MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

Hydraulic conductivity is the key and one of the most uncertain parameters in groundwater modeling. The grid based numerical simulation require spatial distribution of sampled hydraulic conductivity at un-sampled locations in the study area. This spatial interpolation has been routinely performed using variogram based models (two-point geostatistics methods). These traditional techniques fail to capture the complex geological structures, provides smoothing effects and ignore the higher order moments of subsurface heterogeneities. In this work, a multiple-point geostatistics (MPS) method is applied to interpolate hydraulic conductivity data which will be further used in WASH123D numerical groundwater simulation model for regional smart groundwater management. To do this, MPS need ‘training images (TIs) as a key input. TI is a conceptual model of subsurface geological heterogeneity which was developed by using concept of ages, topographic slope as an index criteria and knowledge of geologist. After considerations of full physics of study area, an example shows the advantages of using multiple-point geostatistics compared with the traditional two-point geostatistics methods (such as Kriging) for the interpolation of hydraulic conductivity data in a complex geological formation.

Samarinda City is one of the most attractive cities in Borneo Island (Indonesia) and also as a capital city of EastBorneo Province. The expansion of urban areas becomes essential due to rapid population and housing demand. Base on the statistical report, the annual population growth rate is 0.018% from the year 2016-2017 with a total population of 843446 inhabitants. Many natural disasters occur in some areas in this city, especially flooding. This natural disaster occurs almost every year, many people suffered and forced to evacuate. In 2018 there is 3 flood event with 28311 people was suffered and evacuated, and 5170 houses were flooded [1]. During the flood event, it was very possible to gain damages to their property and make traffic stuck. One common way to reducing the damages is using Early Warning Systems (EWS). Early warning is a major element for disaster risk reduction, including damages. To prevent and mitigate the impact of a disaster, many countries had taken action to build various methods of a public warning system. An effective early warning system focused on people-centered and comprises the following element, such as risk knowledge, technical monitoring and service, communication and dissemination of warnings, and community response capability [2]. Related to the existing condition which Samarinda is a Muslim-dominated city and obviously has a lot of a number of mosques. This is a good potency to develop an early warning system because every mosque has a loudspeaker for echoing Adzan (Muslim prayer-calling). With this existing condition, the loudspeaker can be utilized as a flood outdoor-voice warning announcer. The aim of this study is to briefly introduce the strategy of dissemination early warning by utilizing mosques. The hope of early warning dissemination is giving enough time to the people to evacuate their property to reduce damages and possibly to giving information to avoiding traffic stuck (in a certain location)due to flooding. The results of this study can be used as input for decision-makers to develop effective flood management strategies and policies, especially in the case of an early warning system where not well-developed in Samarinda.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

With the development of sensor and communication technologies, Internet of Things (IoT) subsystem is gradually becoming a crucial part in vehicles. It can effectively enhance functionalities of vehicles. However, new attack types are also emerged. For example, a driver with the smart key in the pocket can push the start button to start a car when. At the same time, security issues in the push-to-start scenario are alerted, such as smart key forgery. In this paper, we propose a vehicle Passive Entry Passive Start (PEPS) system that uses deep learning algorithms to recognize the driver by the Electrocardiogram (ECG) signals measured by his or her smart watch. ECG signals are used for verification. Smart watches, as a new smart key of PEPS system, can replace traditional smart keys to improve security. Experiment results show that Long Short-Term Memory (LSTM) models have achieved the best accuracy score for identity recognition (91%) when single ECG cycle is used. However, it takes at least 30 minutes for training. The training time of Auto Encoder successfully reduces to 5 minutes. When 15 continuous ECG cycles are used, it can achieve 100% identity accuracy.

Taiwan developing offshore wind power to promote green energy and self-electricity production. In this study, a Light Detection and Ranging (Lidar) was set up at Chang-Hua development zone one on the sea and 10km away from the seashore. At Lidar location, WRF (3.33km & 2km grid lengths) model and WAsP were used to simulate the wind speed at various elevations. Three days mean wind speed of simulated results were compared with Lidar data. From the four wind data sets, developed five different comparisons to find an error% and R-Squared values. Comparison between WAsP and Floating Lidar was shown good consistency. Lukang meteorological station 10 years wind observations at 5m height were used for wind farm energy predictions. The yearly variation of energy predictions of traditional and TGC wind farm layouts are compared under purely neutral and stable condition. The one-year cycle average surface heat flux over the Taiwan Strait is negative (-72.5 (W/m2) and 157.13 STD), which represents stable condition. At stable condition TGC (92.39%) and 600(92.44%), wind farms were shown higher efficiency. The Fuhai met mast wind data was used to estimate roughness length and power law exponent. The average roughness lengths are very small and unstable atmosphere.

The increased consumption of high fat-containing foods has been linked to the prevalence of obesity and abnormal metabolic syndromes. Rhizopus oligosporus, a fungus in the family Mucoraceae, is widely used as a starter for homemade tempeh. Although R. oligosporus can prevent the growth of other microorganisms, it grows well with lactic acid bacteria (LAB). Lactobacillus plantarum can produce β-glucosidase, which catalyzes the hydrolysis of glucoside isoflavones into aglycones (with greater bioavailability). Therefore, the development of a soybean-based functional food by the co-inoculation of R. oligosporus and L. plantarum is a promising approach to increase the bioactivity of tempeh. In this study, the ameliorative effect of L. plantarum in soy tempeh on abnormal carbohydrate metabolism in high-fat diet (HFD)-induced hyperglycemic rats was evaluated. The co-incubation of L. plantarum with R. oligosporus during soy tempeh fermentation reduced the homeostatic model assessment of insulin resistance, HbA1c, serum glucose, total cholesterol, triglyceride, free fatty acid, insulin, and low-density lipoprotein contents and significantly increased the high-density lipoprotein content in HFD rats. It also increased the LAB counts as well as the bile acid, cholesterol, triglyceride, and short-chain fatty acid contents in the feces of HFD rats. Our results suggested that the modulation of serum glucose and lipid levels by LAB occurs via alterations in the internal microbiota, leading to the inhibition of cholesterol synthesis and promotion of lipolysis. Tempeh, produced with both L. plantarum and R. oligosporus, may be a beneficial dietary supplement for individuals with abnormal carbohydrate metabolism.

Samarinda’s flooding issue is threatening future city development. As the most populated city in Kalimantan, Samarinda (the municipality of East Borneo) plays a role-model in disaster management for a neighboring city. This paper introduces current flood disaster handling in this city. History of disaster management in Indonesia is started from the earlier of Indonesian independence. Year 2008, after hit by severe Tsunami in Aceh and its surrounding, Government of Republic of Indonesia form special agency to manage disaster specifically, namely National Board for Disaster Management (in Bahasa called: Badan Penanggulangan Bencana Nasional [BNPB]) and follows by the regional and local government to form similar agency in provincial and local scale (including Samarinda), called Regional Board for Disaster Management (in Bahasa: Badan Penanggulangan Bencana Daerah[BPBD]) which is formed in 2009 and 2011, respectively. The aim of this paper is to explain flood management in Samarinda where is flood hazard increase gradually and need to be a priority. Descriptive analysis is used in this study including secondary data and interviewed stakeholders. Finally, the finding of study obtains found five constraints related to Samarinda’s flood management including administrative and policy, social, economic, environment and technical and knowledge constraint. This study also promotes several schemes of non-structural approach to enlarge alternative perspective in flood management.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Dysregulation of cartilage homeostasis and the changes in the density and the architecture of the subchondral bone were postulated as a potent mechanically pathological activity contributing to osteoarthritis (OA) pathogenesis. Extracorporeal shockwave therapy (ESWT) is a new, none invasive and effective method in the treatment of animal OA model. In the current study, we demonstrated that shockwave induced the expression of protein-disulfide isomerase-associated 3 (Pdia-3) which is a multifunctional protein hypothesized to be a significant mediator for 1α,25-Dihydroxyvitamin D3 (1α,25(OH)₂D₃) signaling pathway using two-dimensional electrophoresis. Histological analysis and quantitative polymerase chain reaction (qPCR) were verified and observed that the expression of Pdia-3 at 2 weeks was significantly higher than that of any other group at 4 weeks, 8 weeks, and 12 weeks post-shockwave treatment in early OA knee of rat. The other factors of the 1α,25(OH)₂D₃ rapid membrane signaling pathway including extracellular signal-regulated protein kinases 1 (ERK1), osteopontin (OPG), alkaline phosphatase (ALP), and matrix metallopeptidase 13 (MMP13) were measured and significantly increased by qPCR at 2 weeks post-shockwave treatment in early OA knee. Our proteomic data revealed significant Pdia-3 expression in microenvironments of joint tissue that could be actively responded to ESWT, which may potentially regulate biological function of chondrocytes and osteoblasts in the treatment of OA knee.

Mechanical ventilation (MV), used in patients with acute lung injury (ALI), induces diaphragmatic myofiber atrophy and contractile inactivity, termed ventilator-induced diaphragm dysfunction. Phosphoinositide 3-kinase- (PI3K-) is crucial in modulating fibrogenesis during the reparative phase of ALI; however, the mechanisms regulating the interactions among MV, myofiber fibrosis, and PI3K- remain unclear. We hypothesized MV with or without bleomycin treatment would increase diaphragm muscle fibrosis through the PI3K- pathway. Five days after receiving a single bolus of 0.075 units bleomycin intratracheally, C57BL/6 mice were exposed to 6 or 10 mL/kg MV for 8 h after receiving 5 mg/kg of AS605240 intraperitoneally. In wild-type mice, bleomycin exposure followed by MV 10 mL/kg prompted significant increases in disruptions of diaphragmatic myofibrillar organization, transforming growth factor-1, oxidative loads, Masson’s trichrome staining, extracellular collagen levels, positive staining of -smooth muscle actin, PI3K- expression, and myonuclear apoptosis (P < 0.05). Decreased diaphragm contractility and peroxisome proliferator activated receptor- coactivator-1 levels were also observed (P < 0.05). MV-augmented bleomycin-induced diaphragm fibrosis and myonuclear apoptosis were attenuated in PI3K-γ-deficient mice and through AS605240-induced inhibition of PI3K- activity (P < 0.05). MV-augmented diaphragm fibrosis after bleomycin-induced ALI is partially mediated through PI3K-γ. Therapy targeting PI3K-γ may ameliorate MV-associated diaphragm fibrosis.

Gastric inflammation-related disorders are commonly observed digestive system illnesses char-acterized by the activation of proinflammatory cytokines, particularly tumor necrosis factor-α (TNF-α). This results in the induction of cyclooxygenase-2 (COX-2)/prostaglandin E2 (PEG2) and matrix metallopeptidase-9 (MMP-9). These factors contribute to the pathogenesis of gastric in-flammation disorders. We examined the preventive effects of Lonicera japonica Thunb. ethanol ex-tract (Lj-EtOH) on gastric inflammation induced by TNF-α in normal GES-1 cells. The GES-1 cell line was used to establish a model that simulated the overexpression of COX-2/PGE2 and MMP-9 proteins induced by TNF-α, to examine the anti-inflammatory properties of Lj extracts. The re-sults indicated that Lj-EtOH exhibits significant inhibitory effects on COX-2/PEG2 and MMP-9 ac-tivity, attenuates cell migration, and provides protection against TNF-α-induced gastric inflam-mation. The protective effects of Lj-EtOH are associated with the modulation of COX-2/PEG2 and MMP-9 through activation of TNFR–ERK 1/2 signaling pathways as well as the involvement of c-Fos and nuclear factor kappa B (NF-κB) signaling pathways. Based on our findings, Lj-EtOH ex-hibits a preventive effect on human gastric epithelial cells. Consequently, it may represent a novel treatment for the management of gastric inflammation.

Background: Aging is commonly accepted as a time period of declining heath. Aims: This review aimed to examine the research base concerning the use of term ‘successful aging’, a process and outcome deemed desirable, but challenging to attain. A second was to provide related information to demonstrate how health professionals as well as individuals can aim for a ‘successful aging’ process and outcome, despite the presence of disabling osteoarthritis. Methods: Information specifically focusing on ‘successful aging’ and the concept of improving opportunities for advancing ‘successful aging’ despite osteoarthritis was sought. Results: Among the many articles on ‘successful aging’, several authors highlight the need to include, a broader array of older adults into the conceptual framework. Moreover, conditions such as osteoarthritis should not necessarily preclude the individual from attaining a personally valued successful aging outcome. Conclusion: Pursuing more inclusive research and research designs, and not neglecting to include people with chronic osteoarthritis can potentially heighten the life quality of all aging individuals, while reducing pain and depression, among other adverse aging and disability correlates among those with osteoarthritis

Biofortification refers to the increase in the amount of essential vitamins or provitamins or minerals in crops to improve the nutritional status of the people, which is largely intended to alleviate the problem of micronutrient malnutrition. I argue that biofortification may not be an effective weapon to fight against the hidden hunger since it demonstrates limited capacity on nutritional enhancement and can negatively impact the socio-economic fabric of the society in many different ways. Finally, I suggest a couple of alternatives that might meet the challenge more efficiently than biofortified crops.

Background: Cancer patients require cross-professional care during the diagnosis and treatment periods. Therefore, methods for effectively carrying out case management are essential to tumor care. Purpose: To investigate the effects of using the community software LINE Official Ac-count on oral cancer case management. Methods: An experimental design was used; 100 patients were randomly divided into two groups by using a computer-generated random number table. The experimental group used LINE Official Account, which gave them self-care information, timely messages, and one-on-one health-care consultations. The control group followed standard healthcare practices. Results: The experimental group was satisfied with the self-care information provided by LINE Official Account (86.9%), patients regularly checked the self-care information (89.4%) and would check the information when receiving a push notification (54.3%). Ten patients used the one-on-one consultation(20.0%). LINE Official Account had a significant effect on the rate of participation in support groups. Generalized estimating equations indicated a significant difference between the two groups regarding the overall quality of life over 7 days (P = 0.023). Conclusion: Community software applications used in oncological case management can improve self-management and empower, also enable tracking of long-term follow-up effectiveness and reinforce the case manager’s role as a family therapist. Therefore, this study recommends that case manager systems be incorporated into mobile applications to increase the sustainable management, accessibility, effectiveness, and satisfaction of oncological management systems. This study also provides the value of Sustainable Development Goals (SDGs) with Good Health and Well-being, and decreased social withdrawal among patients with oral cancer.

Non-intrusive load monitoring (NILM) is a core technology for demand response (DR) and energy conservation services. Traditional NILM methods are rarely combined with practical applications, and most studies aim to decompose the whole loads in a household, which leads to low identification accuracy. In this paper, an NILM approach based on multi-feature integrated classification (MFIC) is explored, which combines some non-electrical features such as ON/OFF duration, usage frequency of appliances, and usage period to improve load differentiability. The implementation of MFIC algorithm is consistent with traditional event-based method. The uniqueness of our algorithm is that it designs an event detector based on steady-state segmentation and a linear discriminant classifier group based on multi-feature global similarity. Simulation results using an open-access dataset demonstrate the effectiveness and high accuracy of MFIC algorithm, with the state-of-the-art NILM methods as benchmarks.

The atomic nucleus contains protons and neutrons surrounded by a structured electron cloud. Some combinations of protons and neutrons induce the nucleus to behave like a microscopic magnet, possessing a unique magnitude and orientation known as the nuclear magnetic moment (µ). When the numbers of protons and neutrons are both even then µ=0, but otherwise each nu-clide’s nuclear magnetic moment is unique. A second unique nuclear physical property relates to the nucleon binding energy (BE), which can be thought of as the energy between protons and neu-trons bound within the nucleus. The sequence of stable nuclides increases one nucleon at a time through 36Ar. The binding energy associated with the addition of each successive nucleon (∆BE) through this progression is unique. The hypothesis here is that the unique non-zero magnetic mo-ment and ∆ binding energy of each nuclide derive from its respective microscopic nuclear struc-ture, analogous to the way that the atomic physical properties of an element ultimately derive from its unique electron orbital structure. By extension, the identification of nuclear periodic pat-terns might eventually inform a theory of nuclear structure. The light, stable nuclides through 36Ar were arranged in ascending order according to atomic mass, and their nuclear magnetic mo-ments and binding energies were evaluated for periodic patterns. Fixed-period lengths from 4 through 18 nuclides per period were considered. These fixed periods, each of equal length, were stacked one upon the other and analyzed for vertical trends. The best evidence of periodicity in both µ and ∆BE converges precisely at the fixed 12-nuclide period. Implications for nuclear structure are discussed.

Abstract Cerebral microbleed(s) (CMBs) are increasingly being viewed not only as a marker for cerebral small vessel disease (SVD) but also as having an increased risk for the development of stroke (hemorrhagic/ischemic) and aging-related dementia. Recently, brain endothelial cell activation and dysfunction and blood-brain barrier dysfunction and/or disruption have been shown to be associated with SVD, enlarged perivascular spaces, and the development and evolution of CMBs. CMBs are a known disorder of cerebral microvessels that are visualized as 3-5mm, smooth, round or oval, and hypointense (black) lesions seen only on T2*-weighted gradient recall echo or susceptibility-weighted sequences on MRI images. CMBs (a global problem) are known to occur with high prevalence in community-dwelling older individuals. Since our current global population is the oldest recorded in history and only expected to continue to grow, we can only expect the health care burdens associated with CMBs to also grow. CMBs should raise a red flag regarding the increased risk of large symptomatic neurologic intracerebral hemorrhages. Importantly, CMBs are also currently regarded as markers of diffuse vascular and neurodegenerative brain damage. Thus, it is essential that we try to learn as much as we can about their development, evolution, and their relation to impaired cognition, dementia, and neurodegeneration.

Taiwan’s auditors have suffered from processing excessive audit data, including drawing audit evidence. This study advances sampling techniques by integrating machine learning with sampling. This machine learning integration helps avoid sampling bias, keep randomness and variability, and target the risker samples. We first apply a Naive Bayes classifier to classify data into some classes. Next, a user-based, item-based, or hybrid approach is employed to draw audit evidence. The representativeness index is the primary metric for measuring the representativeness of audit evidence. The user-based approach denotes the selection of samples between two percentiles in a class as audit evidence. It may be equivalent to a combination of monetary and variable sampling methods. The item-based approach represents the choice of risky samples as audit evidence. It may be identical to a combination of non-statistical and monetary sampling methods. Auditors can hybridize those user-based and item-based approaches to balance representativeness and riskiness in selecting audit evidence. Three experiments show that sampling using machine learning integration has the benefits of drawing unbiased samples, handling complex patterns, correlations, and unstructured data, and improving efficiency in sampling big data. However, the limitations are the classification accuracy output by machine learning algorithms and the range of prior probabilities.

Households and businesses are generating unprecedented levels of electrical and electronic wastes (e-waste), fueled by modernisation and rapid obsolescence. While the challenges imposed by e-waste are similar everywhere in the world, disparities in progress to deal with it exists; with developing nations such as South Africa lagging. The increase in e-waste generation increases the need to formulate strategies to manage it. This paper presents an overview of e-waste management on a global and South African scenarios with a specific case for Cathode Ray Tube (CRT) waste management practices in South Africa. CRTs present the biggest problem for recyclers and policy makers because they contain hazardous elements such as lead and antimony. Common disposal practices have been either landfilling or incineration. The research into the South African practices with regards to CRT waste management showed that there is still more to be done to effectively manage this waste stream. This is despite clear waste regulatory frameworks in the country. However, recent developments have placed e-waste as a priority waste stream, which should lead to intensified efforts in dealing with it. Overall, these efforts should aim to maximise diversion from landfilling and to create value-addition opportunities, leading to social and environmental benefits.

Abstract: The recently described perivascular unit (PVU) resides immediately adjacent to the true capillary neurovascular unit (NVU) in the postcapillary venule and contains the normal-benign perivascular spaces (PVS) and pathological enlarged perivascular spaces (EPVS). The PVS are important, in that, they also have recently been identified to be the construct and the conduit responsible for the delivery of metabolic waste from the interstitial fluid to the ventricular cerebrospinal fluid for disposal into the systemic circulation and has been termed the glymphatic system. Importantly, the outermost boundary of the PVS is lined by protoplasmic perivascular astrocyte endfeet (pvACef) that communicate with regional neurons. As compared to the well-recognized and described neurovascular unit (NVU) and NVU coupling, the PVU is less well understood and remains an emerging concept. The primary focus of this narrative review is to compare the similarities and differences between these two units and discuss each of their structural and functional relationships and how they relate not only to brain homeostasis but also how they may relate to the development of multiple clinical neurological disease states and specifically how they may relate to obesity, metabolic syndrome, and type 2 diabetes mellitus. Additionally, the concept and importance of a perisynaptic astrocyte coupling to the neuronal synapses with pre- and postsynaptic neurons will also be considered as a perisynaptic unit to provide for the creation of the information transfer in the brain via synaptic transmission and brain homeostasis. Multiple electron microscopic images and illustrations will be utilized in order to help explain these complex units.

Various vaccines have been developed in response to the SARS-CoV-2 pandemic, and the safety of vaccines has become an important issue. COVID-19 vaccines-related central nervous system inflammatory demyelinating diseases (CNS IDDs) have been reported recently. We present one case of AstraZeneca vaccine-related myelin oligodendrocyte glycoprotein (MOG) antibody-associated disease and literature review another 78 patients published from January 2020 to October 2022. Patients were divided into three vaccine groups (viral vector, mRNA and inactivated vaccines) for further analyses. Among 79 patients with COVID-19 vaccines-related CNS IDDs, 49 (62%) cases received viral vector vaccines, 20 (25.3%) received mRNA vaccines and 10 (12.7%) received inactivated vaccines. Twenty-seven cases (34.2%) were confirmed with autoantibodies, including 15 patients (19%) with anti-MOG, 11 (13.9%) with anti-aquaporin 4 (AQP4), and one (1.3%) with both antibodies. Significantly, more males developed CNS IDDs post viral vector vaccines compared to mRNA and inactivated vaccines. Patients receiving mRNA vaccines were older than other groups. Furthermore, mRNA and inactivated vaccines correlated more with anti-AQP4 antibodies, while viral vector vaccines showed higher MOG positivity. The research suggests potential associations between COVID-19 vaccines-related CNS IDDs and gender, age, and autoantibodies, contingent on vaccine types. Protein sequence analysis implies similarities between the S protein and AQP4/MOG. Further studies may elucidate the mechanisms of CNS IDDs, aiding vaccine selection for specific groups.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

In this study, the preparation of the composite 3% Au/graphite-C3N4 (3% Au/g-C3N4) sensing material was prepared by doping 3% Au onto the surface of graphitic carbonitride (C3N4) for detection pimobendan. By the way of sensing materials characterization, the X-ray diffraction analysis (XRD) and transmission electron Microscope (TEM) were performed. The cyclic voltammetry (CV) was used to measure the concentration and redox properties of pimobendan. It can be seen that when the voltage value is 0.05 V, and a reduction peak was appeared and the pimobendan concentration (0 to 55 μM) has a relationship with the reduction current value. At low concentrations of pimobendan concentration from 0.0 to 0.8 μM, the linearity R2 = 0.9642 with a detection limit of 0.28 μM. A possible pimobendan sensing mechanism on 3% Au/g-C3N4 was proposed.

Building information modeling (BIM) is the digital representation of physical and functional characteristics (such as geometry, spatial relationship, and geographic information) of a facility to support decisions during its life cycle. BIM has been extended beyond 3D geometrical representations in recent years, and now includes time as a fourth dimension and cost as a fifth dimension, as well as such other applications as virtual reality and augmented reality. The Internet of Things (IoT) has been increasingly applied in various products (smart homes, wearables) to enhance work productivity, living comfort, and entertainment. However, research addressing the integration of these two technologies (BIM and IoT) is still very limited, and has focused exclusively on the automatic transmission of sensor information to BIM models. This paper describes an attempt to represent and visualize sensor data in BIM with multiple perspectives in order to support complex decisions requiring interdisciplinary information. The study uses a university campus as an example and includes several scenarios, such as an auditorium with a dispersed audience and energy saving options for rooms with different functions (mechanical/electric equipment, classrooms, and laboratory). This paper also discusses the design of a common platform allowing communication among sensors with different protocols (Arduino, Raspberry Pi), the use of Dynamo to accept sensor data as input and automatically redraw visualized information in BIM, and how visualization may help in making energy-saving management decisions.

Despite huge effort has been devoted to the design of the initiators and reaction conditions, it remains challenging to synthesize high molecular weight polypeptides with conventional solution phase synthesis. In this work, surface-initiated vapor deposition polymerization (SI-VDP) was utilized to graft synthetic polypeptides poly (γ-benzyl L-glutamate) (PBLG) from polystyrene (PS) resin beads by ring-opening polymerization of N-carboxyanhydrides (NCAs). It was demonstrated for the first time that high molecular weight bulk PBLG (> 500,000) could be readily obtained within one hour via solvent-free synthetic method which paves the way for the synthesis of copolypeptides with high molecular weight.

The spectra and global distributions of the X-ray emissions generated by the solar wind charge-exchange (SWCX) process in the terrestrial magnetosheath are investigated based on a global hybrid model and a global geocoronal hydrogen model. The solar wind O6+ ions which are the primary charge state for oxygen ions in solar wind are considered. The line emissivity of the charge-exchange born O5+ ions are calculated by Spectral Analysis System for Astrophysical and Lab oratory (SASAL). It is found that the emission lines from the O5+ ranges from 105.607 to 118.291 eV with the strong line at 107.047 eV. We then simulated the magnetosheath X-ray emission intensity distributions with a virtual camera at two positions of north pole and dusk at six stages during the passing of a perpendicular interplanetary shock combined with a tangential discontinuity structure through the Earth’s magnetosphere. During this process, the X-ray emission intensity increases with time, and the maximum value is 27.11 keV cm-2 s-1 sr-1 on the dayside, which is 4.5 times that before the solar wind structure reaches the Earth. A clear shock structure can be seen in the magnetosheath and moves earthward. The maximum emission intensity seen at dusk is always higher than that seen at north pole.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

Mitochondria are classically termed as powerhouse of a mammalian cell. Most of the cellular chemical energy in the form of adenosine tri phosphate (ATP) is generated by mitochondria and dysregulation of mitochondrial functions thus can be potentially fatal of cellular homeostasis and health. Acute respiratory distress has been earlier linked to mitochondrial dysfunction. SARS-CoV-2 infection severity leads to acute respiratory distress syndrome (ARDS) and can be fatal. We tried to investigate possible connection between SARS-CoV-2, ARDS and mitochondria. Here, we report identification of SARS-CoV-2 non-structural proteins (particularly Nsp12 and 13) that have recognition sequence with respect to mitochondrial entry. We also report that these proteins can potentially shuttle between cytoplasm and mitochondria based on the localization signals and help in downstream maintenance of the virus. Their properties to use ATP for enzymatic activities may cause ATP scavenging allowing viral RNA functions in lieu of host cell health.

Air pollution is a serious global issue, responsible for approximately one in every nine deaths each year, ranking it among the greatest environmental hazards to human health. It is of particular concern in urban areas, where elevated pollutant concentrations and potential sufferers converge. Over one half of the world’s population presently lives in urban areas, and the urban population ratio is expected to reach 68% by 2050. Common air pollutants include particulate matter (PM), sulphur dioxide (SO2), ground-level ozone (O3), nitrogen oxide (NOx) and carbon monoxide (CO). While elevated rates of air pollution pose serious health risks for humans, outdoor plants can help reduce the harmful effects of air pollution by filtering and purifying the air around us.In this project Common Ivy, Aster and Miniature Andromeda plants were evaluated for air pollutant mitigation. In this study we developed a vegetation barrier model with the plant located in the middle of the greenhouse box, and air pollutant was sprayed on one side of the plant. Dispersion patterns of sprayed pollutants were tested with and without vegetation barrier. Measurements of carbon dioxide (CO2), Formaldehyde (HCHO), Total Volatile Organic Compounds (TVOC), and Particulate Matter (PM2.5/PM10) were taken before spraying, then at 0 and 30 minutes after spraying, using both monitors.The results show mitigation rates (in 177 ft3 of air after 30 min): for TVOC the minimum reduction is 5 mg/m3; for HCHO, 1 mg/m3; for CO2, 2000 ppm; for PM2.5, 2000 ug/m3; and for PM10 it was 1000 ug/m3.

This paper presents a two-stage ADC based on pseudo-differential operational transconductance amplifier (OTA), which is designed for the readout circuit of X-ray linear array sensor. This hybrid ADC employs an incremental sigma-delta ADC and a cyclic ADC, achieving a good trade-off between accuracy and conversion speed. The two stages share the same hardware to reduce power consumption and die area. A common-mood feedback module is used to suppress the influence of charge injection, and the effectiveness is demonstrated by detailed theoretical analysis. A test chip of 14-bit ADC is fabricated in 0.35μm CMOS technology. The measured root mean square (RMS) value of DNL is 0.254 LSB, and the maximum value of INL is -0.776/+1.56 LSB. The measured effective number of bits (ENOB) is 13.43 bits.

Field-effect transistor (FET)-based biosensors stand as powerful analytical tools for detecting trace-specific biomolecules in diverse sample matrices, especially in the realms of pandemics and infectious diseases. The primary concern in applying these biosensors is their stability, a factor directly impacting the accuracy and reliability of sensing over extended durations. The risk of biosensor degradation is substantial, potentially jeopardizing sensitivity and selectivity and leading to inaccurate readings, including the possibility of false positives or negatives. This paper delves into the documented degradation of silicon nanobelt FET (NBFET) biosensors induced by buffer solutions. The results highlight a positive correlation between immersion time and the threshold voltage of NBFET devices. Secondary ion mass spectrometry analysis demonstrates a gradual increase in sodium and potassium ion concentrations within the silicon as immersion days progress. This outcome is ascribed to the nanobelt's exposure to the buffer solution during the biosensing period, enabling ion penetration from the buffer into the silicon. The study emphasizes the critical need to address buffer solution-induced degradation to ensure the long-term stability and performance of FET-based biosensors in practical applications.

GaN ultraviolet photodetector with metal-semiconductor-metal structure is achieved by growing on a periodic trapezoid column-shape patterned sapphire substrate using metalorganic chemical vapor deposition. Under 5-V reverse bias, the photodetector fabricated on such patterned sapphire substrate exhibits a lower dark current, a higher photocurrent, and a 476 % enhancement in the maximum responsivity as compare with those of the photodetector fabricated on conventional flat sapphire substrate. It is also found that the much larger UV-to-visible rejection ratio and the fact that responsivity drops in a smaller cut-off region are observed from photodetector fabricated by using a periodic trapezoid column-shape patterned sapphire substrate. These phenomena may all be attributed to the reduction of threading dislocation density and the improved quality of GaN film, as well as the internal reflection and/or scattering effect on the interface between GaN film and the periodic trapezoid column-shape pattern of the substrate.

Xinjiang, as a climate-sensitive region in northwest China, holds significant importance in studying extreme weather events for agricultural production and socioeconomic development. Based on data from 52 meteorological stations and 23 extreme climate indicators in Xinjiang from 1960 to 2021, the 5a moving average, linear trend estimation, climate tendency rate, and GIS spatial analysis methods are used to analyze the distribution and change characteristics of extreme climate. The results revealed that from 1960 to 2021, TXx, TNx, TXn, TNn, FD, ID, TN10p, TX10p, and WSDI showed a significant upward trend, while SU, TR, TN90p, TX90p, and CSDI showed a significant downward trend. What is more, the range of changes in the extreme temperature indexes from 1990 to 2021 is higher than that of 1960 to 1989. The high-value areas of extreme indexes are primarily concentrated in the northern part, while the high-value areas of cold event indexes are mainly distributed in the southern part. The upward/downward trends all accounting for over 80.00% of the entire region. The Rx1day, Rx5day, PRCPTOT, R95p, R99p, R10, R20, and R25 showed a significant growth trend from 1960 to 2021, and the range of change in the extreme precipitation indexes from 1990 to 2021 was lower than that from 1960 to 1989. Moreover, their high-value areas and high climate tendency areas are mainly concentrated in the northern and western parts of Xinjiang, with upward trends all accounting for over 71.00% of the entire region. The research results provide theoretical foundations for formulating climate risk strategies in the northwest region of China.

A multiscale model that enables quantitative understanding and prediction of the size effect on scattering properties of micro- and nanostructures is crucial for the design of LED surface textures optimized for high light extraction efficiency (LEE). In this paper, a hybrid process for combining full-wave finite-difference time-domain simulation and a ray-tracing technique based on a bidirectional scattering distribution function model is proposed. We apply this method to study the influence of different pattern sizes of a patterned sapphire substrate on GaN-based LED light extraction from the microscale to the nanoscale. The results show that near-wavelength–scaled patterns with strong diffraction are not expected to enhance LEE. By contrast, microscaled patterns with optical diffusion behavior have the highest LEE at a specific aspect ratio, and subwavelength-scaled patterns that have antireflection properties show marked enhancement of LEE for a wide range of aspect ratios.

For applications in sensing and cavity-based quantum computing and metrology, open-access Fabry-Perot cavities – with an air or vacuum gap between a pair of high reflectance mirrors – offer important advantages compared to other types of microcavities. For example, they are inherently tunable using MEMS-based actuation strategies, and they enable atomic emitters or target analytes to be located at high field regions of the optical mode. Integration of curved-mirror Fabry-Perot cavities on chips containing electronic, optoelectronic, and optomechanical elements is a topic of emerging importance. Micro-fabrication techniques can be used to create mirrors with small radius-of-curvature, which is a prerequisite for cavities to support stable, small-volume modes. We review recent progress towards chip-based implementation of such cavities, and highlight their potential to address applications in sensing and cavity quantum electrodynamics.

This study proposed a spatially and temporally improving methodology adopting the Regional Frequency Analysis with L-moments approach to estimate rainfall quantiles from 22787 grids of radar rainfall in Taiwan for a 24-hour duration. Due to limited radar coverage in the eastern region, significant discordant grids were found in the coastal area of the eastern region. A K-means cluster analysis using scaled at-site characteristics was used to group the QPESUMS grids in Taiwan into 22 clusters/sub-regions based on their characteristics. Spatially, homogeneous subregions with QPESUMS data produce more detailed homogeneous subregions with clear and continuous boundaries, especially in the mountain range area where the number of rain stations is still very limited. According to the results of z-values and L-moment ratio diagrams, the Wakeby (WAK), Generalized Extreme Value (GEV), and Generalized Pareto (GPA) distributions of rainfall extremes fitted well for the majority of subregions. The Wakeby distribution was the dominant best-fitted distribution, especially in the central and eastern regions. The east of the northern part and southern part of Taiwan had the highest extreme rainfall for each return period. Both areas were frequently struck by typhoons. By using grid-based (at-site) as the basis for assessing regional frequency analysis, the results show that the regional approach in determining extreme rainfall is very suitable for large-scale applications and even better for smaller scales such as watershed areas. The spatial investigation was performed by establishing regions of interest in small subregions across the northern part. It showed that regionalization was correct and consistent.

Background: LncRNA and pyroptosis play important roles in cancer development and tumor immune microenviroment. However, pyroptosis-related lncRNAs (PRLs) in ovarian cancer have not been identified and its impact on prognosis and immune response are not fully understood. Methods: Using pearson correlation analysis, PRLs were screened. Subsequently, we constructed a prognosis signature by using LASSO cox regression. In addition, the association between risk score and cancer immune environment was analyzed. Results: In TCGA-RNA-seq cohort (n=377), 32 prognostic PRLs were selected and a 7-gene signature were developed and had high accuracy in predicting the OS of ovarian cancer patients. Stratification analysis suggested that it might serve as an independent prognostic indicator. Except to clinical outcome, the signature was significantly associated with tumor immune microenvironment. Patients with high risk score exhibited lower infiltration abundance of MHC class Ⅰ cells, Type Ⅰ IFN response and immunotherapy response. In ovarian cancer, TYMSOS was highly expressed and its high expression was associated with worse OS. TYMSOS deletion in ovarian cancer cell lines inhibited the cell proliferation, invasion and migration, indicating that it might serve as a novel biomarker in ovarian cancer. Conclusions: The prognostic PRLs signature constructed in this work is available for prognostic prediction and immune microenvironment infiltration in ovarian cancer.

We used an ultrasensitive, broadband optomechanical ultrasound sensor to study the acoustic signals produced by pressurized nitrogen escaping from a variety of small syringes. Harmonically related jet tones extending into the MHz region were observed for a certain range of flow (i.e., Reynolds number), in qualitative agreement with historical studies on gas jets emitted from pipes/orifices of much larger dimensions. For higher turbulent flow rates, we observed broadband ultrasonic emission in the ~ 0 – 5 MHz range, likely limited on the upper end by attenuation in air. These observations are made possible by the broadband, ultrasensitive response (for air-coupled ultrasound) of our optomechanical devices. Aside from their theoretical interest, our results could have practical implications for the non-contact monitoring and detection of early-stage leaks in pressured fluid systems.

The purposes of this study are based upon the theory of planned behavior (TPB) to examine the impact of past experiences of contract farming on selecting a specific type of contract farming in the future and then compare different psychological factors in the TPB for different potential contract farmer statuses. These statuses include homesteaders, farmers from cooperative farms, farmers from production and sales teams, professional farmers, and brokers. The impact of factors in the TPB for a particular contract type on potential contract farmers is further to compute. To this end, data are collected in three major sweet potato production areas in Taiwan. The results show that the farmers’ past contract farming experience does not influence the selection of the contract in the future. As for the selection of contract type, strengthening the perception and motivating the behavioral intention of contract farming for cooperative farms will increase the probability of selecting an unclassified sweet potato size contract. On the other hand, enhancing perceived behavioral control factors and behavioral intention factors for professional farmers and brokers is apt to have a relatively high probability of selecting those types involving the highest amount or the best price to obtain the best deal.

Multi-wire saw machining (MWSM) used for slicing hard-brittle materials in semiconductor, is an important material removal process that uses free abrasives. Cutting model of single-wire saw machining (SWSM) is the basis of MWSM, and the material removal mechanism of SWSM can better understand than MWSM. Mathematical model (includes brittle fracture and plastic deformation) is presented in this paper for SWSM ceramic with abrasives. This paper determines the effect of various machining parameters on the removal of hard-brittle materials. For brittle fracture of SWSM ceramics, the minimum of the strain energy density is used as a fracture criterion. The material removed of SWSM ceramics due to plastic deformation is calculated using the equations of motion. Actual wire-sawing experiments are conducted to verify the results from the developed mathematical model. Theoretical results agree with experimental data and practical experience. The developed mathematical model shows that brittle fracture plays a major concern role in material removed of SWSM ceramics. Wire speed and working load have positively correlated with material removed of SWSM ceramics. The coefficient of friction is low, a lateral crack, which propagates almost parallel to the working surface, leads to more brittle fracture and material removed is increased on SWSM ceramics.

In hepatocellular carcinoma (HCC), recurrence usually occurs after curative surgical resection. Currently, no approved adjuvant therapy has been shown to reduce recurrence rates. In this report, the in vivo mouse effect of sequential combination treatment with recombinant mouse interferon-alpha (rmIFN-α) and an anti-mouse-PD1 antibody on hepatitis B virus (HBV) clearance was evaluated. A phase I clinical trial was then conducted to assess the safety, tolerability, and inhibitory activity of sequential therapy with ropeginterferon alfa-2b and nivolumab in HCC recurrence in patients who have undergone curative surgery for HBV-related HCC. In animal modeling, HBV suppression was significantly greater with rmIFN-α and anti-PD1 sequential combination treatment than with their treatment alone. In the Phase I study, eleven patients completed the sequential therapy with ropeginterferon alfa-2b every two weeks at the dose of 450 µg for six doses, followed by three doses of nivolumab every two weeks up to 0.75 mg/kg. A notable decrease or clearance of HBV surface antigen was observed in two patients. Dose-limiting toxicity of grade 3 alanine transaminase and aspartate aminotransferase increases was observed in one patient. The maximum tolerated dose was determined. Currently no HCC recurrence has been observed. The treatment modality was well tolerated. The data support further clinical development of sequential combination therapy as a post-surgery prophylactic measure against the recurrence of HBV-related HCC.

We aimed to investigate the mechanism underlying social stress (SS)-induced erectile dysfunction (ED) and evaluate the effects of a single sub-anesthetic dose of ketamine on SS-related ED. Male FVB mice were exposed to retired male C57BL/6 mice for 60 minutes daily over a 4-week period. In the third week, SS mice received intraperitoneal injections of either saline (SSS group) or ketamine (SSK group). Erectile function was assessed by measuring intra-cavernosal pressure (ICP) during electrical stimulation at the major pelvic ganglia. Corpus cavernosum (CC) strips were utilized for wire myography to assess their reactivity. Both SSS and SSK mice exhibited significantly lower ICP in response to electrical stimulation than control. SS mice showed increased contractility of CC induced by phenylephrine. Acetylcholine-induced relaxation was significantly reduced in SSS and SSK mice. Sodium nitroprusside-induced relaxation was higher in SSS mice compared to control and SSK mice. Nicotine-induced neurogenic and nitric oxide (NO)-dependent relaxation was significantly impaired in both SSS and SSK mice. Immunohistochemically analysis revealed co-localization of tyrosine hydroxylase and neuronal nitric oxide synthase (nNOS)-immunoreactive fibers in the CC. These findings highlight the complex nature of SS-related ED and suggest the limited efficacy of ketamine as a therapeutic intervention in this condition.

A Cu₂ZnSnS₄ (CZTS) film with a thickness of approximately 1.5 μm was fabricated on a Mo-coated glass substrate by annealing a CZTS precursor fabricated from nanoparticle ink. The chemical states of the elements in the CZTS thin film in the depth direction were studied to identify the presence of secondary phases, which are detrimental to the performance of solar cells containing CZTS. X-ray diffraction was unable to detect any secondary phases in CZTS because of their small relative amount. Instead, X-ray photoelectron spectroscopy (XPS), which is highly sensitive to chemical state, was conducted at different depths in the CZTS film to further check the presence of secondary phases. XPS analysis revealed peaks shift consistent with the presence of secondary phases. For the CZTS film annealed in a S atmosphere at 575 °C for 3 h, the film surface consisted of a secondary-phase layer composed of CuS, ZnS, and SnSx (x=1 or 2) originating from the decomposition of CZTS. At depths below 80 nm, the film was pure CZTS. Formation of MoS2 at the CZTS–Mo interface was confirmed by XPS analysis of Mo and S.

Previous investigations have illuminated the significant association between the gut microbiome and a broad spectrum of health conditions, including obesity, diabetes, cardiovascular diseases, and psychiatric disorders. Evidence from certain studies suggests that dysbiosis of the gut microbiota may play a role in the etiology of obesity and diabetes. Moreover, it is acknowledged that dietary habits, pharmacological interventions, psychological stress, and other exogenous factors can substantially influence the gut microbial composition. For instance, a diet rich in fiber has been demonstrated to increase the population of beneficial bacteria, whereas the consumption of antibiotics can reduce these advantageous microbial communities. In light of the established correlation between the gut microbiome and various pathologies, strategically altering the gut microbial profile represents an emerging therapeutic approach. This can be accomplished through the administration of probiotics or prebiotics, which aim to refine the gut microbiota and, consequently, mitigate the manifestations of associated diseases. The present manuscript evaluates recent literature on the relationship between gut microbiota and metabolic syndrome published over the past three years and anticipates future directions in this evolving field.

Lactoperoxidase (LP), which is a high-value minor whey protein, has recently drawn extensive attention from research scientists and industry due to its multi-function and potential therapeutic applications. In this study, the separation and optimization of two similar-sized proteins, LP and lactoferrin (LF) were investigated using strong cation exchange column chromatography. Optimization was started with central composite design based experiments to characterize the importance of different decision variables. The three variables used in the optimization were flow rate, length of gradient and final salt concentration in the linear elution gradient step. The obtained empiric functional model represented the effect of the significant factors on the yield as the objective function. Afterwards, the calibrated mechanistic model was employed to predict accurate optimal set of variables. The optimal operating points were found and the results were compared with validation experiments. Predictions respecting yield confirmed a very good agreement with experimental results while keeping purity, a product quality characteristic, equal or above to a predefined value.

This short communication makes use of the principle of singular perturbation to approximate the ordinary differential equation (ODE) of prompt neutron (in the point kinetics model) as an algebraic equation. This approximation is shown to yield a large gain in computational efficiency without compromising any significant accuracy in the numerical simulation of primary coolant system dynamics in a PWR nuclear power plant. The approximate (i.e., singularly perturbed) model has been validated with a numerical solution of the original set of neutron point-kinetic and thermal–hydraulic equations. Both models use variable-step Runge–Kutta numerical integration.

Water quality monitoring was an important objective in the surroundings. In this study, we investigated the sensing characteristics of the arrayed flexible chloride sensor with XBee wireless sensing system. The sensitivity and linearity of the wireless chloride sensing devices were 91.6 mV/pCl and 0.988, respectively. The hysteresis voltages were 50.14 mV and 36.71 mV during the cycles of 1 M → 10⁻¹ M → 1 M → 10⁻³ M → 1 M and 1 M → 10⁻³ M → 1 M → 10⁻¹ M → 1 M, respectively. The selectivity coefficients of the ClO⁻ ion, ClO₄⁻ ion, NO₃⁻ ion and I⁻ ion for Cl⁻ ion were 5.0 × 10⁻², 1.0 × 10⁻¹, 5.9 × 10⁻³ and 5.6×10⁻¹, respectively. The sensing characteristics of real time measurement were investigated for dynamic microfluidic. The arrayed flexible chloride sensor was integrated with the microfluidic device, syringe pump and wireless sensing system. The sensitivity and linearity were 273.1 mV/pCl and 0.978 at 35 μL/min, respectively.

In Taiwan, mountainous areas account for approximately two-thirds of the total area. The steep terrain and concentrated rainfall during typhoons cause landslides, which pose a considerable threat to mountain settlements. Therefore, models for analyzing rainfall-induced landslide hazards are urgently required to ensure adequate land use in mountainous areas. In this study, focusing on Pingtung County in southern Taiwan, we developed a landslide hazard index (IRL) to land use. Using FORMOSA-2 and SPOT-5 satellite images, data were collected before and after four typhoons (one in 2009 and three in 2013). The ArcGIS random tree classifier was used for interpreting satellite images to explore surface changes and disasters, which were used to analyze slope disturbances. The product of the maximum 3-h rolling rainfall intensity and effective accumulated rainfall was used as a rainfall trigger index (IRT). Considering environmental and slope disturbance factors, an index of slope environmental strength potential (ISESP) was developed through logistic regression (LR). Landslide hazard to land use was estimated using IRT and ISESP. The average coefficient of agreement (Kappa) was approximately 0.71 (medium to high accuracy); the overall accuracy of slope environmental strength potential analysis was approximately 80.4%. At a constant ISESP, IRT increased with the increasing hazard potential of rainfall-induced landslides. Furthermore, IRT and ISESP were positively correlated with landslide occurrence. When large ISESP values occur (e.g., fragile environment and high land development intensity), small IRT values may induce landslides.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

In this article, we introduce the concept of soft intervals, soft ordering and sequences of soft real numbers, and some of their structural properties are studied. The notion of soft Lebesgue measure on the soft real numbers has been introduced. Also, a correspondence relationship has been established between the soft Lebesgue measure and the classical Lebesgue measure. Furthermore, we have studied some exciting results and relations between the soft Lebesgue measure and the Lebesgue measure of soft real sets.

Building a widely distributed hotspot network is a very tedious task due to its complexity. Providing security, fully distributed network services, and cost-conscious impact are the major challenges behind this goal. To overcome these issues, we have presented a novel distributed hotspot network architecture with five layers that can provide large-scale hotspot coverage as an assimilated result. Our contributions to this new architecture highlight important aspects. First, scalability can be increased by including many Internet-of-Things (IoT) devices with sensors and Wi-Fi and/or LoraWAN connectivity modules. Second, hotspot owners can rent out their hotspots to create a distributed hotspot network in which the hotspots can act as an ordinary data gateway, a full-fledged hotspot miner, and a lightweight hotspot miner to earn crypto tokens as rewards for certain activities. Third, the advantages of Wi-Fi and LoraWAN can be seamlessly leveraged to achieve optimal coverage, higher network security, and suitable data transmission rate for transferring sensor data from IoT devices to remote application servers and users. Fourth, blockchain is used to enhance the decentralized behavior of the architecture presented here by providing immutability and independence from a centralized regulator and making the network architecture more reliable and transparent. The main feature of our paper is the use of the tau-computing paradigm along with hotspots to improve availability, Internet backhaul-agnostic network coverage, and synchronous update capability, and tau-aware leasing to strengthen and improve coverage. We also discuss the key challenges and future roadmap that require further investment and deployment.

A fast and effective determination method of different species of vegetable seeds oil is vital in the plant oil industry. The near-infrared reflectance spectroscopy (NIRS) method was developed in this study to massively analyze the oil and moisture contents of Camellia gauchowensis Chang and C. semiserrata Chi seeds kernels. In the prediction models of NIRS, the levels of accuracy obtained were sufficient for C. gauchowensis Chang and C. semiserrata Chi, the correlation coefficient of which oil were 0.983 and 0.962, respectively, while which of moisture were 0.937 and 0.907, respectively. The near infrared spectrum of crush seeds kernels was more precise compared to intact kernels. Based on the calibration models of the two Camellia species, the NIRS predictive oil contents of C. gauchowensis Chang and C. semiserrata Chi seeds kernels were 48.71 ± 8.94% and 31.71 ± 7.39%, respectively, and the NIRS predictive moisture contents were 4.39 ± 1.08% and 3.49 ± 0.71%, respectively. Compared with the traditional chemical measurement, the rapid, precise measurement of oil and moisture of C. gauchowensis Chang and C. semiserrata Chi seeds kernels can be actualized by NIRS method.

The main objective of this study is to find out the influence of cooperation and intra-specific competition in escaping predation through refuge of the prey population and the effect of the two intra-specific interactions on the dynamics of prey-predator systems. For this purposes, two mathematical models with Holling type-II functional response function have been proposed and analyzed. The first model includes cooperation among prey populations whereas the second one incorporates intra-specific competition. Existence conditions and stability of different equilibrium points of both models have been carried out for the qualitative behaviour of the systems. Refuge through intra-specific competition has a stabilizing role, whereas cooperation has a destabilizing role on the system dynamics. Periodic oscillations are observed in both the systems through Hopf bifurcation. From the analytical and numerical findings, we conclude that intra-specific competition affects the prey population and continuously checks the refuge class under a critical value, and thus it never becomes too large to cause predator extinction due to food scarcity. Conversely, cooperation leads maximum individuals to escape predation through the refuge so that predators will suffer from low predation success.

The log interpretation and evaluation of Chang 8 tight sandstone reservoir in Longdong West area, Ordos Basin, is facing great challenges due to the existence of low resistivity contrast oil pays. To better guide the exploration of oil resources in this area, the characteristics and control mechanism of low resistivity contrast oil pays were studied in this research. Firstly, according to the relative value of apparent resistivity increase rate of the target formation, the reservoir was divided into two types: low resistivity contrast oil pay (LRCP) and high resistivity oil pay (HRP). Then, the reservoir characteristics were studied by comparing and analyzing the experimental data, formation water data and logging data collected from the two reservoir types. On this basis, the control mechanism of LRCP was studied and summarized into reservoir micro factors and regional macro factors, respectively. It is found that the reservoir rock composition between LRCP and HRP is basically the same. Compared with HRP reservoir, the average porosity and permeability of LRCP reservoir are relatively better, but the pore structure is relatively poorer because of the high content of micro pores. When the filling pressure of crude oil is sufficient enough, the high oil saturation can be formed in LRCP reservoir. The high irreducible water saturation and high formation water salinity are the main micro factors reduced the reservoir resistivity. Besides, the difference of hydrocarbon expulsion capacity of source rock and the regional difference of formation water salinity are the macro factors influenced the distribution of LRCP and HRP from vertical and horizontal of the region. The formation of LRCP is controlled by the comprehensive influence of reservoir micro factors and regional macro factors. And the comprehensive consideration of the influence of micro factors and macro factors on LRCP is suggested during the log interpretation and evaluation.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

Globally increasing antibiotic resistance has been connected to the use of antibiotics in medical, veterinary, and agricultural medicine, contributing to the burden of antibiotic resistance in Asia and Europe. The main objective of this study was to correlations of antimicrobial-resistant of various pathogens in three compartments: humans, animals and the environment in India and Germany. A systematic search was carried out in Medline via PubMed, Google Scholar, and science direct, including studies published in 2022. Out of 532 papers, 24 were considered for meta-analysis. This study reveals that in India, β-lactam is highly resistant in animals. Quinolone, on the other hand, was highly resistant in humans. Furthermore, in the environment and integrated studies, aminoglycosides and β-lactams is resistant. While in Germany, a high rate of AMR resistance in all three sectors was reported in β-lactam. However, E. coli was the most frequent pathogen in both countries and is highly resistant to β-lactam, followed by cephalosporin in all the compartments. Monitoring and evaluating antibiotic-sensitivity patterns and developing proper antibiotic regimens may lead to improved outcomes for inhibiting and controlling E. coli infections in various parts of the world.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

General Linear Modelling (GLM) has been widely employed to estimate the hemodynamic changes evoked by cognitive processing, which are more likely to be nonlinear than linear. First, this study re-analyzed the fNIRS data (N = 38, Mage = 5.0 years, SD = 0.69 years, 17 girls) collected in the Mixed-Order Design Dimensional Change Card Sort (DCCS) task. The results indicated that the quadratic equation was better than GLM to model HbO changes in this task. Second, analysis of a new set of data indicated that the Habit-DisHabit design of DCCS was more effective in identifying the neural correlates of cognitive shifting than the Mixed-Order Design. Third, this study found that the Non-users were more attentive and engaged than the Heavy-users, with a slower but more steady increase of brain activation in BA8 and BA9.

This study aims to examine the impact of tablet use on preschoolers’ executive function during the Dimensional Change Card Sort Task (DCCS) task using the functional near-infrared spectroscopy (fNIRS). Altogether 38 Chinese preschoolers (Mage = 5.0 years, SD = 0.69 years, 17 girls) completed the tasks before the COVID-19 lockdown. Eight children never used tablets, while 16 children were diagnosed as the ‘heavy-user'. The results indicated that: (1) the 'Non-user' outperformed the 'Heavy-user' with a significantly higher correct rate in the DCCS task; (2) the two groups differed significantly in the activation of the prefrontal cortex (BA 9): the 'Non-user' pattern is normal and healthy, whereas the 'Heavy-user' pattern is not normal and needs further exploration.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Bat feces were reported in ancient Chinese medicine books to have the effect of reducing heat and improving eyesight, but the mechanism of vision improvement still needs further research. To this end, we used 2,2-diphenyl-1-picrylhydrazyl (DPPH) and liquid chromatography/tandem mass spectrometry (LC/MS/MS) to analyze the antioxidant capacity of and the types of vitamins in bat feces. We hoped to screen the pharmacological components of bat feces, and to explain the role that these components may play in the treatment of visual deterioration. Our results found that bat feces had a good antioxidant capacity and mainly contain vitamins B1 (thiamine), B2 (riboflavin), B3 (nicotinamide), B3 (nicotinic acid), and B5 (pantothenic acid). Although these vitamins may help maintain the health of the optic nerve and cornea, the vitamin content of bat feces is low, but the heavy metal content is high, as shown using inductively coupled plasma mass spectrometry (ICP-MS) analysis. Therefore, we suggest that the use of bat feces as traditional Chinese medicine to improve vision should be strictly restricted.

This paper proposes a method to utilize weather and land cover models to generate future environmental scenarios, and presents the watershed models to simulate the hydrological impact on watershed-scale hydrology. The Weather Generator model and General Circulation Model were applied to produce rainfall and local temperature under different climate conditions, and the Conservation and Land Use and its Effects model was incorporated to simulate future land cover variability. The circumstances of future climate and land cover changes were used as inputs to drive the HEC-HMS rainfall runoff model for obtaining surface runoff in a mountainous area. The WASH123D model was then utilized for the entire watershed simulation. Modeling results were then examined to discuss hydrological impacts on three different time periods: near future (2020-2039), future (2050-2069), and distant future (2080-2099). The Fengshan Creek basin in northern Taiwan was selected as study site. Simulations results indicated that the influence of climate change revealed more relevant effects when compared to local land cover changes. The ground water levels tended to diminish as the land cover area changed. In addition, both river and groundwater levels reveal that it is drier in dry season and wetter in wet season in future.

The aim of this study was to examine the prevalence of self-reported and parent-reported bullying victimization, perpetration, and victimization-perpetration and the associations of autistic social impairment and attention-deficit/hyperactivity disorder (ADHD) and oppositional defiant disorder (ODD) symptoms with bullying involvement in adolescents with high functioning autism spectrum disorder (ASD). A total of 219 adolescents with high functioning ASD participated in this study. The associations of sociodemographic characteristics, parent-reported autistic social impairment on the Chinese Social Responsiveness Scale, and parent-reported ADHD and ODD symptoms on the Short form of the Swanson, Nolan, and Pelham Version IV Scale (SNAP-IV)-Chinese version with self-reported and parent-reported bullying victimization, perpetration, and victimization-perpetration evaluated using the Chinese version of the School Bullying Experience Questionnaire were examined using logistic regression analysis. The agreement between self-reported and parent-reported bullying involvement was low. Compared with bullying involvement experiences reported by adolescents themselves, parents reported higher rates of pure bullying victimization (23.7% vs. 17.8%) and victimization-perpetration (28.8% vs. 9.1%) but a lower rate of pure bullying perpetration (5.9% vs. 9.1%). Deficit in socio-communication increases the risk of being pure victims and victim-perpetrators. Parent-reported victim-perpetrators had more severe ODD symptoms than did parent-reported pure victims. The agreement between self-reported and parent-reported bullying involvement of adolescents with high functioning ASD was low. Deficit in socio-communication and ODD symptoms were significantly associated with a high risk of bullying involvement in adolescents with high functioning ASD.

Abstract. Graphene family (GF)-Calcium phosphate (CaP) composites, holds great potential as components of bone regeneration materials. GF nanomaterials can be modified physically as well as chemically, which are to be biomimetic, mechanically to be hard due to their capability to support exceptional mechanical, thermal and electronic properties. These biocompatible GF composites coated on the calcium phosphate can enhance and tolerate stem cell growth and differentiation, proliferation into various lineages or interact with bioorganisms. The development in CF-CaP materials and their physicochemical/biointeractions and strategies towards osteoblasts is a great concern to promote faster healing and reconstructions of large bone imperfections or defects. In this review, we explain the influence of the CF-CaP and summarize recent developments on designing CF-CaP architectures as multifunctional bone regeneration platforms. We have also explored the typical biological applications concerning these CF-CaP based bioactive nanocomposites. Furthermore, the future viewpoints and evolving challenges will also be emphasized. Due to the shortage of full-length reviews in this emerging research field, this review would be caught great attention and encourage various new chances across a wider range of disciplines.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

The Cosmic-Ray Extremely Distributed Observatory (CREDO) is a project dedicated to global studies of extremely extended cosmic-ray phenomena, the cosmic-ray ensembles (CRE), beyond the capabilities of existing detectors and observatories. Up to date cosmic-ray research has been focused on detecting single air showers, while the search for ensembles of cosmic-rays, which may overspread a significant fraction of the Earth, is a scientific terra incognita. Instead of developing and commissioning a completely new global detector infrastructure, CREDO proposes approaching the global cosmic-ray analysis objectives with all types of available detectors, from professional to pocket size, merged into a worldwide network. With such a network it is possible to search for evidences of correlated cosmic-ray ensembles. One of the observables that can be investigated in CREDO is a number of spatially isolated events collected in a small time window which could shed light on fundamental physics issues. The CREDO mission and strategy requires active engagement of a large number of participants, also non-experts, who will contribute to the project by using common electronic devices (e.g. smartphones). In this note the status and perspectives of the project is presented.

Dengue virus (DENV), being one of the lethal pathogens in the hot climatic regions of the world, have been extensively studied to decipher its mechanism of pathogenesis and missing links of its life cycle. With respect to the entry of DENV, multiple receptors have been recognised in different cells of the human body. However, scientists still argue whether these identified receptors are the exclusive entry mediators for the virus. Adding to the complexity, DENV has been reported to be infecting multiple organ types in its human host. Also, more than one receptor in a particular cell has been discerned to take part in mediating the ingress of DENV. In this review, we aim to discuss about the different cells of the human immune system that support DENV infection and their corresponding receptors that DENV deploy to gain access to the cells.

In this study, we introduce the concept and construction of an innovative Digital Miniature Cathode Ray Magnetometer designed for the precise detection of magnetic fields. This device addresses several limitations inherent to magnetic probes such as D.C. offset, nonlinearity, temperature drift, sensor aging, and the need for frequent recalibration, while capable of oper-ating in a wide range of magnetic fields. The core principle of this device involves the utilization of a charged particle beam as the sensitivity medium. The system leverages the interaction of an electron beam with a scintillator material, which, then, emits visible light that is captured by an imager. The emitted scintillation light is captured by a CMOS sensor. This sensor not only rec-ords the scintillation light but also accurately determines the position of the electron beam, providing invaluable spatial information crucial for magnetic field mapping. The key innova-tion lies in the combination of electron beam projection, CMOS imager scintillation-based de-tection and digital image signal processing. By employing this synergy, the magnetometer achieves remarkable accuracy, sensitivity and dynamic range. The precise position registration enabled by the CMOS sensor further enhances the device's utility in capturing complex magnetic field patterns, allowing for 2D field mapping. In this work, the optimization of the probe's per-formance is tailored for applications related to the characterization of insertion devices in light sources, including undulators.

We investigate the behavior of the solutions of the ray equation in isotropic media. We discuss local and global transversals and wavefronts and give examples of rays without wavefronts.

The Cosmic Ray Extremely Distributed Observatory (CREDO) is a newly formed, global collaboration dedicated to observing and studying cosmic rays (CR) and cosmic ray ensembles (CRE): groups of a minimum of two CR with a common primary interaction vertex or the same parent particle. The CREDO program embraces testing known CR and CRE scenarios, and preparing to observe unexpected physics, it is also suitable for multi-messenger and multi-mission applications. Perfectly matched to CREDO capabilities, CRE could be formed both within classical models (e.g. as products of photon-photon interactions), and exotic scenarios (e.g. as results of decay of Super Heavy Dark Matter particles), their fronts might be significantly extended in space and time, and they might include cosmic rays of energies spanning the whole cosmic ray energy spectrum. CRE are expected to be partially observable on Earth even if the initiating interaction or process occurs as far as ~1 Gpc away. They would have a footprint composed of at least two extensive air showers with correlated arrival directions and arrival times. Since CRE are mostly expected to be spread over large areas and, because of the expected wide energy range of the contributing particles, CRE detection might only be feasible when using available cosmic ray infrastructure collectively, i.e. as a globally extended network of detectors. Thus, with this review article, the CREDO Collaboration invites the astroparticle physics community to actively join or to contribute to the research dedicated to CRE, and in particular to share any cosmic ray data useful for the specific CRE detection strategies.

Heat dissipation from Li-ion batteries is a potential safety issue for large-scale energy storage applications. Maintaining low and uniform temperature distribution, and low energy consumption of the battery storage is very important. We studied the fluid dynamics and heat transfer phenomena of a single cell, 16-cell modules, battery packs, and cabinet through computer simulations and experimental measurements. The results show that the temperature distribution of single cell is relatively uniform when the cell is facing the air flow. In a module, very high air flow rate and large gap between the cells can reduce the cell temperature. A pack with a good thermally conductive case is very important to ensure good heat dissipation of the battery module. Due to limited space in the cabinet, additional air inlets and outlets can be opened outside of the cabinet to slightly lower the pack temperature. Installing fins outside the cabinet can also slightly reduce the temperature inside the cabinet. Liquid cooling medium, such as water, is much better than the air-cooling medium.

Women of color (WoC) in the health professions encounter challenges in advancement to higher positions, disparities in wages, discrimination, lack of expectation to achieve leadership positions, and absence of extensive support networks. Articles in the literature have addressed race and/or gender in the context of professional development. However, applying an intersectionality lens or framework to better understand the contextual issues of professional development for WoC remains to be addressed. Thus, this scoping review aimed to (i) identify health professions literature that addresses disparities affecting WoC, and (ii) describe strategies and approaches to support WoC in the health professions. Methods: Literature searches were conducted in multiple databases. Three independent reviewers reviewed and screened articles for inclusion. Results: 31 articles were included - medicine(17), nursing(1), pharmacy(7), other(4), and multiple health professions(2). Key findings included underrepresentation of women and minority groups, inequities in professional advancement and leadership positions for WoC, and greater dissatisfaction and attrition among minority and women professionals. Conclusion: WoC face unique and distinct challenges and barriers in their professional careers resulting from the intersectionality of not only race and gender, but also lived experiences and opportunities. Strategies to improve diversity and representation should include an intersectionality framework or lens and be critically evaluated.

The Bacillus Calmette-Guerin vaccine (BCG vaccine) designed to prevent tuberculosis in children has been shown to induce a trained immune response in the body to fight against bacteria as well as other parasites and viruses. This knowledge has been reciprocated to generate the idea that this vaccine can also offer protection against severe acute respiratory syndrome coronavirus-2 (SARS-COV-2). Some recent pre-print articles have highlighted that countries with mass BCG immunizations seems to have a lower incidence of coronavirus disease 2019 (COVID-19) compared to those without BCG immunization. There are yet no experimental proof of any such association and the world health organisation (WHO) is currently testing the theory with clinical trials on selected cohorts. Epidemiologists and other scientific experts has expressed both their hope and concern simultaneously regarding the success theory of BCG vaccination to prevent COVID-19. Though its still not verified in any way whether the BCG vaccination can actually prevent COVID-19 or not but we believe a thorough analytical research in this regard is indeed worth a shot.

One of the solutions of the Einstein equations, called McVittie solution, signifying a black hole embedded by the dynamic spacetime is studied. In the stationary spacetime the Mcvittie metric becomes the Schwarzschild-de Sitter metric (SdS). The geodesic of a freely falling test particle towards the black hole is examined in the SdS spacetime. It is found that unlike Schwarzschild case the potential of such particle becomes maximum at a point where it eventually stops to follow an unstable circular motion and then resumes its motion towards black hole center. It is shown that an observer or system of particles is spaghettified near the black hole singularity in the SdS spacetime. The dynamic of the universe in the framework of McVittie metric, being a generalized time dependent SdS solution, is represented in terms of that point, called stationary or turning point. The motion of the stationary point is studied in various regimes of the expanding universe and the possible outcomes are discussed in brief.

Concrete cracks and local damage can affect the bond performance between concrete and steel bars, thereby reducing the durability of reinforced concrete structures. Compared with general concrete crack repair methods, biomineralization repair not only has effective bonding capabilities but is also particularly environmentally friendly. In view of this, this study aimed to apply biomineralization technology to repair damaged fiber-reinforced lightweight aggregate concrete (LWAC). Two groups of LWAC specimens were prepared. The control group used lightweight aggregates (LWAs) without bacterial spores and nutrient sources, and the experimental group used LWAs containing bacterial spores and nutrient sources. These specimens were first subjected to compression tests and pull-out tests, respectively, and thus were damaged. After the damaged specimen healed itself in different ways for 28 days, secondary compression and pull-out tests were conducted. The self-healing method of the control group involved placing the specimens in an incubator. The experimental group was further divided into experimental group I and experimental group II. The self-healing method of experimental group I was the same as that of the control group. The self-healing method of experimental group II involved soaking the specimen in a mixed solution of urea and calcium acetate for two days, and then taking it out and placing it in an incubator for two days, with a cycle of four days. The test results showed that, compared with the control group specimens, the relative bond strength ratio of the experimental group II specimens increased by 17.9%. Moreover, the EDS and XRD analysis results confirmed that the precipitate formed at the crack was calcium carbonate, which improved the compressive strength and bond strength after self-healing. This indicates that the biomineralization maintenance method used in experimental group II is more effective.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Monsoon winds drive upwelling along the eastern coast of India during the south-west (SW) monsoons. These winds also provide alongshore windstress (AWS) resulting in positive cross-shore Ekman transport (ET) from late May to the end of September. While instances of high ET and sea surface temperature (SST) based upwelling index (UI_SST) were observed along different parts of the coast, UI_SST was weaker in the northern section in the earlier part of monsoon. This was even in the presence of maximum AWS and ET during the 10 years analysis period spanning January-2009 to December-2018. Additionally, negative sea surface height anomalies (SSHAs), typically associated with coastal upwelling, were observed only along the southern-most coast. An empirical orthogonal function (EOF) analysis revealed two coherent modes of SSHA variation. The first principal component (PC) showed a SSHA signature coincident spatio-temporally with the first downwelling Kelvin wave, closely associated with the equatorial zonal winds that drive coastal Kelvin waves. The third PC with a coastal SSHA pattern similar to the second upwelling Kelvin wave was associated with offshore ET along the northern part of the Indian east coast. Time series of the two PCs exhibited suppression of coastal upwelling by downwelling Kelvin waves during May-July along the northeastern coast of India. Local AWS driven ET was the primary driver of coastal upwelling with the weakening of the remotely forced Kelvin waves in August. A coherent mode consisting of negative coastal SSHA signature was excited in response to local AWS driven ET during the upwelling period. This study examined the spatio-temporal variability of SW monsoon coastal upwelling along the east coast of India and illustrated the role of equatorial windstress forced first downwelling Kelvin wave in suppressing upwelling in the northern part of the coast during early SW monsoon season.

The allocation of funding for higher education typically focuses on competition in neoliberal mechanisms. Surprisingly, much less attention has been paid to considering the effect of fund locations for sustainable development through public goods purposes in neoliberal contexts. This study aims to examine specific funding schemes and determine the influential factors impacting funding for teaching, research, and public goods transformation. Taking Taiwan's Higher Education Sprout Project (HESP) as an example, we explored the effect of policy initiatives on public goods transformation towards sustainable development. The data were collected from the Ministry of Education and Scopus databases. First, a regression analysis was conducted to determine which factors influence the effect of funding allocations in academic institutes. Second, we used logistic regression to detect the effects of the system and the sector. Third, we used partial least square structural equation modeling (PLS-SEM) to explore the causal effects among the selected impact variables on expected outcomes. Finally, we used the bootstrap method to demonstrate the model’s robustness. Our study found that only diversity was shown in private technology groups receiving less HESP funding. At the same time, it did not widen the differences in the sector and system in the transformation process. Our findings suggest that funding allocations will not affect teaching and research based on sectors and systems. In contrast, this study demonstrates that transforming public goods through special funding can play a critical role in leading sustainable development in higher education.

Spike (S) protein of Coronaviruses help in receptor attachment and virus entry into the host cells. While S protein is required for virus entry, it is also important as an immunogen as it is the most accessible part of the virus architecture. S protein form knob like structures (viral spikes) protruding outwards in the form of homotrimers containing an S1 and S2 as monomers. Mutations in structural proteins of virus play crucial role in determining virulence and also in many instances influencing emergence of antibody escape variants and cellular tropism. In this paper we have performed in depth analyses of spike protein sequences from various parts of the world and tried to correlate the data with possible functional relevance of such mutations.

A lack of data reproducibility (“reproducibility crisis”) is debated across many scientific and medical disciplines. A systematic analysis of the available evidence on the reliability of scientific data revealed that, although the existence of a reproducibility crisis is widely perceived, conclusive data on the scale of the problem are lacking. Most importantly we found that, although the debate is largely focused on methodological issues, researcher conduct defines research standards and in turn data reliability. The availability of reliable methods itself does not guarantee good practice. Moreover, research is typically characterised by a lack of established methods due to its immanent novelty. Despite the crucial importance of researcher conduct, research and conclusive data on the determinants of researcher behaviour are missing. In conclusion, meta-research is urgently needed that establishes an understanding of the factors that determine researcher behaviour. This knowledge can then be used to implement and iteratively improve measures, which incentivise researchers to apply the highest standards resulting in high quality data.

Monsoon winds drive upwelling along the eastern coast of India during the south-west (SW) monsoons. These winds also provide alongshore windstress (AWS) resulting in positive cross-shore Ekman transport (ET) from March to the end of September. While instances of high ET and sea surface temperature based upwelling index (UI_SST) were observed along two parts of the coast: between Kashinagara and Kakinada in the north, and between Kavali and Point Calimere in the south. The UI_SST illustrated a much poorer agreement with local ET in the northern section, where the onset of UI_SST preceded the rise of ET and the subsidence of UI_SST signals occurred during a period of rising ET. Additionally, negative sea surface height anomalies (SSHAs), typically associated with coastal upwelling, were also missing through most of the upwelling period. A complex empirical orthogonal function (CEOF) analysis revealed two coherent modes of SSHA variation. The first mode showed a SSHA signature spatio-temporally coincident with the first upwelling and downwelling Kelvin waves closely associated with the equatorial zonal winds that drive them. The second CEOF mode, with a coastal SSHA pattern similar to the SSHA signatures of coastal upwelling, was associated with local offshore ET along the Indian east coast. The CEOF analysis exhibited the triggering of coastal upwelling in April and its suppression from June by coastally trapped Kelvin waves along the northeastern coast of India, while local AWS driven ET was the primary driver of coastal upwelling along the southeastern coast. The second CEOF mode also exhibited a coherent negative coastal SSHA signature excited by local AWS driven ET during the upwelling period. This study examined the spatio-temporal variability of premonsoon and SW monsoon coastal upwelling along the western Bay of Bengal and its relation to remotely forced coastal Kelvin waves.

A commercially reared domesticated turkey (Meleagris gallopavo) was purchased from a local market and sections of tissue representing leg, thigh, and breast were harvested and processed for analysis of the lipids and proteins present. Leg and thigh tissue was enriched in mitochondrial proteins whereas the breast tissue was enriched in glycolytic enzymes as well as the cytosolic and mitochondrial forms of glycerol-3-phosphate dehydrogenase. A potential marker for breast tissue muscle formation and/or function was also identified. The tissues could clearly be separated based upon their lipid profiles with little differences in cardiolipin levels suggesting that mitochondrial surface areas may be similar across the tissues. The most significant differences in the lipids were found to be higher levels of oxidized lipids in thigh meat. This work provides the first untargeted proteome and lipidome datasets for the domesticated turkey. The proteome dataset is accessible from ProteomeXchange Consortium via the PRIDE partner repository with the identifier PXD008207.

In this paper, we consider a reconfigurable intelligent surface (RIS)-assisted integrated satellite-high altitude platform-terrestrial networks (IS-HAP-TNs) that can improve network performance by exploiting HAP's stability and RIS's reflection. Specifically, the reflector RIS is installed on the side of HAP to reflect signals from the multiple ground user equipments (UEs) to the satellite. To aim at maximising system sum rate, we jointly optimize the transmit beamforming matrix at the ground UEs and RIS phase shift matrix. Due to the limitation of the unit modulus of the RIS reflective elements constraint, the combinatorial optimization problem is difficult to tackle it effectively by traditional solving methods. Based on this, this paper studies deep reinforcement learning (DRL) algorithm to achieve online decision making for this joint optimization problem. In addition, it is verified through simulation experiments that the proposed DRL algorithm outperforms the standard scheme in terms of system performance and execution time, and higher computing speed, making real-time decision making truly feasible。

We obtain exact solutions to the field equations for 5 dimensional LRS Bianchi type-I spacetime in $f(R,T)$ theory of gravity where specifically the following three cases are considered: (i) $f(R,T)=\mu(R+T)$, (ii) $f(R,T)=R \mu + R T \mu^2$ and (iii) $f(R,T)=R+\mu R^2+\mu T$ where $R$ and $T$ respectively the Ricci scalar and trace of the energy-momentum tensor. It is found that the equation of state (EOS) parameter $w$ is governed by the parameter $\mu$ involved in the $f(R,T)$ expressions. We fine-tune the parameter $\mu$ to obtain effect of phantom energy in the model, however we also restrict this parameter to obtain a stable model of the universe. It is noted that the model isotropizes at finite cosmic time.

Rapidly rotating neutron stars with very strong surface magnetic fields are observed to emit pulsed emission in the whole range of electromagnetic spectrum from radio to high energy gamma-rays. These so called pulsars are known for their exceptional rotational stability. The radio emission from pulsars is generally believed to be powered by the rotational energy of neutron stars. More than 3000 pulsars have been currently known from radio observations, however, it is observed that a large population of pulsars is also bright in optical, X-rays and gamma-rays. The Fermi-LAT observations in the energy range above 100 MeV have discovered about 300 pulsars. However, origin of high energy non-thermal radiation from pulsars is not completely understood and remains an active area of research. In this contribution, we report a summary of observational features of the gamma-ray pulsars and perform pulsar population study to predict their detectability for the MACE gamma-ray telescope, which has just started its regular science operation at Hanle in India.

The stellar winds of the central stars of planetary nebulae play an essential role in planetary nebulae shaping. In the interacting stellar winds model, the fast stellar wind injects energy and momentum which are transfered to the nebular envelope through an X-ray-emitting hot bubble. Together with other physical processes, such as the ionization of the nebular envelope, the asymmetrical mass-loss in the AGB, and the action of collimated outflows and magnetic fields, the presurized hot gas determines the expansion and evolution of planetary nebulae. \emph{Chandra} and \emph{XMM-Newton} have provided us with detailed information of this hot gas. Here in this talk I will review our current understanding of the effects of the fast stellar wind in the shaping and evolution of planetary nebulae and give some hints of the promissing future of this research.

As the natural resources are getting exhausted, the concept of sustainable development of region has received increasing attentions, especially for resource-dependent cities. In this paper an innovative method that emergy analysis and IPAT (Human Impact Population Affluence Technology) model were combined in order to analyze the quantitative relationship of economic growth and energy consumption and further to evaluate its overall sustainability level. Taiyuan, a traditional, resource-dependent city in China, is selected as the case study region. The main results show that total emergy of Taiyuan increased from 9.023× 1023 sej in 2007 to 9.116× 1023sej in 2014, with 38% reduction on non-renewable emergy and 125% growth on imported emergy. Regional emergy money ratio (RMB) was reduced by 48% from 5.31× 1013sej/$ in 2007 to 2.74× 1013sej/$ in 2014, indicating that the increasing speed of consuming resources and energy was faster than the increase of GDP, and that Taiyuan’s money purchasing power declined. The lower emergy sustainability index (ESI) indicates that Taiyuan was explored and produced large quantities of mineral resources, which puts more stress on the environment as a consequence, and that this is not sustainable in the long run. The IPAT analysis demonstrates that Taiyuan sticks to the efforts of energy conservation and environmental protection, in order to promote regional sustainable development, it is necessary to take an integrated effort. Policy insights suggest that resourceful regions should improve include energy and resource efficiency, optimizing energy and resourceful structure.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Cadmium(Cd) is a highly toxic and cumulative environmental pollutant. Siderophores are heavy metal chelators with high tolerance to heavy metals such as Cd. Furthermore, ryegrass (Lolium perenne L.) has potential remediation capacity for soils contaminated by heavy metals. Consequently, using ryegrass alongside beneficial soil microorganisms that produce siderophores may be an effective means to remediate soils contaminated with Cd. In this study, Bacillus strains WL1210 and CD303 that were previously isolated from the rhizospheres of Nitraria tangutorum in Wulan and Peganum harmala L in Dachaidan, respectively, both arid sandy environments, were evaluated for heavy metal pollution mitigation. The results indicate that both strains of Bacillus exhibit favorable biological characteristics and stress resistance, and they are both producers of siderophores, which promote the growth of ryegrass under Cd stress.

Our image recognition system mainly judges whether the left upper limb in the image is the left upper limb or the right upper limb through our deep learning model in the image. The doctor then could give the correct surgical position. From the experimental results, it could be found that the precision rate and recall rate of the intelligent image recognition system proposed in this paper for preventing the upper limb dislocation surgery could reach 98% and 93%, respectively. It proved that our artificial intelligent image recognition system, AIIRS, could indeed assist orthopedic surgeons to prevent the occurrence of left and right dislocation in upper limb surgery. At the same time, this paper also completes the IRB application approval through the prototype experimental results and will conduct the second phase of human trials in the future. It showed that the research results of this paper will be of great benefit and research value to upper limb orthopedic surgery.

Our image recognition system mainly judges whether the left upper limb in the image is the left upper limb or the right upper limb through our deep learning model in the image. The doctor then could give the correct surgical position. From the experimental results, it could be found that the precision rate and recall rate of the intelligent image recognition system proposed in this paper for preventing the upper limb dislocation surgery could reach 98% and 93%, respectively. It proved that our intelligent image recognition system could indeed assist orthopedic surgeons to prevent the occurrence of left and right dislocation in upper limb surgery. At the same time, this paper also completes the IRB application approval through the prototype experimental results and will conduct the second phase of human trials in the future. It showed that the research results of this paper will be of great benefit and research value to upper limb orthopedic surgery.

(1) Background: Proximal humerus fractures can be a debilitating condition if not properly treated. These fracture patterns are varied and differ in every patient. Functional outcomes may be determined by the integrity of the shoulder girdle involving the rotator cuff insertion. The post-operative resorption or malreduction of the greater tuberosity is an important factor contributing to the poor functional outcome of a patient. (2) Methods: A single-center retrospective comparative study was performed to evaluate the functional outcomes of patients undergoing operative fixation for this injury. A total of 387 consecutive cases treated operatively from 2019-2021 were included for analysis. (3) Results: 94 cases fulfilled our criteria for analysis. A matched-group comparison of 19 patients each was performed to compare demographics, post-operative fracture characteristics and functional outcomes. (4) Conclusions: The resorption or malreduction of the greater tuberosity contributes greatly to the prognostic outcome in patients treated with ORIF surgery. In our demographic study, obesity is another contributing factor affecting the parameters of post-operative reduction in proximal humerus fractures. Appropriate surgical planning and post-operative multidisciplinary care must be taken into consideration to attain a satisfactory prognostic outcome.

Background: Hypoalbuminemia is known to be associated with adverse outcome in critical illness. In this study, we attempted to identify if hypoalbuminemia on emergency department (ED) arrival a reliable predictor for in-hospital mortality in necrotizing fasciitis (NF). patients. Method: A retrospective cohort study of hospitalized patients with NF was conducted in a tertiary teaching hospital in Taiwan between March 2010 and March 2018. Blood samples were collected in the ED upon arrival, and serum albumin levels were determined. we evaluated the predictive value of serum albumin level at ED presentation for in-hospital mortality. All collected data were statistically analyzed. Result: Of the 707 NF patients, 40 (5.66%) died in the hospital. The mean serum albumin level was 3.1 ± 0.9 g/dL and serum albumin levels were significantly lower in the non-survivor group than in the survivor group (2.8± 0.7 g/dL vs. 3.5 ± 0.8 g/dL). In the multivariable logistic regression model, albumin was associated with in-hospital mortality significantly (odds ratio[OR] 0.92, 95% confidential interval (CI) 0.88–0.96, P <0.001). The area under-the-receiver-operating-characteristic curve (AUC) for in-hospital survival was 0.77 (95% CI 0.72–0.82) and corresponding sensitivity, specificity, positive predictive value, negative predictive value, positive and negative likelihood ratio were 66%, 74%, 33%, 88%, 2.25 and 0.48, respectively. High sensitivity (96%) was shown at albumin level of 4.0 g/dL and high specificity (91%) was shown at level of 2.5 g/dL. Conclusion: Initial serum albumin levels were independently associated with in-hospital mortality among adult patients with necrotizing fasciitis and demonstrated fair discriminative performance in the prediction of in-hospital mortality. NF patients with hypoalbuminemia on ED arrival should be closely monitored for signs of deterioration and consider early and aggressive intervention to prevent mortality.

Road cracks significantly affect the serviceability and safety of roadways, especially in mountainous terrain. Traditional inspection methods, such as manual detection, are excessively time-consuming, labor-intensive, and inefficient. Additionally, multi-function detection vehicles equipped with various sensors are expensive and not suitable for mountainous roads due to poor conditions. To address these challenges, this study proposes a customized Unmanned Aerial Vehicles (UAV) inspection system designed for automatic crack detection. The system focuses on enhancing autonomous capabilities in mountainous terrains by incorporating embedded algorithms for route planning, autonomous navigation, and automatic crack detection. The slide window method is proposed to enhance the autonomous navigation of UAV flights by generating path planning in mountainous roads. This method compensates for GPS/IMU positioning errors, particularly in GPS-denied or GPS-drift scenarios. Moreover, the YOLOv8 algorithm is introduced to conduct autonomous crack detection from UAV imagery in the offboard module. To validate our UAV inspection system's performance, we conducted several experiments to assess its accuracy, robustness, and efficiency. The experimental results demonstrate that our UAS inspection system accurately estimates the flight trajectory along the mountainous road for autonomous navigation. Furthermore, the experimental detection results also demonstrate that the YOLOv8 algorithm achieves higher recognition accuracy compared to the YOLOv5, and YOLOv7-tiny algorithms, exceeding 3.1%,and 6.8% of mAP, respectively. In summary, the UAV inspection system proposed in this study can provide a useful tool and technological guidance for the regular inspection of mountainous roads.

Heterosis plays a significant role in enhancing variety, boosting yield, and raising economic value, but the molecular mechanism is still unclear. We analyzed the transcriptomes and 3D genomes of hybrid (F1) and its parents (w30 and 082). Analysis of the expression revealed a total of 485 specially expressed genes (SEGs), 173 differentially expressed genes (DEGs) above parental expression level, more actively expressed genes and up-regulated DEGs in F1. Further study revealed that the DEGs detected in F1 and its parents were mainly involved in response to auxin, plant hormone signal transduction, DNA metabolic process, Purine metabolism, starch and sucrose metabolism, which suggested that these biological processes may play a crucial role in the heterosis of B. rapa. The analysis of 3D genome data revealed that hybrid F1 tend to contain more transcriptionally active A compartments after hybridization. Additionally, F1 had a smaller TAD (topologically associated domain) genome length, but the number was the highest, and the expression change of activated TAD was higher than repressed TAD. More specific TAD boundaries were detected between parents and F1. Subsequently, 140 DEGs with genomic structural variants were selected as potential candidate genes. Among them, we found two DEGs with consistent expression changes in A/B compartments and TADs. Our findings suggest that genomic structural variants, such as TADs and A/B compartments, may affect gene expression and contribute to heterosis in B. rapa. This study provides further insight into the molecular mechanism of heterosis in B. rapa.

In kidney, epithelial barrier has diverse functions in body fluid and electrolyte homeostasis, and urine production. Maintaining epithelial integrity fundamentally builds up physiological functionality of the renal epithelial barrier (REB). Specially, the REB) states regularly in osmotic dynamics. The osmotic dynamics gives rise of osmotic pressure that is a physical force. Overloading of osmotic pressure can crack epithelial integrity and damage REB. How REB endures the osmotic pressure force yet remains enigmatic. LMO7 (LIM domain only 7) is a protein associated with cell-cell junctional complex and cortical F-actin. LMO7 upregulation was observed in cells cultured in hypertonic condition. In kidney, LMO7 predominantly distributes in epithelial cells in renal tubules. Hypertonic stimulation leads to assembly of LMO7 and F-actin in cortical stress fibers in renal epithelial cells. Hypertonic-isotonic alternation as pressure force pushing plasma membrane inward/outward was set as osmotic disturbance and was applied to test FAK signaling and LMO7 functioning in maintaining junctional integrity. Along with junctional integrity, LMO7 depleted cells resulted in loss of junctional integrity in the epithelial sheet cultured hypertonic medium or hypertonic-isotonic alternation. On the other hand, FAK inhibited by PF-573228 leads to failure in robust cortical F-actin assembly and association of LMO7 with cortical F-actin in epithelial cells responding upon hypertonic stress. Epithelial integrity in context of osmotic stress, LMO7 and FAK signaling both involves in assembling robust cortical F-actin and maintaining junctional integrity. The LMO7 elaborately manages FAK activation in renal epithelial cells, which was evidently demonstrated in NRK-52E cells who have excessive FAK activation and lost epithelial integrity when cells with LMO7 depletion exposed to hypertonic environment. Our data suggests that LOM7 manages FAK activation and is responsible for maintaining REB under osmotic disturbance.

Entrepreneurship has been viewed as an opportunity for economic development and changing economic scenarios in global markets. Women are viewed as a reservoir of entrepreneurial talent, so they can be growth engines in novel markets. Previous studies have considered entrepreneurship as the most effective way towards the economic empowerment of women. Female students engaged in entrepreneurial education have been addressed persistently, while what transforms them in an education process is still unclear. Considering the transforming global economy and its influence on higher education, this study aims to detect female students transforming entrepreneurial competency, mindset, and intention into sustainable entrepreneurship. Using a self-compiled survey, we targeted 752 female students to investigate their entrepreneurial competency, mindset, and intention. SPSS and AMOS were used to transform the data for interpretation. We assumed that the impact of female students’ entrepreneurial competency could be modified by an entrepreneurial mindset and result in entrepreneurial intention. To detect this causal relationship, this study employed reliability, factor, structural equation modeling (SEM), and bootstrap-ping analyses to verify the evidence. The result of the SEM confirms that female students’ entrepreneurial competency will, through their entrepreneurial mindset, impact entrepreneurial intention. With bootstrapping, 5000 samples were collected, and it was demonstrated that the measure constructs were still reliable in the model. This study found that there is a mediation effect between entrepreneurial competency and entrepreneurial intention. The entrepreneurial mindset plays a crucial role in the transformation process. Without an entrepreneurial mindset, entrepreneurial competency cannot exert a significant effect on entrepreneurial intention. The findings can help reinvent related entrepreneurial education in higher education.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.