Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

Determining accurate PM2.5 pollution concentrations and understanding their dynamic patterns is crucial for scientifically informed air pollution control strategies. Traditional reliance on linear correlation coefficients for ascertaining PM2.5 related factors only uncovers superficial relationships. Moreover, the invariance of conventional prediction models restricts their accuracy. To enhance the precision of PM2.5 concentration prediction, this study introduces a novel integrated model that leverages feature selection and a clustering algorithm. Comprising three components - feature selection, clustering, and integrated prediction, the model first employs the non-dominated sorting Genetic Algorithm (NSGA-III) to identify the most impactful features affecting PM2.5 concentration within air pollutants and meteorological factors. This step offers more valuable feature data for subsequent modules. The model then adopts a two-layer clustering method (SOM+K-means) to analyze the multifaceted irregularity within the dataset. Finally, the model establishes the Extreme Learning Machine (ELM) weak learner for each classification, integrating multiple weak learners using the Adaboost algorithm to obtain a comprehensive prediction model. Through feature correlation enhancement, data irregularity exploration, and model adaptability improvement, the proposed model significantly enhances the overall prediction performance. Data sourced from 12 Beijing-based monitoring sites in 2016 were utilized for an empirical study, and the model's results compared with five other predictive models. The outcomes demonstrate that the proposed model significantly heightens prediction accuracy, offering useful insights and potential for broadened application to multifactor correlation concentration prediction methodologies for other pollutants.

In recent years discrete element method (DEM) has gradually been applied to the traditional fluidization simulation of fine particles in micro fluidized bed (MFB). The application of DEM in simulating fast fluidization of fine particles in MFB has not yet received attention. This article presents a drag model that relies on the surrounding environment of particles, namely particle circumstance-dependent drag modle or PCDD model. Fast fluidization in MFB of fine particles is simulated using DEM based on the PCDD model. It is found that the gas-solid two-phase flow in MFB meets the common law of fast fluidization in circulating fluidized bed (CFB) to a certain extent, and also presents a special law that is significantly different from that in CFB. Simulations indicate that the local structure in MFB exhibits particle aggregation which is a natural property of fast fluidized, forming a structure where continuous dilute phase and dispersed concentrated phase coexist. The formation and fragmentation of particle clusters in different local regions of the bed have time synchronization. There exists strong effect of solid back-mixing in MFB, leading to relatively low outlet solid flux. The gas back-mixing effect is, however, not so distinct. The axial porosity shows a monotonically increasing distribution with the bed height, but does not strictly follow the single exponential distribution. The solid volume fraction at the bottom of the bed is significantly lower than the correlated value in CFB. The axial heterogeneous distribution of the cross-sectional average porosity in the lower half of the bed is also weakened. The radial porosity shows a distribution pattern of higher in the central region and lower in the sidewall region. Compared with the correlation results in CFB, the porosity near the central region in MFB is relatively low, while the porosity near the sidewall region is relatively high. The geometric size of the container, especially the radial size, is much smaller than that of a CFB. The relative area of contact between the MFB wall and particles is larger, and the wall friction factor becomes more significant. This may be the main reason for the time synchronization of particle agglomeration, severe particle back-mixing, low outlet solid flux, monotonically increasing axial porosity and weak core-annular structure of radial porosity.

Objectives: The purpose of this study is to determine the association between umbilical venous blood flow (UVBF) to placental pulsatility index (PPI) ratio and gestational age (GA) in women undergoing prenatal assessments and adverse pregnancy outcome (APO) screening Methods: Between January and December 2022, sonographic examinations were conducted to assess the fetal umbilical cord insertion site in singleton fetuses, and hemodynamic indices of the umbilical artery, umbilical vein, and uterine artery were computed. Through regression analysis, we derived the optimal regression equation to elucidate the UVBF/PPI ratio parameters based on GA. Results: Among 492 singleton fetuses between 21+0 and 40+6 weeks of gestation in the final study. The average fetal UVBF/PPI ratio was 180.45±119.32. Correlation analysis revealed a positive relationship between the UVBF/PPI ratio and GA(p = .000). Using regression analysis, the best-fit regression equation was the linear function model, which explains the value of UVBF/PPI ratio parameters based on GA. Lower UVBF/PPI ratio revealed a positive relationship in the low birth weight fetuses (p=0.021) and higher preterm delivery rate (p=0.034). Cerebroplacental ratio (CPR) showed a high correlation with the UVBF/PPI ratio (r=0.471, p=0.000). Conclusions: The findings of our analyses revealed that contribute to our understanding of fetal hemodynamics and highlight the potential of UVBF/PPI ratio as a predictive marker for adverse pregnancy outcomes, such as preterm birth, low birth weight, or potential fetal hypoxemia. It might be useful for prenatal counseling and clinical purposes.

Infrared thermography has already been proven to be a significant method in non-destructive evaluation since it gives information with immediacy, rapidity and low cost. However, the thorniest issue for wider application of IRT is the quantification. In this work, we proposed a specific depth quantifying technique by employing the Gated Recurrent Units (GRU) in composite material samples via pulsed thermography (PT). Carbon Fiber Reinforced Polymer(CFRP) embedded with flat bottom holes were designed via Finite Element Method (FEM) modeling in order to precisely control the depth and geometrics of the defects. The GRU model automatically quantified the depth of defects presented in the CFRP material. The proposed method evaluated the accuracy and performance of synthetic CFRP data from FEM for defect depth predictions.

A millimeter-wave microstrip leaky-wave antenna array based on the substrate-integrated waveguide (SIW) and the complementary split-ring resonator (CSRR) is proposed in this paper. The slow wave characteristics of the SIW are enhanced by etching two rows of symmetrical CSRR-type slots on the surface of the SIW layer. The magnetic coupling between the CSRR-SIW layer and equally spaced circular patches array on the upper layer realizes the radiation of electromagnetic energy. In the 23~30 GHz (relative bandwidth 26.4%) operating frequency band, the horizontal polarization radiation beam scanning from -62° to -2° is realized, with a peak gain of 9.6~11.7 dBi, and the cross-polarization ratio is more than 43.8 dB.

Abstract：Commuting of residents in big city often brings tidal traffic pressure or congestions. Understanding the causes behind this phenomenon is of great significance for urban space optimization. Various spatial big data make possible the fine description of urban residents travel behaviors, and bring new approaches to related studies. The present study focuses on two aspects: one is to obtain relatively accurate features of commuting behaviors by using mobile phone data, and the other is to simulate commuting behaviors of residents through the agent-based model and inducing backward the causes of congestion. Taking the Baishazhou area of Wuhan, a local area of a mega city in China, as a case study, travel behaviors of commuters are simulated: the spatial context of the model is set up using the existing urban road network and by dividing the area into travel units; then using the mobile phone call detail records (CDR) of a month, statistics of residents' travel during the four time slots in working day mornings are acquired and then used to generated the OD matrix of travels at different time slots; and then the data are imported into the model for simulation. By the preset rules of congestion, the agent-based model can effectively simulate the traffic conditions of each traffic intersection, and can also induce backward the causes of traffic congestion using the simulation results and the OD matrix. Finally, the model is used for the evaluation of road network optimization, which shows evident effects of the optimizing measures adopted in relieving congestion, and thus also proves the value of this method in urban studies.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

Comparison with conventional reservoirs, the prediction of pressure in ultra-deep tight sandstone formations is difficult. The prediction of seismic pressure is more challenging than well logging pressure prediction. The main methods for seismic pressure prediction include equivalent depth method, Eaton method, Fillippone formula, and its modified versions. Among them, the Eaton method is widely used and has good effectiveness. However, this method relies on difficult-to-obtain normal compaction trend line, which leads to low prediction accuracy in space. To address this issue, a method combining the Eaton method and Collocated cokriging is proposed. The Eaton formula is used to predict formation pressure at the well, with compressional wave velocity as the covariate for predicting the main variable, formation pressure. By simulating the shear wave velocity based on seismic compressional wave velocity, the influence of various parameters on the prediction results is analyzed, and the accuracy of this method is verified by comparing it with other methods. The proposed method is then applied to predict formation pressure in the ultra-deep formations of the Junggar Basin. The simulation results show that the Collocated cokriging method achieves higher planar accuracy and better matches the experimental expectations in terms of prediction results. The application results also demonstrate the scientific effectiveness of the combined method, which has achieved good results in practical production applications.

In order to understand the impact of lithologic heterogeneity of continental mixed fine-grained sedimentary rocks on reservoir brittleness in western Qaidam basin, the mechanical properties of the rocks and their correlation with mineral composition and petrographic characteristics were studied by measns of mineralogy, petrography and triaxial stress test. The results show that the reservoir rocks can be divided into 5 different types according to the mechanical properties of the reservoir (characteristics of stress-strain curves), among them Type I and III belong to similar elastoplastic failure model, type II shows a special pulse failure mode for plastic material, type IV shows a failure mode of mixed characteristics, and type V exhibits a typical plastic failure model. The correlation between minerals and mechanical properties indicates that quartz and feldspar, which are often considered brittle minerals, do not contribute much to the brittleness of continental fine-grained sedimentary rocks. The main minerals affecting reservoir brittleness are dolomite and clay minerals, and their contributions to reservoir brittleness are positive and negative, respectively. The petrographic analysis results prove that the abnormal correlation between rock mechanical properties and quartz and feldspar is caused by the different rock fabrics. When dolomite forms a rock skeleton, it typically exhibits greater strength, brittleness and physical properties than other minerals. Based on the results, a brittleness evaluation standard for continental fine-grained sedimentary rock reservoir is proposed, and the validity of the standard is verified by the spatial correlation between the lithology probability model and the micro-seismic monitoring data, indicating that the spatial heterogeneity of dolomite-rich rock is the main controlling factor for the development of ‘sweet spot’ in the Cenozoic continental fine-grained sedimentary rock reservoir in the Western Qaidam Basin.

Saikosaponin (SS) a is a compound with various pharmacological properties and easily degraded into SSb1 and SSg in acid condition. In present work another two new degradation products of SSa formed under acid hydrolytic condition were detected and isolated by analytical and semi-preparative liquid chromatography technology, furthermore their structures were characterized as hydroxyl-saikosaponin a and SSb2 by spectral analysis, which is not only essential in stability-indicating method development and validation but also could be used as a worst case to assess the analytical method performance of SSa. Moreover their structural transformation pathways were also proposed.

The application of organic fertilizers plays a crucial role in achieving carbon sequestration in the agricultural sector. This paper discusses how farmers can more smoothly promote organic fertilizer extension services. An evolutionary game model is developed to describe the conflicting interests of Chinese farmers and local governments in organic fertilizer extension services, and the dynamic evolution of the game players and the influence of parameter adjustment on the strategic choices of both parties is presented. In this paper, the game model and the main results are validated with the help of simulation tools, and a sensitivity analysis of the selected parameters is performed. The results show that (1) the implementation of subsidy policy is less helpful for organic fertilizer extension services; (2) The ideal event probability of the game was found to be positively related to the cost of applying inorganic fertilizers, additional benefits to farmers, political returns to local governments, and penalties for not using organic fertilizers; (3) This is important for improving the performance of local governments, reducing government regulatory costs, improving policy support for organic fertilizer extension services, and reducing the cost of implementing organic fertilizer extension services.

The modifications in planting structure and continuous land use adjustments have significant implications for the structure, diversity, and functioning of arthropod communities in farmland landscapes, particularly regarding the biological control of pest insects by natural enemy species. Therefore, there is an urgent need to comprehensively and accurately assess insect community diversity in croplands. In this study conducted between 2022-2023, we utilized Malaise traps and sweep netting to collect insects from three different double-cropping paddy fields. We extracted DNA from preservative ethanol of Malaise traps and tissue samples of selected parasitoid wasps, followed by amplification using DNA barcoding primers to prepare high-throughput sequencing libraries. As a result, we annotated a total of 4956 operational taxonomic units (OTUs) belonging to 174 genera and 32 families of parasitoid wasps. Our findings demonstrate that the ethanol filter method efficiently captures a wide range of information diversity. However, it demonstrates a lower resolution and may result in a reduction of species abundance. Furthermore, we have identified additional insect species in the parasitoid samples. This demonstrates that high throughput sequencing from adult parasitoid wasps can effectively detect host specie, enabling a comprehensive understanding of host species and providing novel insights into food web construction.

In the context of rapid urbanization, the spatiotemporal patterns of socio-economic exposed to high seismic hazard in large cities lacks quantitative assessment, thus, it is difficult to understand the evolution of earthquake catastrophe risk there. In this paper, exposure change rate, and absolute and relatively exposure indices were proposed to quantitatively study the changes of spatiotemporal exposure to high seismic hazard in urban areas of large cities (i.e., permanent residents in urban areas more than 1 million) in Chinese mainland, using a set of multi-temporal population, GDP, and built-up datasets and a seismic hazard zoning map. The results show that, 64 out of 78 large cities are entirely or partially located in high seismically hazardous zones. Although the urban areas of large cities in high seismically hazardous zones (HSHUAs) cover only 1.73% (167177 km²) of mainland China, their share of population, GDP, and built-up land amounted to 18.14%, 30.24% and 24.55%, respectively, in 2015. Unprecedented urbanization has led to a dramatic exposure growth in HSHUAs between 1990 and 2015. The population, GDP, and built-up land in HSHUAs increased by 110 million people (with an average annual growth rate of 2.37%), 273.71 trillion USD(average annual growth rate of 11.15%), and 10593 km2 (average annual growth rate of 2.02%), respectively. HSHUAs experienced much faster population and GDP growth than the whole country, while relatively slower growth in built-up land. Exposure growth in HSHUAs also was varied for different types of large cities. Megacities had a higher proportion of increased GDP and population in HSHUAs, induced by industry and population agglomeration. Whereas, Type II large cities had a higher proportion of increased built-up land in HSHUAs, driven mainly by urban sprawl. Our analysis indicates that, for large cities under rapid urbanization, it is an urgent need to strengthen resilient urban planning, renewal and construction.

To accurately and non-destructively monitor the growth of spring wheat in the Hetao Irrigation Area, UAV remote sensing was employed during various fertility stages. Digital image indices from diverse fertilization treatments were calculated and compared with physiological indices to identify the most sensitive digital image indices corresponding to these indices. The study underscored the critical importance of the flowering stage in the growth of spring wheat, thus highlighting the necessity of focusing on this stage. This finding reiterated that the flowering stage was pivotal for spring wheat development in the Hetao Irrigation Area. Several digital image indices, such as GLA, R, G, INT, g, GRVI, MGRVI, RGBVI, EXG, and GRRI, exhibited a high frequency of significant correlations with physiological indices during the four primary reproductive stages of wheat. Consequently, these sensitive digital image indices during the flowering stage can more effectively characterize the physiological indices of spring wheat.

This paper addresses a new micromechanical model to predict biaxial tensile moduli of plain weave fabric (PWF) composites by considering the interaction between the orthogonal interlacing strands. The two orthogonal yarns in micromechanical unit cell (UC) were idealized as the curved beams with a path depicted by using sinusoidal shape functions. The biaxial tensile moduli of PWF composites were derived by means of the minimum total complementary potential energy principle founded on micromechanics. The biaxial tensile tests were respectively conducted on the RTM-made EW220/5284 PWF composites at five biaxial loading ratios of 0, 1, 2, 3 and ∞ to validate the new model. The predictions from the new model were compared with experimental data and good correlation was achieved between the predictions and actual experiments, demonstrating the practical and effective use of the proposed model. Using the new model, the biaxial tensile moduli of plain weave fabric (PWF) composites could be predicted based only on the properties of basic woven fabric.

The quantified residence time distribution (RTD) provides a numerical characterization of mixing in the continue casting tundish, thus allowing the engineer to better understand the metallurgical performance of the reactor. This paper describes a computational fluid dynamic (CFD) modelling study for analyzing the flow pattern and the residence time distribution in a five-strand tundish. Two passive scalar transport equations are applied to separately calculate the E-curve and F-curve in the tundish. The numerical modelling results are compared to the water modelling results for the validation of the mathematical model. The volume fraction of different flow regions (plug, mixed and dead) and the intermixing time during the ladle changeover are calculated to study the effects of the flow control device (FCD) on the tundish performance. The result shows that a combination of the U-baffle with deflector holes and the turbulence inhibitor has three major effects on the flow characteristics in the tundish: i) reduce the extent of the dead volume; ii) evenly distribute the liquid streams to each strand and iii) shorten the intermixing time during the ladle changeover operation.

Teachers’ time resources are becoming increasingly scarce and time poverty will have a direct impact on the long-term sustainability of their professional development. However, the current state of teachers’ time poverty and its potential harmful consequences are unclear. Therefore, this research conducts two cross-sectional studies to investigate the current situation and group differences in time poverty among Chinese teachers (Sample 1), as well as the influence of teachers’ time poverty on job burnout (Sample 2). The results indicate that: (1) there is a high level of time poverty among teachers; (2) there is no significant difference in gender, teaching years, or teaching section, and there is a significant difference in teaching responsibilities; (3) time poverty could positively and significantly predict job burnout, and job burnout could positively and significantly predict mental health; (4) mental health factors (including depression, anxiety and stress) play the mediating role in the relationship between teachers’ time poverty and job burnout. To create a sustainable development environment for teachers, it is suggested that teachers improve time management skills and establish a self-regulation mechanism; schools should clarify the boundaries of teachers’ work and respect their right to rest; and society should provide positive and adequate spiritual support.

Muscle fatigue caused by using staplers affects the surgical procedures of surgeons. Compared to manual staplers, electric staplers decrease the muscle fatigue by replacing repeated gripping and releasing with automatic model. Still powered by the battery, the electric staplers are confronted with new operation fatigue due to the extra weight of the battery. The weight and manual operation of the electric stapler can cause user's muscle fatigue. To tackle the unsettled fatigue issue, the study is to propose a new design method to offset the influence of extra weight of the battery attached to the electrical stapler by changing the opening and closing of the stapler end clamp to electric control. The purpose of this study is to verify whether the design of this electric stapler can offset the impact of weight. Experiments are set up to test the feasibility of the design on 12 male Chinese surgeons. The muscle fatigue is indicated by measuring the EMG (electromyography) signal, and the stapler's working effect is indicated by measuring the end movement of the stapler. The result shows the new-designed stapler reduce the operation fatigue, counteracting the impact of the battery weight.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Multi-rotor drones, a kind of unmanned equipment which is widely used in military, commercial consumption and other fields, has been developed very rapidly in recent years. However, their short flight time has hindered the expansion of their application range. This can be addressed by utilizing hydrogen fuel cells, which exhibit high energy density, strong adaptability to ambient temperature, and no pollution emissions, as the power source. Accordingly, the application of hydrogen fuel cells as the power source in multi-rotor drones is a promising technology that has attracted significant research attention. This paper summarizes the development process of hydrogen fuel cell mul-ti-rotor drones and analyzes the key obstacles that need to be addressed for the further development of hydrogen fuel cell multi-rotor drones, including structural lightweight, hydrogen storage methods, energy management strategies. Additionally, prospects for the future development of hydrogen fuel cell multi-rotor drones are presented.

The microstructure evolution during the cold rolling and subsequent annealing of Alloy 800H was investigated. Two distinct rolling methods, unidirectional rolling and cross-rolling, were intro-duced. Results show that better ductility was observed in the unidirectional rolling than in cross-rolling, whilst a higher volume fraction of large deformed grains was observed in the cross-rolled plates than in the unidirectionally rolled plates. Recrystallization occurred faster in plates from unidirectional rolling than from cross-rolling.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

High density of buildings and the large traffic volume of cities give rise to narrow spaces and high passenger flows in most subway stations. When evacuation is required during an emergency, these problems may trigger issues in operational safety. Therefore, it is imperative to comprehensively assess subway station emergency evacuation times and capacities during the operating process to ensure the design is safe, science-based, and rational. To further enhance safe evacuation capacity, this paper proposes an overall evacuation time model that considers the multielement charac-teristics of subway stations in multiple segments. The evacuation route is decomposed into five stages according to the critical nodes in the evacuation process. An overall emergency evacuation time model is established based on the diversity of bottlenecks in the five stages, integrating elements such as the horizontal movement velocity of passengers, subway equipment parameters, and human density. Taking Xi’an Wulukou Subway Station as an example, this paper verifies the outcomes of the theoretical model against the Pathfinder software and conducts additional anal-yses of the evacuation conditions of stairs and exits. The results show that the error between the theoretical emergency evacuation time and simulation evacuation time was 5.4%, The emergency evacuation model established in this study boasts strong robustness and stability.

In the neuroscience research field, specific for medical imaging analysis, how to mining more latent medical information from big medical data is significant for us to find the solution of diseases. In this review, we focus on neuroimaging data that is functional Magnetic Resonance Imaging (fMRI) which non-invasive techniques, it already becomes popular tools in the clinical neuroscience and functional cognitive science research. After we get fMRI data, we actually have various software and computer programming that including open source and commercial, it's very hard to choose the best software to analyze data. What's worse, it would cause final result imbalance and unstable when we combine more than software together, so that's why we want to make a pipeline to analyze data. On the other hand, with the growing of machine learning, Python has already become one of very hot and popular computer programming. In addition, it is an open source and dynamic computer programming, the communities, libraries and contributors fast increase in the recent year. Through this review, we hope that can make neuroimaging data analysis more easy, stable and uniform base the one platform system.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Infrared thermography has already been proven to be a significant method in non-destructive evaluation since it gives information with immediacy, rapidity, and low cost. However, the thorniest issue for the wider application of IRT is quantification. In this work, we proposed a specific depth quantifying technique by employing the Gated Recurrent Units (GRU) in composite material samples via pulsed thermography (PT). Finite Element Method (FEM) modeling provides the economic examination of the response pulsed thermography. In this work, Carbon Fiber Reinforced Polymer (CFRP) specimens embedded with flat bottom holes are stimulated by a FEM modeling (COMSOL) with precisely controlled depth and geometrics of the defects. The GRU model automatically quantified the depth of defects presented in the stimulated CFRP material. The proposed method evaluated the accuracy and performance of synthetic CFRP data from FEM for defect depth predictions.

Oxygen evolution reaction (OER) is a key half-reaction in electrocatalytic water splitting. Large-scale water electrolysis is hampered by the commercial precious metal-based OER electrocatalysts owing to their high cost and slow kinetics. To address these issues, we present a facile one-pot room-temperature coprecipitation method to quickly synthesize carbon nanotubes-interconnected amorphous NiFe-layered double hydroxides (NiFe-LDH@CNT) as low-cost, efficient and stable OER electrocatalyst. NiFe-LDH@CNT hybrid catalyst delivers outstanding OER performance with a low onset overpotential of 255 mV and a small Tafel slope of 51.2 mV dec-1, as well as outstanding long-term stability. The terrific catalytic capability of NiFe-LDH@CNT can be associated with the synergistic effects of its room-temperature synthesized amorphous structure, bi-metallic modulation, and conductive CNT skeleton. The room-temperature synthesis can not only offer economic feasibility, but also obtain amorphous NiFe-LDH without crystalline boundaries, facilitating long-term stability during OER process. The bi-metallic nature of NiFe-LDH guarantees a modified electronic structure, providing additional catalytic sites. Simultaneously, the highly conductive CNT network fosters a nanoporous structure, facilitating electron transfer, O2 release and enriching catalytic sites. This study presents a strategy to purposefully design nanoarchitecture and facilely synthesize amorphous transition metal-based OER catalysts, ensuring the cost effectiveness, production efficiency, and long-term stability.

This study employs the phase-field regularized cohesion model (PF-CZM) to simulate crack propagation and damage behavior in porous granite. We investigate how pore radius (r), initial crack-pore distance (D), and pore-crack angle (θ) impact crack propagation. The simulation findings reveal that, with a fixed deflection angle and initial crack-pore distance, larger pores are more likely to induce crack extension under identical loading conditions. Moreover, with r and θ keeping constant, the crack extension can be divided into two stages: from its initiation to the lower edge of the pore and then from the lower edge to the upper boundary of the model. By varying the values of D and r, we derive multiple combinations of different D/r ratios and pore radii. These results demonstrate that with constant r, cracks tend to deflect toward the pore closer to the initial crack. Conversely, when D is maintained constant, cracks will preferentially deflect toward pores with a larger r. In summary, the numerical simulation of rock pores and initial cracks, based on the PF-CZM, exhibits remarkable predictive capabilities and holds significant potential in advancing rock fracture analysis.

Chronic renal failure (CRF) is a major public health problem worldwide. In this work, we investigated the effects of a purified Laminaria japonica polysaccharide (LJP61A) on the renal function using adenine-induced CRF mice model. Results exhibited that adenine treatment caused serious renal pathological damages and elevation of serum creatinine and blood urea nitrogen of mice. However, these changes could be significantly reversed by the administration of LJP61A in a dose-dependent manner. Additionally, LJP61A could dramatically reduce the weight loss, improve the urine biochemical index, and regulate the electrolyte disturbance of CRF mice. These results suggested that the renal functions of adenine-induced CRF mice could be improved by LJP61A, which might be developed to a potential therapeutic agent for CRF patients.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Distributed/semi-distributed models are considered to be sensitive to the spatial resolution of the data input. In this paper, we take a small catchment in high urbanized Yangtze River Delta, Qinhuai catchment as study area, to analyze the impact of spatial resolution of precipitation and the potential evapotranspiration (PET) on the long-term runoff and flood runoff process. The data source includes the TRMM precipitation data, FEWS download PET data, and the interpolated metrological station data. GIS/RS technique was used to collect and pre-process the geographical, precipitation and PET series, which were then served as the input of CREST (Coupled Routing and Excess Storage) model to simulate the runoff process. The results clearly showed that, the CREST model is applicable to the Qinhuai catchment; the spatial resolution of precipitation had strong influence on the modelled runoff results and the metrological precipitation data cannot be substituted by the TRMM data in small catchment; the CREST model was not sensitive to the spatial resolution of the PET data, while the estimation fourmula of the PET data was correlated with the model quality. This paper focused on the small urbanized catchment, suggesting the influential explanatory variables for the model performance, and providing reliable reference for the study in similar area.

The branch prediction units (BPUs) generally have security vulnerabilities, which can be used by attackers to obtain the execution status, jump directions, and jump address of conditional branches, and the existing protection methods cannot defend against these attacks. Therefore, this article proposes a hardware security protection method for conditional branches of embedded systems. This method calculates the number of updates to the branch target buffer (BTB). When it exceeds the threshold, BTB is locked to prevent attackers from analyzing the execution status of branches based on the time difference of whether BTB is updated. Moreover, the hybrid physical unclonable function (PUF) circuit is designed to provide confidentiality protection for the jump directions, jump addresses, and their indexes, preventing attackers from stealing these critical data. If these mechanism fails and attackers successfully tamper with conditional branches, this paper proposes a control flow integrity (CFI) protection mechanism based on branch labels to timely detect tampering with instruction codes, jump addresses, and jump directions. The proposed method is implemented and tested on FPGA. The experimental results show that this method can achieve fine-grained security protection for conditional branches, with about 5.4% resource overhead and less than 5.5% performance overhead.

Objective: To examine the effect of bilateral total lobectomy and unilateral total lobectomy on improving thyroid function in patients with thyroid micropapillary carcinoma treated with euthyrox. Methods: The study was conducted on 68 patients with thyroid micro papillary carcinoma treated with euthyroxwho had been surgically treated with euthyrox in our hospital between January 2018 and December 2019. On the basis of random number grouping, they were divided into control groups (n = 34, bilateral total lobectomy) and observation groups (n = 34, unilateral total lobectomy plus isthmectomy). Thyroid function, free triiodothyronine (FT3), thyroid hormone (TSH), and voice function (VHI score) of the two groups were compared.Results: In comparison to the control group, the observation group had shorter incision lengths, shorter operation times, and shorter hospital stays, as well as less intraoperative bleeding and drainage volume, and the difference was statistically significant (P < 0.05); As compared with the control group, the observation group had higher FT4 and FT3 levels as well as lower TSH levels, a statistically significant difference (P < 0.05).VHI scores of emotions, function, physiology, and other voice functions were significantly lower among the observation group than those of the control group (P < 0.05).Conclusion: A unilateral total lobectomy with adjacent isthmus resection in patients with thyroid micro papillary carcinoma can yield ideal results, accelerate the time taken for surgical rehabilitation, improve thyroid function, thereby improving voice quality, as well as improve the overall prognosis of the patient.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Due to the extremely inert surface of the polyester (PET) fabric, a toxic and traditional resorcinol-formaldehyde-latex (RFL) dipping solution is always needs to be used in in rubber composite industry. Unfortunately, other effective methods for fabric surface treatment are in urgent needed to improve the poor bonding interface between the fabric and the rubber matrix. In our study, a facile way to modify PET fabric was developed. Specifically, the fabric is treated by an alkaline solution and a coupling agent with magnetic agitation. Afterwards, the treated fabric/rubber composites are prepared through a co-vulcanization process. Attenuated total reflectance fourier transform infrared spectroscopy (ATR-FTIR), thermogravimetric analysis (TGA) were used to characterize the surface chemical compositions of the modified fabrics. The adhesion behavior is analyzed by the peel test. The results show that the fabric surface is successfully grafted with a coupling agent, and the peel strength reaches 9.8 N/mm after KH550 treatment, which is increased 32% compared with that of the original fabric/rubber composites. In addition, the vulcanization rate and interfacial fracture mechanism are also researched.

Dryland winter wheat in Loess Plateau is facing yield reduction due to shortage of soil moisture and delayed sowing time. Field experiment was conducted at Loess Plateau in Shanxi Province, China from 2012 to 2014, to study the effect of subsoiling and conventional tillage and different sowing dates on the soil water storage and contribution of N accumulation and remobilization to yield of winter wheat. The results showed that subsoiling significantly improved the soil water storage at 0-300 cm depth, improved the number of tillers and pre-anthesis N translocation in various organs of wheat and post-anthesis N accumulation, eventually increased the yield up to 17-36%. Delaying sowing time had reduced the soil water storage at sowing and winter accumulated temperature by about 180˚C. The contribution of N translocation to grain yield was maximum in glume+spike followed by in leaves and minimum by stem+sheath. In addition a close relationship was found between the N accumulation and translocation and the soil moisture in the 20-300 cm. Subsoiling during the fallow period and the medium sowing date was beneficial for improving the soil water storage and increased the N translocation to grain, thereby increasing the yield of wheat, especially in dry year.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

High-precision inertial sensors or accelerometers can provide us references of free-falling motions in gravitational field in space, and serve as the key payloads for gravity recovery missions. In this work, a systematic method of electrostatic inertial sensor calibrations for gravity recovery satellites is introduced, which is applied to and verified with the Taiji-1 mission. Taiji-1 is the first technology demonstration satellite of the ``Taiji Program in Space'', which, in its final extended phase in 2022, could be viewed as a gravity recovery satellite operating in the high-low satellite-to-satellite tracking mode. Based on the calibration principles, swing maneuvers with time span about 200 s and rolling maneuvers for 19 days were conducted by Taiji-1 in 2022. The inertial sensor's operating parameters including the scale factors, the center of mass offset vector and the intrinsic biased acceleration are precisely re-calibrated and are updated to the Taiji-1 science team. Data from one of the sensitive axis is re-processed with the updated operating parameters, and the performance is found to be slightly improved compared with former results. This approach could be of high reference value for the accelerometer or inertial sensor calibrations of the GFO, the Chinese GRACE-type mission, and the planned Next Generation Gravity Missions. This could also shed some light on the in-orbit calibrations of the ultra-precision inertial sensors for future GW space antennas because of the technological inheritance between these two generations of inertial sensors.

This paper investigates the polarization and heat generation characteristics of batteries under different ambient temperatures and discharge rates by means of using a coupled electric-thermal model. The study found that the largest percentage of polarization is ohmic polarization, followed by concentration polarization and electrochemical polarization. The values of the three types of polarization are generally small and stable under normal-temperature environments and low-discharge rates. However, they increase significantly in low-temperature environments and high-discharge rates and continue to rise during the discharge process. Additionally, ohmic heat generation and polarization generation also increase significantly under these conditions. Reversible entropy heat is less sensitive to ambient temperature but increases significantly with the increase of the discharge rate. Ohmic heat generation and polarization heat generation contribute to the total heat generation of the battery at any ambient temperature, while reversible entropy heat only contributes to the total heat generation of the battery at the end of discharge.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Sinojackia Hu. comprises five to eight Chinese endemic species with high ornamental and medicinal value. However, the generic limits, interspecific relationships and evolutionary history of the genus remain unresolved. In this study, we newly sequenced and assembled three plastomes of S. oblongicarpa and compared them with those of the other congeneric species to explore the taxonomic delimitation of the species and the evolutionary history of the genus. Plastomes structure of Sinojackia species were extremely conserved in terms of number of genes, sequence length and GC content. Codon usage patterns revealed that natural selection may be the main factor shaping codon usage bias. Our phylogenetic tree shows that Sinojackia is monophyletic and can be divided into two clades. Sinojackia oblongicarpa as a distinct species is supported for it is distantly related to S. sarcocarpa. The evolutionary analysis of morphological features indicates that woody mesocarp is an ancestral feature, while mesocarp undeveloped, spongy and fleshy are the later derived. Sinojackia originated in Central-Southeast China during the early Miocene. In this period, it experienced elevated diversification and migrated from the Central-Southeast China to Hunan Province and Sichuan Province with the development of the Asian monsoon and East Asian flora. Sinojackia experienced elevated diversification at intraspecies levels that mainly occurred in the Quaternary. Glacial-interglacial interactions with the monsoon climate may provide favorable expansion conditions for Sinojackia on a small-scale.

During the hand-eye calibration process of the manipulator, the Euclidean distance error of the calibration results cannot be calculated because the true values of the hand-eye conversion matrix cannot be obtained. In this paper, a new method of projection error analysis is presented. Error analysis is carried out by using a priori knowledge that the location of AR markers is fixed in the calibration process. The coordinates of the AR marker center point are reprojected to the pixel coordinate system, and then compared with the true pixel coordinates of the AR marker center point obtained by corner detection or manual labeling in order to obtain the Euclidean distance between the two coordinates as the basis for error analysis. Experimental results show that the proposed optimization method can greatly improve the accuracy of hand-eye calibration results.

The pandemic SARS-CoV-2 continues to evolve to give rise to variants of concern that can escape vaccine-induced immunity. As such, more effective vaccines are urgently needed. In this study, we evaluated virus-like particle (VLP) as a vaccine platform for SAS-CoV-2. The spike, envelope, and membrane proteins of the SARS-CoV-2 Wuhan strain were expressed by a single recombinant baculovirus BacMam and assembled into VLPs in cell culture. The morphology and size of the SARS-CoV-2 VLP as shown by transmission electron microscopy was found to be similar to the authentic SARS-CoV-2 virus particle. In a mouse trial, two intramuscular immunizations of the VLP BacMam with no adjuvant elicited spike-specific binding antibodies in both sera and bronchoalveolar lavage fluids. Importantly, BacMam VLP -vaccinated mouse sera showed neutralization activity against SARS-CoV-2 spike pseudotyped lentivirus. Our results indicated that the SARS-CoV-2 VLP BacMam stimulated spike-specific immune responses with neutralization activity.

Fuzzy Rule Interpolation (FRI) offers an innovative methodology for inferring outcomes from data points that match no established rules in a sparse fuzzy rule base. Generally, a traditional fuzzy rule-based system suffers from the inability to perform inference while facing an unmatched observation, given a sparse fuzzy rule base that is derived from insufficient data or inadequate human experience and that fails to cover parts of a specific problem domain. Fortunately, starting with a sparse rule base, Fuzzy Rule Interpolation (FRI) can help to formulate interpolated rules specifically in instances where observations fail to activate any existing rule. An interpolated rule gives a result called consequent, which is related to the unmatched observation so that the inference system will not fail to generate an outcome corresponding to the observation as the output. Conventionally, these interpolated rules will be discarded after obtaining outcomes. However, valuable information may be potentially embedded within those discarded rules addressing the limitation regarding the coverage of the original sparse knowledge space. Moreover, without exploiting the potential value of the interpolated rules, the fuzzy inference system based on a sparse rule base will never improve its efficiency and robustness in the long run. Therefore, this underscores the necessity for Dynamic Fuzzy Rule Interpolation (D-FRI), which aims to collate interpolated rules that cover particular knowledge spaces absent in the sparse rule base. Intuitively, those frequently appeared interpolated rules are considered valuable because future observations are more likely to hit the respective problem areas. Promoting selected interpolated rules to the sparse rule base can enhance the overall coverage of the knowledge space and increase the inference efficiency over time. This paper introduces a framework for Dynamic Fuzzy Rule Interpolation that integrates the widely used Transformation-based Fuzzy Rule Interpolation (T-FRI) with an effective form of clustering of interpolated results. Experimental findings validate the effectiveness of this approach.

As the largest energy consumer and carbon emitter, China has made substantial efforts to improve energy efficiency for decrease energy consumption, while the energy rebound effect determines its effectiveness. The embodied energy consumption of construction projects accounted for nearly one-sixth of the total economy's energy consumption in China. This paper is based on the logical relationship among capital input, technological progress, economic growth, and energy consumption, adapting an alternative estimation model to estimate the energy rebound effect for the construction industry in China for the first time. Empirical results in our paper reveal that the energy rebound effect for the construction industry in China is about 59.5% for the period of 1990–2014. The results indicate that the energy rebound effect does exist in China’s construction industry and it presented a fluctuating declining trend. This implies that half of the energy savings by technological progress is achieved. In addition, China’s government should implement proper energy pricing reforms and energy taxes to promote the sustainable development of China’s construction industry.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

Here, we present a series of novel block copolymers (BCP) from bio-derived monomers, poly(lactic acid)-block-poly(2,5-furandimethylene succinate) (PLA-b-PFS), in which the furan groups from PFS block can be crosslinked with bis(maleimido) triethylene glycol (M2) through a Diels-Alder reaction. This dynamic crosslinking reaction leads to a network structure for enhancing the mechanical properties compared to their linear BCP analogous. Decreasing the crosslinking density leads to a decrease of glass transition temperature of BCPs and a transition from glassy to rubbery-like behavior at room temperature. This allows a wide tunablity of both elastic moduli and yields of the materials. For the lowest crosslinking density. the material exhibits an over 50% self-healing efficiency at room temperature after five days, attributed to the low Tg (15.2 C) from the introduction of PFS block, allowing sufficient chain mobility for structure re-organization. Moreover, with the appropriate selection of crosslinking density (PLA-b-PFS/M2 (6/1)), it also shows an excellent shape memory property with a high recovery rate of 96.3% and a fixity rate of 97.3%. The permanent shape can be rewriteable due to the reversibility of Diels-Alder reaction. With these advanced functionalities and ease in large-scale fabrication, the PLA-b-PFS/M2 shows great promises for self-healing coatings or films with shape memory properties in a wide variety of applications such as packaging materials

Fish feeding behavior analysis plays a critical role in aquaculture, marine fisheries, and ecological monitoring. At present, the accuracy of current fish feeding behavior analysis is easily affected by the environment, and the hypoxia state in water and high temperature have a huge impact on behavior. In addition, the poor stability, and the speed is affected by the calculation amount of the model, so it cannot be applied to aquaculture ponds. In order to solve the above problems, we propose an improved RepVGG-based method for fish feeding behavior analysis to identify nine behavioral states of fish populations, including hypoxia, hot, and normal states of none, medium, and strong feeding. Firstly, our method adds the identity and residual branches to the block of the VGG network, focusing on the acceleration operation to ensure accuracy. At the same time, the Efficient Channel Attention (ECA) module is added to reduce dimensionality to balance speed and accuracy. To evaluate the effectiveness of the method, it is validated on a constructed fish feeding behavior dataset and compared with a Convolutional Neural Network (CNN) including AlexNet, VGG16, ResNet34, MobileNet V3, and RepVGG. The experimental results show that after 15 epochs of training, the average precision of proposed method reached 97%. Compared with the basic classification algorithm, our method can increase by at least 3% while the inference speed exceeds 85 Frames Per Second (FPS). This study can be integrated into the aquaculture vision system to guide users to plan feeding strategies, and provide new ideas and methods for water quality monitoring.

In this paper, we focus on developing a novel method to extract sea ice cover (i.e., discrimination/classification of sea ice and open water) using Sentinel-1 (S1) cross-polarization (vertical-horizontal, VH or horizontal-vertical, HV) data in extra wide (EW) swath mode based on the machine learning algorithm support vector machine (SVM). The classification basis includes the S1 radar backscatter coefficients and texture features that are calculated from S1 data using the gray level co-occurrence matrix (GLCM). Different from previous methods where appropriate samples are manually selected to train the SVM to classify sea ice and open water, we proposed a method of unsupervised generation of the training samples based on two GLCM texture features, i.e. entropy and homogeneity, that have contrasting characteristics on sea ice and open water. We eliminate the most uncertainty of selecting training samples in machine learning and achieve automatic classification of sea ice and open water by using S1 EW data. The comparison shows good agreement between the SAR-derived sea ice cover using the proposed method and a visual inspection, of which the accuracy reaches approximately 90% - 95% based on a few cases. Besides this, compared with the analyzed sea ice cover data Ice Mapping System (IMS) based on 728 S1 EW images, the accuracy of extracted sea ice cover by using S1 data is more than 80%.

In recent decades, widespread damage to structures due to destructive earthquakes has encouraged researchers to use seismic control systems. One of the most important structures is bridges, which should maintain their service after severe earthquakes. One of the ways to control the bridge is to isolation the deck from the substructure, which results in high displacements at different points in the bridge and the residual displacements within the separator itself, thus requiring repair and replacement of these systems after severe earthquakes. Therefore, the use of new seismic separation systems on bridges has always been important. The purpose of this project is to utilize a new memory-shaped seismic separator system to investigate the seismic performance of v-shaped column bridges , in which case the effect of earthquake orientation and its effects on responses the earthquake will also be assessed. Due to the ever-increasing advances in various intelligent materials, such as shape memory alloys, and their unique capacities, such as back-centering, and high fatigue and corrosion resistance, in this study, these materials have been used as a complementary component along with lead core separators. The shape memory alloy has been used as 4 vertical rods that connect two separating parts to each other and in this research the diameter and location of these rods will be calculated using optimization algorithm in Matlab software.

To overcome the difficulty of separating bastnaesite from fluorite through the flota-tion technique, the present study examined the suitability of sodium alginate (SA) as a depressant in the flotation process. The effect of SA on the flotation separation of bastnaesite and fluorite was evaluated using micro-flotation tests, zeta potential meas-urements, adsorption density measurements, Fourier infrared spectroscopy, and X-ray photoelectron spectroscopy. The micro-flotation results showed that SA exerted a strongly detrimental effect on fluorite flotation, while slightly affecting bastnaesite flotation. The surface chemistry results revealed that the -COO- and HO- functional groups in SA coordinated with Ca2+ on the fluorite surface, which induced hydro-philicity and hindered the adsorption in the subsequent collector. However, the inter-action of SA with the bastnaesite surface was marginal and did not affect the anchor-ing of the collector on the surface of bastnaesite. Based on these results, the present study proposes a possible model for the interaction of SA on the surfaces of the two minerals, laying a foundation for the flotation separation of bastnaesite from fluorite with SA as an environmentally benign depressant.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

Globally,coastal regions are vital areas of human activities and, as such, are centres of population growth and urban and economic development. Long-term human development has had a major impact on the ecological environment of coastal zones. Therefore, exploring the distribution and provenance of marine sediment types in coastal areas heavily influenced by human activities can provide scientific evidence and references for the current and future ecological management of these sensitive environments. For this reason, we have conducted an analysis on the sediment grain size, Endmember, organic matter content and geochemical elements in the Lu’erhuan River‒Malan Island‒Sandun Island area in the eastern part of Qinzhou Bay, a region heavily influenced by human activities. Sediment grain size clearly differs throughout the study site and the material provenances and hydrodynamic conditions are also varied, likely due to the local environmental conditions and the significant impact human activities have had on the area. The finest-grained sediment is imported from either inland or coastal areas via rivers and weak tidal currents, the next finest component is input from coastal areas through weak tidal currents, and the moderately coarse component mainly originates from nearby beaches. The two coarsest-grained sediment components are influenced by the combination of human activities, tidal currents and waves and enter the water via erosion. Organic matter provenance resembles that of the sediment components, exhibiting varied characteristics. This is due to the combination of natural and human activities in the bay. The organic matter in the upper reaches of the Lu’erhuan River originates from the river and coastal paddy fields, with obvious terrigenous characteristics; the organic matter in northern Malan Island mainly comes from external sources related to oyster farming; while organic matter in eastern Sandun Island is mainly produced endogenously by marine plankton. Al, Ti, Fe, Mg, K, Ga and other elements indicate that terrestrial sediments are significantly disturbed by human activities. However，Mn reflects the marine distribution of terrestrial sediments from the Lu’erhuan River to Jishuimen. Ca and Sr, indicators of marine sediments, are distributed in the eastern offshore area of Sandun Island, which is connected to the open waters. Due to the influence of human activities, As and Cd are highly enriched in the study area, while Cu is less affected by human activities.

Compressed Sensing (CS) MRI has shown great potential in enhancing time efficiency. Deep learning techniques, specifically Generative Adversarial Networks (GANs), have emerged as potent tools for speedy CS-MRI reconstruction. Yet, as the complexity of deep learning recon-struction models increases, this can lead to prolonged reconstruction time and challenges in achieving convergence. In this study we present a novel GAN-based model that delivers superior performance without escalating model complexity. Our generator module, built on the U-net architecture, incorporates dilated residual (DR) networks, thus expanding the network's receptive field without increasing parameters or computational load. At every step of the downsampling path, this revamped generator module includes a DR network, with the dilation rates adjusted according to the depth of the network layer. Moreover, we have introduced a channel attention mechanism (CAM) to distinguish between channels and reduce background noise, thereby fo-cusing on key information. This mechanism adeptly combines global maximum and average pooling approaches to refine channel attention. We conducted comprehensive experiments with the designed model using public domain MRI datasets of the human brain. Ablation studies af-firmed the efficacy of the modified modules within the network. Compared to other relevant models, our proposed model exhibits exceptional performance, achieving not only excellent sta-bility but also outperforming other networks in terms of Peak Signal-to-Noise Ratio (PSNR) and Structural Similarity Index (SSIM). The model presents a promising pathway for enhancing the efficiency and quality of CS-MRI reconstruction.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Survivin was initially identified as a member of the inhibitor apoptosis (IAP) protein family and has been shown to play a critical role in regulation of both apoptosis and mitosis. Survivin has emerged as an attractive target for cancer therapy because its overexpression has been found in most human cancers and is frequently associated with chemotherapy resistance, recurrence, and poor survival rate in cancer patients. In this review, we discuss our current understanding of how survivin mediates various aspects of malignant transformation and drug resistance, as well as efforts that have been made to develop therapeutics targeting survivin for the treatment of cancer.

Aiming at the defects of low precision and time cumulative error, an external wireless signal weighted centroid localization algorithm aided inertial positioning method is designed in this paper. According to the signal strength of each anchor node received at the test point, the distance between the anchor node and the anchor node is obtained by using the attenuation model of the wireless signal. Three anchor nodes are used to measure the distance between the anchor node and the measured point. We can obtain the area to be measured according to the actual situation, the position of the measured point is obtained by the weighted centroid localization algorithm and a combined model of wireless signal aided inertial navigation system is established. The simulation results show that the method can greatly improve the positioning accuracy and restrain the divergence of the longitude error and latitude error.

To date, viral RNA detection is almost the only way to confirm SARS-CoV-2infectionin practice.However, variousreasons can cause low sensitivity for RNA detection, and thisposes aserious challenge to disease control. We tested the performance of detecting total antibody(Ab) and IgM levels in serum by the methods of chemiluminescence, enzyme-linked immunosorbent assay (ELISA), and colloidal golddetection. The datashowed that the sensitivity and specificity for detecting total Ab and IgM levels were high by all three methods, and the sensitivity was higher for detecting total Ab than for detecting IgM. Evidence from studieshas shown thatviral RNA testingcombinedwith serological testing could increase the diagnostic sensitivity while maintaining a high specificity. Specific serology testsfor SARS-CoV-2 havegreat value for clinical practice and public health.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

As an emerging discipline, Design Morphology, with the advantage of "Form Study", has been integrated with many disciplines, and gradually formed its collaborative innovation paradigm. The inclusion of "Ecology" into Design Morphology is expected to promote the research of Design Morphology with the help of the systematic thinking and methods of ecology. The ecosystem of Design Morphology includes the natural ecosystem and the quasi-ecosystem closely related to human beings, and also put forward the concept of "Form Community" for the first time in the design field. In fact, this is exactly the research scope of Design Morphology. Advocating the ecological view of Design Morphology, can not only help to design researchers improve their values and world view, with new thinking and method to engage in "Form Study", but also contribute to the theoretical construction and thinking expansion of Design Morphology, and play a positive role in promoting interdisciplinary collaborative innovation led by Design Morphology. In addition, it can be used to evaluate the overall research and future development trend of Design Morphology, and provide the new research ideas and approaches for the development of design.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

The part transportation efficiency is a main factor of aircraft sortie generation rate. Part transportation is used to transport spare part from base to carrier. Transportation strategy depends on both demand on carrier and inventory in transportation base. The transportation time and stochastic demand will induce fluctuations of cost and inventory. Thus, a Takagi-Sugeno fuzzy system of dynamic part transportation is established considering transportation time and stochastic demand. And a novel Takagi-Sugeno fuzzy robust control is designed for dynamic part transportation, which will keep transportation cost and part inventory stable. First of all, a fuzzy model with stochastic demand and transportation time is proposed. Then, a novel robust control with cross rule groups is conducted according to production and transportation strategy, which will reduce fluctuations induced by strategies switch. Moreover, robust stability is guaranteed and part can be supplied in time under a low cost. Finally, simulation illustrates usefulness and quickness of the novel Takagi-Sugeno fuzzy robust control. Besides, the proposed method will be useful in other transportation electrification systems with delay time and uncertainty.

Mulberry is an economically significant crop for the sericulture industry worldwide. Stresses such as drought exposure have a significant influence on plant survival. Metabolome directly reflects plant physiological status; thus, a way to assess this impact is to perform a global metabolomic analysis. This study investigated the effect of drought stress on mulberry Yu-711 metabolic balance using a liquid chromatography-mass spectrometry (LC-MS) based on an untargeted metabolomic approach. For this objective, Yu-711 leaves were subjected to two weeks of drought stress treatment and control without drought stress. Multivariate and univariate statistical analyses highlighted numerous differentially-accumulated metabolic elements as a function of time and treatment. Drought stress led to a more differentiated metabolites response than the control. We found that the levels of total lipids and galactolipids, and phospholipids (PC, PA, PE) were significantly altered, producing 48% of the total differentially expressed metabolites. Fatty acyls were the most abundant lipids expressed and decreased considerably by 73.6%. Prenol lipids class of lipids increased in drought leaves. Other classes of metabolites, including polyphenols( flavonoids and cinnamic acid), organic acid (amino acids), carbohydrates, benzenoids, and organoheterocyclic, all had a dynamic trend in response to the drought stress. However, their levels under drought stress generally decreased significantly compared to the control. These results provide an overview of the metabolic profile of the mulberry plant through differentially-accumulated compounds and provide a better understanding of global plant metabolic changes in defense mechanisms.

The phycobilisome (PBS) is the major light-harvesting apparatus in cyanobacteria and red algae, a large multi-subunit protein complex of several megadaltons that is found on the stromal side of thylakoid membranes in orderly arrays. Chromophore lyases catalyse the thioether bond between apoproteins and phycobilins of PBSs. Depending on the species, composition, spatial assembly and, especially, the functional tuning of different phycobiliproteins mediated by linker proteins, PBSs can absorb light between 450 and 650 nm, making them efficient and versatile light-harvesting systems. However, basic research and technological innovations are needed, not only to understand their role in photosynthesis but also to realise the potential applications of PBSs. Synthetic biology provides an innovative approach to expand our understanding of the distinctive properties that make the PBS such an efficient light-harvesting system and to explore its heterologous synthesis, photosynthetic functions and potential medical applications. Focusing on these topics, this review describes the essential components needed for PBS assembly, the functional basis of PBS photosynthesis and the applications of phycobiliproteins. Moreover, key technical challenges for heterologous biosynthesis of phycobiliproteins in chassis cells are discussed.

As the most commonly used hydrogel material in contact lenses, the amount of water in a lens affects its optical properties and comfort for the wearer. Therefore, an important challenge is to determine the safety and efficacy of contact lenses by accurately and non-destructively measuring the water content in real time. In this study, we demonstrate the accurate detection of water content in hydrogel contact lenses using a high-precision ATR format in a portable terahertz time-domain spectroscopy system. The technique can resolve small variations in the dielectric constant in solution, which is difficult to achieve with traditional transmission and reflection measurement modes. Information is obtained from the interaction between the sample and the swift waves propagating along the prism surface. The swift waves can excite longitudinal modes that are not directly accessible by conventional techniques. It is worth noting that the reference wave can be measured by removing the sample without disturbing the optical path. We also enhance the plasma effect at the interface with the hydrogel by using PVDF dielectric films of different polarities. We observed that the water content and refractive index changes in the ATR mode show different response patterns for nonpoled PVDF and poled PVDF membranes. This suggests that reflection and relative phase can be accurately evaluated in the THz-ATR technique, resulting in an accurate method for determining complex dielectric constants in the reflection geometry. This will allow accurate measurement of both surface and in vivo water content in hydrogels in the future and is a potential technical route for application in bioaqueous tissue measurements.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

With the development of engineering technology, engineering has higher requirements for the accuracy and the scale of simulation calculation. The computational efficiency of traditional se-rial program can not meet the requirements of engineering。Therefore, reducing the calcula-tion time of temperature control simulation program has important engineering significance for real-time simulation of temperature field and stress field, and then adopting more reasona-ble temperature control and crack prevention measures. GPU parallel computing is introduced into the temperature control simulation program of massive concrete to solve this problem and the optimization is carried out. Considering factors such as GPU clock rate, number of cores, parallel overhead and Parallel Region, The improved GPU parallel algorithm analysis indicator formula is proposed. It makes up for the shortcomings of traditional formula that focus only on time. According to this formula, when there are enough threads, the parallel effect is limited by the size of the parallel domain, and when the parallel domain is large enough, the efficiency is limited by the parallel overhead and the clock rate. This paper studies the optimal Kernel execu-tion configuration. Shared Memory is utilized to improve memory access efficiency by 155%. After solving the problem of bank conflicts, an accelerate rate of 437.5x was realized in the sub-routine of the matrix transpose of the solver. The asynchronous parallel of data access and logi-cal operation is realized on GPU by using CUDA Stream , which can overlap part of the data access time. On the basis of GPU parallelism, asynchronous parallelism can double the compu-ting efficiency. Compared with the serial program, the accelerate rate of inner product matrix multiplication of the GPU asynchronous parallel program is 61.42x. This study further proposed a theoretical formula of data access overlap rate to guide the selection of the number of CUDA streams to achieve the optimal computing conditions. The GPU parallel program compiled and optimized by CUDA Fortran platform can effectively improve the computational efficiency of the simulation program for concrete temperature control, and better serve for engineering computing.

For massive multiple-input multiple-output (MIMO) communications, the minimum mean square error (MMSE) scheme provides close to optimal recognition but involves inverting the high-dimensional matrix. A Gauss-Seidel (GS) detector based on conjugate gradient and Jacobi iteration (CJ) joint processing is introduced to address this problem. Firstly, the signal is initialized with the best of the three initialization regimes for faster algorithm convergence. Secondly, the signal is processed together with CJ. Finally, the pre-processed result is transferred to the GS detector. The simulation results indicate that the proposed iterative algorithm has a lower BER performance than the GS and improved iterative scheme based on GS in channels with different correlation levels.

The 11 system in iron-based superconducting family has become one of the most extensively studied materials in the research of high-temperature superconductivity due to their simple structure and rich physical properties. However, the research on 11 iron-based superconductors faces numerous obstacles, mainly stemming from the challenges associated with producing high-quality single crystals. Since the discovery of FeSe superconductivity in 2008, researchers have made significant progress in crystal growth, overcoming the hurdles that initially impeded their studies. Consequently, they have successfully established the complete phase diagrams of 11 iron-based superconductors, including FeSe1-xTex, FeSe1-xSx and FeTe1-xSx. In this paper, we aim to provide a comprehensive summary of the preparation methods employed for 11 iron-based single crystals over the past decade. Specifically, we will focus on hydrothermal, chemical vapor transport (CVT), self-flux, and annealing methods. Additionally, we will discuss the quality, size, and superconductivity properties exhibited by single crystals obtained through different preparation methods. By exploring these aspects, we can gain a better understanding of the advantages and limitations associated with each technique.

We introduce a novel hybrid Transformer-CNN architecture for robotic grasp detection, designed to enhance the accuracy of grasping unknown objects. Our proposed architecture has two key designs. Firstly, we develop a hierarchical transformer as the encoder, incorporating the external attention to effectively capture the correlation features across the data. Secondly, the decoder is constructed with cross-layer connections to efficiently fuse multi-scale features. Channel attention is introduced in the decoder to model the correlation between channels and to adaptively recalibrate the channel correlation feature response, thereby increasing the weight of the effective channels. Our method is evaluated on the Cornell and Jacquard public datasets, achieving an image-wise detection accuracy of 98.3% and 95.8% on each dataset, respectively. Additionally, we achieve object-wise detection accuracy of 96.9% and 92.4% on the same datasets. A physical experiment is also performed using the Elite 6Dof robot, with a grasping accuracy rate of 93.3%, demonstrating the proposed method's ability to grasp unknown objects in real-world scenarios. The results of this study show that our proposed method outperforms other state-of-the-art methods.

In the field of vision-based robot grasping, effectively leveraging RGB and depth information to accurately determine the position and pose of a target is a critical issue. To address this challenge, we propose a tri-stream cross-modal fusion architecture for 2-DoF visual grasp detection. This architecture facilitates the interaction of RGB and depth bilateral information and is designed to efficiently aggregate multiscale information. Our novel modal interaction module (MIM) with spatial-wise cross-attention algorithm adaptively captures cross-modal feature information. Meanwhile, the channel interaction modules (CIM) further enhance the aggregation of different modal streams. In addition, we efficiently aggregate global multiscale information through a hierarchical structure with skipping connections. To evaluate the performance of our proposed method, we conduct validation experiments on standard public datasets and real robot grasping experiments. We achieve the image-wise detection accuracy of 99.4% and 96.7% on Cornell and Jacquard datasets respectively. The object-wise detection accuracy reaches 97.8% and 94.6% on the same datasets. Furthermore, physical experiments using the 6-DoF Elite robot demonstrate a success rate of 94.5%. These experiments highlight the superior accuracy of our proposed method.

Acemetacin (ACM) is a new non-steroidal anti-inflammatory drug with anti-inflammatory, analgesic, and antipyretic effects. However, the poor water solubility and gastrointestinal side effects limit its use. Recently, the co-amorphous (CAM) strategy has attracted great interest to improve solubility for poorly water-soluble drugs, and basic amino acids have the potential to protect the gastrointestinal tract. In order to develop highly efficient and low toxic ACM formulation, we propose to prepare ACM CAM, with basic amino acids (lysine, arginine and histidine) as co-formers, using a cryo-milling method. The solid-state behaviors of the ACM CAMs were characterized by polarizing light microscopy, differential scanning calorimetry and powder X-ray diffraction. Fourier transform infrared spectroscopy and molecular docking were carried out to understand the formation mechanism. Moreover, the gastro-protective effects of ACM CAMs were evaluated in a rat gastric ulcer model. The results demonstrated CAMs improved the dissolution rates of ACM compared with the neat amorphous counterpart. Furthermore, ACM CAMs are significantly effective in mitigating the ACM-induced gastric ulcer in rats, and the ulcer inhibition rates were almost 90%. More importantly, this study provided a useful method for mitigating drug-induced gastrointestinal damage and broadened the applications of drug-amino acid CAMs.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Carpels are a reproductive feature restricted to angiosperms, therefore they are a focus of many botanical studies. However, there are controversies over the nature of carpels. A reason underly-ing these controversies is mixing implications given by conflicting interpretations on fossil carpels in early fossil angiosperms from the Cretaceous. These controversies hinder a clear understanding of angiosperm evolution and systematics. A key to these questions is older fossil fruits bearing concerned information. Here we report a new fossil fruit, Xenofructus dabuensis gen. et sp. nov, from the Middle Jurassic of Liaoning, China. Unlike previously reported fruits of early angio-sperms that were interpreted as bearing seeds either on adaxial or abaxial margin by various au-thors, our fossil demonstrates clearly that the seeds in Xenofructus are neither borne on the adaxial nor abaxial margin of the fruit, instead the seeds of Xenofructus are borne on an axis positioned between two margins. This new feature implies that a placenta in carpels is an ovule/seed-bearing axis, a carpel is a composite organ comprising an enclosing leaf (fruit wall) and an axis (placenta). The adaxial or abaxial position of ovules/seeds frequently seen in fossil and extant angiosperms is a consequence derived through long time evolution (coalescence of placenta with either margin of fruits). Carpels can be taken as foliar structures enclosing their associated ovulate branches.

The utilization of titanium dioxide (TiO2) as a photocatalyst for the treatment of wastewater has attracted significant attention in the environmental field. Herein, we have prepared a NH2-MIL-125-derived TiO2@N-doped C Visible Light Catalyst through an in-situ calcination method. The nitrogen element in the organic connector is released through calcination, simul-taneously doping into the sample, thereby enhancing its spectral response to cover the visible region. The as-prepared TiO2@N-doped C catalyst exhibited preserved cage structure even after calcination, thereby alleviating the optical shielding effect and further augmenting its photo-catalytic performance by increasing the reaction sites between the catalyst and pollutants. The calcination time of the TiO2@N-doped C-450 °C catalyst was optimized to achieve a balance be-tween the TiO2 content and nitrogen doping level, ensuring efficient degradation rates for basic fuchsin (99.7%), Rhodamine B (89.9%), and tetracycline hydrochloride (93%) within 90 minutes.

With the rapid development of space programs in various countries, the number of satellites in space is increasing, resulting in an increasingly complex space environment. Therefore, improving space object identification technology has become highly important. We proposes a method of applying deep learning to intelligent detection of space object. We utilize 49 authentic 3D satellite models including 16 scenarios to generate a dataset comprising 17,942 images, which contains over 500 actual satellite photos. Additionally, we acquired a substantial amount of annotated data using a semi-automatic labeling method, which resulted in significant labor cost savings, and obtained a total of 39,000 labels. We validate the feasibility of the dataset using YOLOv3 and YOLOv7 models. What's more, we optimize the YOLOv7 model by integrating deformable convolution RepPoint into the YOLOv7 backbone to obtain the YOLOv7-R model. Through training with these two models, experimental results show that YOLOv3 achieves an accuracy of 0.927, YOLOv7 reaches an accuracy of 0.964, and YOLOv7-R achieves the highest accuracy at 0.983. This provides an effective solution for intelligent space object detection.

Nanosystems-based antifungal agents have emerged as an effective strategy to address issues related to drug resistance, drug release, and toxicity. Among the different materials used for drug delivery, multifunctional polymers have proven to be ideal due to their versatility. This review provides an overview of the various types of nanoparticles used in antifungal drug delivery systems, with a particular emphasis on the types of polymers used. The review focuses on the application of drug delivery systems and the release behavior of these systems. Furthermore, the review summa-rizes the critical physical properties and relevant information utilized in antifungal polymer nanomedicine delivery systems, and briefly discusses the application prospects of these systems.

3CL^pro is the main protease of the novel coronavirus (SARS-CoV-2) responsible for their intracellular duplication. Based on virtual screening technology, we found 23 approved clinical drugs such as Carfilzomib, Saquinavir, Thymopentin and etc., which showed high affinity with the 3CL^pro active sites. These findings suggest that 3CL^pro inhibitors might be potential candidates for further activity detection and molecular modification.

Innovation is an essential key factor in the technology development history. Past research on innovation focused more on the innovation behavior of technology, but seldom described knowledge assets which also influence innovation behavior greatly. The effect of knowledge assets attribute and result on disruptive innovation is therefore regarded as the research topic in this study, where disruptive innovation is divided into outbound and inbound to combine combination-embeddednessandmajor business specificityof knowledge assets as the research model. Manufacturing enterprises in China are proceeded the questionnaire survey, and 173 valid copies are collected. The empirical analysis shows that combination-embeddedness of knowledge assets presents significantly positive effects on major business specificity and outbound innovationof an enterprise but reveals remarkably negative effects on inbound innovation. Enterprises are suggested to constantly accumulate knowledge assets with low major business specificity before disruptive innovation in order to reduce ineffective inbound innovation.

The electronic structural evolution of LLM-105 crystal and the (101) plane of LLM-105 crystal under different pressures is investigated by the density functional theory (DFT) calculations and the surface properties of seven low-Miller-index planes of LLM-105 crystal were investigated in this study. The result demonstrates that the surface energy of (101) plane of LLM-105 is much smaller when compared with other low-Miller-index planes of LLM-105.In order to further investigate the stability of crystal structure and (101) plane of LLM-105 under different pressures, a series of pressures ranged from 0 GPa to 55 GPa were applied during the DFT calculation, and the result shows that the electronic structures of LLM-105 crystal and the (101) plane changed with the increase of external pressure and the evolution process of (101) plane is different from that of LLM-105 crystal structure.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

COX II containing a dual core CuA active site is one of the three core subunits of mitochondrial Cco, which plays a significant role in the physiological process. In this report, the full-length cDNA of COXⅡ gene was cloned from Sitophilus zeamais, which had an ORF of 684 bp encoding 227 amino acids residues. The predicted COXⅡ protein had a molecular mass of 26.2 kDa with pI value of 6.37, and multiple sequence alignment and phylogenetic analysis indicated that Sitophilus zeamais COXⅡ had high sequence identity 78.51% with the COXⅡ of other insect species, especially similarity to sitophilus oryzae. This gene was subcloned into the prokaryotic expression vector pET-32a, and induced by IPTG in E.coli Transetta (DE3) expression system. Finally the COXⅡ with 6-His tag was purified using affinity chromatography with Ni²⁺-NTA agarose. WB showed the recombinant COXⅡ was about 44 kD, and the concentration of fusion protein was 50μg/mL. UV-spectrophotometer and infrared spectrometer analysis showed that recombinant COXⅡ could catalyze the oxidation of substrate Cytc, and influenced by AITC. It was found that AITC could form a hydrophobic region with COXⅡ protein via molecular docking, besides, a sulfur atom of AITC structure could form a length of 2.9 Å hydrogen bond with Leu-31. These results will provide valuable information for elucidating the role of COXⅡ in Sitophilus zeamais responses to AITC, meanwhile, it will helpful to carry out a point mutation in AITC binding sites for the future research.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.