To prepare an edible coating with a good preservative effect on sweet cherries, carboxymethyl chitosan (CMCS) and gelatin (GL) were selected as the film-forming matrix in this experiment, and CaCl2 and ascorbic acid (AA) were added as crosslinking agents and antioxidants, respectively. First, the film was prepared by the casting method, and the film formula with better mechanical and barrier performance was filtered out by one-factor and response surface optimization test, and the differences in the preservation effect of different film formulations (CMCS-GL, CaCl2- CMCS-GL, AA -CaCl2- CMCS-GL) on sweet cherries were compared. and then the different film formulations were compared. The difference in film formulation on the preservation effect of sweet cherries was investigated. The results showed that the optimal formulation for an edible film based on CMCS-GL with good performance was CMCS: GL (w:w)=2:1, with the additional amount of 1% glycerol, 2% CaCl2, 0.1% Tween-20, 2% AA, the tensile strength, elongation at break, oxygen permeability and water vapor permeability of the film obtained with this formula were: 16.28 MPa, 71.46%, 1.39×10-12 g- cm/(cm2-s-Pa), 5.10×10-11 cm3-cm/(m2-s-Pa), respectively. In the preservation of sweet cherries, all three film formulations effectively reduced the rotting rate and weight loss during storage while preserving the high hardness and skin color of the fruit. Among them, the formulation AA -CaCl2- CMCS-GL showed the best preservation effect and can be used as a new method for postharvest preservation of sweet cherries.

A single fracture is the basic unit of fracture medium, and the roughness of fracture wall surface is an important factor influencing hydraulic characteristics of the flow in bedrock fracture. However, effects of the shape and density of roughness elements (various bulges/pits on rough fracture wall surfaces) on water flow in a single rough fracture have not been thoroughly discovered. Thus the water flow in single fracture with different shapes and densities of roughness elements was simulated by using Fluent software in this study. The results show that in wider fractures the flow rate mainly depends on fracture aperture, while in narrow and close fracture medium the surface roughness of fracture wall is the main factor of head loss of seepage; there is a negative power exponential relation between the hydraulic gradient index and the average fracture aperture, i.e. with the increase of fracture aperture, the relative roughness of fracture and the influence weight of hydraulic gradient both decrease; and in symmetrical-uncoupled fractures there is a super-cubic relation between the discharge per unit width and average aperture. Above results would help to deepen the understanding of rough fracture seepage.

The deterioration of soil-cement in corrosive environment leads to the reduction of strength and the increase of permeability. Effective methods of determining deteriorated layer permeability coefficient of soil-cement are currently lacking. A laboratory test method for permeability coefficient of deteriorated layer was proposed using the modified permeability coefficient testing apparatus. According to the proposed method, the permeability coefficient of deteriorated layer can be obtained after testing the permeability coefficient of the soil-cement specimen in curing room and the equivalent permeability coefficient and deterioration depth of the soil-cement specimen in corrosion environment. Taking the marine dredger fill of Jiaozhou Bay for example, the deteriorated layer permeability coefficients of soil-cements with different cement contents were tested. It turned out that the permeability of deteriorated layer increases with the increase of age. At the beginning of curing age, larger cement content leads to smaller permeability coefficient of the deteriorated layer of soil-cement. As the curing age increases, the deteriorated layer permeability coefficient of the soil-cement with larger cement content becomes larger. The evolution of the permeability coefficient of deteriorated layer with age can be formulated as the Logistic function. This study provides a support for anti-permeability designs of soil-cement structures in corrosive environment.

Anthracnose is one of primary diseases in tea plants that affects tea yield and quality. The geographical distribution, occurrence regularity, and agronomic measures of tea plants with anthracnose have been researched for decades. However, the pathogenic cause of anthracnose in tea plants is diverse in different regions of the world. Identifying the specific pathogenic fungi causing tea anthracnose is an essential control measure to mitigate this disease. In this study, 88 Diaporthales and 45 Colletotrichum isolates were obtained from 3 different types of diseased tea leaves. Based on multilocus phylogenetic and morphological analysis, 3 known species, including Discula theae-sinensis, Diaporthe ueckerae, Diaporthe lithocarpus, and 3 indistinguishable species of Diaporthales were identified. In adddition, 8 known species of Colletotrichum, C. fructicola, C. camelliae, C. aenigma, C. siamense, C. henanense, C. karstii, C. tropicicola, C. gigasporum, were identified. This study is the first to report C. tropicicola and C. gigasporum in tea plant in China. Discula theae-sinensis was the most common species in this study and caused disease lesions around wounded areas of tea leaves. The dual trials in vitro indicated Discula theae-sinensis and Colletotrichum were slight inhibition. Co-inoculating Discula theae-sinensis and C. fructicola was superior to single inoculation at low concentration.

Permeability has an important effect on drug absorption. In this study, the effect of different concentrations of sodium sulfobutyl ether-β-cyclodextrin (SBE-β-CD) on the absorption of ranitidine was investigated to examine the mechanism of permeability changes. The results of parallel artificial membrane permeability assay (PAMPA) showed that increasing the concentration of sodium sulfobutyl ether-β-cyclodextrin, 0, 0.12% (w/v), 0.36% (w/v) and 3.6% (w/v), respectively, the apparent permeability coefficient of ranitidine decreased to 4.62×10-5 , 4.5×10-5 , 3.61×10-5 and 1.08×10-5 in Caco-2 cells, respectively. The same results were obtained from oral pharmacokinetic study in rats; Further studies indicated that SBE-β-CD significantly increased the zeta potential of ranitidine. SBE-β-CD interacted with ranitidine charges to form a complex that reduced ranitidine permeability, and SBE-β-CD should be chosen with caution for drugs with poor permeability.

Semisolid casting can provide excellent castings, but the nature of the pore-forming mechanisms has not been properly clarified. In the current communication, it was suggested that hydrogen precipitated during slurry making might have a decisive role in the formation of both gas and shrinkage porosity. Intensive stirring at the end of the slurry making process may act as a degassing step. Without the intense stirring, structures of primary slurry particles form around the hydrogen pores, strongly affecting pore formation and feeding during the intensification stage.

In the paper, the authors establish two identities to express the generating function of the Chebyshev polynomials of the second kind and its higher order derivatives in terms of the generating function and its derivatives each other, deduce an explicit formula and an identities for the Chebyshev polynomials of the second kind, derive the inverse of an integer, unit, and lower triangular matrix, present several identities of the Catalan numbers, and give some remarks on the closely related results including connections of the Catalan numbers respectively with the Chebyshev polynomials, the central Delannoy numbers, and the Fibonacci polynomials.

Lactobacillus plantarum has been observed to play a crucial role in shaping the sensory properties of chili sauce. However, the specific taste-active metabolites responsible for the desirable flavor profile of chili sauce remain inadequately characterized. This study employed a combination of metabolomics and web-based computational tools analysis to investigate the dynamic changes in taste-active metabolites during chili sauce fermentation. Initially, metabolites were rapidly annotated using a feature-based molecular network, leading to the tentative annotation of 206 metabolites, of which a significant proportion had not been previously reported. Subsequently, the VirtualTaste tool identified dihydrosphingosine, lactic acid, isoleucine, phytosphingosine, and gluconic acid as potential taste markers for quality control. Finally, pathway enrichment analysis revealed that these components were primarily associated with amino acid tRNA, phenylalanine, tyrosine, and tryptophan biosynthesis, as well as sphingolipid metabolism. This study provides valuable insights into the mechanisms underlying the formation of the distinctive flavor of chili sauce.

This paper proposes a new approach for multi-focus images fusion based on Region Mosaicing on Contrast Pyramids (REMCP). A density-based region growing method is developed to construct a focused region mask for multi-focus images. The segmented focused region mask is decomposed into a mask pyramid, which is then used for supervised region mosaicking on a contrast pyramid. In this way, the focus measurement and the continuity of focused regions are incorporated and the pixel level pyramid fusion is improved at the region level. Objective and subjective experiments show that the proposed REMCP is more robust to noise than compared algorithms and can fully preserves the focus information of the multi-focus images meanwhile reducing distortions of the fused images.

During choriogenesis in insects, chorion (eggshell) is formed by surrounding follicular epithelial cells in ovarioles. However, the regulatory endocrine factor(s) activating choriogenesis and the chemical components on eggshell deserve further exploration. In two representative Coleopterans, a Coccinellid Henosepilachna vigintioctopunctata and a Chrysomelid Leptinotarsa decemlineata, genes encoding the 20-hydroxyecdysone (20E) receptor heterodimer, ecdysone receptor (EcR) and ultraspiracle (USP), and two chitin biosynthesis enzymes UDP-N-acetylglucosamine pyrophosphorylase (UAP) and chitin synthase (ChS1), were highly expressed in ovaries of the young females. RNA interference (RNAi)-aided knockdown of either HvEcR or Hvusp in H. vigintioctopunctata inhibited oviposition, suppressed the expression of HvChS1, and lessened the positive signal of Calcofluor staining on the chorions, which suggests the reduction of a chitin-like substance (CLS) deposited on eggshells. Similarly, RNAi of LdEcR or Ldusp in L. decemlineata constrained oviposition, decreased the expression of LdUAP1 and LdChS1, and declined CLS contents in the resultant ovaries. Knockdown of LdUAP1 or LdChS1 caused similar defective phenotypes, i.e., reduced oviposition and CLS contents in the L. decemlineata ovaries. These results, for the first time, indicate that 20E signaling activates choriogenesis in two Coleopteran species. Moreover, our findings propose the deposition of a CLS on the chorions.

Applied talent is not only a builder of human civilization but also a promoter of economic development. They not only need systematic and solid engineering theoretical knowledge but also rich engineering practical experience. Applied undergraduate colleges are the cradle for cultivating applied talent and shoulder the important mission of cultivating various types of applied talent for society. With the rapid development of higher education, the number of applied undergraduate institutions has sharply increased, but the quality of applied talent cultivated by them has shown a significant decline, which greatly restricts the pace of industrial development in the world. This article proposes a new concept of promoting the "three certificates" (graduation certificate, degree certificate, and skill certificate) education model in applied undergraduate colleges, which is of great significance for the country to cultivate composite talents with the ability of "product design, production management, and product processing" at the same time.

Aflatoxin biosynthesis is correlated with oxidative stress and is proposed to function as a secondary defense mechanism to redundant intracellular reactive oxygen species (ROS). We find that the antioxidant gallic acid inhibits aflatoxin formation and growth in A. flavus in a dose-dependent manner. Global expression analysis (RNA-Seq) of gallic acid treated A. flavus showed that 0.8% (w/v) gallic acid revealed two possible routes of aflatoxin inhibition. Gallic acid significantly inhibited the expression of farB, encoding a transcription factor that participates in peroxisomal fatty acid β oxidation, a fundamental contributor to aflatoxin production. Secondly, the carbon repression regulator encoding gene creA was significantly down regulated by gallic acid treatment. CreA is necessary for aflatoxin synthesis and aflatoxin biosynthesis genes were significantly downregulated in DcreA mutants. In addition, the results of antioxidant enzyme activities and the lipid oxidation levels coupled with RNA-Seq data of antioxidant genes indicated that gallic acid may reduce oxidative stress through the glutathione- and thioredoxin-dependent systems in A. flavus.

We estimated the daily intakes of chlorpyrifos and cypermethrin via ingestion of indoor dust and outdoor soils using the Stochastic Human Exposure and Dose Simulation Model on a probabilistic approach for Taiwan’s homes. Variable information for the daily intake estimation, such as concentration, ingestion rate, body weight, was adopted from previous studies. Monte Carlo simulation was performed with 1,000,000 iterations to simulate a single daily intake, which was shown in terms of percentage of the Acceptable Daily Intake (ADI) of either insecticide. The daily intakes were minimal with a 99% probability; at 99.9th percentile, however, the total intakes leaped to 13.1% and 20.0% of the respective ADIs of chlorpyrifos and cypermethrin. The sensitivity analysis indicated that concentration was the most determinant variable. Compared to the data of daily intakes via dietary ingestion of vegetables derived from a previous study, the estimated intakes by this study were considerable at the highest percentile, which referred to insecticide residues few days after insecticide application. Consequently, the non-dietary ingestion exposure to either insecticide was negligible in most cases; nevertheless, for those with indoor insecticide applications, the daily intakes for young children could be of concern. Frequently home cleaning is recommended to reduce the exposure.

Bearings are widely used in various types of electrical machinery and equipment. As their core components, failures will often cause serious consequences . At present, most methods of parameter adjustment are still manual adjustment of parameters. This adjustment method is susceptible to prior knowledge and easy to fall into the local optimal solution, failing to obtain the global optimal solution and requires a lot of resources.Therefore, this paper proposes a new method of bearing fault diagnosis based on wavelet packet transform and convolutional neural network optimized by simulated annealing algorithm.The experimental results show that the method proposed in this paper has a more accurate effect in feature extraction and fault classification compared with traditional bearing fault diagnosis methods. At the same time, compared with the traditional artificial neural network parameter adjustment, this paper introduces the simulated annealing algorithm to automatically adjust the parameters of the neural network, thereby obtaining an adaptive bearing fault diagnosis method. To verify the effectiveness of the method, the Case Western Reserve University bearing database was used for testing, and the traditional intelligent bearing fault diagnosis method was compared. The results show that the method proposed in this paper has good results in bearing fault diagnosis. Provides a new way of thinking in the field of bearing fault diagnosis in parameter adjustment and fault classification algorithms

The calculation of the exact value of the square root of 2 is requested. In order to obtain its infinite value, A new concept is proposed where the accumulations of the infinitely many of finity is indicated by the change in direction which means that there is a jump from finity to infinity .The meaningless for an infinite number with a decimal point is indicated by this jump because any decimal number only have meanings within a finite range values and there is only an infinite integer quantity that can not be operated by algorithms like operations of multiplication，division,addition, and subtraction . The final result of the change in direction is two quantity where the second quantity and the first quantity extend in parallel line and never intersect and the second quantity represent the size of the first quantity. The first quantity is the infinitely great that can't be talked about anything outside of it and can compress any quantities outside of it to nothing and it is the exact value of the square root of 2 .

Abstract Although we know something about single cell neuromuscular junction, It is still mysterious how multiple skeletal muscle cells coordinate to complete the intricate spatial curve movement. Here I propose a hypothesis that skeletal muscle cell populations with action potentials are alligned according to a curved manifolds on space(a curved shape on space) and the skeletal muscle also moves according to this corresponding shape(manifolds) when an specific motor nerve impulses are transmitted. the action potential of motor nerve fibers has the characteristics of time curve manifold and this time manifold curve of motor nerve fibers come from visual cortex in which a spatial geometric manifolds are formed within the synaptic connection of neurons. This spatial geometric manifolds of the synaptic connection of neurons orginate from spatial geometric manifolds in outside nature that are transmitted to brain through the cone cells and ganglion cells of the retina.Further,the essence of life is that life is an object that can move autonomously and the essence of life's autonomous movement is the movement of proteins. theoretically, due to the infinite diversity of geometric manifold shapes in nature, the arrangement and combination of 20 amino acids should have infinite diversity, and the geometric manifold formed by protein three-dimensional spatial structure should also have infinite diversity.

An approximate calculation of the spatial characteristics on finite range is required, so one quantitative continuum represents the accumulation of infinite great quantities is artificially divided it into smaller and camparable parts in which calculus operation can be applied .This operation is defined as Theorem 1 in which infinity is not involved, there is a camparable finity is constantly (forever) approaching and not reaching infinity, and only staying within a finite range. Theorem 1 can exist in this paper as a new mathematical basis for physics. Because the essence of all physical quantities is size comparison, and the size comparison relation of matter can only be space/time, so relation formula space/time is the only expression of the concept of matter, all physical quantities are applicable to this expression, each different physical quantity is a multi-dimensional representation of this expression. A new mass energy formula is aslo derived from this paper.

Abstract Unlike accelerated motion or curvalinear motion,a nonlinear motion state(non-inertial system) can be described by differential equations or the other algebric equations in axiom 2, the accelerated motion in axiom 3 can be considered to be described by using the equation of the linear and curvilinear process of the continuum extending to infinitely distance.Further, this linear and curvilinear process of the continuum is a quantitative continuum in essence as a unity of infinitely quantities and infinitely dimensions at infinite distance (infinity) relative to all orientations in which we exist. These indicates that an accelerated motion accumulates continuously started from a finite quantities, leaping to transit from finite to infinite quantities by an infinitely great accelerating force.

This general review assesses the impact of physical exercise on oxidative and nitrosative stress and the counteractive role of antioxidants, drawing from a systematic literature search up to March 2024 in databases like PubMed and Web of Science. The review highlights studies on the effect of exercise on the production of reactive oxygen species (ROS) and reactive nitrogen species (RNS) and antioxidant responses in both human and animal models based on rigorous inclusion and exclusion criteria. Due to the variety of exercise types and participants' characteristics, a narrative synthesis approach was adopted. The findings indicate that moderate exercise boosts antioxidant defenses, known as hormesis, whereas excessive physical activity may increase oxidative and nitrosative damage. The review also explores the complex effects of antioxidant supplementation, revealing that while natural dietary antioxidants support health, high-dose supplements could potentially hinder positive adaptations to exercise. Recommendations for athletes and the general active population highlight the importance of balancing exercise and dietary intake to optimize health benefits. The review concludes with a call for more detailed research on tailored exercise and nutrition plans to dissect these intricate relationships further.

A novel scheme that can simultaneously measure the Doppler frequency shift (DFS) and angle of arrival (AOA) of microwave signals is proposed. At the signal receiving unit (SRU), two echo signals and the reference signal are modulated by a Sagnac loop structure and sent to the central station (CS) for processing. At the CS, two low-frequency electrical signals are generated after polarization control and photoelectric conversion. The DFS without direction ambiguity and wide AOA measurement can be real-time acquired by monitoring the frequency and power of the two low-frequency electrical signals. In the simulation, an unambiguous DFS measurement with errors of ±3×10-3 Hz and a -90° to 90° AOA measurement range with errors of less than ±0.5° are realized. The safety and robustness of the system to environmental disturbance are improved, and it is more suitable for the modern electronic warfare system.

This paper considers the Hermitian solutions of a new system of commutative quaternion matrix equations, we establish both necessary and sufficient conditions for the existence of solutions. Furthermore, we derive an explicit general expression when it is solvable. To illustrate our main findings, we present two numerical algorithms and examples in this paper.

Arc sensors have been used in seam tracking and widely studied since the 80s; commercial arc sensing products for T and V shaped grooves have been developed. However, it is difficult to use these arc sensors in narrow gap welding because arc stability and sensing accuracy are not satisfactory. Pulse gas melting arc welding (P-GMAW) has been successfully applied in narrow gap welding and all position welding processes, so it is worthwhile to research P-GMAW arc sensing technology. In this paper, we derived a linear mathematical P-GMAW model for arc sensing, and the assumptions for the model are verified through experiments and finite element methods. Finally, the linear characteristics of the mathematical model were investigated. In torch height changing experiments, uphill experiments, and groove angle changing experiments the P-GMAW arc signals all satisfied the linear rules. In addition, the faster the welding speed, the higher the arc signal sensitivities; the smaller the groove angle, the greater the arc sensitivities. The arc signal variation rate needs to be modified according to the welding power, groove angles, and swing or rotate speed.

The fusion of machine learning, biomedical, and bioengineering research offers novel ways to understand, diagnose, and treat various health conditions. However, the complexities of biomedical and bioengineering data, coupled with the intricate process of developing and deploying machine learning solutions, often pose significant challenges to researchers in these fields. We introduce a new Automatic Semantic Machine Learning Microservice Framework (AIMS) that addresses these challenges by automating key aspects of the machine learning pipeline, from data preprocessing to model evaluation. Our proposed framework emphasizes model interpretability, the integration of domain knowledge, and the efficient handling of biomedical data. Furthermore, it incorporates self-supervised knowledge learning strategies, enabling the automatic generation, optimization, and continuous adaptation of machine learning models in response to new tasks and data. We illustrate the potential of our framework through three case studies in biomedical research, showcasing its capacity to streamline research processes, improve scientific exploration quality, and provide a foundation for significant breakthroughs.

The theory of heterogeneous nucleation was initially developed as a part of condensed matter physics and later it was used as an important engineering tool to design metallurgical processes. The success leads to wide applications of the theory in metallurgical practice. For example, engineering heterogeneous nucleation in ductile iron has been used to reduce shrinkage defects, suppress cementite formation, and modify size and shape of micro-structural constituencies. This demonstrates how theoretical knowledge could benefit industry practice. This overview aims to summarize the authors’ published studies in co-authorship with colleagues and students, which covered different aspects of engineering heterogeneous nucleation in multiphase cast alloys. Several approaches for engineering heterogeneous nucleation using thermodynamic simulation and practical methods for improving efficiency of nucleation using co-precipitation technique and a local transient melt supersaturation were suggested. Automated Scanning Electron Microscopy Energy-Dispersive-X-ray (SEM/EDX) analysis and a high-resolution Transmission Electron Microscopy (TEM) were used to verify simulation predictions. Practical examples of controlling micro-porosity shrinkage in cast irons with spheroidal graphite are presented to illustrate the power of engineering heterogenous nucleation. The authors appreciate the great efforts that the co-authors have made on the original, overviewed articles here.

This paper presents a multifunctional reflective digital metasurface of arbitrary base based on voltage tunable liquid crystal (LC). The reflective digital metamaterial can be multiplexed for different desirable functions by properly biasing the LC for different code patterns. Simulation results of three significant functions, beam steering with a steering elevation angle 27° at 75 GHz, RCS reduction of at least 15dB along the incident direction, and beam shaping with different beam shapes have been presented to prove the concept.

This paper addresses the effect of both microstructure and relative humidity on the long-term creep properties of sustainable calcium carbonate (CaCO₃) cements. Those can be prepared by mixing amorphous calcium carbonate and vaterite with water. A larger starting amount of vaterite, X_V, within the mixture design gives a higher elasticity and resistance to the specimens due to the larger overall bridging area within the newly formed calcite crystals. Regarding creep properties for a given relative humidity, the amplitude of creep strain decreases with X_V, and makes the relation between the elastic modulus, E, and hardness, H, of the samples to be linear with the contact creep modulus, C. On the other hand, for a given composition, the amplitude of creep increases with the relative humidity, making the contact creep modulus, Ci, to rise exponentially with the elastic modulus, E, and hardness, H, of the specimens. The most probable creep mechanisms for this kind of cement seem to be a combination of microcraking in the early stages and dissolution and reprecipitation of calcite in the long-term (also known as pressure solution theory). The presence of water in pores with increasing relative humidity might enhance the local dissolution of calcite, and hence the creep amplitude.

In wireless sensor networks (WSNs), each sensor node can estimate the global parameter from the local data in distributed manner. This paper proposed a robust diffusion estimation algorithm based on minimum error entropy criterion with self-adjusting step-size, which are referred to as diffusion MEE-SAS (DMEE-SAS) algorithm. The DMEE-SAS algorithm has fast speed of convergence and is robust against non-Gaussian noise in the measurements. The detailed performance analysis of the DMEE-SAS algorithm is performed. By combining the DMEE-SAS with diffusion minimum error entropy (DMEE) algorithms, an Improving DMEE-SAS algorithm is proposed, in non-stationary environment where tracking is very important. The Improving DMEE-SAS algorithm can avoid insensitivity of the DMEE-SAS algorithm due to the small effective step-size near the optimal estimator, and obtain a fast convergence speed. Numerical simulations are given to verify the effectiveness and advantages of these proposed algorithms.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

In China, "new quality productive forces" have become an important focus for high-quality development; accelerating this development is an important task for the Chinese government in 2024. Such development relies on the traction of the digital economy. In view of this, developing “new quality productive forces” driven by the Chinese digital economy requires focusing on blocking points, such as the insufficient vitality of data, inadequate algorithmic regulation, the uneven distribution of computing power resources and the immature market environment. In order to dredge these blocking points, it is necessary to establish basic rules on data, strengthening algorithm supervision, building a national integrated computing power network, and optimizing the market environment.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

BACKGROUND. The aims of this study was to compare differences in daytime sleepiness between genders and qualification levels in a cohort university Chinese soccer player under 0 Covid policy restrictions in the urban area of Shanghai. METHODS. 491 questionnaires of Epworth Sleepiness Scales (ESS) were compiled online by males and females Soccer Students (SS), Semi-professional players (SP) and professional players (PP) during the ongoing measures of Shanghai lockdown. ANOVA was performed for players levels and gender. RESULTS. Significant differences were found between the 3 levels and between males and females. PP showed a very low score in the ESS (5,97) well below the threshold of 8, while SS and SP showed an ESS score above the threshold. Female showed higher scores than males. CONCLUSIONS. This study present the first data on sleepiness in Chinese soccer players of different level of qualification in a lockdown condition. Professional players has been less affected by lockdown measures than SS and SP. We can hypothesize the reasons resides in the more ordered lifestyle of PP in comparison to SS and SP, which mitigated the effects of the lockdown. Measures to improve sleep in females’ soccer player should be adopted.

Stem cells are undifferentiated cells which can give rise to any types of cells in our body. Hence, they have been utilized for various applications such as drug testing and disease modeling. However, for the successful of those applications, the survival and differentiation of stem cells into specialized lineages should be well controlled. Growth factors and chemical agents are the most common signals to promote the proliferation and differentiation of stem cells. However, those approaches holds several drawbacks such as the negative side effects, degradation or denaturation, and expensive. To address such limitations, nanomaterials have been recently used as a better approach for controlling stem cells behaviors. Graphene oxide is the derivative of graphene, the first 2D materials in the world. Recently, due to its extraordinary properties and great biological effects on stem cells, many scientists around the world have utilized graphene oxide to enhance the differentiation potential of stem cells. In this mini review, we highlight the key advances about the effects of graphene oxide on controlling stem cell growth and various types of stem cell differentiation. We also discuss the possible molecular mechanisms of graphene oxide in controlling stem cell growth and differentiation.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

Defect recognition in ballastless track structures, based on distributed acoustic sensors (DASs), was researched in order to improve detection efficiency and ensure the safe operation of trains on high-speed railways. A line in southern China was selected, and equipment was installed and debugged to collect the signals of trains and events along it. Track vibration signals were extracted by identifying a train track, denoising, framing and labeling to build a defect dataset. Time–frequency-domain statistical features, wavelet packet energy spectra and the MFCCs of vibration signals were extracted to form a multi-dimensional vector. An XGBoost model was trained and its accuracy reached 89.34%. A time-domain residual network (ResNet) that would expand the receptive field and test the accuracies obtained from convolution kernels of different sizes was proposed, and its accuracy reached 94.82%. In conclusion, both methods showed good performance with the built dataset. Additionally, the ResNet delivered more effective detection of DAS signals compared to conventional feature engineering methods.

Chronic hepatitis B infection remains a significant worldwide health burden, placing persons at risk for hepatocellular cancer and hepatic fibrosis. Chronic hepatitis B virus (CHB) infection is characterized by elevated levels of immunosuppressive regulatory T cells (Tregs), which can inhibit the function of effector T cells and lead to an insufficient immune clearance response against HBV in the host. Theoretically, suppression of Treg functionality and percentage could increase anti-HBV reactivity in CHB-infected patients, although this has not yet been explored. We attempted to enhance our previously established anti-CHB protocol utilizing the GM-CSF+IFN-α+rHBVvac regimen (GMI-HBVac) by incorporating Mafosfamide (MAF), which has been utilized in anticancer therapy in the past. Intravenous administration of MAF to rAAV8-1.3HBV-infected mice resulted in a dose-dependent reduction of Tregs in the blood, rebounding to pretreatment levels 10 days later. To determine the efficacy of anti-CHB, 2ug/ml MAF was combined with the GMI-HBVac in an HBV-infected animal model as an anti-Treg treatment. When rAAV8-1.3HBV-infected mice were immunized with MAF+GMI-HBVac, peripheral blood Tregs decreased significantly, leading to dendritic cell activation, HBV-specific T cell proliferation, and upregulation of IFN-gamma producing CD8+T cells. In addition, MAF+GMI-HBVac vaccination stimulates T cell infiltration in HBV-infected liver. These conditions may contribute to an enhanced immune response and the clearance of HBV-associated antigens, including serum HBsAg, serum HBcAg, and HBcAg+ hepatocytes. Overall, this is the first indication that MAF was utilized as an adjuvant to deplete Tregs and paired with GMI-HBVac as a unique therapeutic vaccine regimen against established CHB mice to produce a functional cure, as seen by the remarkable clearance of HBsAg.

We investigate and discuss in detail the structure of the restricted singular value decomposition for a tensor triplet under t-product (T-RSVD). The algorithm is provided with a numerical example illustrating the main result. For applications, we consider color image watermarking processing with T-RSVD.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

The Mine Internet of Things (MIoT), as a key technology for reconstructing post-disaster communication networks, enables to realize the safety monitoring and controlling of the affected roadway. However, due to the challenging underground mine environment, the MIoT suffers from severe signal attenuation, vulnerable nodes, and limited energy, which result in low network reliability of the post-disaster MIoT. To improve the transmission reliability as well as to reduce energy consumption, a directional-area-forwarding-based energy-efficient opportunistic routing (DEOR) for the post-disaster MIoT is proposed. DEOR defines a forwarding zone (FZ) for each node to route packets toward the sink. The candidate forwarding set (CFS) is constructed by the nodes within the FZ that satisfy the energy constraint and the neighboring node degree constraint. The nodes in CFS are prioritized based on the routing quality evaluation by taking the local attributes of nodes into consideration, such as the directional angle, transmission distance, and residual energy. DEOR adopts a recovery mechanism to address the issue of void nodes. The simulation results validate that the proposed DEOR outperforms ORR, OBRN and ECSOR in terms of energy consumption, average hop count, packet delivery rate, and network lifetime.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

The pathogenicity of grapevine geminivirus A (GGVA), a recently identified DNA virus, to grapevine plants remains largely unclear. Here, we report a new GGVA isolate (named GGVAQN) obtained from grapevine ‘Queen Nina’ plants with severe disease symptoms; the infectious clone of GGVAQN (pXT-GGVAQN) was also constructed. Infection assays indicated that Nicotiana benthamiana plants inoculated with GGVAQN display upward leaf curling and chlorotic mottling symptoms. Direct injection of Agrobacterium tumefaciens cells carrying pXT-GGVAQN into roots of in vitro-grown ‘Red Globe’ grape plantlets by syringe led to systemic infection with GGVAQN, and the plants exhibited chlorotic mottling symptoms on their upper leaves, and downward curling, interveinal yellowing, and leaf-margin necrosis symptoms on their lower leaves. Our results provide insights into the pathogenicity of GGVA, and a simple and efficient inoculation method to deliver infectious viral clones to woody perennial plants.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

The hospital indoor environment plays a significant role in shaping the microbial exposures that humans encounter. Resistance to antibiotics is one of the mechanisms employed by bacteria to develop resilience against stress in indoor environments. The extensive usage of antibiotics has been a key factor in driving changes in the ecological function of antibiotic resistance genes (ARGs) and their acquisition by pathogenic bacteria. By integrating the 16S rRNA Illumina sequencing and high throughput-qPCR approaches with water and air dust samples across seven departments at Peking University Shenzhen Hospital, China, this study yielded intriguing findings regarding the department-specific variation, transmission, and correlation of bacteria, ARGs and MGEs within the hospital indoor environment. One notable observation was that the seasonal variation played a vital role in shaping the bacterial composition in the overall hospital indoor environment across seven studied departments. Nevertheless, a similar significant seasonal impact was only observed in the blood test room and emergency departments, rather than in the other five departments. Another intriguing finding was the correlation between ARGs and MGEs abundance. This correlation was evident in the overall hospital indoor environment, which was conversely not found in the emergency, pneumology and gynecology departments. Additionally, while there was no significant relationship that occurred between bacterial communities and ARGs/MGEs within the hospital, the gynecology department demonstrated a close link between bacterial communities and the presence of ARGs/MGEs. Notably, the gynecology department also stood out as an important source of bacteria and ARGs/MGEs for other departments. This study underscores the need for careful surveillance and monitoring of antibiotic resistance, particularly in Legionella spp. in man-made water systems. The findings also show the importance of monitoring and understanding the genetic elements such as Tp614 involved in gene transfer and recombination, as well as their impact on antimicrobial treatment efficacy.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (>90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

Diffuse cavernous hemangioma of the rectum (DCHR) is a rare benign lesion of vascular malformation. According to previous studies, the most reported major symptoms of DCHR are recurrent painless rectal bleeding or iron deficiency anemia[1][2][3][4][5][6]. We present a case of an 8Y11M boy who was diagnosed with DCHR by MRI. The patient underwent Laparoscopic-assisted transanal distal sigmoidectomy and sigmoido-anal anastomosis（Laparoscopic Swenson Procedure）, and recovered well. After the operation, the child had short-term fecal incontinence and loose stools, which returned to normal after half a year. Regardless of age and symptoms, early and correct diagnosis and treatment of DCHR and postoperative restoration of normal anal function are necessary. Laparoscopic Swenson procedure may be a good option for the treatment of DCHR.

Group-IV GeSn photodetectors (PDs) compatible with standard complementary metal-oxide-semiconductor (CMOS) processing have emerged as a new and non-toxic infrared detection technology to enable a wide range of infrared applications. The performance of GeSn PDs is highly dependent on the Sn composition and operation temperature. Here, we develop theoretical models to establish a simple rule of thumb, namely “GeSn-rule 23”, to describe GeSn PDs’ dark current density in terms of operation temperature, cutoff wavelength, and Sn composition. In addition, analysis of GeSn PDs’ performance shows that the responsivity, detectivity, and bandwidth are highly dependent on operation temperature. This rule provides a simple and convenient indicator for device developers to estimate the device performance at various conditions for practical applications.

An electrocardiograph (ECG) reflects the health of the human heart and is used to help diagnose arrhythmia and myocardial infarction(MI) in clinical practice. Early diagnosis of arrhythmia helps implement preventive measures and plays a crucial role in saving a patient's life. With the increasing demand of clinicians for ECG analysis technology, intelligent detection and diagnosis of ECG signals has become a more efficient means to assist physicians in diagnosing cardiovascular diseases. This paper introduces an ECG diagnosis approach based on an ensemble deep learning combination of CNN(convolutional neural network) and SLAP(stacked-long short term memory architecture for prediction) architecture. ECG data is denoised and further divided into single heartbeats to achieve data standardization and sample diversity. Adam optimizer and BCEwithlogitsloss multi-classification loss function were used to enhance the model effect, and the system achieved the classification effect of 99.3% average accuracy, 99.0% F1-value, and 99.2% sensitivity in MIT-BIH standard database classification. It also shows good generalization ability on the Tianchi data set.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

This study aimed to identify whether gyrate atrophy of the choroid and retina (GACR) heterozygous individuals have possible clinical manifestations and to explore the potential pathogenic mechanism. In this retrospective study, we surveyed a two-generation pedigree of an individual diagnosed with GACR. Two family members underwent ophthalmological, hematologic, and genetic tests. An arginine-restricted diet with vitamin B6 supplementation was implemented; clinical assessments were repeated every 3 months during follow-up. Relative OAT mRNA expression was determined using real-time quantitative polymerase chain reaction. The 19-year-old compound heterozygous daughter (OAT: c.1186C>T; c.748C>T), had bilateral high myopia, posterior staphyloma, chorioretinal atrophy, macular abnormalities, and elevated hematologic ornithine. The 54-year-old heterozygous mother (OAT: c.1186C>T), presented with bilateral severe myopia, asymmetric posterior staphyloma, retina and choroidal capillary layer atrophy, retinal pigment epithelium abnormalities, and mildly elevated hematologic ornithine. Compared to normal individuals, the daughter and mother had 29% and 46% relative OAT mRNA expression, respectively (P<0.001). We believe that this is the first report of a carrier of one OAT variant allele with mild phenotypes, suggesting that family members should be aware of the possible involvement of autosomal recessive conditions. Additional data suggests nonsense mediated decay-initiated mRNA degradation may cause GACR.

Regeneratively cooled scramjet has already been successfully verified as propulsion device for hypersonic vehicle. As a result, dynamic process of flow and heat transfer in cooling channel is commonly occurred which may bring hazard and control difficulties for scramjet. To study transient flow and heat transfer process in cooling channel, a dynamic numerical model is established. Dynamic characteristics of flow and heat transfer under different conditions are calculated and discussed, which includes change of inlet fuel mass flow, heat flux and pressure working conditions. Results show that stable time of cooling channel outlet fuel temperature is related to the change rate of inlet mass flow and heat flux. The stable time of outlet fuel temperature under heat flux decreasing working conditions are about 12.5 s. The initial response of working pressure fluctuation will lead to fuel temperature fluctuation, which has little effect on wall temperature.

Dual quaternions have wide applications in automatic differentiation, computer graphics, mechanics and others. Due to its application in control theory, the matrix equation AXB=C has been extensively studied. However, there is currently limited information on matrix equation AXB=C over the dual quaternion algebra. In this paper, we provide the necessary and sufficient conditions for the solvability of the dual quaternion matrix equation AXB=C, and present the expression for the general solution when it is solvable. As an application, we derive the ϕ-Hermitian solutions for the dual quaternion matrix equation AXAϕ=C, where the ϕ-Hermitian extends the concepts of Hermiticity and η-Hermiticity. Lastly, we present a numerical example to verify the main research results of this paper.

The objective of this study is to design an optimal model predictive control (MPC) strategy using manipulated variables to control the production of a sufficient amount of hydrogen through low temperature autothermal reforming of dimethyl ether (DME), a reforming reaction performed using PdO/ZnO/γ-Al2O3 catalysts coated on honeycomb cordierite ceramics. Experiments and simulation have verified that the optimal activity temperature of the catalyst is 400 °C, and the hydrogen volume fraction in syngas is over 43%. In the implementation of the hydrogen production system, the MPC controller can precisely determine the feed rates of DME, high-purity air, and water based on the space state equation of the reformer, to achieve the anti-disturbance of the reformer temperature. Thus, the reduction of hydrogen yield and sintering of the catalyst as a result of overheating are prevented. As the static and dynamic performance of hydrogen production exhibits excellent tracking of the setpoints, an autonomous, automated, and reliable continuous system was designed to meet the desired hydrogen demand situation. This study shows that an autonomous, automated, and reliable continuous hydrogen production reforming system can be designed to actively respond to the on-board hydrogen usage situation.

The calcium-sensing receptor (CAS), as a chloroplast thylakoid membrane protein, involved in the process of [Ca2+] ext-induced [Ca2+]cyt increase (CICI) in the plant. However, the underlying mechanism regulating this process is lacking. Furthermore, recent evidence suggests that CAS may perform additional roles in the plant. Here, we provide an update covering the multiple roles of CAS in stomatal movement regulation and calcium signaling in the plant. We also analysis the possible phosphorylation mechanism of CAS by light and discuss the role of CAS in abiotic stress (drought, salt stress) and biotic stresses (plant immune signaling). Finally, we provide a perspective for future experiments which are required to fill gaps in our understanding of the biological function of CAS in the plant.

This narrative review critically evaluates the multidimensional impacts of team sports on student wellness through the Wellness Wheel framework, encompassing physical, emotional, intellectual, social, spiritual, occupational, and environmental well-being. Methodologically, the review synthesizes empirical studies, systematic reviews, and meta-analyses from the last 20 years, extracted from databases such as PubMed, PsycINFO, Scopus, Web of Science, and Google Scholar, to construct a comprehensive understanding of how team sports contribute to holistic student development. Our findings highlight team sports as a vital component of educational and wellness programs, significantly enhancing not just physical health but also emotional stability, cognitive performance, social skills, spiritual enrichment, and environmental awareness. The review underscores the necessity of integrating team sports into educational curricula to promote a balanced and comprehensive approach to student well-being. It also identifies existing gaps in literature, particularly the need for further research on enhancing inclusivity and accessibility in team sports, ensuring that all students can benefit from their wide-ranging impacts. This study advocates for strategic initiatives to incorporate team sports in educational settings, emphasizing their essential role in cultivating a well-rounded, healthy, and inclusive student body.

Periodontitis is a progressive and inflammatory oral disease and results in the damage of the supporting tissues of teeth. Peroxiredoxin6 (PRDX6) is an antioxidant enzyme and has been identified as a regulator in redox balance. This study aimed to investigate whether PRDX6 could protect human gingival fibroblasts (HGFs) from lipopolysaccharide (LPS) induced inflammation and its mechanisms. Here, both inflamed and non-inflamed human gingival tissues were collected to assess the expression of PRDX6 and NRF2 by Immunohistochemistry and Western blotting. Furthermore, HGFs were stimulated with LPS, MJ33 (PRDX6 phospholipase A2 inhibitor), or ML385 (NRF2 inhibitor). The expression levels of inflammatory cytokines were measured by RT-qPCR and ELISA, and reactive oxygen species (ROS) was detected using DCFH-DA. PRDX6 was downregulated in inflamed gingival tissues. In HGFs, LPS induced inflammatory cytokines and ROS was upregulated in PRDX6 knockdown cells. Furthermore, co-treatment with MJ33 alleviated LPS-induced inflammatory cytokines and ROS, while inhibiting NRF2 upregulated those in HGFs. Therefore, this study provided a new mechanistic insight that PRDX6, regulated by the NRF2 signaling, alleviates LPS- induced periodontitis in human gingival fibroblasts.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Cs2NaInCl6 double perovskites, which have excellent photoelectric conversion properties and are non-toxic and lead-free, have recently attracted much attention. In particular, double perovskite quantum dots (QDs) are considered to be a promising material for optoelectronic device applications. Ligands such as oleic acid (OA) and oleylamine (OAm) are essential for the synthesis of perovskite QDs, but their roles on double perovskite QDs are not yet clear. In this study, we have investigated the binding of OA and OAm to Cs2NaInCl6 QDs through FTIR and NMR and their effects on the surface defect reduction and stability improvement for Cs2NaInCl6 QDs. We found that only OAm was bound to the QD surfaces while OA was not. The OAm has a great effect on photoluminescence quantum yield (PLQY) improvement by passivate the QD surface defects. The stability of the QDs was also investigated, and it was shown that OA played a significant role in the stability of the QDs. Our findings provide critical insights into the roles of the ligands for photophysical properties and stability of lead-free double perovskite QDs.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The optimization of the production process of metal mines has been traditionally driven only by economic benefits while ignoring resource efficiency. However, it has become increasingly aware of the importance of resource efficiency since mineral resource reserves continue to decrease while the demand continues to grow. To better utilize the mineral resources for sustainable development, this paper proposes a multi-objective optimization model of the production process of metal mines considering both economic benefits and resource efficiency. Specifically, the goals of the proposed model are to maximize the profit and resource utilization rate. Then, the fast and elitist Non-Dominated Sorting Genetic Algorithm (NSGA-II) is used to optimize the multi-objective optimization model. The proposed model has been applied to the optimization of the production process of a stage in the Huogeqi Copper Mine. The optimization results provide a set of Pareto-optimal solutions that can meet varying needs of decision makers. Moreover, compared with those of the current production indicators, the profit and resource utilization rate of some points in the optimization results can increase respectively by 2.99% and 2.64%. Additionally, the effects of the decision variables (geological cut-off grade, minimum industrial grade and loss ratio) on objective functions (profit and resource utilization rate) were discussed using variance analysis. The sensitivities of the Pareto-optimal solutions to the unit copper concentrate price were studied. The results show that the Pareto-optimal solutions at higher profits (with lower resource utilization rates) are more sensitive to the unit copper concentrate prices than those obtained in regions with lower profits.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

Ultraviolet (UV) radiation has both harmful and beneficial effects on human health. It can cause skin damage and cancer, but also provides the primary source of vitamin D. Additionally, UV radiation affects energy metabolism in mice with metabolic diseases and has protective effects on hypertension and cardiovascular diseases.Metabolic Syndrome is a collection of metabolic dysfunctions such as dyslipidemia, hypertension, hyperglycemia, abdominal/central obesity, and insulin resistance. Chronic UVR exposure suppressed obesity and type 2 diabetes in high-fat diet-fed mice, while vitamin D supplementation did not replicate these effects. On the other hand, topical application of nitric oxide (NO) donors replicated UV effects on mice, and NO scavengers prevented the positive impact of UV. UVR may prevent the development of obesity and metabolic syndrome through mechanisms that depend on UVR-induced NO, not vitamin D. Exposure to sunshine has a protective impact on blood pressure and cardiovascular disease. Although lower vitamin D concentration is linked to increased hypertension and the incidence of CVD, oral vitamin D supplementation does not decrease blood pressure or the risk of CVD, indicating that vitamin D may not mediate the beneficial effects of sun exposure. Instead, NO plays a crucial role as an endogenous vasodilator, produced by the vascular endothelium. Solar UVA may release nitrogen oxides from skin storage into the bloodstream, lowering blood pressure and cardiovascular mortality.In conclusion, UVR exposure could be a promising non-pharmacological intervention for metabolic syndrome, hypertension, and CVD prevention, and NO may play a crucial role in mediating these effects. Further research is needed to explore the precise mechanisms and identify the optimal doses and exposure times of UVR.

Biodiversity plays an important role in maintaining the ecological balance of the earth. The study of traditional knowledge related to biological resources is a hot issue in the field of international biodiversity conservation. Xishuangbanna is a key area of biodiversity and a cultural hotspot of international significance. According to the Technical Regulation for Classification, Investigation, and Inventory of Traditional Knowledge Relating to Biological Diversity issued by the Ministry of Ecology and Environment, we investigated and catalogued the traditional knowledge related to biodiversity of the Jino people who have lived in Xishuangbanna for generations, and collected 490 entries of traditional knowledge related to biodiversity of the Jino people. Drawing on the traditional knowledge diversity index calculation method proposed by Wang Guoping, the overall traditional knowledge α-diversity index of the Jino people is 0.63, indicating that the richness of the traditional knowledge of the Jinuo people is relatively high. The traditional culture related to biodiversity, the traditional knowledge related to agricultural genetic resources, and the traditional technology related to the sustainable utilization of biological resources are relatively rich and diverse. The diversity index is 0.86, 0.82 and 0.79 respectively. In addition, Xishuangbanna has invested a lot of energy in biodiversity protection, including the establishment of nature reserves, botanical gardens, zoos, ecological tea gardens and other species reserves, the promulgation of laws and policies related to biodiversity protection, and has achieved remarkable results in in-situ protection and ex-situ protection. On the basis of analyzing the progress and achievements of biodiversity conservation in Xishuangbanna, this study points out that Xishuangbanna faces challenges such as the loss of traditional knowledge, insufficient conservation efforts, and great changes in land use, and puts forward corresponding suggestions.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Newly build offshore wind farms (OWFs) render a collision risk between ships and installations. The paper proposed a real-time traffic monitoring method based on machine vision and deep learning technology to improve the efficiency and accuracy of the traffic monitoring system in the vicinity of offshore wind farms. Specifically, the method employs real automatic identification system (AIS) data to train a machine vision model, which is then used to identify passing ships in OWF waters. Furthermore, the system utilizes stereo vision techniques to track and locate the positions of passing ships. The method is tested in offshore water in China to validate its reliability. The results prove that the system sensitively detects the dynamic information of the passing ships, such as the distance between ships and OWFs, ship speed and course. Overall, this study provides a novel approach to enhancing the safety of OWFs, which is increasingly important as the number of such installations continues to grow. By employing advanced machine vision and deep learning techniques, the proposed monitoring system offers an effective means of improving the accuracy and efficiency of ship monitoring in challenging offshore environments.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

Soil erosion due to soil erosion is an important ecological impact factor. In order to further explore the impact and contribution of soil and water conservation measures on sand production and transport in the watershed, and also to provide a reference for soil erosion control, soil and water conservation and ecological environmental protection in the Yellow River Basin. In this paper, based on the measured data from the Henan Soil and Water Conservation Observatory in the Yellow River Basin, we select appropriate equations for quantifying soil erosion factor to calculate the rainfall erosion, topography, soil, vegetation and soil conservation measures in the basin, and then analyse the changes in soil erosion factor and the actual benefits of soil conservation measures in the basin. The results show that there is an increasing trend in the rainfall erosion force factor R in the Yellow River Basin; Soil erosion can be K value made the vertical loess > yellow clunamon soil, the overall change shows a decreasing trend, indicating that erosion control has produced results and that attention should be paid to erosion control in the lithosol region in the future; Since the slope lengths of the runoff plots are laid out consistently with the same LS values for both topographic factors, soil erosion is severely increased when the slope exceeds 20°. The C value of natural vegetation is small, while the C value of bare land is large. The authorities should continue to promote the return of farmland to forests and grasses and pay attention to the self-regulation and restoration of ecosystems; There is an overall decreasing trend in the P value of the soil and water conservation measures factor, the soil and water conservation measures have been effective in providing good protection.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

With increasing demand from unmanned driving and robotics, more attention has been paid to point cloud-based 3D object accurate detection technology. However, due to the sparseness and irregularity of the point cloud, the most critical problem is how to utilize the relevant features more efficiently. In this paper, we proposed a point-based object detection enhancement network to improve the detection accuracy in the 3D scenes understanding based on the distance features. Firstly, the distance features are extracted from the raw point sets and fused with the raw features about reflectivity of the point cloud to maximizing the use of information in point cloud. Secondly, we enhanced the distance features and raw features that we collectively refer to them as self-features of the key points in Set Abstraction (SA) layers with the self-attention mechanism, so that the foreground points can be better distinguished from the background points. Finally, we revised the group aggregation module in SA layers to enhance the feature aggregation effect of key points. We conducted experiments on the KITTI dataset and nuScenes dataset and the results show the enhancement method proposed in this paper has excellent performance.

Abstract: Image aesthetic assessment (IAA) with neural attention has made significant progress due to its effectiveness in object recognition. Current studies have shown that the features learned by convolutional neural networks (CNN) at different learning stages indicate meaningful information. The shallow feature contains the low-level information of images and the deep feature perceives the image semantics and themes. Inspired by this, we propose a visual enhancement network with feature fusion (FF-VEN). It consists of two sub-modules, the visual enhancement module (VE module) and the shallow and deep feature fusion module (SDFF module). The former uses an adaptive filter in the spatial domain to simulate human eyes according to the region of interest (ROI) extracted by neural feedback. The latter not only takes out the shallow feature and the deep feature by transverse connection, but also uses a feature fusion unit (FFU) to fuse the pooled features together with the aim of information contribution maximization. Experiments on standard AVA dataset and Photo.net dataset show the effectiveness of FF-VEN.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

The prolonged lockdown imposed to contain the COVID-19 pandemic prevented many people from direct contact with nature and greenspaces, raising alarms for a possible worsening of mental health. This study investigates the effectiveness of a simple and affordable remedy for improving psychological well-being, based on audio-visual stimuli brought by a short computer video showing forest environments, with an urban video as a control. Randomly selected participants were assigned the forest or urban video, to look at and listen early in the morning, and filled questionnaires. In particular, the State-Trait Anxiety Inventory (STAI) Form Y, collected in baseline condition and at the end of the study, and the Part II of the Sheehan Patient Rated Anxiety Scale (SPRAS), collected every day immediately before and after watching the video. The virtual exposure to forest environments showed effective to reduce perceived anxiety levels in in people forced by lockdown in limited spaces and environmental deprivation. Although significant, the effects were observed only in the short term, highlighting the limitation of the virtual experiences. The reported effects might also represent a benchmark to disentangle the determinants of health effects due to real forest experiences, for example, the inhalation of biogenic volatile organic compounds (BVOC).

The Loess Plateau is an important region for vegetation restoration in China, however, changes in soil organic carbon (SOC), soil nutrients, and stoichiometry after restoration in this vulnerable ecoregion are not well understood. Typical restoration types, including orchardland (OL), grassland (GL), shrubland (SL), and forestland (FL) were chosen to examine changes in the stocks and stoichiometry of SOC, soil total nitrogen (TN), and soil total phosphorus (TP) at different soil depths and recovery times. Results showed that SOC stocks first increased and then stabilized in OL, GL, and SL at 0–30 cm depth, while in FL, stocks gradually increased. Soil TN stocks first increased and then decreased in OL, SL, and FL with vegetation age at 0–30 cm depth, while soil TP stocks showed little variation between restoration types. In the later stages of restoration, the stocks of SOC and soil TN at 0–30 cm soil depth were still lower than those in natural grassland (NG) and natural forest (NF). The overall C:N, C:P, and N:P ratios increased with vegetation age. Additionally, the SOC, soil TN and soil TP stocks, and C:N, C:P, and N:P ratios decreased with soil depth. The FL had the highest rate of change in SOC and soil TN stocks, at 0-10 cm soil depth. These results indicate a complex response of SOC, soil TN, and soil TP stocks and stoichiometry to vegetation restoration, which could have important implications for understanding C, N, and P changes and nutrient limitations after vegetation restoration.

Nowadays, we use social networks such as Twitter, Facebook, WeChat and Weibo as means to communicate with each other and get to know others. Gradually social networks has become indispensable in our everyday life, and we cannot absolutely imagine what the daily life would be like without social networks. Through social networks, we can access friends' opinions and behaviors easily and are influenced by them in turn. Thus, an effective algorithm to find the top-K influential nodes (the problem of influence maximization) in the social network is critical for various downstream tasks such as viral marketing, anticipating natural hazards, reducing gang violence, public opinion supervision etc. Solving the problem of influence maximization in real-world propagation scenarios often involves estimating influence strength (influence probability between two nodes), which cannot directly observed. To estimate influence strength, conventional approaches propose various humanly-devised rules to extract features of user interactions, the effectiveness of which heavily depends on domain expert knowledge. Besides, they are often applicable for special scenarios or specific diffusion models. Consequently, they are difficult to be generalized into different scenarios, diffusion models and even domains. Inspired by the powerful ability of neural networks in the field of representation learning, we design a deep hierarchical network embedding model HGE to map nodes (with attributes) into latent space automatically. In general, HGE takes an attributed social network as the input for learning latent network representation of each node, incorporating hierarchical community structure, node attributes and general network structure into a unified deep generative framework. Then, with the leaned latent representation of each node, we propose a HGE-GA algorithm to predict influence strength and compute the top-K influential nodes through a greedy-based maximization algorithm. Extensive experiments on real-world attributed networks demonstrate the outstanding superiority of the proposed HGE model and HGE-GA algorithm compared with the state-of-the-art methods, verifying the effectiveness of the proposed model and algorithm.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (<1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

Our aim was to evaluate efficacy and safety of 30mL CaO alone or plus Asc in bowel preparation before colonoscopy. Two hundred and forty six patients were allocated randomly to ingest 2L PEG with 30mL CaO, 1L PEG with 30mL CaO plus 5g Asc, or 3L PEG. We used Boston Bowel Preparation Scale (BBPS) to evaluate bowel preparation efficacy. We also determined other outcomes such as procedure time, polyp or adenoma detection rate and adverse events (AEs). Of 282 patients recruited, 36 were excluded. Groups were matched for baseline characteristics except weight (P = 0.020) and body mass index (BMI) (P = 0.003). Patient’s satisfaction were higher in 2L PEG-CaO (P = 0.016) and 1L PEG-CaO-Asc groups (P = 0·017). Patients’ compliance was 67.5%, 71.4% and 80.5% in 3L PEG, 2L PEG-CaO and 1L PEG-CaO-Asc groups (P = 0.014). Adequate bowel preparation rate was 75%, 78.57% and 53.66% in 3L PEG, 2L PEG-CaO and 1L PEG-CaO-Asc groups (P = 0.021). There were no differences in terms of remaining outcomes. Despite an increase in patients’ satisfaction and compliance, 1L PEG-CaO-Asc significantly decreased adequate bowel preparation rate. However, 2L PEG-CaO improved the patients' satisfaction and compliance and increased adequate bowel preparation rate.

Five new perylenequinone derivatives, altertoxins VIII-XII (1-5), as well as one known compound cladosporol I (6), were isolated from the fermentation broth of Cladosporium sp. KFD33 from a blood cockle from Haikou Bay, China. Their structures were determined based on spectroscopic methods and ECD spectra analysis along with quantum ECD calculations. Compounds 1-6 exhibited quorum sensing inhibitory activities against Chromobacterium violaceum CV026 with MIC values of 30, 30, 20, 30, 20 and 30 μg/well, respectively.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

With the rise of the Internet of Things (IoT), maintaining data confidentiality and protecting user privacy have become increasingly challenging. End devices in IoT are often deployed in unattended environments and connected to open networks, which can make them vulnerable to physical tampering and other security attacks. Different authentication key agreement (AKA) schemes have been validated to date, but most schemes do not cover the necessary security features or are incompatible with resource-constrained end devices. Besides, their security proofs have been performed under the real-or-random model, which is not guaranteed to be secure in real applications. To reduce the weaknesses, we present an AKA protocol for end devices and servers. The proposal leverages the ECC-based key exchange mechanism and one-way hash function-based message authentication method to achieve mutual authentication, user anonymity, and forward security. Formal security proof of the proposed scheme is performed under the standard model with the elliptic curve encryption computational assumptions, and an automatic formal verification was performed with ProVerif. Further, the performance comparison verifies that our scheme reduces computation and communication costs while providing improved security features.

A solid structure, such as a road, building wall or envelop, used as a solar collector is considered an effective and new way to use renewable energy. This paper focused on the temperature characteristics of four structures exposed to sunshine: asphalt, red brick, composite cement and concrete road slab. Furthermore, the collected heat based on a hydraulic system was investigated experimentally. For the four structure slabs, their temperature differences are due to solar radiation absorption varied greatly by the material’s heat absorptance and color. Through the test, asphalt slab attained the highest temperature and had the weakest reflection among the structures. Compared with the others, the temperature of the asphalt slab was greater by 8.1%, 14.9% and 16.4% than the brick, composite cement and concrete, respectively. The reflection intensity growth ratio was defined and indicates the growth potential for absorbing radiation in the solid slab surface. From the experiments, it was concluded that a suitable selection of road materials can greatly improve the thermal absorption, conduction and penetration into the solid slab. The collected heat capability was approximately 250 W/m2 to 350 W/m2 in the natural summer condition. A black coating or a surface modification can collect more heat, reaching greater than 250 W/m2. The solar collecting heat efficiency with a surface configuration of the road slab can reach above 30% in the summer time.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

The excessive vibration caused by crowds walking across footbridges has attracted great public concerns in the past few decades. This paper presents, from considering the dynamic characteristics of the bipedal crowd model, a new stability limit criterion based on the bipedal excitation model. The stability limit can be used to estimate the upper boundary of crowd size. In addition, the dynamic stable performances of a structure, under a certain walking crowd size, can be predicted by the stability criterion. This proposed mechanism provides an alternative comprehension how crowd excite the excessive sway motion with a large-span structure.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

Genetic engineering and directed evolution are effective methods to address the low yield and poor industrialization level of microbial target products. The current research focus is on how to efficiently and rapidly screen beneficial mutants from constructed large-scale mutation libraries. Traditional screening methods such as plate screening and well plate screening are severely limited in their development and application due to their low efficiency and high costs. In the past decade, microfluidic technology has become an important high-throughput screening technology due to its fast speed, low cost, high automation, and high screening throughput, and it has developed rapidly. Droplet-based microfluidic high-throughput screening has been widely used in various fields such as strain/enzyme activity screening, pathogen detection, single-cell analysis, drug discovery, and chemical synthesis, and has been widely applied in industries such as materials, food, chemicals, textiles, and biomedicine. In particular, in the field of enzyme research, droplet-based microfluidic high-throughput screening has shown excellent performance in discovering enzymes with new functions, improved catalytic efficiency or stability, acid-base tolerance, etc. Currently, droplet-based microfluidic high-throughput screening technology has achieved high-throughput screening of enzymes such as glycosidase, lipase, peroxidase, protease, amylase, oxidase, and transaminase, as well as high-throughput detection of products such as riboflavin, coumarin, 3-dehydroquinate, lactic acid, and ethanol. This article reviews the application of droplet-based microfluidics in high-throughput screening, with a focus on high-throughput screening strategies based on UV, visible, and fluorescence spectroscopy, including labeled optical signal detection screening, as well as label-free electrochemical detection, mass spectrometry, Raman spectroscopy, nuclear magnetic resonance, etc. Furthermore, the research progress and development trends of droplet-based microfluidic technology in enzyme modification and strain screening are also introduced.

In this paper, we investigate the new degenerate Daehee polynomials and numbers which are called the degenerate Daehee polynomials of the second kind, and derive some new and interesting identities and properties of those polynomials.