progression (△CAC/year>20). During the 3.5-year follow-up, coronary artery calcifications occurred in 43 (12.8%) of 336 individuals with an initial CAC score of zero. Of 112 individuals with initial CAC presence, 60 (53.6%) had △CAC/year>20. Age, male sex, body mass index, and all risk factors were significantly associated with △CAC/year>20, but recently diagnosed hypertension (odds ratio [OR], 11.3) and initial CAC score (OR, 1.05) were significant independent predictors in multivariate regression analyses. CAC progression was affected by demographic and traditional risk factors, but adjusting for these factors, recently diagnosed hypertension and initial CAC score were the most influential factors for rapid CAC progression. These findings suggest that patients with higher initial CAC scores may benefit from more frequent follow-up scans and checks regarding risk factor changes.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

Drafting formations have been long recognized as highly effective for reducing drag and enhancing athletic performance, particularly in race walking events. The precise spacing and positioning of the race walkers are critical to optimizing the effectiveness of drafting. In this study, the drag reduction of 15 drafting formations is investigated using wind-tunnel experiments and CFD numerical simulations. The results show excellent consistency in drag reduction rate between the two methods, with differences being within 10%. This can be attributed to spacing replacing body shape differences as the primary factor influencing drag reduction. Optimal double, triple, and quadruple drafting formations produce the same results in both wind-tunnel experiments and CFD simulation, resulting in drag reductions of 67%, 66%, and 81% (wind-tunnel) and 65%, 72%, and 85% (CFD). The sources of drag differences in the two methods are discussed from various aspects. The flow field obtained through CFD analysis is used to examine the mechanism of drag reduction, revealing that drafting formations have a significant shielding effect on incoming air, which reduces the number and speed of airflow impacting the core race walker. This shielding effect is identified as the primary cause of drag reduction. Using an empirical model for mechanical power output, optimal double, triple, and quadruple drafting formations enhance sport economy (4.4-5.7%), speed (3.61-4.67%), and performance (173.8-223.3s) compared to race walking alone. The findings can serve as a reference for race walkers' positioning strategy and provide insights for considering drafting formations in various running events.

Goal-conditioned reinforcement learning (RL) holds promise for addressing intricate control challenges by enabling agents to learn and execute desired skills through separate decision modules. However, the irregular occurrence of required skills poses a significant challenge to effective learning. In this paper, we demonstrate the detrimental effects of this imbalanced skill(sub-goal) distribution and propose a novel training approach, Classified Experience Replay (CER), designed to mitigate this challenge. We demonstrate that adapting our method to conventional RL methods significantly enhances the performance of the RL agent. Considering the challenges inherent in tasks such as driving, characterized by biased occurrences of required sub-goals, our study demonstrates the improvement in trained outcomes facilitated by the proposed method. In addition, we introduce a specialized framework tailored for self-driving tasks on highways, integrating Model Predictive Control (MPC) into our RL trajectory optimization training paradigm. Our approach, utilizing CER with the suggested framework, yields remarkable advancements in trajectory optimization for RL agents operating in highway environments.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

The stability of deep soft rock tunnels is of particular concern under seepage conditions. Aiming at thoroughly discussing the seepage actions and their consequences on the support scheme of such structures, the host rocks of the Weilai Tunnel situated in Guangxi province of China are taken as the research substance. Emphasizing on seepage conditions, stresses, displacements and plastic zone radii along the surrounding rocks of such tunnel are adequately examined taking into consideration the Mogi-Coulomb strain criterion and the elastic-plastic theory. Subsequently, based on strain-softening model, the coupled actions of seepage and softening on the rocks surrounding the tunnel are studied. According to the results, it is revealed that the support scheme of deep soft rock tunnels must be of highest resistance possible to better decrease the plastic zone and the tangential stress along the host rocks. Moreover, throughout the surrounding rocks, the dissemination of pore water pressure is strongly affected by the uneven permeability coefficient under anisotropic seepage states. Combined effects of softening and seepage are very dangerous for the surrounding rocks of deep-buried tunnels. To better guarantee reasonable longevity of such tunnels, long-term monitoring of their support structures with reliable remote sensors is strongly recommended.

A Chinese superalloy GH4099 (~20 vol.% γ' phase), which can operate for long periods of time at temperatures of 1173-1273 K, was fabricated by electron beam melting (EBM). Argon gas atomized (AA) and plasma rotation electrode process (PREP) powders with the similar composition and size distribution were used as raw materials for comparison. Microstructure and mechanical properties of both the as-EBMed and post-treated alloy samples were investigated. The results show that the different powder characteristics resulted in the different build temperatures for AA and PREP samples, which were 1253 K and 1373 K, respectively. With increasing the building temperature, the EBM processing window shifted towards the higher scanning speed direction. Furthermore, intergranular cracking was observed for the as-fabricated PREP sample as a result of local enrichment of Si at grain boundaries. The cracks were completely eliminated by hot isostatic pressing (HIPing) and did not re-open during subsequent solution treatment and aging (STA). Fine spherical γ' phase precipitated uniformly after STA. The tensile strength of the HIP+STA samples was ~920 MPa in the building direction and ~850 MPa in the horizontal direction, comparable with that of the wrought alloy.

Reinforcement Learning (RL) has demonstrated considerable potential in solving challenges across various domains, notably in autonomous driving. Nevertheless, implementing RL in autonomous driving comes with its own set of difficulties, such as the overestimation phenomenon, extensive learning time, and sparse reward problems. Although solutions like Hindsight Experience Replay (HER) have been proposed to alleviate these issues, the direct utilization of RL in autonomous vehicles remains constrained due to the intricate fusion of information and the possibility of system failures during the learning process. In this paper, we present a novel RL-based autonomous driving system technology that combines Obstacle Dependent Gaussian (ODG) RL, Soft Actor-Critic (SAC), and meta-learning algorithms. Our approach addresses key issues in RL, including the overestimation phenomenon and sparse reward problems, by incorporating prior knowledge derived from the ODG algorithm. We evaluated our proposed algorithm on official F1 circuits, using high-fidelity racing simulations with complex dynamics. The results demonstrate exceptional performance, with our method achieving up to 89% faster learning speed compared to existing algorithms in these environments.

Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

The Android-based IoT platform just like the existing Android provides an environment that makes it easy to utilize Google's infrastructure services including development tools and APIs through which it helps to control the sensors of IoT devices. Applications running on the Android-based IoT platform are often UI free and are used without the user’s consent to registered permissions. It is difficult to respond to the misuse of permissions as well as to check them when they are registered indiscriminately while updating applications. This paper analyzes the versions of before and after an application the update running on the Android-based IoT platform and the collected permission lists. It aims to identify the same permissions before and after the update, and deleted and newly added permissions after the update were identified, and thereby respond to security threats that can arise from the permissions that is not needed for IoT devices to perform certain functions.

Longitudinal cutting is a most common process in steel structure manufacturing, and the man-hours of the process provide an important basis for enterprises to generate production schedules.However, currently the man-hours in factories are mainly estimated by experts, and the accuracy of this method is relatively low.In this study,we propose a system that predicts man-hours with history data in the manufacturing process and that can be applied in practical structural steel fabrication.The system addresses the data inconsistency problem by one-hot encoding and data normalization techniques,Pearson correlation coefficient for feature selection,and the Random Forest Regression(RFR) for prediction.Compared with the other three Machine Learning(ML) algorithms, the Random Forest algorithm has the best performance.The results demonstrate that the proposed system outperforms the conventional approach and has better forecast accuracy, so that it is suitable for man-hours prediction.

For concrete structures exposed to offshore areas, chloride ion erosion is one of the main factors affecting the durability. It is crucial to evaluate chloride ion permeability resistance of concrete structures. In this article, a finite element simulation of the chloride ion diffusion process in concrete is conducted. A mass diffusion finite element model based on random aggregate approach is established to investigate the influence of aggregate, interface transition zone, and micro-cracks on chloride ion diffusion coefficients in concrete. The results show that the mass diffusion finite element analysis based on the exponential function model and power function model can effectively simulate the chloride ion diffusion process in concrete. In addition, the data reveal that coarse aggregate is the most important factor affecting chloride ion diffusivity in concrete. However, the interface transition zone significantly accelerates chloride ion diffusion in concrete. Moreover, this acceleration effect exceeds the barrier effect of aggregate.