Broadband reverse saturable absorption is systematically investigated via Z-scan, transient absorption spectrum (TAS). The excited state absorption and negative refraction of Orange IV are observed in the Z-scan experiment at 532 nm. Meanwhile, two-photon induced excited-state absorption and pure two-photon absorption are observed at 600 nm and 700 nm with the pulse width of 190 fs, respectively. An ultrafast broadband absorption in visible wavelength region is observed via TAS. The different nonlinear absorption mechanism at multiple wavelengths is discussed and interpreted from the results of TAS. In addition, the ultrafast dynamics of negative refraction in the excited state of Orange IV is investigated via degenerate phase object pump probe, from which the weak long-lived excited state is extracted. All studies indicate that Orange IV has the potential to be further optimized into a superior broadband reverse saturable absorption material and also has certain reference significance for the study of optical nonlinearity in organic molecules containing azobenzene groups.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

Synthesis of ZSM-5 zeolite from OSDA-free systems has been a very interesting alternative method because it can avoid the usage of organic templates and consequent calcination step. However, in opened reports, organic substance such as alcohol is more or less involved. In the present work, a calcined commercial ZSM-5 zeolite was used as a seed, sodium aluminate as an aluminum source, silica sol as a silicon source, which ensures that there is no any organics (template) in the synthesis system, and polycrystalline ZSM-5 aggregates consisting of rod-like nanocrystals are successfully prepared in a completely OSDA-free system. The effects of seed (chemical component, dosage) and crystallization conditions on the synthesis of ZSM-5 were systematically investigated. The results show that highly crystallinity ZSM-5 aggregate consisting of primary nano-sized crystals with a size of less than 100 nm can be yielded from a gel precursor with 5.6 wt.% seed after hydrothermal treatment for 48 h. The results also shows that the chemical composition of the seeds had little effect on the topological structure and pore structure of the synthesized samples, but the seed with a low Si/Al ratio is more conducive to the rapid crystallization of zeolite and to the improvement of the acid, especially the strong acid centers of the catalyst.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Innovation is an essential key factor in the technology development history. Past research on innovation focused more on the innovation behavior of technology, but seldom described knowledge assets which also influence innovation behavior greatly. The effect of knowledge assets attribute and result on disruptive innovation is therefore regarded as the research topic in this study, where disruptive innovation is divided into outbound and inbound to combine combination-embeddednessandmajor business specificityof knowledge assets as the research model. Manufacturing enterprises in China are proceeded the questionnaire survey, and 173 valid copies are collected. The empirical analysis shows that combination-embeddedness of knowledge assets presents significantly positive effects on major business specificity and outbound innovationof an enterprise but reveals remarkably negative effects on inbound innovation. Enterprises are suggested to constantly accumulate knowledge assets with low major business specificity before disruptive innovation in order to reduce ineffective inbound innovation.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.

Abstract：This paper uses the balanced panel data from 29 provinces (autonomous regions and municipalities) in China for a total of 17 years from 2000 to 2016 as a research sample, and establishes an empirical model to examine the impact of environmental regulations and technological innovation on the quality of economic growth. Then this paper test technological innovation as a threshold variable, in which play a regulatory role. Taking the provincial balanced panel data as a research sample, a fixed effect model, a system GMM model, and a panel threshold model were established for empirical testing and the robustness test. Based on the empirical results, this article draws the following conclusions: from a national perspective, environmental regulations and technological innovation can significantly promote the quality of economic growth; from a regional perspective, there are regional differences in impact effects. Under the constraints of environmental regulations, the promotion effect of technological innovation on the quality of economic growth will be reduced; the impact of environmental regulation on the quality of economic growth will have a "threshold effect", and environmental regulation can significantly promote the quality of economic growth only after crossing the threshold and the threshold of technological innovation.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

COX II containing a dual core CuA active site is one of the three core subunits of mitochondrial Cco, which plays a significant role in the physiological process. In this report, the full-length cDNA of COXⅡ gene was cloned from Sitophilus zeamais, which had an ORF of 684 bp encoding 227 amino acids residues. The predicted COXⅡ protein had a molecular mass of 26.2 kDa with pI value of 6.37, and multiple sequence alignment and phylogenetic analysis indicated that Sitophilus zeamais COXⅡ had high sequence identity 78.51% with the COXⅡ of other insect species, especially similarity to sitophilus oryzae. This gene was subcloned into the prokaryotic expression vector pET-32a, and induced by IPTG in E.coli Transetta (DE3) expression system. Finally the COXⅡ with 6-His tag was purified using affinity chromatography with Ni²⁺-NTA agarose. WB showed the recombinant COXⅡ was about 44 kD, and the concentration of fusion protein was 50μg/mL. UV-spectrophotometer and infrared spectrometer analysis showed that recombinant COXⅡ could catalyze the oxidation of substrate Cytc, and influenced by AITC. It was found that AITC could form a hydrophobic region with COXⅡ protein via molecular docking, besides, a sulfur atom of AITC structure could form a length of 2.9 Å hydrogen bond with Leu-31. These results will provide valuable information for elucidating the role of COXⅡ in Sitophilus zeamais responses to AITC, meanwhile, it will helpful to carry out a point mutation in AITC binding sites for the future research.

The research fills the policy research gap for the women entrepreneurship and sustainability performance for examining key successful factors. Previous women entrepreneurship research fails to offer policy recommendations. The research purpose is to investigate these factors affect women entrepreneurship capabilities and sustainability performance by using SEM analysis and making policy recommendation. This research employs online and mail survey and obtains 175 women entrepreneur sample. The study finds that family support and motivation have positive effect on women entrepreneurship capabilities and sustainability performance. Barriers have no effect on performance. Hopefully, the research can provide the guidance to contribute to women’s entrepreneurship opportunities for achieving SDGs. Policy recommendation and managerial implication are discussed in the article.

Antibiotic resistance (ABR) is concerning issue due to its direct and indirect repercusions on public health, since decreased therapeutic effect of certain antibiotic to treatment complications that can cause death. There are several mechanism as to how ABR can be transferred from one microoorganisms to another, and many of them are dependant many environmental factors. The food supply chain is a environment in which ABR gene transfer can occur is multiple pathways, which generate concerns regarding food safety. Here, we summarize relevant mechanisms which are implied in ABR in food supply chain but also we are addressing routes of transmission and prevalence of ABR, implications on public health, and the application of new alternatives to antibiotics such as antimicrobial peptides, mainly bacteriocins, in order to countermeasure ABR.

Economic development and advancements in information technology contributed to the shift on accounting objective from commission responsibility view to decision-making useful view. The decision-making useful view claims that the accounting measurement methods should be changed to improve the usefulness of accounting information, to enable information users to make correct decisions. In addition, the development of financial instruments leads to the birth of fair value accounting. In recent years, fair value has been one of the most important measurement methods in the International Accounting Standard and US Generally Accepted Accounting Principles. However, China has been quite cautious when it comes to applying fair value full time, especially after the global financial crisis happened in 2008, wherein fair value accounting was exposed to strong suspicion. Hence, studying the value relevance of fair value is of great significance to exploring the accounting profession and reforming accounting standards. This paper attempts to investigate the value-relevance of fair value based on the data of listed financial companies and manufacturing companies in China. The results indicate that the fair value information in the financial industry has a strong explanatory influence to corporate share price. In contrast, the fair value information shows limited relevance in the manufacturing industry. Finally, consulting with the results of normative analysis and empirical study, this paper suggests several rational advices for the application of fair value in China.

Trichothecene mycotoxin T-2 toxin is an important environmental pollutant and poses a global threat to human and animal health. T-2 toxin could induce nephrotoxicity, however, the precise molecular mechanism remains unclear. In this study, the mice were intraperitoneally administrated with a single dose of 2 mg/kg T-2 toxin. The kidney function and ultrastructural observation were also assessed and found T-2 toxin exposure could cause kidney damage. Transmission electron microscopy showed a significant swelling and vacuolization of the mitochondria of renal cell. A total of 1122, 58, and 391 differential expression genes (DEGs) that were predominantly expressed in kidney tissues at 1 d, 3 d, and 7 d after T-2 toxin exposure, respectively. Early transcriptomic changes at 1 d after exposure were down-regulation of DEGs involved in the cell cycle, p53 signaling pathway, and cellular senescence, while up-regulation of DEGs referred to the ribosome pathway. The temporal variations in gene expression pattern in T-2 toxin exposure in mice kidney were presented and cellular metabolism was disturbed at the exposure recovery period with 7 d. In conclusion, this study, for the first time, provided a comprehensive comparative transcriptomic analysis of gene regulation in T-2 toxin exposure-induced nephrotoxicity at different temporal periods and explored the nephrotoxicity mechanism of T-2 toxin at the mRNA level.

Atopic dermatitis (AD) is a chronic inflammatory skin disease, which can cause skin barrier function damaged. Although co-incubation with docosahexaenoic acid (DHA) exerts a positive effect in deficient skin model, there is no study to investigate the effects of topical treatment with DHA in inflammatory reconstructed human epidermis (RHE) model. The effects of DHA on monolayer normal human epidermal keratinocyte (NHEK) cells were evaluated via CCK-8, qPCR and ELISA. The skin related barrier function was assessed by hematoxylin-eosin (HE) staining, western blot (WB), Immunohistofluorescence (IF) and ELISA in normal and inflammatory RHE models. DHA upregulated filaggrin and loricrin expression at mRNA levels in addition to suppress overexpression of TNF-α，IL-1α and IL-6 stimulated by poly I:C plus LPS (stimulation cocktail) in cultured NHEK cells. After topical treatment with DHA, cocktail induced inflammatory characteristics of skin diseases including barrier morphological, differentiation proteins and TSLP secretion, which were alleviated in RHE models. Supplementation with DHA can improved related barrier function and have anti-inflammation effects in monolayer keratinocytes and RHE models, which indicated that DHA may have a potential value for the treatment of inflammation-associate skin diseases.

Technology can be seen everywhere and has been integrated into our lives.We are always using technology and enjoying the convenience brought by technology. However, physical retailers and e-commerce companies are also gradually adopting advanced technologies. Technology improves the purchasing environment and purchasing experience. Virtual reality and augmented reality have been hotly discussed in recent years. Technology, although virtual reality and augmented reality technology have not yet matured, it can be said that they will in the future It has great development potential. Virtual reality and augmented reality are also beginning to sprout in the retail industry. However, research on the acceptance of the use of virtual reality and augmented reality in the apparel shopping process is still lacking because This study explores how usefulness, ease of use, hedonicity, customer experience, customer engagement and satisfaction. To influence customer loyalty, this study adopted questionnaire survey and convenience sampling methods, and collected a total of 308 valid questionnaires. The analysis method used confirmatory factor analysis and structural equation model to verify the research hypothesis relationship. The results of this study found. Hedonic has a significant impact on customer loyalty, while usefulness, ease of use, customer experience, customer engagement and satisfaction Satisfaction does not have a significant impact on customer loyalty. This study explains the academic contribution of the research results. The practical implications in marketing are put forward, and specific suggestions and directions for future research are given.

Epitranscriptomic RNA modifications play a crucial role in the posttranscriptional regulation of gene expression. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic RNA and plays a pivotal role in RNA fate. RNA m6A modification is regulated by a group of cellular proteins, methyltransferases (writers) and demethylases (erasers), which add and remove the methyl group from adenosine, respectively. m6A modification is recognized by a group of cellular RNA-binding proteins (readers) that specifically bind to m6A-modified RNA, mediating effects on RNA stability, splicing, transport, and translation. The functional significance of m6A modification of viral and cellular RNA is an active area of virology research. In this review, we summarize and analyze current literature on m6A modification of HIV-1 RNA, the multifaceted functions of m6A in regulating HIV-1 replication, and the role of viral RNA m6A modification in evading the innate immune responses to infection. Furthermore, we briefly discuss future directions and therapeutic implications of mechanistic studies of HIV-1 epitranscriptomic modifications.

Threshing device is the core component of grain combine harvester, and its working performance determines the working quality and production efficiency of the harvester to a great extent. The straw guide plate plays an important role in the threshing device to dredge the threshing matter and control the threshing time of the combine harvester matter in the threshing chamber. In the past, the guiding structure of threshing device could not optimize the working performance of the machine by adjusting the spiral angle, that is, most cereal combine harvester may not be fed smoothly or even clogged when operating under different crop types, yield differences and operating environments, a kind of threshing device with adjustable guide straw board was studied. In this study, the movement model of the straw on the straw guide plate was analyzed, and it was found that the spiral angle “α”of the straw guide was 0<α<58°.Three-factor and three-level response surface method was used to carry out field experiment on drum speed, working speed and guide grass plate spiral angle, and the experimental data were analyzed by quadratic polynomial regression.The results show that the drum speed, working speed and the spiral angle of the guide grass plate have significant effects on the loss rate (PLR) , impurity content (PIR) and breakage rate (PBR) , the drum speed and working speed have an interactive effect on the impurity ratio (PIR) , and the working speed and the helical angle of the guide grass plate have an interactive effect on the loss ratio (PLR) and breakage ratio (PBR) , there is an interaction between the rotary speed of the roller and the helical angle of the guide grass plate on the crushing rate (PBR) .Further optimization analysis showed that the predicted value was PLR = 1.18% , PIR = 0.72% , PBR = 0.53% , the experimental verification value was PLR = 1.26% , PIR = 0.73% , PBR = 0.61% . The absolute error between the experimental value and the predicted value was very small, however, the optimized field test verified value decreased by 8.31% , 50.04% and 60.30% respectively, which indicated that the optimized harvester had better operation quality, in particular, PIR, PBR and other two indicators have a greater increase in the effect.

Rhododendron chrysanthum Pall., live in Changbai Mountain being exposed to chilling temperature, high light intensities and water scarcity condition. To adapt to the harsh environment, the cold resistance mechanisms of R. chrysanthum have been successfully evolved in the long-term adaptive process. In our present work, the methods of proteomics combined with physiological and biochemical analyses were used to investigate the effects of cold stress on the photosynthesis and antioxidant system of Rhododendron chrysanthum Pall. and the molecular mechanisms involved in cold resistance of plants. A total of 153 photosynthesis related proteins were identified in present work, of which 7 proteins including Rubisco large subunit (rbcL) were up-regulated in experiment group (EG) compared with control group (CG). Simultaneously, four chlorophyll fluorescence parameters were measured in present study. The results showed that the maximum photochemical efficiency of photosystem II (Fv/Fm), actual quantum yield of PSII (Y(II)) and photochemical quenching (qP) were significantly higher in EG, whereas the non-photochemical quenching (NPQ) was notably decreased. Cold stress could lead to a significant reduction in electron transport rate (ETR) accompanied with an increase in excitation pressure (1-qP). The abundance of PetE which involved in the plants photosynthetic electron transfer was also significantly influenced by cold stress. Moreover, the up-regulated expressions and higher levels of enzymatic activities of Glutathione peroxidase (GPX) and Ascorbate peroxidases (APXs) were detected in EG. All these changes which can help plants to survive in low temperature are considered as the crucial parts of cold tolerance mechanisms. These results revealed that photosynthesis and redox adjustment play significant roles in the defense of cold-induced damage.

To understand lung damage caused by COVID-19, we deduced two-phase lung damage mechanisms. After the lungs are infected with SARS-CoV-2 virus, the affected lung tissue swells and surface properties of pulmonary capillaries change, resulting in an increased flow resistance of affected capillaries. If a sufficient number of capillaries are affected by the infection, the swelling and increased cell wall adhesion collectively raise pulmonary vascular resistance. The increased vascular resistance further increases the dwell times of WBCs in affected capillaries and nearly capillaries. When pulmonary pressure is sufficiently higher, WBCs are forced to squeeze into interstitial spaces or alveolar spaces when local pressures are higher than what the capillaries can withstand. When more and more WBCs are dynamically retained, the flow resistance of more capillaries rises, pulmonary vascular resistance rises, and pulmonary pressure rises. The rise in the pulmonary pressure in turn results in elevated capillary pressures. When capillary pressures around the alveoli are sufficiently high, they cause interstitial pressures to change from normally negative values to positive values. The positive pressures cause fluid leakage to the alveolar space and thus degrade lung function. Tissue swelling, and occupation of WBCs in interstitial spaces and alveolar spaces further reduce compressible volume, and thus cause further rise in the pulmonary vascular resistance and pulmonary pressure. When the pulmonary pressure has reached a critical point as in the second phase, the blood breaks capillary walls and squeezes through interstitial spaces to reach alveolar spaces, resulting in irreversible lung damages. The available free volume in the thorax cage, organ usable capacities, temperature and humid are expected to have great impacts on degree of lung damages. The free volume in the thorax cage, lung usable surplus capacity, and other organ usable capacities determine the arrival time of last-phase irreversible damage. The mechanisms imply that the top priority for protecting lungs is maintaining pulmonary micro-circulation and preserving organ functions in the entire disease course while controlling viral reproduction should be stressed in the earliest time possible. The mechanisms also explain leukecytes are recruited and migrated into inflamed tissues by increasing their dwell times caused by increased local flow resistance.

Due to the long-term deformation settlement of foundations, issues such as damage and functional failure of buildings and structures have long been of concern in the engineering field. The creep of soil is one of the primary causes leading to long-term deformation of foundations. In this paper, the consolidation deformation, creep characteristics, and creep model of reconstituted saturated silty clay were studied by isotropic compression test and triaxial shear creep test. The results show that for the isotropic compression test, although the applied load adopts different stages of loading, as long as the final applied confining pressure is the same, the number of stages applied by the confining pressure has little effect on the final isotropic consolidation deformation of the sample and the triaxial undrained shear strength after creep. However, for the triaxial shear creep test, it is found that under the same final deviatoric stress, the final deviatoric strain of the sample is closely related to the number of loading stages of deviatoric stress. It shows that the more loading stages of the sample loaded with the same deviatoric stress, the smaller the final deviatoric strain, and the triaxial undrained shear strength of the sample after creep will increase. In addition, it is reasonable to determine the pore pressure dissipation of the sample to 95%((u0-u0)/u0=95%) as the main consolidation end time (tEOP) of the sample. The isotropic consolidation creep curves and the triaxial shear creep curves show certain nonlinearity. Then the logarithmic model and the hyperbolic model were used to fit the creep curves of the samples. It is found that the hyperbolic model has a better fitting effect than the logarithmic model, but for the triaxial shear creep test, the creep parameters of the sample change greatly. Therefore, studying the creep characteristics of soil under different pre-loading steps is of significant engineering importance for evaluating the long-term deformation of underground structures.

Background: The COVID-19 outbreak has accelerated the huge difference between medical care and disease prevention in Chinese medical institutions. This study aimed to investigated the relationship between the symbiotic units, environments, models, and effects of the integration of medical and disease prevention. Methods: This cross-sectional study involved 762 employees of public hospitals in 11 cities in Zhejiang Province by random stratified sampling. We analyzed the influence paths of elements in the mechanism of integration of medical and disease prevention and the mediating effect of symbiotic models among symbiotic units, symbiotic environments, and effects for on this integration. Results: The path coefficient of symbiotic unit on the symbiosis model was 0.46 (p&lt;.001), the path coefficient of symbiotic environment on symbiosis model was 0.52 (p&lt;.001). The path coefficient of the symbiotic unit and environment was 0.91 (p&lt;.001). The symbiotic models exhibited a partial mediation effect between symbiotic units and the effect of this integration. Sobel test = 3.27, β = 0.152, and the mediating effect accounted for 34.6%. Conclusions: It is suggested that Health policy-makers and public hospital managers should provide sufficient symbiotic units, establish collaborative symbiotic models, and improve the effects of integration of medical and disease prevention in public hospitals.

In this study, we investigated the effects of three surface treatment techniques on 316L stainless steel, low-temperature immersion corrosion, shot peening followed by immersion corrosion, and electrochemical corrosion. Surface alterations were analyzed using scanning electron microscopy, Raman spectroscopy, and α-step thin-film thickness profiling. Human osteoblast adhesion was evaluated using Liu’s stain and metallographic optical microscopy. The results revealed weak cell adhesion after low-temperature immersion and shot peening followed by immersion corrosion. By contrast, electrochemical corrosion, particularly with a high current density and low corrosive solution concentration, resulted in a uniformly corroded surface, thus promoting dense cell adhesion. All three techniques resulted in porous oxide layers. Overall, our experimental findings highlighted shot peening (1 kg/cm2 for 20 s) and electrochemical corrosion (0.5 M HCl) as effective processes. Electrochemical corrosion produced uniformly dense corrosion pits, whereas shot peening produced semicircular grooves with small corrosion pits, both favorable for cell adhesion. Electrochemical corrosion also yielded excellent cell adhesion, emphasizing its suitability for biomedical activity. We developed a process for creating a porous surface layer and thereby enhancing the cell adhesion to 316L stainless steel for potential biomedical implant applications.

After reviewing cancer theories, cancer treatment development histories, randomized clinical trial's performance, cancer treatment strategy, trial follow-up times, and conducting numerous simulations using existing data, the authors found: (1) medical treatments come with three to four lethal factors: treatment side-effects, emotional distress and chronic dress, lack of exercises or physical inactivity, and excessive nutrition in some cases; (2) clinical trial exaggerates the benefits of fast-acting treatments and underestimates the slow-delivering adverse side effects as a result of statistical averaging, interfering effects of personal lifestyle factors, and insufficient follow-up times; (3) the benefits of medical treatments are limited by chain comparison, where surgery sets up a negative standard relative to the best way for resolving cancer; (4) the strategy of destroying the tumor is unworkable; (5) medical treatments can turn natural cancer growth curve into approximately doubly exponential curve; (6) multiple factor non-medical measures are much more powerful than medical treatments in controlling cancer growth and metastasis rates; and (7) cancer early diagnosis and over treatments are bad strategies that have great adverse impacts on cancer patients. Based on huge increases in cancer growth rate constants, substantial of loss of organ functional capacity, and severe systemic aging-like cellular damages, the authors concluded that medical treatments promote cancer growth and metastasis rates and shorten patient lives in most cases, and the claimed benefits are caused by triple biases of clinical trials. The authors believe that the better strategy for ending the global cancer epidemic is abandoning clinical trails as the research model, changing caner treatment strategy from killing cancer cells to slowing down cancer growth rates by using multiple factors optimization approach in personalized medicine.

This paper studies the contemporaneous relationship between S&P 500 index returns and log-increments of the market volatility index (VIX) via a nonparametric copula method. Specifically, we propose a conditional dependence index to investigate how the dependence between the two series varies across different segments of the market return distribution. We find that: (a) the two series exhibit strong, negative, extreme tail dependence; (b) the negative dependence is stronger in extreme bearish markets than in extreme bullish markets; (c) the dependence gradually weakens as the market return moves toward the center of its distribution, or in quiet markets. The unique dependence structure supports the VIX as a barometer of markets' mood in general. Moreover, applying the proposed method to the S&P 500 returns and the implied variance (VIX²), we find that the nonparametric leverage effect is much stronger than the nonparametric volatility feedback effect, although, in general, both effects are weaker than the dependence relation between the market returns and the log-increments of the VIX.

We aimed to evaluate the protective effects of acetyl-xylogalactan on the activity of RAW264.7 macrophages against heat stress. To this end, we assessed cell survival, phagocytic activity, in-tracellular Ca2+ level, mitochondria potential exchange, apoptotic assay findings, galactosidase activity and the RNA-seq by NGS and real-time polymerase chain reaction (PCR) expression. In our evaluation of macrophage morphology at 37°C and 41°C, the macrophages showed an oval shape at 41°C , unlike the spindle shape at 37°C. Therefore, 41°C was chosen as the heat stress condition. Subsequently, we designed an experiment to evaluate changes in the RAW264.7 macrophages after acetyl-xylogalactan treatment under heat stress. The survival of RAW264.7 macrophages treated with acetyl-xylogalactan was higher than that of controls that were not treated with acetyl-xylogalactan. Moreover, on the basis of the results of the annexin-V detection assay, the apoptotic activity of macrophages appeared to have reduced after treatment with ac-etyl-xylogalactan. Moreover, treatment with acetyl-xylogalactan resulted in a stronger recovery trend in the intracellular Ca2+ and mitochondrial membrane potential after heat stress. RNA sequencing and real-time polymerase chain reaction (PCR) illustrated that Sarcodia suieae acetyl-xylogalactan could upregulate the expression of the anti-apoptosis Cflar gene and down-regulate the expression of the apoptosis factors Ddit3, and Hyou1 to protect macrophages under heat stress.

The fatigue delamination damage is one of the most important fatigue failure modes of laminated composite structures. However, the developments of the theoretical framework, mathematical/physical model and numerical simulation of fatigue delamination are still challenging issues, and there is a lack of systematic classification. This article reviews the experimental phenomena of the onset and propagation stage of delamination under fatigue loading, and summarizes the commonly used phenomenological models for laminated composite structures. The research methods, general modeling formulas and development prospects of the phenomenological models are presented in detail. In the light of the analysis of finite element model (FEM) for the laminated composite structures, a number of simulation methods of fatigue delamination crack propagation damage model are carefully classified. Furthermore, within the theoretical framework of strength theory model (SM), fracture mechanics model (FM), damage mechanics model (DM) and hybrid model (HM), the complete procedure, application, capability assessment, advantages and limitations of the models are also discussed in detail. Finally, several valuable suggestions are given for the research interests, and challenging technical problems that need to be overcome on the fatigue delamination prediction of laminated composite structures in the future.

Under the dual background of underemployment and health inequality, this paper empirically analyzes the impact of education level on underemployed workers’ health based on CLDS2016 data. The results show that underemployment is significantly related to the decline of self-rated health, increased depression tendency, and morbidity in a certain period. The results indicate that underemployment can significantly reduce the health level of workers in the low education level group and the high education level group. However, it has no significant impact on workers’ health in the middle education level group; even if we change the measurement method of indicators and consider endogeneity, the research conclusion is still robust. Moreover, this kind of health inequality mainly comes from the difference in economic effect and leisure effect of underemployment to workers with different educational levels. This paper provides empirical support for increasing the labor protection mechanism of underemployed people and reducing the health inequality caused by educational level differences.

For the last two decades, an increasing demand for low-cost adsorbents for drinking water treatment has been challenged in the rural areas of developing countries that have problems with arsenic (As) contamination. In this work, spent bleaching earth (SBE), a residual material that is formed during the process of refining vegetable oil, has been utilized to prepare the new magnetic adsorbent Fe-SBE/C by modifying its surface area through calcination and co-precipitation with iron. The experimental results demonstrate that Fe-SBE/C exhibits a substantial adsorption capacity towards both arsenite (As(III)) and arsenate (As(V)). Optimal pH conditions were found to be pH 10 for As(III) and pH 3 for As(V), resulting in adsorption percentages of 76.7% and 94.1%, respectively. Other experimental parameters such as calcination conditions, adsorbent dosage, iron-loading ratio, and the presence of co-existing ions were thoroughly investigated. The kinetic study revealed that the adsorption processes follow the Elovich and intraparticle diffusion models, suggesting a combined adsorption mechanism of boundary layer control and chemisorption. Furthermore, the isotherm followed the Langmuir model with a maximum adsorption capacity of 202.61 μg g-1 for As(III) and 187.61 μg g-1 for As(V). Through thermodynamic analysis and reinforcement by activation energy data, this research validates that the observed adsorption process is indicative through chemisorption. The regeneration study revealed the potential for multiple cycles of arsenic removal, highlighting the practical applicability of Fe-SBE/C in environmental contexts. In conclusion, the findings of this study underscore the efficacy of Fe-SBE/C in arsenic removal and present it as a promising and environmentally friendly solution for mitigating arsenic pollution.

Many types of banana (Musa spp.)—one of the most economically important horticultural crops—exist, and their ploidy (diploid, triploid, and tetraploid, usually) and genome types (containing A or/and B genome in most cases) differ. At present, observation and genome type detection are commonly used to identify banana germplasm resources. However, the former is tedious, while the latter cannot distinguish categories below genome types. It is therefore urgent that a simple and effective method for identifying banana germplasm resources is established. We sequenced and analyzed the ribosomal DNA internal transcribed spacer (ITS) sequences of 62 banana germplasm and found that the sequencing peaks, especially the 20 bp region near the 420 bp position (referred to as the “420 bp region”), exhibited relatively recognizable and repeatable polymorphism characteristics. Using the “420 bp region” as a marker, we were able to quickly distinguish bananas belonging to different genome type groups (comprising the AA, AB, AAA, ABB, AAB, ABBB, AAAB, and AAAA groups) or different subgroups in the same genome type group (for example, the Cavendish, Gros Michel, Red, Lakatan, and Ibota Bota subgroups in the AAA group; and the Pisang Raja, Plantain, Pome and Silk subgroups in the AAB group). Moreover, it appeared that Sanger sequencing of ITS could be used for identifying banana hybrid offspring. These results demonstrated that the banana ITS region contains rich genetic information that is useful for genotyping. In general, ITS sequencing simplifies the classification of banana germplasm resources and has potential application in several areas of Musa improvement.

Leucokinins (LKs) constitute a neuropeptide family first discovered in a cockroach and later identified in numerous insects and several other invertebrates. The LK receptors are only distantly related to other known receptors. Among insects, there are many examples of species where genes encoding LKs and their receptors are absent. Furthermore, genomics has revealed that LK signaling is lacking in several of the invertebrate phyla and in vertebrates. In insects, the number and complexity of LK expressing neurons vary, from the simple pattern in the larva of Drosophila where the entire CNS has 20 neurons of three main types, to cockroaches with about 250 of many different types. Common to all studied insects is the presence or 1-3 pairs of LK-expressing neurosecretory cells in each abdominal neuromere of the ventral nerve cord, that, at least in some insects, regulate secretion in Malpighian tubules. This review summarizes the diverse functional roles of LK signaling in insects, as well as other arthropods and mollusks. These functions include regulation of ion and water homeostasis, feeding, sleep-metabolism interactions, state-dependent memory formation, as well as modulation of gustatory sensitivity and nociception. Other functions are implied by the neuronal distribution of LK, but remain to be investigated.

Cancer/testis (CT) antigens exhibit selective expression predominantly in immunoprivileged tissues in non-pathological contexts but are aberrantly expressed in diverse cancers. Because of their expression pattern, they have historically been attractive targets for immunotherapies. The investigation of mechanistic roles of CT antigens in promoting oncogenesis has historically been a prominent research question, and a growing number of studies implicate CT antigens in promoting almost all the hallmarks of cancer. This suggests that CT antigens may act as cancer drivers. CT antigens are expressed in head and neck squamous cell carcinomas, although their role in the pathogenesis, prognostication, and treatment for this family of cancers remains poorly studied. Given that CT antigens hold intriguing potential as therapeutic targets and as biomarkers for prognosis and therapeutic response and that they can provide novel insights into oncogenic mechanisms, their further study in the context of head and squamous cell carcinoma is warranted.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a positive sense single stranded RNA genome containing virus which has infected millions of people all over the world particularly China. The virus has been mutating rapidly enough resulting in the emergence of new variants and sub-variants which have reportedly been spread from Wuhan city of China, the epicenter of the virus, to the rest of China and all over the world. The occurrence of mutations in the viral genome especially in the viral spike protein region has resulted in the evolution of multiple variants and sub-variants which gives the virus benefit of host immune evasion and render the modern-day vaccines and therapeutics ineffective. Therefore, there is a continuous need to study the genetic characteristics and evolutionary dynamics of the SARS-CoV-2 variants. Hence, in this study, a total of 833 complete genomes of SARS-CoV-2 variants (including the wild-type or reference sequence) from Taiyuan and Wuhan cities of China were genetically characterized and studies their phylogenetic and evolutionary dynamics using phylogenetics, genetic similarity, and phylogenetic network analysis. Our results show a lot of useful information regarding the evolutionary dynamics of the viral variants, their genetic similarities/dissimilarities, and their phylogenetic relationships. It has been reported in this study that the SARS-CoV-2 variants have nine recombinant events which suggest very important information regarding the viral evolution. In addition, the phylogenetic network analysis shows the number of mutations resulting in emergence and clustering of the viral variants of both cities which reveal significant information regarding the phylodynamics of the virus. This study, to the best of our knowledge, is the first ever genetic comparative study of Taiyuan and Wuhan cities. This study will help better understand the virus, cope with the emergence, and spread of new variants at local level as well as at international level and inform the public health authorities to make better informed decisions in designing new viral vaccines and therapeutics.

In recent years, video anomaly detection technology , which can intelligently analyze massive video and quickly find abnormal phenomena, has attracted extensive attention with the wide application of video surveillance technology . To address the complex and diverse problem of abnormal human behavior detection in surveillance videos, a surveillance video abnormal behavior detection and localization supervised method based on the deep network model and the traditional method is proposed. Specifically, we combined AGMM and YOLACT methods to obtain more accurate foreground information by fusing the foreground maps extracted by each technique. To further improve the accuracy , we use the PWC-Net technique to extract features of the foreground images and input them into an anomaly classification model for classification. The proposed method effectively detects and locates the abnormal behavior in the monitoring scene. In addition to the aforementioned methods, this paper also employs YOLOV5 and DeepSORT networks for object detection and tracking in the video, which allows us to track the detected objects for better understanding of the scene in the video. Experiments on the UCSD benchmark dataset and the comparison with state-of-the-art schemes prove the advantages of our method.

The cuttlebone-like structure is a complex porous bionic structure with asymmetric sinusoidal S-shaped wall structure connecting laminar septa, and studies have shown that the cuttlebone-like structure has light weight, high strength and excellent energy absorption capability. It has become an important research to investigate the mechanical mechanism of cuttlebone-like structure and to design a bionic structure beyond nature structure based on it. In order to investigate the mechanical properties of the static compression and shearing processes of the cuttlebone-like structure, this paper establishes theoretical formulas and analyzes the influence of dimensionless parameters such as height-to-thickness ratio $\lambda$, period-to-thickness ratio $\xi$ and amplitude to period ratio $\eta$ on the compression and shearing processes with the help of ABAQUS finite element software.The parameter sensitivity analysis method was used to compare the important influence degree of each dimensionless parameter on the mechanical properties of the structure and to determine the relative optimal parameters of the structural mechanical properties under compression and shearing. Based on the relatively optimal parameter of the cuttlebone-like structure, the cross-sectional geometry of the structure is improved to build a new cuttlebone-like structure.The experimental results showed that the new cuttlebone-like structure with revised cross-section improved the mechanical properties of the cuttlebone-like structure.The study results are of theoretical guidance to enhance the mechanical properties and geometric design of cuttlebone-like structures.

The vegetation types on the Qinghai-Tibet Plateau are complex and diverse, and the ecological environment is fragile and sensitive. It is very important to study the dynamic changes in vegetation and the main factors related to these changes to grasp the present state of the regional ecosystem, maintain the balance of the ecosystem and promote the sustainable development of the ecosystem. Therefore, this paper is based on SPOT/VEG NDVI (normalized difference vegetation index) data, land use data, topographic data and meteorological data from 1999 to 2019. The spatiotemporal variation in the NDVI over the Tibetan Plateau in the last 21 years and its response to different driving factors were investigated by using the Sen slope method, Mann–Kendall mutation test, partial correlation analysis and geographical detector method. The results showed that (1) the vegetation coverage on the Qinghai-Tibet Plateau showed an increasing trend from 1999 to 2019, with increases in approximately 67.00% of the plateau area. (2) The spatial differences in vegetation coverage were large; notably, low-density vegetation areas decreased obviously, moderate-density vegetation areas accounted for approximately 50% of the total area, high-density vegetation areas were the least common, and the overall growth rate was significant. (3) The NDVI was positively correlated with temperature and precipitation, and a positive correlation was observed in more than 66% of the region. (4) The order of the influence of single driving factors on the NDVI was as follows: precipitation > soil type > altitude > temperature > gradient > slope > population density > GDP. (5) The effect of multiple factors was significantly higher than that of single driving factors, with a notable nonlinear influence. The interactions between meteorological factors, such as precipitation, and topographic factors, such as altitude, were important, with a q value over 0.79.

This study aimed at exploring what role artificial intelligence techniques could play in the futural numerical analysis. In this paper, a convolutional neural network techniques based on modified loss function is proposed as a surrogate of finite element method(FEM). Several surrogate-based physics-informed neural networks(PINNs) are developed to solve representative boundary value problems based on elliptic partial differential equations (PDEs). Results from the proposed surrogate-based approach are in good agreement with ones from conventional FEM. It is found that modification of the loss function could improve the prediction accuracy of the neural network. It is indicated that to some extent the artificial intelligence technique could replace conventional numerical analysis as a great surrogate model.

As the adoption of renewable energy sources grows, ensuring a stable power balance across various time frames has become a central challenge for modern power systems. In line with the "dual carbon" objectives and the seamless integration of renewable energy sources, harnessing the advantages of various energy storage resources and coordinating the operation of long-term and short-term storage have become pivotal directions for future energy storage deployment. To address the complexities arising from the coupling of different time scales in optimizing energy storage capacity, this paper proposes a method for energy storage planning that accounts for power imbalance risks across multiple time scales. Initially, the Seasonal and Trend decomposition using the Loess (STL) decomposition method is utilized to temporally decouple actual operational data. Subsequently, power balance computations are performed based on the obtained data at various time scales to optimize the allocation of different types of energy storage capacities and assess the associated imbalance risks. Finally, the effectiveness of the proposed approach is validated through hourly applications using real-world data from a province in China over recent years.

In this study, we present a federated learning approach that combines a multi-branch network and the Oort client selection algorithm to improve the performance of federated learning systems. This method successfully addresses the significant issue of non-iid data, a challenge not adequately tackled by the commonly used MFedAvg method. Additionally, one of the key innovations of this research is the introduction of uniformity, a metric that quantifies the disparity in training time amongst participants in a federated learning setup. This novel concept not only aids in identifying stragglers but also provides valuable insights into assessing the fairness and efficiency of the system. Experimental results underscore the merits of the integrated multi-branch network with the Oort client selection algorithm and highlight the crucial role of uniformity in designing and evaluating federated learning systems.

We conducted many model simulations to understand the causes of the damages of coronavirus (COVID-19) to lung tissue and constructed a diagram showing apparent viral reproduction, immune response and damage accumulation curves. We found that lung damages include virus-caused damage, tissue damage caused by immune responses and tissue damage caused by accumulated wastes. The virus-caused damage is proportional to the phase lag between the viral reproduction curve and the delayed adaptive immune response curve, while waste-induced damage is attributed to imbalance in removing viral, cellular and metabolic by-products. We found that treatment strategies should slow down viral reproduction and speed up immune response, and improve blood micro-circulation in the lungs. Consistent with the strategies, measures are taken to void direct lung infection, strengthen innate responses, promote immune responses, dilute viral concentration in lung tissue, maintain waste removal balance, protect heart and kidneys, control other infections, avoid allergic reactions and other inflammation, etc. We show that medical, dietary, emotional, lifestyle, environmental, mechanical factors, etc. may be simultaneously used to mitigate lung damages and prove that multiple factor health optimization method is magnitudes more powerful than a single factor treatment. Such a method does not depend on molecular specificity and can be used in parallel to antiviral drugs.

To understand great disparities in disease outcomes between CIVID-19 patients, we explore infection and host responses in kinetics. From existing data, we deduced a model that the lungs are damaged by rapidly rising flow resistance as a result of retaining white blood cells in lung tissues. The retention of white blood cells is initially triggered by viral infection but aggravated by injuries caused by low temperature. Lungs are initially damaged by fluid leakage, rapidly followed by extruding blood into alveolar spaces. The step of blood extruding is predicted to take place in a very short time. Our simulations show that as little as 0.1% retention of white blood cells in the lungs can lead to their failure in 5 to 10 days. The small degrees of imbalance implies that this imbalance could be corrected by a large number of factors that are known to reduce flow resistance. The model implies that the top priority is maintaining blood micro-circulation and preserving organ functions in the entire disease course, especially after the virus has spread the whole lungs. From exploring a large number of hypothetical infection modes, we propose preventive, mitigating and treatment strategies for ultimately ending the pandemic. The first strategy is avoiding exposures that could result in widespread damages to lungs and taking post exposure mitigating measures that would reduce disease severity. The second strategy is reducing death rate and disability rate from the current levels to one tenth for infected patients by using multiple factors health optimization method. The double reduction strategies are expected to generate a series of chain reactions that favor mitigating or ending the pandemic. Some reactions include a big reduction of the amount of viral discharges from infected patients into the air, the avoidance of panic, chronic stress and emotional distress, and cross-infections which are expected in quarantines. The double reductions would have a final effect of ending the pandemic.

GaN ultraviolet photodetector with metal-semiconductor-metal structure is achieved by growing on a periodic trapezoid column-shape patterned sapphire substrate using metalorganic chemical vapor deposition. Under 5-V reverse bias, the photodetector fabricated on such patterned sapphire substrate exhibits a lower dark current, a higher photocurrent, and a 476 % enhancement in the maximum responsivity as compare with those of the photodetector fabricated on conventional flat sapphire substrate. It is also found that the much larger UV-to-visible rejection ratio and the fact that responsivity drops in a smaller cut-off region are observed from photodetector fabricated by using a periodic trapezoid column-shape patterned sapphire substrate. These phenomena may all be attributed to the reduction of threading dislocation density and the improved quality of GaN film, as well as the internal reflection and/or scattering effect on the interface between GaN film and the periodic trapezoid column-shape pattern of the substrate.

This paper examines certain implications from the literature on Tiebout’s model of local gov-ernment service provision, particularly Hamilton’s extension of the model to include local control of land use and property taxation. Our empirical analysis focuses on the use of fiscal zoning to lower property tax rates, a topic that has not been addressed in the extensive Tiebout literature. Using data for over 100 municipalities in the Miami, Florida, metropolitan area, we specify property tax rates as a function of fiscal zoning measures, other municipal characteristics, and tax mimicking. We conclude that single-family zoning is by far the most important variable ex-plaining municipal property tax rates.

Nowadays the relationship between planning land use and actual land use is not so clear in general. A lot of efforts have been put in the failures of regulation for the expansion of construction land. However, it still lacks an integrated approach to study the effectiveness of land use regulation in terms of different land use types. Furthermore, the existing evaluation of land use plan mainly focuses on a general level, a detailed research on the regulation effectiveness of each construction land use type is absent. Therefore, this research tries to evaluate regulation effectiveness of land use plan, which takes Cangwu country, Guangxi Province as an example. The finding by analysis is that the total area of construction land expansion was about 3494.73 ha, nearly 1.1 times of the plan quota. Moreover, the effectiveness differs greatly in various construction land use types. Town, industrial/mining sites can be well regulated through the quota of land use plan. While, the quota regulation system is not as effective for other type of construction land. Thus, we suggest to improve the regulation effectiveness of construction land through different plan instruments.

Modern medicine adopted four presumptions when it evolved from ancient experienced-based mind-body medicine. To understand its failure in finding cures for chronic diseases, we examined four presumptions, and found that statistical population of health properties does not exist for most research purposes, mathematical models are misused to model intensive properties, synthetic drugs are inherently more dangerous than nature-made medicines under their respective application conditions, and reductionist treatments are inferior and inherently dangerous. We found that clinical trials are valid only for research where treatment effect is much stronger than the total effects of all interfering or co-causal factors or errors introduced by misused mathematical models can be tolerated. In all other situations, clinical trials introduce excessive errors and fail to detect treatment effects, or produce biased, incorrect or wrong results. We further found that chronic diseases are manifestation of small departures in multiple process attributes in distinctive personal biological pathways networks, that modern medicine lacks required accuracy for accurately characterizing chronic diseases, and that reductionist treatments are good at controlling symptoms and safe for short term uses. For all stated reasons, as long as modern medicine continues relying on the flawed presumptions, it can never find predictable cures for chronic diseases. By implication, predictable cures to chronic diseases are adjustments to lifestyle, dietary, emotional, and environmental factors to slowly correct departures in process attributes responsible for chronic diseases.

This is the first study to comprehensively evaluate the benefit of urban open spaces and cropland with different adjacent public facilities seen as locally undesirable (“not in my backyard,” NIMBY) or desirable (“yes in my backyard,” YIMBY). The total benefit increases or decreases for urban open space and cropland with adjacent NIMBY or YIMBY facilities in a municipality in Taiwan. The results show that for the city as a whole, the current arrangement of NIMBY and YIMBY in different zones decreases the total benefit of urban open spaces in highly urbanized zones and increases the total damage to cropland in extremely rural zones. This indicates a need to avoid further installing NIMBY or YIMBY facilities in already occupied urban open spaces. The results also demonstrate that locating NIMBY or YIMBY facilities near cropland fails to highlight the benefit of YIMBY facilities and magnifies opposition to NIMBY facilities. For individual housing units, the total damage is 1.87% of the average housing price for cropland-type open space with adjacent NIMBY or YIMBY facilities, and the total benefit is 7.43% of the average housing price for urban-type open space in a highly urbanized area. In contrast, the total benefit for open space with adjacent NIMBY or YIMBY facilities is a 2.95%-13.80% increase in the average housing price for areas with mixed urban open space and cropland.

Simultaneous Localization and Mapping (SLAM) is considered as a challenge in environments with many moving objects. This paper proposes a novel LiDAR Inertial Odometry framework, ID-LIO, for dynamic scenes that builds on LIO-SAM. To detect the pointclouds on the moving objects, a dynamic point detection method is integrated, which is based on pseudo occupancy along the spatial dimension. Then, we present a dynamic points propagation and removal algorithm based on indexed points to remove more dynamic points in the local map along the temporal dimension and update the status of the point features in keyframes. In the LiDAR odometry module, a delay removal strategy is proposed for history keyframes and the sliding window-based optimization includes the LIDAR measurement with dynamic weights to reduce error from dynamic points in keyframes. We perform the experiments both on the public low dynamic and highly dynamic data set. The results show that the proposed method greatly increases the localization accuracy in high dynamic environments. And the ATE(Absolute Trajectory Error) average RMSE((Root Mean Square Error) of our ID-LIO can be improved by 67% and 85% in the UrbanLoco-CAMarketStreet dataset and UrbanNav-HK-Medium-Urban-1 dataset respectively when compared with LIO-SAM.

In the war against the COVID-19 pandemic, the world is experiencing severe resource constraints. Although transmission routes are well understood, we suspect that they cause different disease consequences. We evaluate them in different forms to understand how they affect infection rates and disease severity. In determining how they affect disease outcome, we evaluated target tissue vulnerability, functional role, defense mechanisms, viral concentration, infection vicinity to target vital tissue, and host factors. We found that direct lung infection is the most lethal transmission route followed by bronchi infection. Transmissions by physical contacts, foods, and blood by low viral concentration (as expected in normal human activities) pose lower or much lower risks unless the infection is followed by subsequent lung exposures. After adding transmission route, treatment timings, and improper treatments into the list of known risk factors, we found that death rate and disability rate for young or healthy persons are nearly zero. We show that population based medical model improperly shifts nominal death rate from few vulnerable people to the population resulting in unnecessary population panic, and such panic is responsible for shutting down human activities and the world economy. Finally, we examined limitations in population-based mitigating measures and proposed for governmental and private adoption community guidelines, which are mainly to enable vulnerable people avoid exposures, prevent non-vulnerable people from serving as viral transmitters, get rid of high-risk exposure modes in working environment, improve safety for people in buses, ships and planes, and reduce death and disability rates for infected people.

Insulin resistance, as a common pathological process of many metabolic diseases, including diabetes and obesity, has attracted much attention due to its relevant influencing factors. To date, studies have mainly focused on the mechanisms between mitochondrial stress and insulin resistance, and they are now pursued as a very attractive therapeutic target due to their extensive involvement in many human clinical settings. In view of the complex pathogenesis of diabetes, natural drugs have become new players in diabetes prevention and treatment because of their wide targets and few side effects. In particular, plant phenolics have been paid more attention because of their close relationship with oxidative stress. In this review, we briefly review the mechanisms by which mitochondrial stress leads to insulin resistance. Moreover, we list some cytokines and genes that have recently been found to play roles in mitochondrial stress and insulin resistance. Furthermore, we describe several natural drugs that are currently widely used and give a brief overview of their therapeutic mechanisms. Finally, we suggest possible ideas for future research related to the unique role that natural drugs play in the treatment of insulin resistance through the above targets.

The increased consumption of high fat-containing foods has been linked to the prevalence of obesity and abnormal metabolic syndromes. Rhizopus oligosporus, a fungus in the family Mucoraceae, is widely used as a starter for homemade tempeh. Although R. oligosporus can prevent the growth of other microorganisms, it grows well with lactic acid bacteria (LAB). Lactobacillus plantarum can produce β-glucosidase, which catalyzes the hydrolysis of glucoside isoflavones into aglycones (with greater bioavailability). Therefore, the development of a soybean-based functional food by the co-inoculation of R. oligosporus and L. plantarum is a promising approach to increase the bioactivity of tempeh. In this study, the ameliorative effect of L. plantarum in soy tempeh on abnormal carbohydrate metabolism in high-fat diet (HFD)-induced hyperglycemic rats was evaluated. The co-incubation of L. plantarum with R. oligosporus during soy tempeh fermentation reduced the homeostatic model assessment of insulin resistance, HbA1c, serum glucose, total cholesterol, triglyceride, free fatty acid, insulin, and low-density lipoprotein contents and significantly increased the high-density lipoprotein content in HFD rats. It also increased the LAB counts as well as the bile acid, cholesterol, triglyceride, and short-chain fatty acid contents in the feces of HFD rats. Our results suggested that the modulation of serum glucose and lipid levels by LAB occurs via alterations in the internal microbiota, leading to the inhibition of cholesterol synthesis and promotion of lipolysis. Tempeh, produced with both L. plantarum and R. oligosporus, may be a beneficial dietary supplement for individuals with abnormal carbohydrate metabolism.

Chronic diseases are still known as incurable diseases, and we suspect that the medical research model is unfit for characterizing chronic diseases. In this study, we examined accuracy and reliability required for characterizing chronic diseases, reviewed implied presumptions in clinical trials and assumptions used in statistical analysis, examined sources of variances normally encountered in clinical trials, and conducted numeric simulations by using hypothetical data for several theoretical and hypothetical models. We found that the sources of variances attributable to personal differences in clinical trials can distort hypothesis test outcomes, that clinical trials introduce too many errors and too much inaccuracies that tend to hide weak and slow effects of treatments, and that the means of treatments used in statistical analysis have little or no relevance to specific patients. We further found that a large number of uncontrolled co-causal or interfering factors normally seen in human subjects can greatly enlarge the means and the variances of the experimental errors, and the use of high rejection criteria (e.g., low p values) further raises the chances of failing to find treatment effects. As a whole, we concluded that the research model using clinical trials is wrong on multiple grounds, under any of our realistic theoretical and hypothetical models, and that misuse of statistical analysis is most probably responsible for failure to identify treatment effects for chronic diseases and to detect harmful effects of toxic substances in the environment. We proposed alternative experimental models involving the use of single-person or mini optimization trials for studying low-risk weak treatments.

A novel coronavirus (2019-nCoV) was first identified in Wuhan, Hubei Province, and then spreads to the other Provinces of China. 2019-nCoV was reported to share the same receptor, Angiotensin-converting enzyme 2 (ACE2), with SARS-CoV. Previous studies have found ACE2 is abundantly present in humans in the epithelia of the lung and small intestines, and they found ACE2 expression in the basal layer of the non-keratinizing squamous epithelium in nasal and oral mucosa and the nasopharynx. Here based on the public single-cell RNA-Seq datasets, we analyzed the ACE2 expression in the nasal, mouth, lung, and colon tissues. We find that the number of ACE2-expressing cells in the nasal tissue and mouth is comparable to the number of ACE2-expressing cells in the lung tissue and colon. We also find that ACE2 tends to be co-expressed with HLA-DRB1, which plays a central role in the immune system by presenting peptides derived from extracellular proteins, in the nasal, mouth, lung, and colon tissues at single-cell resolution. We hope this provides valuable information for virus-prevention strategy and therapeutic strategy development.

To explore the relevant factors that affect the efficacy of consciousness-regaining therapy (CRT)for prolonged disorder of consciousness(pDOC),a retrospective analysis was conducted on the case data of 114 patients with pDOC admitted to department of functional neurosurgery of Tianjin Huanhu Hospital from January 2019 to January 2022. Basic information on the cases,data on pDOC disease assessment, consciousness-regaining therapy methods, and efficacy evaluation were collected. A total of 114 patients were grouped and compared based on the efficacy at the end of treatment. Among them, there were 61 cases in the ineffective group and 53 cases in the effective group. There was no statistically significant difference (P&gt;0.05) between the two groups in terms of gender, age, etiology, acute cerebral herniation, emergency craniotomy surgery, emergency decompressive craniectomy, time from onset to start of consciousness-regaining therapy , and duration of consciousness-regaining therapy(P&gt;0.05). However, there were statistically significant differences (P&lt;0.05) in terms of secondary hydrocephalus, , consciousness-regaining therapy methods, CRS-R grading before treatment, and GOSE score at 6 months after treatment. Binary logistic regression analysis showed that the type of therapy (OR=0.169, 95% CI: 0.057-0.508) was a related factor affecting the efficacy of consciousness-regaining therapy (P&lt;0.05).Compared with non-invasive therapy, personalized awakening therapy using various invasive consciousness-regaining therapy methods can help improve the efficacy of therapy for pDOC.

Micro-electro-mechanical systems (MEMS) are once proposed in 1970s and evolving rapidly. The current researchers are seeking for better designs and better applications of MEMS actuators. This work presents an electrostatic driven dual-axis scanning micromirror, i.e., two-dimensional (2D) scanning micromirror with a mirror size of 500 μm × 500 μm. The scanning mirror is implemented by using bulk micromachining process on silicon on insulator (SOI) substrate, which is compatible with present complementary metal oxide semiconductor (CMOS) manufacturing technology. The scanning frequencies of the slow and the fast axis are 4.87 kHz and 31.15 kHz, respectively. The impact factors of the dimensions of comb fingers and torsional beams are analyzed and discussed in this study. Under the driving voltage difference of 100 volts and 70 volts, the deviation angle is 4.57° × 13.08°. Therefore, a simple design of a dual-axis MEMS scanning micromirror is proposed, which can be precisely controlled without additional complex sensors or circuits.

The flat terrain in plain areas makes the land easily accessible for cultivation and farming, providing vast opportunities for agricultural development. Additionally, these areas are crucial for urban construction and economic growth. Soil mapping plays a crucial role in understanding soil characteristics and guiding land management practices. However, accurately mapping soils in plain regions can be challenging due to their low spatial variability and diverse land use types. This study focuses on the impact of land cover changes on the accuracy of soil mapping in plain areas, aiming to provide effective assistance in soil mapping through the analysis of their coupling relationship. Starting with a 20-year land cover change analysis, this study utilizes a unified approach that combines expert knowledge, mixed sampling methods, and random forest mapping techniques. The study incorporates environmental covariates that have minimal period influence and synergistically use NDVI (Normalized Difference Vegetation Index) and land cover data from the same year. The analysis is based on transition matrices, confusion matrices, and their derived indicators. The research findings indicate that Tongzhou District has experienced rapid development over the past 20 years, with the area of construction land nearly doubling. 29% of arable land has been converted into construction land, resulting in an increase in the accuracy of the soil map from 58.99% to 66.91% over the 20-year period. The soil change area during this period accounts for 16.5% of the total area, with 51.9% of the changed areas overlapping with land cover change areas. These overlapping regions are predominantly influenced by human activities. In terms of cultivated land types in the study area, the quantity of arable land has decreased by approximately 29% over the 20 years, while the proportion of sandy loam calcareous fluvo-aquic soil and light loam calcareous fluvo-aquic soil, which constitute nearly half of the soil types, has increased. These data demonstrate the coupling relationship between land cover changes and soil type variations, particularly the significant influence of human activities on soil structure. It is evident that on one hand, improving the extent of land use in plain areas enhances the credibility of soil mapping. On the other hand, human activities impact land cover, which in turn affects and reflects changes in the soil.

A perirectal abscess, while typically considered benign, has the potential to invade extraperitoneal spaces, including the space of Retzius, resulting in complications with severe systemic illness. It is postulated that there is communication within adipose tissue between the pararectal spaces and the vesical extraperitoneal space anteriorly, secondary to the termination of the umbilical-vesical fascia at the reflection of the vesical peritoneum. While occurrences of perirectal abscess ex-tending to the extraperitoneal space are infrequent, a thorough understanding of the anatomical structure, physiology, and the subsequent therapeutic approach remains crucial. For assessment, a computed tomography scan with intravenous contrast is preferred for evaluation, given the probable insidious and nonspecific nature of the clinical presentation, physical exam signs, and even laboratory studies. Primary therapeutic modalities involve immediate resuscitation, intra-venous administration of broad-spectrum antibiotics, and percutaneous drainage. Surgical in-tervention may become necessary in cases where there is no prompt improvement in septic progression. Additionally, the underlying comorbidities and baseline illness could be indicative of unfavorable outcomes. If fever or sepsis is not efficiently controlled, a more comprehensive workup or intervention should be contemplated, considering the associated higher risks of complications and mortality rates. In this study, we presented the case of a 68-year-old male with diffuse pain located in the lower abdomen. Fortunately, an immediate computed tomography scan played a pivotal role in iden-tifying a perirectal abscess with upward extension to the space of Retzius, which was subse-quently treated appropriately. Above all, this rare case presentation underscores the anatomic complexity within pelvic compartments and emphasizes the importance of maintaining high-index suspicions and analyzing overall differential diagnosis.

The first paper of this two-part series paper discussed the development of a novel lightweight 3D wood dowel-reinforced glass epoxy hybrid composite material (3DdrFRP) and its manufacturing procedures. It also experimentally compared the performance of scaled utility poles made from conventional 2D E-glass epoxy and 3DdrFRP materials. In the second part, we developed robust finite element (FE) models in LS-DYNA, calibrated them based on experimental results, and used them to simulate the performance of equivalent 2D and 3D poles, proving the integrity of the numerical model. Additionally, we developed a simplified analytical calculation method for engi-neers to determine the stiffness of 3D-DrFRP poles accurately and quickly.

The plant graft healing process is an intricate development influenced by numerous endogenous and environmental factors. This process involves the histological changes, physiological and biochemical reactions, signal transduction, and hormone exchanges in the grafting junction. Studies have shown that applying exogenous plant growth regulators can effectively promote the graft healing process and improve the quality of grafted plantlets. However, the physiological and molecular mechanism of graft healing formation remains unclear. In our present study, transcriptome changes in the melon and cucurbita genomes were analyzed between control and NAA treatment, and we provided the first view of complex networks to regulate graft healing under exogenous NAA application. The results showed that the exogenous NAA application could accelerate the graft healing process of oriental melon scion grafted onto squash rootstock through histological observation, increase the SOD, POD, PAL, and PPO activities during graft union development and enhance the contents of IAA, GA3, and ZR except for the IL stage. The DEGs were identified in the plant hormone signal-transduction, phenylpropanoid biosynthesis, and phenylalanine metabolism through transcriptome analysis of CK vs. NAA at the IL, CA, and VB stage by KEGG pathway enrichment analysis. Moreover, the exogenous NAA application significantly promoted the expression of genes involved in the hormone signal-transduction pathway, ROS scavenging system, and vascular bundle formation.

The discrete element method (DEM) coupled with computational dynamics (CFD) has been considered one of the most sensitive ways of studying fluidized beds. This paper presents gas-solid fluidized bed simulations by use of CFD-DEM. The two-phase interaction is calculated in a way of decoupling. Within the effective neighborhood of the particles, the kernel approximation method is used to calculate the local porosity, thereby calculating the drag force on the particles. At the grid scale, the momentum exchange coefficient is calculated using a two fluid model based method, thereby calculating the source term of the phase interaction in the fluid control equation. The simulated form, size and motion process of the big bubble are all consistent with experimental observations. The simulated solid volume fraction and relative pressure averaged in a horizontal plane at 45 mm above the bottom are in reasonable agreement with the experimental data. The fluctuation of the simulated bed height over time is similar to the experimental measurement results. The reproduction of these qualitative and quantitative results indicates that the proposed method effectively improves simulation performance and accuracy.

This paper explores the application of wavelet analysis, a multiscale approach for enhancing visual clarity, in the context of image denoising, which reduces the impact of noisy pixels, caused by various factors such as electronic sensor limitations, low-light conditions, or transmission errors in digital imaging systems. This paper introduces some common noise types like Gaussian noise and processes of image denoising, eliciting the strength of wavelet analysis. As a powerful image denoising technology, wavelet analysis needs five steps to process the image, and the key step is thresholding. There are many kinds of wavelet, and each wavelet has different advantages and functions, which makes it suitable for different applications. Hence, wavelet analysis also makes a contribution in various fields beyond signal processing and data analysis, such as Biomedical Imaging and Geophysics and Seismology, where preserving image quality is essential for accurate analysis and interpretation. In short, this research highlights the promise of wavelet analysis, emphasizing the use of high- quality image data.

Synthetic Aperture Radar (SAR) is an active type of microwave remote sensing. Using the microwave imaging system, remote sensing monitoring of the land and global ocean can be done in any weather conditions around the clock. Detection of SAR image targets is one of the main needs of radar image interpretation applications. In this paper, an improved two-parameter CFAR algorithm based on Rayleigh distribution and morphological processing is proposed to perform ship detection and recognition in high resolution SAR images. Through simulation experiments, comprehensive study of the two algorithms for high resolution SAR image target detection is achieved. Finally, the results of ship detection experiments are compared and analyzed, and the effects of detection are evaluated according to the Rayleigh distribution model and algorithms.

Additive manufacturing (AM) has been the core area of sustainable manufacturing commonly recognized for its high efficiency in enabling cost-effective production towards sustainability. There are three models this research constituted: In Collection-Recycling-Manufacturing (CRM) model, technologies and processes are benchmarked followed by Business model that evaluates industrial key criteria. However, these are insufficient for AM to effectively play dominant role as the realization requires human factors such as multi-entities authorities, policy making and AM society to initiate and execute the plan. Strategy control model focuses on human-centric approaches such as demography, population control, policy, regulations, and management. It investigates each nation’s demography, and enables strategy, plan and control to relocate overcrowding population to rural areas. It also produces robust workforce to support AM and materials recycling through the appropriate applications. Through the construction of AM and materials recycling, strategy control model creates job opportunities for those unemployed people. It further builds infrastructure for the livelihood of new residents and supports AM home-based business (HBB).

I propose a dynamic evolution hypothesis regarding the evolution of organisms by incorporating both diminished fitness returns and mutation rate tuning during adaptation to a constant environment. Basically, accumulating evidence from life history studies conducted over the past 70 years suggests that the evolution of individual fitness is subject to ecological constraints, leading to the evolutionary existence of an upper limit of individual fitness (ULIF). Given the existence of the ULIF, organismal evolution, which might initially have relatively great fitness returns through primarily Darwinian evolution, will eventually be subject to diminished fitness returns towards zero. With the diminished fitness return, Darwinian selection strength may eventually become smaller than the power of random genetic drift, leading to the occurrence of neutral evolution at both phenotypic and molecular levels. Meanwhile, mutation rates may change from an initial increase, due to the relatively strong fitness return, to subsequent decreases, due to both the diminished fitness return of beneficial mutations and the cost of deleterious mutations. The diminished fitness returns with subsequently reduced mutation rates are two potential evolution barriers leading to eventual evolutionary stasis. These findings provide important insights for understanding the conditions for the occurrences of different evolutionary patterns. Darwinian evolution theory, neutral evolution theory and punctuated equilibrium theory can be unified in the context of the dynamic evolution hypothesis formulated in this study.

The global usage of veterinary antibiotics is significant. These antibiotics can be released into the aquatic environment and exert toxic effects on non-target organisms. To explore the physiological effects of tetracycline antibiotics on aquatic life, the growth characteristics of and toxin release from the cyanobacterium Microcystis aeruginosa (M. aeruginosa) were studied. Results showed that the toxicity order of the three target antibiotics was TC (tetracycline) > CTC (chlortetracycline hydrochloride) > OTC (oxytetracycline) in terms of inhibition occurrence time and the EC₁₀ and EC₂₅ values. Further, the target antibiotics regulated the production of MC-LR (microcystin-LR) to different degrees. CTC destroyed the M. aeruginosa cells and resulted in a decreased MC-LR release but stimulated the ability to synthesise MC-LR. OTC had a relatively weaker toxicity compared with CTC, while TC was the most toxic among the three antibiotics. Therefore, TC is friendly to the aquatic environment because it simultaneously reduced the intracellular and extracellular MC-LR content. These results aid our understanding of the effects of tetracycline antibiotics on Microcystis aeruginosa, which is important for environmental evaluation and protection. These results are also helpful for guiding the application of veterinary antibiotics in agricultural settings.

This paper proposes a novel biologically inspired design for an insect-scale flapping robot. The proposed scheme employs two motors to drive four wings, mimicking the flapping motion of nat-ural four-winged insects. The vehicle incorporates two pairs of flapping wings to generate lift force, with a transmission mechanism featuring flexure hinges instead of pivot joints, resulting in reduced weight and volume. The flexure hinges also exhibit nonlinear stiffness to facilitate smooth wing motion. The vehicle is designed to be symmetrical in structure, with the wings of each section generating greater lift through the clap-and-fling mechanism. The final product weighs 6.2g, pos-sesses a wingspan of 17cm, a one-sided flapping wing angle of 103 degrees, and generates lift that exceeds its weight, attesting to its successful design.

Shear dynamics simulation under extreme pressure was used to optimise the composition of ester-based lubricant base oil and extreme pressure additives. As a result, the ester-based lubricant in the weak-gel drilling fluid achieves reduction and increases the efficiency in drilling construction, and the field operation efficiency improves. The results of base oil lubrication simulation show that three base oils, namely, methyl oleate, ethyl oleate and butyl oleate, can be stably adsorbed on the surface layer of the shear surface. Methyl oleate has the lowest system temperature after shear stabilisation and has a high load-bearing capacity. The shear stress of methyl oleate decreases by changing the initial shear temperature and speed. It increases by 6.36 MPa when the speed increases from 10 m/s to 30 m/s. At this time, the shear stress of butyl oleate increases by 10.11 MPa. The results of the four-ball friction experiments show that the radius of the abrasion spot of methyl oleate is 179.83 μm, which is smaller than that of the other two base oils. Moreover, the friction coefficient of methyl oleate is 0.0018, which is approximately 1/3 of that of butyl oleate. Methyl oleate has better lubrication efficiency. The shear simulation results are consistent with the experimental results. The simulation can be used for the molecular design of lubricant materials. The oleic acid amide–containing amine group and the glyceride oleic–containing hydroxyl group were selected as the extreme pressure functional components for shear simulation. Results show that the shear stress of oleic acid amide is much lower than that of oleic acid glyceride when the initial shear temperature and speed change. The extreme pressure lubrication component–containing amine group is better than the extreme pressure lubrication material–containing hydroxyl group. The effects of different oleamide contents in the two-component mixtures on the lubricating properties were investigated through shear simulation, with methyl oleate as the base oil and oleamide as the extreme pressure functional component. The simulation results show that the lubricant has the optimal shear stress when 10% oleamide is added to the lubricant. The base properties of the lubricant were tested using a mixture of 90% methyl oleate and 10% oleamide, formulated as a lubricant. Results show that the friction coefficient can be reduced to 0.03 when 0.5% of the lubricant is added to the base mud. Moreover, the lubricant film formed shows high strength. Then, 1% lubricant was added to the weak-gel drilling fluid to evaluate the effect of the lubricant on the gel structure of the drilling fluid. Results show that adding lubricant does not affect the rheological properties of the drilling fluid. The gel structure of the system also remains stable even after 7 days of continuous ageing. The results of the field experiments in Hua3-01 well show that adding 1% ester-based lubricant to the field drilling fluid reduces the drilling friction by 33%. Thus, the efficiency of directional side drilling can be effectively improved, complicated accidents, such as poor starting and stopping of drilling and stuck jamming, can be avoided, and the goals of reducing quantity and increasing efficiency can be completed.

High dietary phosphate intake and poor adherence to phosphate-binding-therapy elevate the risk of hyperphosphatemia in maintenance hemodialysis (HD; MHD) patients. Therefore, chronic kidney disease-related mineral and bone disorder (CKD-MBD) indicators increase; consequently, risks of CKD-MBDs and inflammation are elevated. This double-blind, randomized control trial intervention study was designed to investigate the possibility of reducing blood CKD-MBD indicators and modulating inflammatory indicators by consuming low-phosphate (LP) meals accompanied by a minimum dose of a calcium-based phosphate binder (CaCO3). MHD patients were recruited and randomly assigned to an LP meal group (LP group) or a control group. After initial data collection, blood collection, and dietary counseling, subjects were asked to consume a washout diet for 1 week. During the washout diet period, subjects consumed their usual diet but took 1 tablet of calcium carbonate (1CaCO3) as a phosphate binder with each meal. After the washout diet period, subjects in the LP group and control group respectively consumed LP meals and regular meals twice a day for 1 week. Meat in the LP meals was boiled before the regular cooking process, but meat in control meals was not. All meals were supplied by a central kitchen so that the contents of phosphate and other nutrients could be identified. In total, 40 MHD patients completed the study program. After 1 week of the dietary intervention, the blood Ca x P product and dietary phosphate had significantly decreased in the LP group compared to the control group (p&lt;0.05). The LP group had significantly lower variations in dietary phosphate intake, blood calcium, Ca x P product, and tumor necrosis factor (TNF)-α than the control group by comparing differences between after the dietary intervention and the baseline (△after intervention - baseline, p&lt;0.05). The increase in dietary phosphate intake (△3rd - 2nd dietary phosphate intake) augmented the increase in the TNF-α level by 6.24-fold (odds ratio [95% confidence interval]: 6.24 [1.12~34.92], p&lt;0.05). These results highlighted the conclusion that LP meals accompanied by a minimum dose of CaCO3 downregulated pro-inflammation by reducing CKD-MBD indicators which was triggered by decreasing dietary phosphate intake.

Tellurium exhibits exceptional intrinsic electronic properties. However, investigations into the modulation of tellurium's electronic properties through physical modification are notably scarce. Here, we present a comprehensive study focused on the evolution of the electronic properties of tellurium crystal flakes under plasma irradiation treatment by employing conductive atomic force microscopy and Raman spectroscopy. The plasma-treated tellurium experienced a process of defect generation through lattice broken. Prior to the degradation of electronic transport performance due to plasma irradiation treatment, a remarkable observation emerged: in the low-energy region of hydrogen plasma-treated tellurium, a notable enhancement in conductivity was unexpectedly detected. The mechanism underlying this enhancement in electronic transport performance was thoroughly elucidated by comparing it with the electronic structure induced by argon plasma irradiation. This study not only fundamentally uncovers the effects of plasma irradiation on tellurium crystal flakes, but also unearths an unprecedented trend of enhanced electronic transport performance at low irradiation energies when utilizing hydrogen plasma. This abnormal trend bears significant implications for guiding the prospective application of tellurium-based 2D materials in the realm of electronic devices.

This paper proposed emotion recognition methods for consecutive facial images, and implements the inference of neural network model on a field-programmable gate array (FPGA). The proposed emotion recognition methods are based on a neural network model architecture that combines convolution neural networks (CNNs), long short-term memory (LSTM), and fully connected neural networks (FCNNs), called CLDNN or ConvLSTM-FCN. This type of neural network mod-el can analyze the local feature sequences obtained through convolution of data, making it suita-ble for processing time-series data such as consecutive facial images. In this paper, sequences of facial images are sampled from videos corresponding to various emotional state of subjects. The sampled images are then pre-processed with the processes includes facial detection, greyscale conversion, resize, and data augmentation if necessary. The 2-D CNN in ConvLSTM-FCN is used for feature extraction for these pre-processed facial images. These sequences of facial im-age features are time sequences with dependent properties between the elements within them. The LSTM is then used to model these time sequences followed by fully connected neural net-works (FCNNs) for classification. The proposed consecutive facial emotion recognition method achieves an average recognition rate of 99.51% on RAVDESS dataset, 87.80% on BAUM-1s dataset and 96.82% on eNTERFACE’05 data set, using 10-fold cross-validation on the PC. Some com-parisons of recognition accuracies between the proposed method and the other existing related works are conducted in this paper. According to the comparisons, the proposed emotion recog-nition methods outperform the existing related researches. The proposed emotion recognition methods are then implemented on an FPGA chip using the neural network model inference algo-rithms in this paper, and the accuracies of the experiments conducted on the FPGA chip are iden-tical to those obtained on the PC. This verifies that the proposed neural network model imple-mented on the FPGA chip performs well.

In this paper, we study the constrained minimization problem for an energy functional which is related to the following Kirchhoff type equation \begin{equation*} -\Big(\eta+b\big(\int_{\R^{3}}|\nabla u|^{2}dx\big)^{s}\Big)\Delta u+V(x)u=\mu u +\lambda|u|^{p}u,\end{equation*} where $b$ is a positive constant, parameters $\eta\geq0, \lambda>0$, exponents $s>0$, $0

In response to the growing need for efficient energy conversion technologies, this pa-per introduces an innovative Tubular Thermoelectric Generator (TTEG), specifically de-signed for high-efficiency conversion of waste heat into electrical energy. Unlike conven-tional flat plate thermoelectric generators (FTEGs), the TTEG incorporates full-ring ther-moelectric elements within a tubular layout, offering a novel approach to thermal energy recovery from fluid-based systems. This design significantly enhances the heat transfer capabilities, thereby improving the efficiency of energy conversion. Comprehensive simulations and analyses form the core of this study, where the per-formance of the TTEG is rigorously compared with traditional FTEGs. These comparisons highlight the advantages of the tubular design in terms of energy conversion efficiency and practical applicability in various scenarios. The findings reveal that the TTEG not only outperforms its flat plate counterparts but also presents a scalable and adaptable so-lution for waste heat recovery in a wide range of industrial and automotive applications. This research contributes to the field of energy science and technology by presenting a detailed experimental setup, complete with reproducible procedures and results. It opens new pathways for the development of more sustainable and efficient energy conversion systems, aligning with the goal of harnessing renewable and sustainable energy sources. The potential applications of this technology in enhancing energy efficiency and reducing environmental impact are vast, making it a significant step forward in the quest for clean and sustainable energy solutions.