The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.

To understand lung damage caused by COVID-19, we deduced two-phase lung damage mechanisms. After the lungs are infected with SARS-CoV-2 virus, the affected lung tissue swells and surface properties of pulmonary capillaries change, resulting in an increased flow resistance of affected capillaries. If a sufficient number of capillaries are affected by the infection, the swelling and increased cell wall adhesion collectively raise pulmonary vascular resistance. The increased vascular resistance further increases the dwell times of WBCs in affected capillaries and nearly capillaries. When pulmonary pressure is sufficiently higher, WBCs are forced to squeeze into interstitial spaces or alveolar spaces when local pressures are higher than what the capillaries can withstand. When more and more WBCs are dynamically retained, the flow resistance of more capillaries rises, pulmonary vascular resistance rises, and pulmonary pressure rises. The rise in the pulmonary pressure in turn results in elevated capillary pressures. When capillary pressures around the alveoli are sufficiently high, they cause interstitial pressures to change from normally negative values to positive values. The positive pressures cause fluid leakage to the alveolar space and thus degrade lung function. Tissue swelling, and occupation of WBCs in interstitial spaces and alveolar spaces further reduce compressible volume, and thus cause further rise in the pulmonary vascular resistance and pulmonary pressure. When the pulmonary pressure has reached a critical point as in the second phase, the blood breaks capillary walls and squeezes through interstitial spaces to reach alveolar spaces, resulting in irreversible lung damages. The available free volume in the thorax cage, organ usable capacities, temperature and humid are expected to have great impacts on degree of lung damages. The free volume in the thorax cage, lung usable surplus capacity, and other organ usable capacities determine the arrival time of last-phase irreversible damage. The mechanisms imply that the top priority for protecting lungs is maintaining pulmonary micro-circulation and preserving organ functions in the entire disease course while controlling viral reproduction should be stressed in the earliest time possible. The mechanisms also explain leukecytes are recruited and migrated into inflamed tissues by increasing their dwell times caused by increased local flow resistance.

After reviewing cancer theories, cancer treatment development histories, randomized clinical trial's performance, cancer treatment strategy, trial follow-up times, and conducting numerous simulations using existing data, the authors found: (1) medical treatments come with three to four lethal factors: treatment side-effects, emotional distress and chronic dress, lack of exercises or physical inactivity, and excessive nutrition in some cases; (2) clinical trial exaggerates the benefits of fast-acting treatments and underestimates the slow-delivering adverse side effects as a result of statistical averaging, interfering effects of personal lifestyle factors, and insufficient follow-up times; (3) the benefits of medical treatments are limited by chain comparison, where surgery sets up a negative standard relative to the best way for resolving cancer; (4) the strategy of destroying the tumor is unworkable; (5) medical treatments can turn natural cancer growth curve into approximately doubly exponential curve; (6) multiple factor non-medical measures are much more powerful than medical treatments in controlling cancer growth and metastasis rates; and (7) cancer early diagnosis and over treatments are bad strategies that have great adverse impacts on cancer patients. Based on huge increases in cancer growth rate constants, substantial of loss of organ functional capacity, and severe systemic aging-like cellular damages, the authors concluded that medical treatments promote cancer growth and metastasis rates and shorten patient lives in most cases, and the claimed benefits are caused by triple biases of clinical trials. The authors believe that the better strategy for ending the global cancer epidemic is abandoning clinical trails as the research model, changing caner treatment strategy from killing cancer cells to slowing down cancer growth rates by using multiple factors optimization approach in personalized medicine.

We conducted many model simulations to understand the causes of the damages of coronavirus (COVID-19) to lung tissue and constructed a diagram showing apparent viral reproduction, immune response and damage accumulation curves. We found that lung damages include virus-caused damage, tissue damage caused by immune responses and tissue damage caused by accumulated wastes. The virus-caused damage is proportional to the phase lag between the viral reproduction curve and the delayed adaptive immune response curve, while waste-induced damage is attributed to imbalance in removing viral, cellular and metabolic by-products. We found that treatment strategies should slow down viral reproduction and speed up immune response, and improve blood micro-circulation in the lungs. Consistent with the strategies, measures are taken to void direct lung infection, strengthen innate responses, promote immune responses, dilute viral concentration in lung tissue, maintain waste removal balance, protect heart and kidneys, control other infections, avoid allergic reactions and other inflammation, etc. We show that medical, dietary, emotional, lifestyle, environmental, mechanical factors, etc. may be simultaneously used to mitigate lung damages and prove that multiple factor health optimization method is magnitudes more powerful than a single factor treatment. Such a method does not depend on molecular specificity and can be used in parallel to antiviral drugs.

To understand great disparities in disease outcomes between CIVID-19 patients, we explore infection and host responses in kinetics. From existing data, we deduced a model that the lungs are damaged by rapidly rising flow resistance as a result of retaining white blood cells in lung tissues. The retention of white blood cells is initially triggered by viral infection but aggravated by injuries caused by low temperature. Lungs are initially damaged by fluid leakage, rapidly followed by extruding blood into alveolar spaces. The step of blood extruding is predicted to take place in a very short time. Our simulations show that as little as 0.1% retention of white blood cells in the lungs can lead to their failure in 5 to 10 days. The small degrees of imbalance implies that this imbalance could be corrected by a large number of factors that are known to reduce flow resistance. The model implies that the top priority is maintaining blood micro-circulation and preserving organ functions in the entire disease course, especially after the virus has spread the whole lungs. From exploring a large number of hypothetical infection modes, we propose preventive, mitigating and treatment strategies for ultimately ending the pandemic. The first strategy is avoiding exposures that could result in widespread damages to lungs and taking post exposure mitigating measures that would reduce disease severity. The second strategy is reducing death rate and disability rate from the current levels to one tenth for infected patients by using multiple factors health optimization method. The double reduction strategies are expected to generate a series of chain reactions that favor mitigating or ending the pandemic. Some reactions include a big reduction of the amount of viral discharges from infected patients into the air, the avoidance of panic, chronic stress and emotional distress, and cross-infections which are expected in quarantines. The double reductions would have a final effect of ending the pandemic.

Modern medicine adopted four presumptions when it evolved from ancient experienced-based mind-body medicine. To understand its failure in finding cures for chronic diseases, we examined four presumptions, and found that statistical population of health properties does not exist for most research purposes, mathematical models are misused to model intensive properties, synthetic drugs are inherently more dangerous than nature-made medicines under their respective application conditions, and reductionist treatments are inferior and inherently dangerous. We found that clinical trials are valid only for research where treatment effect is much stronger than the total effects of all interfering or co-causal factors or errors introduced by misused mathematical models can be tolerated. In all other situations, clinical trials introduce excessive errors and fail to detect treatment effects, or produce biased, incorrect or wrong results. We further found that chronic diseases are manifestation of small departures in multiple process attributes in distinctive personal biological pathways networks, that modern medicine lacks required accuracy for accurately characterizing chronic diseases, and that reductionist treatments are good at controlling symptoms and safe for short term uses. For all stated reasons, as long as modern medicine continues relying on the flawed presumptions, it can never find predictable cures for chronic diseases. By implication, predictable cures to chronic diseases are adjustments to lifestyle, dietary, emotional, and environmental factors to slowly correct departures in process attributes responsible for chronic diseases.

In the war against the COVID-19 pandemic, the world is experiencing severe resource constraints. Although transmission routes are well understood, we suspect that they cause different disease consequences. We evaluate them in different forms to understand how they affect infection rates and disease severity. In determining how they affect disease outcome, we evaluated target tissue vulnerability, functional role, defense mechanisms, viral concentration, infection vicinity to target vital tissue, and host factors. We found that direct lung infection is the most lethal transmission route followed by bronchi infection. Transmissions by physical contacts, foods, and blood by low viral concentration (as expected in normal human activities) pose lower or much lower risks unless the infection is followed by subsequent lung exposures. After adding transmission route, treatment timings, and improper treatments into the list of known risk factors, we found that death rate and disability rate for young or healthy persons are nearly zero. We show that population based medical model improperly shifts nominal death rate from few vulnerable people to the population resulting in unnecessary population panic, and such panic is responsible for shutting down human activities and the world economy. Finally, we examined limitations in population-based mitigating measures and proposed for governmental and private adoption community guidelines, which are mainly to enable vulnerable people avoid exposures, prevent non-vulnerable people from serving as viral transmitters, get rid of high-risk exposure modes in working environment, improve safety for people in buses, ships and planes, and reduce death and disability rates for infected people.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Chronic diseases are still known as incurable diseases, and we suspect that the medical research model is unfit for characterizing chronic diseases. In this study, we examined accuracy and reliability required for characterizing chronic diseases, reviewed implied presumptions in clinical trials and assumptions used in statistical analysis, examined sources of variances normally encountered in clinical trials, and conducted numeric simulations by using hypothetical data for several theoretical and hypothetical models. We found that the sources of variances attributable to personal differences in clinical trials can distort hypothesis test outcomes, that clinical trials introduce too many errors and too much inaccuracies that tend to hide weak and slow effects of treatments, and that the means of treatments used in statistical analysis have little or no relevance to specific patients. We further found that a large number of uncontrolled co-causal or interfering factors normally seen in human subjects can greatly enlarge the means and the variances of the experimental errors, and the use of high rejection criteria (e.g., low p values) further raises the chances of failing to find treatment effects. As a whole, we concluded that the research model using clinical trials is wrong on multiple grounds, under any of our realistic theoretical and hypothetical models, and that misuse of statistical analysis is most probably responsible for failure to identify treatment effects for chronic diseases and to detect harmful effects of toxic substances in the environment. We proposed alternative experimental models involving the use of single-person or mini optimization trials for studying low-risk weak treatments.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

Nicotine exposure may affect NSCLC is associated with lung cancer in humans. Whether nicotine exhibits carcinogenesis promoted activities in tumor growth still unknown. Nicotine is known to have dichotomous effects on cancer biology, acting like a pro- or anti-carcinogenesis agent. There are different functions between adenocarcinoma and squamous NSCLC cancer cells. Excess generation of nicotine may inhibit mitochondrial metabolism, protein modification, and DNA cleavage. Materials and Methods: We used the H520 NSCLC line obtained from human lung epithelial cells to detected nicotine growth and toxicity using MTT assay and western blotting. The concentration of nicotine stimulated cell growth to correspond to low concentration, while high concentration was cytotoxic. Results: According to MTT assay results, at 1.0 μM nicotine has significantly enhanced the H520 cell viability (%). Nicotine induced lung cancer carcinogenesis through mechanisms of α7nAchR, EGFR, HDAC2/4/5, Cyclin D/Cyclin E, Bcl-2, p-Akt, and inflammatory proteins of NF-KappaB and COX2 increases at 1.0 μM. Apoptosis proteins were decreases at 1.0 μM nicotine by p21, p27, c-jun, and p38α using western blotting. Nicotine stimulates tumor growth is mediated through α7nicotinic-acetylcholine receptors (α7nAChR), possibly involving inflammation. On the other hand, at high nicotine concentrations (> 1.0 μM) with consistent cytotoxic effects and appeared to be due to direct cell kill. Nicotine can prevent apoptosis induced by NSCLC. Conclusion: Therefore, the effects on chemotherapeutics by NSCLC malignant cell lines, nicotine in concentrations as low as 1.0 μM decreased. These mechanisms are responsible for the genotoxic effects caused by nicotine. This leads to downstream effects on decreased apoptosis, increased cell proliferation and transformation. The malignant NSCLC cells respond to the treatment with nicotine in lung cancer, the nicotine-mediated induction of growth may provide one of its links to α7nAchR or EGFR.

To predict how the COVID-19 pandemic progresses, we developed a systematic method for predicting disease outcomes. In the method, we evaluate how personal disease outcomes are mainly affected by viral concentration and exposure time and four defense mechanisms: human innate immunity/host response, acquired immune response, inflammation resolution and micro circulation, and the available space in the thorax cage. By considering how pandemic measures affect viral exposure and those mechanisms, we found many pandemic measures are misused or abused to deliver long-term adverse impacts. We noted that lifestyles have been changed as a result of movement restriction measures. By using the method, we found that altered lifestyles are predicted to raise infection rate, disability and death risks in the future. We show that a person can use personal, environmental, emotional factors to reduce infection rate and death risk. To prove the validity of this finding, we extensively examined medical research models, holistic and reductionist models, epidemiological models, disease risk factors, etc, and found that population methods are unfit for studying holistic health, statistical population does not exist in most clinical trials, mathematical models were misused for studying disease properties for a population, mathematical equations for modeling personal diseases are beyond human ability to solve, statistical models are misused, population-derived treatments are inherently dangerous to patients, vaccines have limited benefits due to unique lung structure and rapid RNA mutation, and immune system damage is caused by fast viral replication rate. We found that altering biological properties to improve the defense mechanisms could prevent a super majority of deaths and prevent the virus from reaching a point to damage the immune system. For vulnerable persons, such measure is a viable strategy for surviving from the pandemic. As a whole, holistic personalized medicine is more powerful than population-based reductionist treatment by one to several orders of magnitudes. We urge people do their parts to force the medical establishment to abandon population treatment models that are responsible for failure of medicine and dissemination of misleading and factually wrong information on the effectiveness of medical treatments.

We previously proposed a public intervention framework concept that would allow people to resume personal and economic activities. We showed that intervention measures are used in a quantitative scale to reduce transmission probabilities and disease severity. In this article, we systematically examine the origin, assumptions, performance and limitations of epidemiological models from different views used in past review. We found that nearly all model assumptions fail to hold or are remote from reality; R0 does not exit or has no utility in guiding treatment options; personalized intervention measures are vitally important to COVID-19 due to its transmission characteristic; and current epidemiological models are unable to accurately assess the true benefits of personalized intervention measures. We suggest that poor performance of the models are attributed to flawed assumption that health/disease properties can be treated as transferable properties. The flaw creates a fiction that disease properties such as infection probabilities and death risks can be transferred from any vulnerable persons to anyone in the population and thus severely limit societal ability to fight the pandemic. We finally show that the benefits of personalized mitigation measures could be determined directly by using variable Ri values for infected persons (or nodes) together assessment of death rate and disability rate; the attempt of avoiding the disease by defeating all potential transmission probabilities is unrealistic; but mitigating disease severity for specific persons is more feasible and reliable. A most reliable strategy for reviving economy is using personalized protective measures and improving person health before effective vaccine is available.

The COVID-19 pandemic has great adverse impacts on personal life, the U.S. economy, and the world economy. Freezing all human activities is not a sustainable measure. Thus we want to develop a public intervention framework that allows people to resume personal and economic activities. In this article, we examined transmission routes, disease severity, personal vulnerability, available treatments, and person-person interactions to establish a general public intervention framework. We divide people into risk groups, non-risk group and group that may serve as viral transmitters, explore interactions between individual persons within each group and between different groups, and propose interaction behavior modifications to mitigate viral exposures. For the non-risk groups, we identified preventive measures that can help them avoid the most serious exposures and infections that pose higher death risks. The invention measures for the vulnerable groups include prior-exposure measures, heightened protective measures, interaction behavior changes, post-exposure remedial measures, and multiple factors treatments to reduce death and disability risks. The multiple interventions and two-ways defensive behavior modifications are expected to result in reduced rate of detectable infections and lowered disease severity for the vulnerable groups. In this framework, most human activities and economic activities can continue as normal. With time passing, the population acquires population immunity against the COVID-19 virus. Implementation of this intervention framework requires considerable resources and governmental effects while the multiple factors treatment protocol requires the support of health care professionals.

We examined special roles of the Central Nervous System (CNS) in an attempt to resolve the puzzle that chronic diseases cannot be cured by medicine. By exploring a skill-learning model, we found that the CNS is able to remember certain information reflecting biochemical and cellular (B&C) processes in the body. From the skill using ability, we found that the CNS is able to control basic B&C processes that drive and power the skill. From the ability to adjust forces and force direction of a physical act, we found that the CNS is able to adjust B&C processes that drive the physical act. From this adjustment capability, we further inferred that the CNS must also store information on the baseline B&C processes. As a whole, we found that the CNS can maintain information on baseline B&C processes, up-regulate or down-regulate the processes, and make comparisons in performing its regulatory functions. We found that chronic diseases are the results of deviated baseline B&C processes. Per the proved hypothesis, the CNS maintains deviated baseline B&C processes, and thus protects the body states of fully developed diseases. We then used the three CNS roles to explain that cancer progresses with increasing malignancy, cancer quickly returns after a surgery, cancer cells repopulate after chemotherapy and radiotherapy, cancer develops drug resistance inevitably, immune cells rebound after suppression, generally poor benefits of cancer drugs such as beta-blockers, etc. We further showed that long-term exercises generally push most, if not all, baseline B&C processes in diametrical opposing directions against the diseased B&C processes, implying that exercises play unique roles in reversing chronic diseases. Finally, we proposed several strategical approaches to resetting the CNS’ state memory as the essential condition for curing chronic diseases.

This study introduces session-aware recommendation models, leveraging GRU (Gated Recurrent Unit) and attention mechanisms for advanced latent interaction data integration. A primary ad-vancement is enhancing latent context, a critical factor for boosting recommendation accuracy. We address existing models' rigidity by dynamically blending short-term (most recent) and long-term (historical) preferences, moving beyond static period definitions. Our approaches, pre-combination (LCII-Pre) and post-combination (LCII-Post) with fixed (Fix) and flexible learning (LP) weight configurations, are thoroughly evaluated. We conducted extensive experiments to as-sess our models' performance on public datasets such as Amazon and MovieLens 1M. Notably, on the MovieLens 1M dataset, LCII-PreFix achieved a 1.85% and 2.54% higher Recall@20 than II-RNN and BERT4Rec+st+TSA, respectively. On the Steam dataset, LCII-PostLP outperformed these models by 18.66% and 5.5%. Furthermore, on the Amazon dataset, LCII showed a 2.59% and 1.89% improvement in Recall@20 over II-RNN and CAII. These results affirm the significant enhancement our models bring to session-aware recommendation systems, showcasing their po-tential for both academic and practical applications in the field.

Instrumental activities of daily living (IADL) training is critical in clinical practice of occupational therapy (OT) for stroke patients. In the conventional approaches, the therapists simulate various occupational tasks in their healthcare settings or reach their nearby real circumstances for the training. As an alternative technology, immersive virtual reality (IVR) has been used widely in stroke rehabilitation for years; however, limited research has compared occupational performances between virtual and real environments. Our team has established a novel IVR shopping training system for stroke rehabilitation. We recruited 10 stroke patients from our department to test the system. All patients attempted to implement shopping tasks in the virtual and real environments respectively. The Wilcoxon test showed no significant differences between virtual and real environments in memory capacity and time-consuming for implementing tasks, and memory capacities in virtual and real environments presented excellent correlations with the IADL assessment. This study suggests that IVR shopping tasks can be used as an alternative approach in rehabilitation when there is limited resource for implementing shopping training in a real environment, while the psychometric property, clinical effect and the effect transferred to the real environment induced by virtual training require further study.

Passive and forced drinking harm was prevalent but less recognized in Chinese adolescents. We educated adolescents on such harm to reduce their intention to drink. Students (n=1244) from 7 secondary schools in Hong Kong participated in a video-based health talk on passive and forced drinking harm. Paired t-test was used to assess their change in knowledge of passive and forced drinking, health and social harm of drinking after the health talk. McNemar's chi-squared test and adjusted multivariable logistic regression (AOR) were used to assess their change in intention to drink and intention to quit. Students were less likely to drink (OR 0.29, 95% CI 0.19-0.42) and more likely to quit drinking (OR 3.50, 1.10-14.6) after the health talk. Increased knowledge of passive drinking was associated with less intention to drink (AOR 0.93, 0.90-0.97), increased knowledge of health harm (adjusted b 0.06, 0.05-0.08), and social harm of drinking (adjusted b 0.12, 0.10-0.16). Similar associations were observed in forced drinking (intention to drink: AOR 0.87, 0.79-0.96; health harm: adjusted b 0.16, 0.12-0.19; social harm: adjusted b 0.36, 0.28-0.43). We showed preliminary evidence that the health talk on passive and forced drinking reduced the intention to drink in adolescents.

Background: Passive drinking is prevalent in adolescents worldwide, but its prevalence and harm are understudied. Methods: Secondary students (n=5840, grades 7-12) from 23 selected schools in Hong Kong participated in the survey from 2015-16. Students reported the harm of passive drinking, perceived health status, Patient Health Questionnaire-2, Perceived Stress Scale-4, perceived happiness, family health, happiness, and harmony in the questionnaire. The associations were analyzed using multivariable logistic regression (odds ratio, OR) and linear regression (unstandardized coefficient, b), adjusted for confounders. Results: 29.1% (95% CI 27.8 to 30.5%) of students experienced passive drinking in the past 30-day. Past 30-day parental passive drinking was associated with a higher level of depressive symptoms (AOR 1.63, 95% CI 1.26 to 2.10), stress (adjusted b 0.76, 0.42 to 1.10), and lower level of perceived happiness (adjusted b -0.52, -0.72 to -0.33). Past 30-day parental passive drinking was associated with a lower level of family health (adjusted b -1.39, 95% CI -1.66 to -1.11), family happiness (adjusted b -1.36, -1.64 to -1.08), and family harmony (adjusted b -1.40, -1.70 to -1.10). Conclusion: Passive drinking was associated with poorer mental health, family wellbeing, and lower level of happiness among Hong Kong Chinese adolescents.

Motivated by the intriguing discovery of $X(6900)$ by LHCb Collaboration, we undertake a comprehensive study of the $s\bar{s}s\bar{s}$ tetraquark system in positive parity, employing the Gaussian expansion within the chiral quark model method. We consider two structures, diquark-antidiquark ($ss$-$\bar{s}\bar{s}$) structure and meson-meson ($s\bar{s}$-$s\bar{s}$)strcuture, encompassing all conceivable color and spin configurations. Despite the absence of bound states in our calculations, we have identified potential resonant states with $J^P=0^{+}$, namely $R(0,2150)$ and $R(0,2915)$, as well as a resonant state with $J^P=1^{+}$ denoted as $R(1,2950)$, and a resonant state with $J^P=2^{+}$ denoted as $R(2,2850)$, utilizing the real-scaling method. Through a comparison of their energies and widths, we propose that $R(0,2915)$ and $R(1,2950)$ may share characteristics with $X(6900)$, while $R(0,2150)$ could be a promising experimental candidate for $f_0(2100)$. We strongly advocate for experimental investigations to shed light on the existence and properties of these resonant states.

Process safety plays a vital role in the modern process industry. To prevent undesired accidents caused by malfunctions or other disturbances in complex industrial processes, considerable attention has been paid to data-driven fault detection techniques. To explore the underlying manifold structure, manifold learning methods including Laplacian eigenmaps, locally linear embedding, and Hessian eigenmaps have been utilized in data-driven fault detection. However, only the partial local structure information is extracted from the aforementioned methods. In this paper, these typical manifold learning methods are synthesized to find the underlying manifold structure from different angles. A more comprehensive local structure is discovered under a unified framework by constructing an objection optimization function for dimension reduction of the process data. The proposed method takes advantage of different manifold learning methods. Based on the proposed dimension reduction method, a new data-driven fault detection method is developed. Hotelling’s T2 and Q statistics are established for the purpose of fault detection. Experiments on an industrial benchmark Tennessee Eastman process and a real blast furnace ironmaking process are carried out to demonstrate the superiority and effectiveness of the proposed method.

Objective: This study investigated the effects of an easily implemented 8-week program centered around jump rope exercise (JRE) on executive function among children with ADHD. Methods: Using the Stroop Color Word Test to assess inhibitory control, the n-back task (1- and 2-back) to assess working memory, and task switching to assess cognitive flexibility. Results: After the intervention, there were within-group effects only for the experimental group, with higher accuracy on the 1-back working memory task (t= -2.79，p= 0.011< 0.05，Cohen’s d= 0.60) and on task switching after compared with before the JRE intervention (t= -4.00，p=0.01<0.05，Cohen’s d= 0.85), but with no change in reaction time. There was no significant within-group difference on the Stroop test (P> 0.05). Additionally, there were no between-group effects as assessed by one-way analyses of variance. Conclusion: 8-week program focused on JRE improved two aspects of executive function, working memory and cognitive flexibility, with no significant effect on a third aspect, inhibitory control, among children with ADHD aged 7 to 12 years.

Three kinds of hydrophobic groups grafted starches of maleic anhydride grafted starch (MAH-g-starch), lactic acid grafted starch (LA-g-starch), and methyl acrylate grafted starch (MA-g-starch) were prepared by in-situ solid phase polymerization. The results of Fourier transform infrared spectroscopy (FT-IR) and X-ray photoelectron spectroscopy (XPS) were confirmed successful grafting. The grafting ratios of MAH-g-starch, LA-g-starch and MA-g-starch were 6.50%, 12.45%, and 0.57%, respectively. Influenced by the grafting ratio, LA-g-starch had the best hydrophobic properties and the largest molecular weight, and those for MA-g-starch was the worst. The surfaces of grafted starches were covered with graft polymer, with obvious surface roughness and bond degree of MAH-g-starch and LA-g-starch. The crystalline structure of grafted starches showed some damage, with LA-g-starch exhibiting the greatest decrease in crystallinity, and less of a change for MA-g-starch. Overall, the grafting reaction improved thermoplasticity, with LA-g-starch the most improved, followed by MAH-g-starch, and then MA-g-starch.

Background: The study aimed to explore the association between the prognostic nutrition index (PNI) and in-hospital complication and mortality in patients with spontaneous intracerebral hemorrhage (ICH). Methods: We conducted a retrospective analysis using data from the Changhua Christian Hospital Clinical Research Database (CCHRD) between January 2015 and December 2022. 2402 patients were included, with the median PNI value set at 42.77. The restricted cubic spline model, Kaplan-Meier and ROC analysis for overall survival were used to evaluate the association of PNI with medical complications and mortality. Propensity score matching (PSM) analysis was performed to balance these clinical variables between groups, which could reduce potential bias to some extent. Results: PNI was significantly associated with in-hospital complications and 28-day and 90-day mortality in multivariate analysis. The main finding of our study is that a low PNI score at admission was independently associated with a poor ICH outcome. The Kaplan-Meier curves revealed higher survival rates in the high PNI group. PNI demonstrated sensitivity to predict medical complications and mortality based on ROC analysis. Conclusions Our study suggests that PNI could serve as a valuable marker for predicting medical complications and mortality in patients with spontaneous ICH.

Background: primary sclerosing cholangitis (PSC) is a chronic cholestatic disease characterized by inflammation and fibrosis of the bile ducts. Cholestasis may lead to hepatic inflammation and fibrosis, and amelioration of cholestasis may allow recovery from inflammatory and fibrotic pathological damage. Prevotella copri (P. copri) intervention have been reported could significantly improve cholestasis and liver fibrosis in DDC-induced PSC mice model. Despite alone P. copri treatment could not recover DDC-induced inflammation, it increased the abundance of Lactobacillus murinus (L. murinus) compared to DDC treatment, which has been reported to have anti-inflammatory effects. The abundance of L. murinus still not recover to normal level may underlie hepatic inflammation in P. copri+DDC mice. Method: alone or in combination interventions of P. copri and L. murinus were used to investigate the molecular mechanism of improvement of PSC inflammation and fibrosis. Results: P. copri and L. murinus significantly reduced the hepatic inflammatory cell aggregation and inflammatory factor expression, as well as the hepatic collagen content and fibrin factor expression in PSC mice. Further analysis of phosphorylation and dephosphorylation levels revealed that P. copri and L. murinus combined intervention in PSC mice inhibited the activity of DDC-activated TGF-β1/Smad pathway, thereby reducing liver inflammation and fibrosis. Conclusion: combination of P. copri and L. murinus inhibits the TGF-β1/Smad pathway and reduces inflammation and fibrosis in PSC.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

An event-based dynamic output feedback control (DOFC) strategy for unmanned marine vehicle (UMV) systems is concerned. The whole UMV systems are composed of an UMV closed-loop system, a land-based control unit and the communication network. To increase the effectiveness of data transmission in the network channel and better enable the control unit against attack, an adaptive event-triggered mechanism (AETM) is applied. Moreover, a quantizer is installed between the sampler and the control unit. The quantizer further reduces the communication burden. The occurrence of aperiodic denial-of-service (DoS) attack is considered in the channel from the control unit to the UMV system. Sufficient criterion for ensuring global exponential stability of system with an expected H∞ disturbance attenuation index is obtained. Co-design of the dynamic output feedback controller and the AETM is derived. The effectiveness of the proposed approach is verified in the given illustrative simulation. The simulation results indicate that the reduction percentages of yaw angle amplitudes and yaw velocity accumulative error of the UMV system with the control strategy proposed in this paper are 43.2%and 45.9%, respectively, which are 0.3% and 5.8% improvement in both metrics compared to the previously published work.

Amid escalating urbanization, devising rational commercial space layouts is a critical challenge. Leveraging machine learning, this study uses a Back-propagation (BP) neural network to optimize commercial spaces in Weinan City's central urban area. The results indicate an increased number of commercial facilities with a trend of multi-centered agglomeration and outward expansion. Based on these findings, we propose a strategic framework for rational commercial space development emphasizing aggregation centers, development axes, and spatial guidelines. This strategy provides valuable insights for urban planners in small and medium-sized cities in the Yellow River Basin and metropolitan areas, ultimately showcasing the power of machine learning in enhancing urban planning.

Bamboo plastic composites have become a hot research topic and a key focus of research. However, the many strong, polar, hydrophilic hydroxyl groups in bamboo flour (BF) results in poor interfacial compatibility between BF and hydrophobic polymers. Maleic anhydride-esterified (MAH-e-BF) and lactic acid-esterified bamboo flour (LA-e-BF) were prepared using an in situ solid-phase esterification method with BF as the raw material and maleic anhydride or lactic acid as the esterifying agent. Fourier transform infrared spectroscopy results confirmed that BF esterification with maleic anhydride and lactic acid was successful, with the esterification degrees of MAH-e-BF and LA-e-BF at 21.04 and 14.36%%, respectively. Esterified BF was characterized by scanning electron microscopy, contact angle testing, X-ray diffractometry, and thermogravimetric analysis. The results demonstrated that esterified BF surfaces were covered with graft polymer and the surface roughness and bonding degree of MAH-e-BF clearly larger than those of LA-e-BF. The hydrophobicity of esterified BF was significantly higher than BF and the hydrophobicity of MAH-e-BF better than LA-e-BF. The crystalline structure of esterified BF showed some damage, with MAH-e-BF exhibiting a greater decrease in crystallinity than LA-e-BF. Overall, the esterification reaction improved BF thermoplasticity, with the thermoplasticity of MAH-e-BF appearing better than LA-e-BF.

To compare The effects of organic and inorganic impregnation on the properties of unmodified, phenol formaldehyde oligomer-modified (PFOMCF), and sodium silicate-modified Chinese fir wood (SSMCF) were compared using samples prepared using the respiratory impregnation method. Impregnation and reinforcement effects and water resistance of PFOMCF and SSMCF were compared and the results was showed that the weight percentage gain, density increase rate, bending strength, and compressive strength of SSMCF were clearly higher than those of PFOMCF and had a lower water absorption rate within 60 h. The impregnation and reinforcement effects and dimensional stability of SSMCF were better than those of PFOMCF. FT-IR, XRD, CONE, and TGA examinations were used to test and analyze the chemical structure, crystalline structure, flame retardancy, and heat resistance of these modified woods. The results indicated that SSMCF possessed more hydrogen bonds than PFOMCF and that Si–O–Si chemical bonding with high bond energy was formed. Meanwhile, the weakened degree of the diffraction peak of SSMCF was much less than that of PFOMCF. These results explained that the mechanical properties and water resistance of SSMCF were better than PFOMCF. Compared with PFOMCF, SSMCF had a lower heat release rate (HRR), peak-HRR, mean-HRR, total heat release, smoke production rate, and total smoke production as well as higher thermal decomposition temperature and residual rate. Inorganic sodium silicate was shown to be a better flame retardant, while SSMCF had good smoke suppression effects, thermal stability, and safety performance in the case of fire.

Ferulic acid esters have been suggested as a group of natural chemicals with sunscreen function. The study aimed to utilize an environment-friendly enzymatic method to produce octyl ferulate by esterification of ferulic acid with octanol. The Box-Behnken design with response surface methodology (RSM) was adopted to evaluate the effects of synthesis variables, including reaction temperature (70–90 °C), enzyme amount (1000–2000 PLU) and stir speed (50–150 rpm), on the molar conversion of octyl ferulate. According to the joint test, both the reaction temperature and enzyme amount had great impacts on the molar conversion. RSM-developed second-order polynomial equation further showed great ability on data-fitting. Based on ridge max analysis, the optimum parameters for the biocatalyzed reaction were: 72 h reaction time, 92.2 °C reaction temperature, 1831 PLU enzyme amount and 92.4 rpm stir speed, respectively. Finally, the molar conversion of octyl ferulate under optimum condition was verified to be 93.2 ± 1.5%. In conclusion, high yield of octyl ferulate synthesized by commercial immobilized lipase under elevated temperature conditions has been suggested, which our findings could broaden the utilization of the lipase and provide a biocatalytic approach, instead of the chemical method, for ferulic acid ester synthesis.

A plenty of theories on the origin of genetic codes have been proposed so far, yet all ignored the energetic driving force, its relation to the biochemical system, and most importantly, the missing “matchmaker” between proteins and nucleic acids. Here, a new hypothesis is proposed, according to which ATP is at the origin of the primordial genetic code by driving the coevolution of the genetic code with the pristine biochemical system. This hypothesis aims to show how the genetic code was produced e.g. by photochemical reactions in a protocell that derived from a lipid vesicle enclosing various life’s building blocks (e.g. nucleotides and peptides). At extant cell, ATP is the only energetic product of photosynthesis, and is at the energetic heart of the biochemical systems. ATP could energetically form and elongate chains of both polynucleotides and polypeptides, thus acting a “matchmaker” between these two bio-polymers and eventually mediating precellular biochemical innovation from energy transformation to informatization. ATP was not the only one that could drive the formation of polynucleotides and polypeptides, but favored by precellular selection. The protocell innovated a photosynthesis system to produce ATP efficiently and regularly with the aids of proteins and RNA/DNA. The completion of permanently recording the genetic information by DNA marked the dawn of cellular life operated by Darwinian evolution. The ATP hypothesis assumes or supports the photochemical origin of life, shedding light on the origins of both photosynthetic and biochemical systems, which remains largely unknown thus far. Based on ATP hypothesis, virus (like the new coronavirus) could not be the earliest life on Earth, as it has neither biochemical systems nor lipid bilayer membrane that provided relatively isolated environment for the development of protobiochemical reactions, although it owns the genetic code of a cellular life. Virus could not be a bridge between life and non-life, but is an anti-life substance, as it depletes cellular material for its own replication, and then spreads by destroying the host cells. It can be imagined that if cellular life are completely wiped out by the virus, the complete destruction of life on Earth would be inevitable.

3,4-Dihydroquinolin-2(1H)-ones represent a class of valuable bioactive compounds with six-membered nitrogen-containing heterocyclic structures. The development of simple, mild and efficient synthetic methods has been widely concerned by synthetic chemists. In this review, we have summarized a series of different synthetic strategies for the synthesis of dihydroquinoline-2(1H)-ones via catalytic annulation of α,β-unsaturated N-arylamides in the past decade, including covering electrophilic cyclization, radical initiated cyclization and photochemical cyclization reactions. Besides, the substrate scope and mechanistic details are also discussed. This paper will provide a useful reference for the development of diverse synthesis methodologies of 3,4-dihydroquinolin-2(1H)-ones.

This article obtains data through questionnaire survey, and then uses the Multiple Indicators Multiple Causes (MIMIC) Model to establish the Taoyuan City’s quality of life quantifying framework in a city-level community context. Statistical test results show that the reliability of overall model is high and is suitable for policy analysis. There are thirteen variables in the structural model that significantly affect the quality of life as well as eleven indicators in the measurement model that can significantly measure the quality of life. Then, half of the observations are substituted back to calculate the quality of life. Via ArcGis operation, it finds that the quality of life of Longtan District is the best as well as Dayuan District is the worst one. LISA cluster of quality of life illustrates hot spots areas are distributed in Longtan, Daxi, and Pingzhen Districts.

(1) Background: This retrospective study aimed to compare the efficacy and safety of one-stage computed tomography (OSCT)- to that of two-stage computed tomography (TSCT)-guided localization for the surgical removal of small lung nodules. (2) Methods: We collected data from patients with ipsilateral pulmonary nodules who underwent localization before surgical removal at Veteran General Hospital Kaohsiung between October 2017 and January 2022. The patients were divided into the OSCT and TSCT groups. (3) Results: We found that OSCT significantly reduced the localization time and risky time compared to TSCT, and the success rate of localization and incidence of pneumothorax were similar in both groups. However, the time spent under general anesthesia was longer in the OSCT group than in the TSCT group. (4) Conclusions: The OSCT-guided approach to localize pulmonary nodules in hybrid operation room is a safe and effective technique for the surgical removal of small lung nodules.

The early detection of cognitive decline and timely non-pharmacological management or drug therapy are extremely important in providing care for Parkinson’s disease with dementia (PDD). In this study, we first conducted a discovery study to identify six plasma microRNAs that may allow for the differentiation of PD with or without mild cognitive impairment via NGS. A total of 120 participants were further recruited in a validation cohort and divided into four subgroups, namely, normal controls (HC), PD with no dementia (PDND), PD with mild cognitive impairment (PD-MCI) and PDD. Among the six candidates, miR-203a-3p was successfully detected in the plasma of the validation cohort using droplet digital PCR (ddPCR). Our results show that the ratio of miR-203a-3p/miR-16-5p observed in PDD was significantly increased compared to in PD-MCI (p < 0.001) and PDND (p = 0.041). Moreover, the ratio of miR-203a-3p/miR-16-5p showed a significant correlation with MoCA scores (r = -0.237, p = 0.024) in patients with PD (PwP). The ROC curve of the logistic regression model, consisting of the variables of age, the ratio of miR-203a-3p/miR-16-5p and the UPDRS III score, also demonstrated an average AUC of 0.883 via 5-fold cross-validation. In conclusion, the ratio of miR-203a-3p/miR-16-5p may serve as a potential biomarker for distinguishing cognitive dysfunction from PwP.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

Ginkgolic acids (GA) have been reported to exhibit anticancer properties, however, the mechanisms remain unclear. This study aims to investigate the mechanisms of GA C13:0 that was isolated from Ginkgo biloba exocarp (GBE) for anti-proliferation, pro-apoptosis and anti-migration effects in human MCF-7 and mouse 4T-1 breast cancer cells. The cytotoxic effect, apoptosis induction and migration inhibition were measured using MTT, TUNEL and Wound healing assays. The expression of mRNA and protein were determined using qPCR and Western blot. Our results showed that no cytotoxicity was found at concentrations of C13:0 below 100µM. The effects of GA C13:0 was further demonstrated by up-regulation of the Bax/Bcl-2 apoptosis pathway and the expression of Apaf-1 protein in the mitochondria. In addition, GA C13:0 also suppressed cell migration and epithelial to mesenchymal transition (EMT) with the increase of E-cadherin expression accompanied by the decrease of Snail, MMP-2, MMP-9 and Vimentin expression. Moreover, GA C13:0 induced cytochrome P450 (CYP) 1B1 expression in aryl hydrocarbon receptor (AhR) pathway. Notably, the up-regulation of CYP1B1 also might play a pivotal regulatory role in mitochondrial and EMT pathways in MCF-7 and 4T-1 cells. Our results may have implications for the development of anticancer agents containing GA as functional additives.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Hepatocellular carcinoma (HCC) is one of the most common cancers and the main cause of cancer-related death globally. Immune dysregulation of CD4+ T cells has been identified as a role in the development of HCC. Nevertheless, the underlying molecular pathways of CD4+ T cells in HCC are not completely known. Thus, a better understanding of the dysregulation of lncRNA-miRNA/mRNA network might yield novel insights into the etiology or progression of HCC. In this study, circulating CD4+ T cells were isolated from the whole blood of 10 healthy controls and 10 HCC patients for next-generation sequencing of the expression of lncRNAs, miRNAs, and mRNAs. Our data showed that there was different expression of 34 transcripts (two lncRNAs, XIST and MIR222HG, 29 mRNA, and 3 other types of RNA) and 13 miRNAs in the circulating CD4+ T cells of HCC patients. The expression of the lncRNA XIST-related miRNAs and their target mRNAs was confirmed using real-time quantitative polymerase chain reaction (qPCR) on samples from 100 healthy controls and 60 HCC patients. The lncRNA–miRNA/mRNA regulation network was created using interaction data generated from ENCORI and revealed there are positive correlations in the infiltration of total CD4+ T cells and negative correlations in the infiltration of Th1 CD4+ T cells.

Physical inactivity is a well-known risk factor for various non-communicable diseases (NCDs). Sufficient physical activity (PA) is essential for the prevention of NCDs and thus it is imperative to study the current status of PA and its influencing factors among rural residents in China. A population-based survey was conducted in rural areas of Shandong, Shanxi and Yunnan Provinces using a stratified random sampling method. The International Physical Activity Questionnaire Short Form (IPAQ-S) was used to collect the data on PA. A total of 3780 rural residents participated in the survey. The result showed that 22.2% of rural residents were physical inactivity. The proportion of rural residents reporting practice of physical exercise was 54.4%. The most frequently performed physical exercise was walking/brisk walking(78.3%).Binary logistic regression analyses showed that being female, people at age between 15 to 34 years or 60 years old and above, employees of governmental departments/retirees, school students, the unemployed, people with NCDs were risk factors of PA and ethnic minority groups,smoking and alcohol consumption were risk factors of physical exercise. Health promotion programme aiming at increasing people’s PA in rural China is needed and it should focus on the populations groups of the female, people at age 60 years and above ,school students, the unemployed, and people with NCDs.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Abstract Objective: Endometriosis is a chronic disease characterized by the growth of endometrial cells outside the uterine cavity. The dysfunction of the immune system is strongly associated with the progression of endometriosis, and is also correlated to the diversity of microbiota in the genital tract. According to previous studies, the microbiota significantly contributes to multi-systemic function, but the evidence of endometriosis and adenomyosis remains insufficient. Thus, the present study attempted to identify the characteristics of microbiota in endometriosis patients, and the connection between microbiota and immunological dysfunction. Methods: In order to compare and explore the potential microbiota correlated to endometriosis and adenomyosis in the genital tract, 134 samples obtained from the cervical canal, posterior fornix and uterine cavity were analyzed by 16s-rRNA sequencing. The raw data was filtered, analyzed and visualized, and bio-information methods were used to identify the different and distinctive characteristics of microbiota. Results: Two different locations near the cervix, cervical canal and posterior fornix, exhibited no differences in alpha diversity. Among the different disease groups, five microbiota were distinctive in the genus level, and Atopobium presented with the greatest significance in adenomyoisis-endometriosis patients. The LEfSe analysis failed to identify the special biomarkers, while several characteristic functions were identified through PICRUSt. Conclusion: Lactobacillus is dominant in the female lower genital tract, and Atopobium is distinctively higher in patients with endometriosis combined with adenomyosis. Several different functions of microbiota were explored, and these are found to be associated with endometriosis and adenomyosis. These findings may provide a new concept of microbiota/immune system/endometriosis system. There is an urgent need to investigate the potential microbial biomarkers of endometriosis in the future.

In this work, the Ni/Ti/Nb multilayer composite was successfully manufactured by accumulative pack-roll bonding. The microstructure evolution and mechanical properties of the composite during the accumulative roll bonding (ARB) process were investigated by scanning electron microscopy(SEM), energy dispersive spectrometer(EDS), transmission electron microscopy (TEM), micro-hardness and tensile tests. The results showed that after 5 passes of the ARB process, the deformations of layers were relatively uniform, and no large number of interlayer fractures occurred. The microstructures of Ni and Ti were both equiaxed grains with a grain size of 200 nm and 150 nm, respectively, and finer equiaxed grains of the Ni layer were observed at the interface. The laminar structure of Nb layer was observed. The tensile strength and micro-hardness increased significantly as the number of ARB increased. After 5 passes of the ARB process, the tensile strength of the composite reached 792.3 MPa, and the micro-hardness of Ni, Ti, and Nb were increased to 270.2, 307.4, and 243.4 HV, respectively.

Mechanical ventilation (MV), used in patients with acute lung injury (ALI), induces diaphragmatic myofiber atrophy and contractile inactivity, termed ventilator-induced diaphragm dysfunction. Phosphoinositide 3-kinase- (PI3K-) is crucial in modulating fibrogenesis during the reparative phase of ALI; however, the mechanisms regulating the interactions among MV, myofiber fibrosis, and PI3K- remain unclear. We hypothesized MV with or without bleomycin treatment would increase diaphragm muscle fibrosis through the PI3K- pathway. Five days after receiving a single bolus of 0.075 units bleomycin intratracheally, C57BL/6 mice were exposed to 6 or 10 mL/kg MV for 8 h after receiving 5 mg/kg of AS605240 intraperitoneally. In wild-type mice, bleomycin exposure followed by MV 10 mL/kg prompted significant increases in disruptions of diaphragmatic myofibrillar organization, transforming growth factor-1, oxidative loads, Masson’s trichrome staining, extracellular collagen levels, positive staining of -smooth muscle actin, PI3K- expression, and myonuclear apoptosis (P &lt; 0.05). Decreased diaphragm contractility and peroxisome proliferator activated receptor- coactivator-1 levels were also observed (P &lt; 0.05). MV-augmented bleomycin-induced diaphragm fibrosis and myonuclear apoptosis were attenuated in PI3K-γ-deficient mice and through AS605240-induced inhibition of PI3K- activity (P &lt; 0.05). MV-augmented diaphragm fibrosis after bleomycin-induced ALI is partially mediated through PI3K-γ. Therapy targeting PI3K-γ may ameliorate MV-associated diaphragm fibrosis.

The conceptualisation of happiness varies across different cultures. In Chinese culture, happiness is not only inclusive of oneself, but also hinges on the people is related to and society. Chinese social development have influenced psychological traditionality and modernity and individual's happiness. In Experienment1, 450 participants were recruited and surveyed to examine the levels of happiness amongst Chinese undergraduates with diverse cultural values. The results showed that individuals with both traditional and modern psychological orientations had high levels of happiness. Those with higher psychological traditionality showed more satisfaction with family relationships and social happiness, while those with higher psychological modernity demonstrated a higher level of relational happiness. In Experienment2, 280 participants were recruited, and a "happiness token distribution" and "happiness importance survey" were employed to draw a 'happiness circle' for Chinese undergraduates. The results revealed that those with a higher degree of psychological traditionality assigned a greater proportion of their happiness to ascribed relationships. In contrast, those with a higher degree of psychological modernity allocated a larger share of their happiness to interactive relationships and social relationships. Individuals with lower values of both traditionality and modernity perceived themselves as the most important component in their happiness circle.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

To analyse Xuanwei ham flavour quality at different post-ripening times, and to elucidate its microbial diversity, we studied free amino acids and volatile flavouring compounds (VOCs) and their relationships. We determined microbial community changes in Xuanwei ham at 1, 2, 3 and 4 years (W1-4) by high-throughput sequencing, and simultaneously, VOCs and free amino acid contents by gas chromatography-mass spectrometry (GC-MS) and liquid chromatography (LC), respectively. Then heatmap analysis was used to determine correlations between microbial communities, free amino acids and VOCs. A total of 25 free amino acids were detected, among which W3 contained the fewest and most were generally lower than in hams in the other three years. Fifty-nine VOCs were detected, among which were 17 esters, and the highest ester content was found in W4. Atotal of 87508391 reads were obtained from the samples, of which 812844 were clean reads, and the bacterial Chao1 index and Shannon index were significantly higher in W3 than in the other three ham years. In differetly-aged Xuanwei hams, Pseudomonadota was the dominant bacterial phylum, and the most abundant genera were Sarocladium, Klebsiella and Vibrio. Klebsiella was the most abundant genus in W1, and Vibrio in W3, and the second most abundant genera were Sarocladium and Gammaretrovirus. We elucidated differences in Xuanwei ham microflora structures in different years and the main flavor-related microorganisms, thus providing a theoretical basis for subsequent Xuanwei ham storage, quality and improvement.

Strawberry root rot caused by Neopestalotiopsis clavispora is one of the main diseases of strawberry and significantly impacts the yield and quality of strawberry fruit. There are now no effective control techniques available except for fungicide sprays, which may directly impact consumers. Biological control is becoming an alternative method for the control of plant diseases to replace or decrease the application of traditional synthetic chemical fungicides. Trichoderma is widely used as a biological agent for controlling strawberry root rot. In order to provide resources for screening the highly effective biocontrol fungus for controlling strawberry root rot caused by Neopestalotiopsis clavispora, the biocontrol mechanism,the control effects of Trichoderma asperellum CMT10 against strawberry root rot and growth-promoting effects on strawberry seedlings were investigated by plate culture, microscopy observation and root drenching methods.The results showed that CMT10 had obvious competitive, antibiotic and hyperparasitism effects on Neopestalotiopsis clavispora CMGF3. The CMT10 could quickly occupy nutritional space, and the inhibition rates of CMT10 against CMGF3 in confrontation culture on 7 d was 65.49%. The inhibition rates of volatile metabolite and fermentation metabolite produced by CMT10 against CMGF3 were 79.67% and 69.84%, respectively. The mycelium of strain CMT10 can act as hyperparasites by making contacting, winding and penetrating hyphae of CMGF3. Pot experiment showed that the biocontrol efficacy of CMT10 on strawberry root rot caused by Neopestalotiopsis clavispora was 63.00%. CMT10 had obvious promotion effect on strawberry growth, the plant height, root length, total fresh weight, root fresh weight, stem fresh weight and root dry weight, with the promotion rates were 20.09%, 22.39%, 87.11%, 101.58%, 79.82% and 72.33%, respectively. Overall, this study showed the ability of Trichoderma asperellum CMT10 to control strawberry root rot and their potential to develop as novel biocontrol agents to replace chemical fungicides for eco-friendly, sustainable agriculture.

The last-mile logistics in cities have become an indispensable part of the urban logistics system. This study aims to explore the effective selection of last-mile logistics nodes to enhance the efficiency of logistics distribution, strengthen the corporate distribution image, and further reduce corporate operating costs and alleviate urban traffic congestion. This paper proposes a clustering-based approach to identify urban logistics nodes from the perspective of geographic information fusion. This method comprehensively considers several key indicators, including the coverage, balance, and urban traffic conditions of logistics distribution. Additionally, we employed a greedy algorithm to identify secondary nodes around primary nodes, thus constructing an effective nodal network. To verify the practicality of this model, we conducted an empirical simulation study using the logistics demand and traffic conditions in the Xianlin District of Nanjing. This research not only identified the locations of primary and secondary logistics nodes but also provided a new perspective for constructing the urban last-mile logistics system, enriching the academic research related to logistics node construction. The results of this study are of significant theoretical and practical importance for optimizing urban logistics networks, enhancing logistics efficiency, and promoting the improvement of urban traffic conditions.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

In the ground-based infrared optical remote sensing system, the target signal is very weak due to the dynamic strong light background and the movement of small and small targets. In order to improve the limit detection capability, the background suppression and target enhancement methods are required to be more suitable for this scene. To solve this problem, we first analyze the image features in the current scene, and propose a more perfect point target and noise model. Then, we propose a new WY distribution function based on the Fermi Dirac distribution function, and propose an anisotropic filtering method based on this function, and further suppress the back-ground through the difference results of two steps. Then, based on the distribution function, we further designed an energy concentration accumulation strategy in 9 scale directions, through which the SNR of the target is effectively improved and the suppression ability of the background is enhanced. Through quantitative and qualitative experimental analysis, compared with the same type of algorithms, the proposed method has better robustness against extremely weak targets and dynamic backgrounds.

With the rapid development of the economy and the transformation of social contradictions, the economic development model in China has also changed, and a high-quality economic development model has been proposed. This paper uses the entropy method to measure the level of innovation and high-quality economic development in nine prefecture-level cities in Fujian Province from 2011 to 2020, and finds that the overall level shows an increasing trend year by year, but there are obvious regional differences. By constructing a grey correlation degree model, it is found that the innovation subsystem and the high-quality economic development are strongly correlated, the development level of innovation and the subsystem of high-quality economic development are both strongly correlated, the grey correlation degree from high to low is green, coordinated, shared, and livelihood, indicating that innovation has a significant impact on high-quality economic development. Based on the research results, countermeasures and suggestions are proposed to promote the coordinated development of innovation and high-quality economy.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Innovations and improvements in hydraulic fracturing and horizontal well technologies have contributed to the success of the shale gas industry; however, the industry is also challenged by freshwater use and environmental health issues. Increasing water impact makes precise quantification of water consumption important. The objective in this study was to better understand water sustainability and availability of the projected shale gas from 2018 to 2030 in the Weiyuan play, China. The water footprint framework was used to quantify the potential water use and environmental impacts on different time scales. The results showed that the water use per well ranged from 11351.3 to 60664.73 m3, with a median of 36013.94 m3, totaling ~3.44 Mm3 for 97 wells. Yearly evaluation results showed that the gray water footprint was the main contributor and accounted for 83.82% to 96.76%, which was dependent on different scenarios of treatment percentages. The monthly environmental impact results indicated that the annual streamflow statistics were more likely to prevent water withdrawal. Water quality issues may be alleviated through recycling and retreatment measures that improve current waste water management strategies. Resource regulators should manage their water resources by matching water demand to water availability or replenishment.

This work demonstrates that a plasmid can function as an efficient biocatalyst in mediating the nitroaldol (Henry) reaction at high temperatures in ultrapure water. Compared with ssDNA, the plasmid displayed a remarkable catalytic efficiency (97% yield within 20 min). Aromatic aldehydes which bear strong or moderate electron-withdrawing groups reacted satisfactorily with nitromethane, which afforded the corresponding β-nitroalcohols in good yields within 2 h (up to 98%). By contrast, aliphatic and aromatic aldehydes with electron-donating groups did not react. Moreover, the yield significantly dropped when the size of the carbanion increased, and the yield was only 10% when nitropropane was used as the donor.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

The construction of sustainable urban forests follows the principle that well-being in people is promoted when exposed to tree population. Facial expression is the direct representation of inner emotion that can be used to assess real-time perception in urban forests. The emergence and change of facial expressions for forest visitors are in an implicit process. The reserved character of oriental races strengthens the requirement for the accuracy to recognize expressions through instrument rating. In this study, a dataset was established with 2,886 randomly photographed faces from visitors in a constructed urban forest park and a promenade at summertime in Shenyang City at Northeast China. Six experts were invited to choose 160 photos in total with 20 images representing one of eight typical expressions as angry, contempt, disgusted, happy, neutral, sad, scared, and surprised emotions. The FireFACE ver. 3.0 software was used to test hit-ratio validation as the accuracy (ac.) to match machine-recognized photos with those identified by experts. According to Kruskal-Wallis test on the difference from averaged scores in 20 recently published papers, contempt (ac.=0.40%, P=0.0038) and scared (ac.=25.23%, P=0.0018) expressions cannot pass the validation test. Therefore, the FireFACE can be used as an instrument to analyze facial expression from oriental people in urban forests but contempt and scared expressions cannot be identified.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

The soil microbial community serves as a crucial indicator for assessing soil fertility and health. The composition and activity of soil microorganisms reflect the soil's well-being and its ability to provide proper nutrients for crops. Fertilization plays a prominent role in enhancing soil fertility, and novel types of fertilizers, such as stabilized fertilizers with nitrification/urease inhibitors and coated fertilizers, have gained popularity in rice and maize cultivation. However, the long-term effects of these stabilized and coated urea fertilizers on soil chemical properties, microbial di-versity and community structure, as well as nitrogen cycling functional genes, remain unclear. Therefore, it is essential to investigate the impact of extended use of stabilized and coated urea fertilizers on soil fertility and microbiota in rice paddy fields. This research will provide scientific and theoretical support for the development and promotion of stabilized and coated urea ferti-lizers. To examine the effects of long-term application of these stabilized and coated urea fertilizers on soil chemical properties and microorganisms in rice paddy fields, soil samples were collected from brown soil rice paddy fields treated with various urease and nitrification inhibitors, stable urea, sulfur-coated urea (SCU), and resin-coated urea (PCU). The study revealed that 16 years of long-term use of conventional urea nitrogen fertilizer led to a considerable reduction in soil TP. On the other hand, NBPT and conventional urea fertilizers, when applied for an extended period, significantly increased soil organic matter (SOM). Moreover, except for HQ and NBPT+DMPP, the prolonged application of new urea fertilizers also signifi-cantly enhanced soil total potassium (TK). Notably, among all the treatments, PCU treatment had higher values for various soil chemical properties. In the case of SCU fertilizer used in brown soil rice paddy fields, it resulted in a significant decrease in soil pH over time. However, this change in pH did not affect the population of ammonia-oxidizing bacteria (AOB), as it was primarily in-fluenced by soil available nitrogen. DMPP, HQ+DCD, NBPT+DMPP, SCU, and PCU significantly reduced the copy number of bacterial 16S rRNA genes in the soil, with the coated urea fertilizers (SCU and PCU) having a greater impact. The long-term use of stabilized urea fertilizers containing HQ significantly reduced the bacterial community in rice paddy soil. Conversely, HQ+DCD stable urea fertilizer significantly increased the population structure and abundance of Basidiomycota fungi while decreasing the population structure and abundance of Rozellomycota fungi. DMPP stabilized urea fertilizer notably increased the population structure and abundance of Ascomycota fungi while decreasing the population structure and abundance of Rozellmycota and Chytridiomycota fungi. Further-more, HQ stabilized urea fertilizer significantly reduced the population structure and abundance of Chytridiomycota fungi. It is important to note that SCU fertilizer is not suitable for long-term application in neutral to slightly acidic meadow brown soil with a background pH. On the other hand, stable urea fertilizers and resin-coated urea fertilizers containing HQ, NBPT, DCD, DMPP, and their combinations are suitable for long-term application in neutral to slightly acidic meadow brown soil.

The fluorine-less noble-gas containing anions OBONgO- and OCNNgO-have been studied by correlated electronic structure calculation and density functional theory. The obtained energetics indicates that for Ng = Kr and Xe, these anions should be kinetically stable at low temperature. The molecular structures and electron density distribution suggests that these anions are stabilized by ion-induced dipole interactions with charges concentrated on the electronegative OBO and OCN groups. The current study shows that in additional to the fluoride ion, polyatomic groups with strong electronic affinities can also form stable noble-gas containing anions of the type X-...NgO.

Drafting formations have been long recognized as highly effective for reducing drag and enhancing athletic performance, particularly in race walking events. The precise spacing and positioning of the race walkers are critical to optimizing the effectiveness of drafting. In this study, the drag reduction of 15 drafting formations is investigated using wind-tunnel experiments and CFD numerical simulations. The results show excellent consistency in drag reduction rate between the two methods, with differences being within 10%. This can be attributed to spacing replacing body shape differences as the primary factor influencing drag reduction. Optimal double, triple, and quadruple drafting formations produce the same results in both wind-tunnel experiments and CFD simulation, resulting in drag reductions of 67%, 66%, and 81% (wind-tunnel) and 65%, 72%, and 85% (CFD). The sources of drag differences in the two methods are discussed from various aspects. The flow field obtained through CFD analysis is used to examine the mechanism of drag reduction, revealing that drafting formations have a significant shielding effect on incoming air, which reduces the number and speed of airflow impacting the core race walker. This shielding effect is identified as the primary cause of drag reduction. Using an empirical model for mechanical power output, optimal double, triple, and quadruple drafting formations enhance sport economy (4.4-5.7%), speed (3.61-4.67%), and performance (173.8-223.3s) compared to race walking alone. The findings can serve as a reference for race walkers' positioning strategy and provide insights for considering drafting formations in various running events.

Abstract. Graphene family (GF)-Calcium phosphate (CaP) composites, holds great potential as components of bone regeneration materials. GF nanomaterials can be modified physically as well as chemically, which are to be biomimetic, mechanically to be hard due to their capability to support exceptional mechanical, thermal and electronic properties. These biocompatible GF composites coated on the calcium phosphate can enhance and tolerate stem cell growth and differentiation, proliferation into various lineages or interact with bioorganisms. The development in CF-CaP materials and their physicochemical/biointeractions and strategies towards osteoblasts is a great concern to promote faster healing and reconstructions of large bone imperfections or defects. In this review, we explain the influence of the CF-CaP and summarize recent developments on designing CF-CaP architectures as multifunctional bone regeneration platforms. We have also explored the typical biological applications concerning these CF-CaP based bioactive nanocomposites. Furthermore, the future viewpoints and evolving challenges will also be emphasized. Due to the shortage of full-length reviews in this emerging research field, this review would be caught great attention and encourage various new chances across a wider range of disciplines.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

Tulou dwellings in Southeast China have captivated global interest due to their distinctive appearance, sustainable construction materials and technologies, and their defensive and collective housing functions. Despite several recognized as World Cultural Heritage sites, the vast majority of tulou buildings are undergoing irreversible decline and destruction, necessitating a comprehensive and systematic study. Taking 83 Tulou buildings in Raoping County, Chaozhou City, Guangdong Province as the research object, this study reconstructs the historical scenes and systematically reveals the emergence, popularity, and consolidation process of tulou dwellings as integrated defensive and residential buildings for ordinary people by conducting a comprehensive analysis of historical documents and local chronicles. Based on an extensive field investigation, the study systematically analyzes the geospatial distribution and the spatial characteristics of Raoping tulou and its residential unit. The results demonstrate the adaptability and flexibility of tulou dwellings, showcasing their developmental process and revealing the inclusive nature of these traditional residences, as well as the initiative of those who reside within them. The research findings contribute to a more dynamic, comprehensive, and authentic understanding of tulou and Chinese traditional residences, providing valuable references for the preservation and sustainable development of tulou architectural heritage.

Herpesviridae is a family of enveloped double-stranded DNA viruses that cause a wide range of diseases in hosts. Among the various components of herpesvirus particles, tegument proteins residing between the envelop and nucleocapsid play crucial roles in viral replication, immune evasion, and modulation of host cellular pathways. Understanding the three-dimensional structure of herpesvirus tegument proteins help to reveal the molecular mechanism underlying the crosstalk with other viral and cellular components, and thus is crucial for the investigation of their biological and pathological functions. In this review, we summarize the current knowledge of the structural features of herpesvirus tegument proteins, highlighting the structure-based functional implications, including the potential as targets for antiviral drug development.

The open communication is an exigent need for future power system where the time delay is unavoidable. In order to secure the stability of the grid, the frequency must remain within its limited range which is achieved through the load frequency control. The load frequency control signals are transmitted through communication networks which induces time delay that could destabilize the power systems. So, in order to guarantee the stability the delay margin should be computed. In this paper, we present a new method for calculating the delay margin in load frequency control systems. The transcendental time delay characteristics equation is transformed to frequency dependant equation. The spectral radius is used to find the frequencies at which the roots crosses the imaginary axis. The crossing frequencies are determined through the sweeping test and the binary iteration algorithm. A one-area load frequency control system is chosen as case study. The effectiveness of the proposed method has been proved through comparing with the most recent published methods. The method shows its merit with less conservativeness and less computations. The PI controller gains are preferable to be chosen large to reduce the damping, however, the delay margin decreases with increasing the PI controller gains.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

This paper presents a critical review and comparison of the results of recently published studies in the fields of human-machine interface and the use of sonomyography (SMG) for the control of upper limb prothesis. For this review paper, a combination of the keywords "Human Machine Interface", "Sonomyography", "Ultrasound", "Upper Limb Prosthesis", "Artificial Intelligence" and "Non-Invasive Sensors" was used to search for articles on Google Scholar and PubMed. Sixty-one articles were found, of which 59 were used in this review. For a comparison of the different ultrasound modes, feature extraction methods, and machine learning algorithms, 16 articles were used. It was found that various modes of ultrasound devices for prosthetic control, various machine learning algorithms for classifying different hand gestures, as well as various feature extraction methods for increasing the accuracy of artificial intelligence used in their controlling systems are reviewed in this article. The results of the review article show that ultrasound sensing has the potential to be used as a viable human-machine interface in order to control bionic hands with multiple degrees of freedom. Moreover, different hand gestures can be classified by different machine learning algorithms trained with extracted features from collected data with an accuracy of around 95%.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

The dynamics of hydrological lateral nutrient fluxes contribute to our understanding of ecological functions related to energy, materials, and organism flows across various spatiotemporal scales. To explore the connectivity between multiple spatial flow processes, we conducted a one-year field measurement to assess lateral hydrologic carbon (C) and nitrogen (N) fluxes over the continental shelf in the Yangtze estuary. We observed a significant correlation between the differences in remote sensing-based estimates of gross primary production (GPP) (∆GPPMODIS) and the differences in eddy covariance (EC) tower-based GPP (∆GPPEC) at both high-elevation and low-elevation sites. Over the course of a year, our predicted daily maximum tidal elevation (TE) closely matched the observed values in the creek, which facilitated the development of theoretical models to simulate biogeochemical cycling processes and aquatic ecosystem functions. Our findings indicate that the studied saltmarsh acts as a net exporter of dissolved total C (DTC) while serving as a net sink for dissolved total N (DTN). Furthermore, there is a significant correlation in the total dissolved stoichiometry of the C/N ratio between imports and exports. These findings highlight the importance of integrating ecological stoichiometric principles to gain a deeper understanding of the complex relationships between physical, chemical, and biological processes, particularly within the context of the meta-ecosystem framework. Additionally, when considering reciprocal hydrological lateral C and N flows, single ecosystem can function both as sources and sinks within the meta-ecosystem framework.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

Over the past four decades, China has experienced a nutritional transition and has developed the largest population of internet users. In this study, we evaluated the impacts of internet access on the nutritional intake in Chinese rural residents. An IV-Probit-based propensity score matching method was used to determine the impact of internet access on nutritional intake. The data were collected from 10042 rural households in six Chinese provinces. The results reveal that rural residents with internet access have significantly higher energy, protein, and fat intake than those without. Chinese rural residents with internet access consumed 1.35% (28.62 kcal), 5.02% (2.61 g), and 4.33% (3.30 g) more energy, protein, and fat, respectively. There was heterogeneity as regards the intake of energy, protein, and fat among those in different income groups. Moreover, non-staple food consumption is the main channel through which internet access affects nutritional intake. The results demonstrate that the local population should use the internet to improve their nutritional status. Further studies are required to investigate the impact of internet use on food consumed away from home and micronutrients intake.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

We explored the trends and the diversity of the mortality and risk factors of age-standardized cardiovascular diseases (CVD) and cerebrovascular disease (CBD) from 2000 to 2020 in five advanced Asian countries, including China, Japan, Singapore, South Korea, and Taiwan. Data were obtained from the Global Burden of Disease (GBD) report. Overall, the CVD mortality rates decreased gradually in all five Asian countries. Singapore had the highest rates before 2011, but Taiwan replaced Singapore as the nation of the highest mortality rates after 2012. Additionally, South Korea had the highest CBD mortality rates before 2016, while Taiwan experienced a peak in 2011 and remained high thereafter. The absolute difference (AD) and relative difference (RD) for CVD mortality rates showed clear declining trends in all five countries, with South Korea and China displaying the highest reductions, respectively. It is noteworthy that overweight and obesity exhibited an increasing trend in all these five Asian countries, with China demonstrating the highest AD and RD. Except for Taiwan, where a negative association of r=-0.732 was observed, CVD mortality was positively associated with CBD, hypertension, and DM mortality in all other four countries, therefore, further investigation into these relationships are needed.

The decline in Pinus sylvestris var. mongolica in the introduction area has had a high profile in recent years. For the ecological restoration, management and silvicultural design of Mongolian pines in the introduction area, it is necessary to conduct a comprehensive and in-depth study on the ecological adaptation mechanism of Mongolian pines in provenances. The ecological process of water and nutrient accumulation as well as the influence of environmental factors on the photosynthetic physiology are the key to revealing the ecological adaptation mechanism of Mongolian pines. According to the differences of climate in the distribution area of Mongolian pines, sampling sites were set up, the effects of environmental factors on leaf δ13C and the relationship between leaf δ13C and nutrient content were analyzed. The results showed that leaf δ13C values were ranging from - 29.7 ‰ to - 23.76 ‰. The ecological stoichiometry, including LC (522.81 mg·g-1), LN (16.04 mg·g-1), LP (1.19 mg·g-1) and L-N:P (13.56), indicated that leaf photosynthesis and water use efficiency is greatly affected by environmental conditions, Mongolian pines had strong ability of carbon fixation, and its growth was obviously restricted by nitrogen. Although there was no significant correlation between δ13C with stoichiometric parameters in leaf, photosynthesis was the key link in the process of carbon fixation. It also showed that Pinus sylvestris var. mongolica was a stomatal limited plant. Leaf δ13C had significant correlation with climatic factors. VPD is the dynamic factor affecting the photosynthetic physiological process in leaves. Air and soil moisture are the dominate factors affecting the leaf stomatal conductance and determines leaf δ13C value, while other factors indirectly affect leaf δ13C by its impact on relative humidity or soil water content. Soil phosphorus content affected by clay is a key factor affecting soil water availability and soil nutrient cycling. Photosynthetic process in leaf is the dynamic process affecting the nutrient accumulation.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Advances in reconfigurable liquid-based reconfigurable antennas are enabling new possibilities to fulfil the requirements of more advanced wireless communication systems. In this review, a comparative analysis of various state-of-the-art concepts and techniques for designing reconfigurable antennas using liquid is presented. First, the electrical properties of different liquids at room temperature commonly used in reconfigurable antennas are identified. This is followed by a discussion of various liquid actuation techniques in enabling high frequency reconfigurability. Next, liquid-based reconfigurable antennas in literature used to achieve the different types of reconfiguration will be critically reviewed. These include frequency-, polarization-, radiation pattern- and compound reconfigurability. The current concepts of liquid-based reconfigurable antennas can be classified broadly into three basic approaches: altering the physical (and electrical) dimensions of antennas using liquid, applying liquid-based sections as reactive loads; and implementation of liquids as dielectric resonators. Each concept and their design approaches will be examined, outlining their benefits, limitations, and possible future improvements.

In urban areas like Chicago, daily life extends above ground level due to prevalence of high-rise buildings where residents and commuters live and work. This study examines the variation in fine particulate matter (PM2.5) concentrations across building stories. PM2.5 levels were measured using PurpleAir sensors, installed between April 8 and May 7, 2023, on floors one, four, six, and nine of an office building in Chicago. Additionally, data were collected from a public outdoor PurpleAir sensor on the fourteenth floor of a condominium located 800 meters away. Results show that outdoor PM2.5 concentrations peak at 14 meters height, then decline by 0.11 μg/m3 per meter elevation, especially noticeable from midnight to 8 AM under stable atmospheric conditions. Indoor PM2.5 concentrations increase steadily by 0.02 μg/m3 per meter elevation, particularly during peak work hours, likely caused by greater infiltration rates at higher floors. Both outdoor and indoor concentrations peak around noon. We find that indoor and outdoor PM2.5 are positively correlated, with indoor levels consistently remaining lower than outside levels. These findings align with previous research suggesting decreasing outdoor air pollution concentrations with increasing height. The study informs decision-making by community members and policymakers regarding air pollution exposure in urban settings.

Transposable elements (TEs), also known as mobile elements (MEs), are interspersed repeats that constitute a major fraction of the genomes of higher organisms. As one of their important functional impacts on gene function and genome evolution, TEs participate in regulating the expression of genes nearby and even far away at transcriptional and post-transcriptional levels. There are two known principal ways by which TEs regulate expression of genes. First, TEs provide cis-regulatory sequences in the genome with their intrinsic regulatory properties for their own expression making them potential factors for regulating the expression of the host genes. TE-derived cis-regulatory sites are found in promoter and enhancer elements, providing binding sites for a wide range of trans-acting factors. Second, TEs encode for regulatory RNAs with their sequences showed to be present in a substantial fraction of miRNAs and long non-coding RNAs (lncRNAs), indicating the TE origin of these RNAs. Furthermore, TEs sequences were found to be critical for regulatory functions of these RNAs including binding to the target mRNA. TEs thus provide crucial regulatory roles by being part of cis-regulatory and regulatory RNA sequences. Moreover, both TE-derived cis-regulatory sequences and TE-derived regulatory RNAs, have been implicated to provide evolutionary novelty to gene regulation. These TE-derived regulatory mechanisms also tend to function in tissue-specific fashion. In this review, we aim to comprehensively cover the studies regarding these two aspects of TE-mediated gene regulation, mainly focusing on the mechanisms, contribution of different types of TEs, differential roles among tissue types, and lineage specificity, based on data mostly in humans.

Refractive index measurements have been an important task for a long time because that index plays an essential role in describing the optical properties of a material. Many methods have been developed to perform that task. Some of them use interferometry to achieve high precision, however these configurations are complicated. Some measure the critical angle using simple structures, but the accuracy is not satisfactory because it is difficult to judge the exact critical angle with intensity variations. Here we propose several new schemes based on measuring the polarization change in the total internal reflection. The proposed method has the merits of simple structure and easy incident angle determination that gives the maximum phase change. Additionally, it is possible to find the material dispersion by measuring the wavelength dependence of the polarization ellipticity. Some useful formulas relating the refractive index with the maximum phase change are obtained. This work can provide valuable alternatives for index measurement.

In recent years, cerium dioxide (CeO2) has attracted considerable attention owing to its remarkable performance in various applications, including photocatalysis, fuel cells, and catalysis. This study explores the effect of nickel (Ni) doping on the structural, thermal, and chemical properties of CeO2 nanorods, particularly focusing on oxygen vacancy-related phenomena. Utilizing X-ray powder diffraction (XRD), alterations in crystal structure and peak shifts were observed, indicating successful Ni doping and the formation of Ni2O3 at higher doping levels, likely due to non-equilibrium reactions. Thermal gravimetric analysis (TGA) revealed changes in oxygen release mechanisms, with increasing Ni doping resulting in the release of lattice oxygen at lower temperatures. Raman spectroscopy corroborated these findings by identifying characteristic peaks associated with oxygen vacancies, facilitating the assessment of Ni doping levels. Overall, this study underscores the substantial impact of Ni doping on CeO2 nanorods, shedding light on tailored catalytic applications through modulation of oxygen vacancies while preserving the nanorod morphology.

Globally,coastal regions are vital areas of human activities and, as such, are centres of population growth and urban and economic development. Long-term human development has had a major impact on the ecological environment of coastal zones. Therefore, exploring the distribution and provenance of marine sediment types in coastal areas heavily influenced by human activities can provide scientific evidence and references for the current and future ecological management of these sensitive environments. For this reason, we have conducted an analysis on the sediment grain size, Endmember, organic matter content and geochemical elements in the Lu’erhuan River‒Malan Island‒Sandun Island area in the eastern part of Qinzhou Bay, a region heavily influenced by human activities. Sediment grain size clearly differs throughout the study site and the material provenances and hydrodynamic conditions are also varied, likely due to the local environmental conditions and the significant impact human activities have had on the area. The finest-grained sediment is imported from either inland or coastal areas via rivers and weak tidal currents, the next finest component is input from coastal areas through weak tidal currents, and the moderately coarse component mainly originates from nearby beaches. The two coarsest-grained sediment components are influenced by the combination of human activities, tidal currents and waves and enter the water via erosion. Organic matter provenance resembles that of the sediment components, exhibiting varied characteristics. This is due to the combination of natural and human activities in the bay. The organic matter in the upper reaches of the Lu’erhuan River originates from the river and coastal paddy fields, with obvious terrigenous characteristics; the organic matter in northern Malan Island mainly comes from external sources related to oyster farming; while organic matter in eastern Sandun Island is mainly produced endogenously by marine plankton. Al, Ti, Fe, Mg, K, Ga and other elements indicate that terrestrial sediments are significantly disturbed by human activities. However，Mn reflects the marine distribution of terrestrial sediments from the Lu’erhuan River to Jishuimen. Ca and Sr, indicators of marine sediments, are distributed in the eastern offshore area of Sandun Island, which is connected to the open waters. Due to the influence of human activities, As and Cd are highly enriched in the study area, while Cu is less affected by human activities.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

The world is currently experiencing COVID-19, one of the worst pandemics that have happened in this century, affecting 10.7 million people worldwide. It has caused massive growth in the number of employees working from home. However, employees have minimal cybersecurity resources unlike organizations with security teams protecting them against attacks. Hence, cybersecurity plays an important role as users can be easily targeted by cybercriminals. This paper examines how cyberattacks have increased during this pandemic and shows how greatly they have affected health organizations, individuals and social networking applications. Results of the attacks include data breaches, false announcements and operations being disrupted. Attacks occurring during this pandemic and how they were handled are also critically discussed. The existing contributions do touch on related attacks but do not provide in-depth solutions regarding the issues. Even though there are many works and findings that were done previously, technology is ever evolving. Therefore, we need to be well versed with current and future issues and provide the latest mechanisms to prevent cybersecurity threats from occurring. On our share, we intend to present our findings on the challenges being faced by the population and its increasing threats as well as presenting unique solutions that can help organizations or related persons understand or spread awareness on the importance of cybersecurity. Through the research performed in this paper, it is found that there are many ways these issues can be alleviated. However, the issue is that there is significant lack of action and investment in terms of actual implementation and application of the available solutions.

This study investigates the spatial and temporal dynamics of Paomo restaurants in Xi'an's central urban area from 2012 to 2023, leveraging Point of Interest (POI) data through a series of sophisticated analytical techniques. Methods including nearest neighbor distance, kernel density estimation, and band set statistical analysis were employed to thoroughly examine the evolutionary patterns and key drivers influencing the spatial distribution of these eateries. Our results highlight a notable trend of expansion from the central city to the periphery, characterized by significant spatial agglomeration. Initially concentrated in the city center, the distribution of Paomo restaurants has progressively shifted towards multiple distinct cores, reflecting the dual influence of urban policy initiatives and the dynamics of market competition. Furthermore, the research identifies several pivotal factors shaping this spatial distribution, particularly transportation access, residential quality of life, and the availability of commercial services. These findings demonstrate the profound effects of urban spatial reconfiguration and socioeconomic development on the specialized catering industry. The insights gleaned from this analysis offer valuable guidance for urban planners and policymakers, providing strategic recommendations for the spatial planning of specialty catering services to optimize urban layouts and foster sustainable economic progress.

Based on the 5.7-magnitude earthquake that stroke Songyuan (China) and 172 groups of liquefaction data collected in mainland China, the hyperbolic liquefaction discriminant formula originally proposed by Sun Rui was revised, and a new formula for the liquefaction of sand was put forward. Groups of data derived from the Bachu earthquake in Xinjiang and an earthquake that occurred in New Zealand (47 and 195 groups, respectively) were used to carry out a back-judgment test, then, the results were compared with those of the existing standard method. Overall, the results showed that the new formula for hyperbolic liquefaction discrimination compensates for the conservative liquefaction discrimination of the older formula; moreover, it has a good applicability to different intensities, groundwater levels, and the deep sand layer of the Songyuan site, reflected by a more balanced success rate. Therefore, combining the existing liquefaction discrimination methods and the research results of discrimination, it is necessary to establish a suitable regional identification method through the continuous accumulation of liquefaction data and expanding database.

Acute ischemic strokes are the third leading cause of death and the leading cause of neurological disability worldwide. The oxygen and glucose deprivation associated with ischemic strokes not only leads to neuronal cell death, but also increases the inflammatory response and decreases functional output of the brain. The only intervention approved by US Federal Drug and Food Administration for treatment of ischemic strokes is tissue plasminogen activator (tPA), however, such treatment can only be given within 4.5 hours of the onset of stroke-like symptoms. This narrow time-range limits its application, and it also might induce detrimental rather than beneficial effects to stroke patients by treatment of the tPA. In order to reduce the infarct volume of an acute ischemic stroke while increasing the time period for treatment, emerging therapies reveal great potential by targeting inflammation, growth factors, ion channels, and neurotransmitter receptors with monoclonal antibody (MAB). With successfully application in the treatment of cancer patient by MAB, in this review, we will focus on recent advances on stroke therapy by using MAB on the treatment of stroke by targeting inflammation, growth factors, ion channels, and neurotransmitter receptors. Therefore, developing specific MAB targeting the signaling pathway of stroke will contribute to stroke therapy.

The concept of transit-oriented development (TOD) has been widely recognized in recent years for its role in reducing car traffic, improving public transportation, and enhancing traffic sustainability. This paper conducts empirical research on a developed rail transit network, using Shanghai as a case study. In addition to traditional TOD features, other factors based on urban rail transit are introduced, including multi-level modeling (MLM), which is used to analyze the possible factors influencing rail patronage. To avoid the bias of research results led by the correlation between independent variables, factors are divided into two levels. The first level includes three groups of variables: the built environment, station characteristics, and socioeconomic and demographic characteristics. The second level includes a set of variables which are regional characteristics. Results show that the most significant impact on train patronage is station location in the business district area. Other factors that have a positive effect on promoting rail transit travel include the number of service facilities around the station, degree of employment around the station, economic level, intensity of residential development, if the station is a transfer station, the operating period of the station, and the size of the large transportation hub around the station.