Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

Metal creep has been a subject of extensive study for more than 110 years, because it affects the useful life of engineering components operating at high temperatures. It is even more so with ever-increasing operating temperatures of propulsion/power-generation systems by the environmental regulations to reduce greenhouse emissions. This review summaries the recent development in creep modeling with regards to creep strain evolution, creep rate, creep ductility, creep life and fracture mode, attempting to provide a comprehensive mechanism-based framework to address all the important creep phenomena and the long-standing issue of long-term creep life prediction with microstructural evolution and environmental effects.

High dietary phosphate intake and poor adherence to phosphate-binding-therapy elevate the risk of hyperphosphatemia in maintenance hemodialysis (HD; MHD) patients. Therefore, chronic kidney disease-related mineral and bone disorder (CKD-MBD) indicators increase; consequently, risks of CKD-MBDs and inflammation are elevated. This double-blind, randomized control trial intervention study was designed to investigate the possibility of reducing blood CKD-MBD indicators and modulating inflammatory indicators by consuming low-phosphate (LP) meals accompanied by a minimum dose of a calcium-based phosphate binder (CaCO3). MHD patients were recruited and randomly assigned to an LP meal group (LP group) or a control group. After initial data collection, blood collection, and dietary counseling, subjects were asked to consume a washout diet for 1 week. During the washout diet period, subjects consumed their usual diet but took 1 tablet of calcium carbonate (1CaCO3) as a phosphate binder with each meal. After the washout diet period, subjects in the LP group and control group respectively consumed LP meals and regular meals twice a day for 1 week. Meat in the LP meals was boiled before the regular cooking process, but meat in control meals was not. All meals were supplied by a central kitchen so that the contents of phosphate and other nutrients could be identified. In total, 40 MHD patients completed the study program. After 1 week of the dietary intervention, the blood Ca x P product and dietary phosphate had significantly decreased in the LP group compared to the control group (p<0.05). The LP group had significantly lower variations in dietary phosphate intake, blood calcium, Ca x P product, and tumor necrosis factor (TNF)-α than the control group by comparing differences between after the dietary intervention and the baseline (△after intervention - baseline, p<0.05). The increase in dietary phosphate intake (△3rd - 2nd dietary phosphate intake) augmented the increase in the TNF-α level by 6.24-fold (odds ratio [95% confidence interval]: 6.24 [1.12~34.92], p<0.05). These results highlighted the conclusion that LP meals accompanied by a minimum dose of CaCO3 downregulated pro-inflammation by reducing CKD-MBD indicators which was triggered by decreasing dietary phosphate intake.

In the study of rough sets, there are many covering approximation spaces, how to classify covering approximation spaces has become a hot issue. In this paper, we propose concepts covering approximation $T_{1}$-space, $F-$symmtry, covering rough continuous mapping, covering rough homeomorphism mapping to solve this question. We also propose a new method for constructing topology in Theorem 5.1, and get the following properties: (1) For each $x\in U$, $\{X_{i}:i\in I\}\subseteq \mathcal{P}(U)$ is all the subsets of $U$ which contains $x$ and $*$ is a reflexive relation on $U$. If $V\in \tau$ is a subset of $U$ and $x\in V$, then $\underline{*}(\bigcap \limits_{i\in I}X_{i})$ is the smallest subset of $U$ and $x \in \underline{*}(\bigcap \limits_{i\in I}X_{i})\subseteq V$. Denoted by $C(x)=\bigcap \{\underline{*}(X_{i}):x\in \underline{*}(X_{i}),i\in I\}$. (2)If $V\in \tau$ is a subset of $U$, then $V =$ $\bigcup \limits_{x\in V} C(x)$. (3) Let $\{\underline{*}(X_{i}):x\notin \underline{*}(X_{i}), i\in I\}$, then $\overline{\{x\}}$ $=$ $U \setminus \bigcup \limits_{x\notin \underline{*}(X_{i}), i\in I}\underline{*}(X_{i})$; (4) Let $*$ be a reflexive relation on $U$. For every $X\subseteq U$, we have $int(\underline{*}(X))=\underline{*}(X)$. Where $int(\underline{*}(X))$ represents the interior of $\underline{*}(X)$. (5) Let $\{\underline{*}(X_{i}):x\in \underline{*}(X_{i}),i\in I\}$ be a family subsets of $U$, then $\{\underline{*}(X_{i}):x\in \underline{*}(X_{i}),i\in I\}$ is a base for $(U,\tau)$ at the point $x$. \\

An undescribed diterpene, stellerterpenoid A (1) and two undescribed sesquiterpenoids, stellerterpenoids B and C (2-3), together with six known compounds, were isolated from the roots of Stellera chamaejasme L. Their structures were elucidated by extensive spectroscopic data (1D, 2D NMR, IR, UV and HR-ESI-MS). The absolute configuration of 1-3 were elucidated based on ECD calculation. Among of them, stellerterpenoid A was a rare 13, 14 - seco nortigliane diterpenoid and stellerterpenoid B was a guaiacane type sesquiterpenoid with an unusual 1, 2-diketone moiety. The known stelleraguaianone B (5) exhibited moderate activity to suppress NO production in LPS - simulated macrophages with an IC50 value of 24.76 ± 0.4 μM. None of the compounds showed inhibitory influenza virus and tumor activity.

An optimal scheduling strategy for cooling, heating and power (CCHP) joint-power-supply system is proposed to improve energy utilization and minimize costs in this paper. Firstly, the mathematical model of CCHP system is established. Particle swarm optimization (PSO) is used to optimize the regularization coefficient C and the kernel parameter λ which can affect the prediction accuracy of KELM(PSO-KELM). Then PV generation and load prediction model are established by PSO-KELM. In order to jump out of local optimal solution, Cauchy variation is introduced in SFLA local update, and adaptive mutation operation is carried out on SFLA individuals. The predictions of PV generation and load power by PSO-KELM are imported into the objective function, and the microgrid dispatching model is solved by the improved SFLA algorithm. Compared with the traditional GA-KELM and KELM, PSO-KELM has faster convergence and prediction accuracy. Compared with the power supply division, the operation cost of the power grid is reduced by the proposed optimization dispatching strategy of CCHP micro-grid.

Three monoruthenium complexes 1(PF6)23(PF6)2 bearing a N(CH3)-bridged ligand have been synthesized and characterized. These complexes have a general formula of [Ru(bpy)2(L)](PF6)2, where L is a 2,5-di(N-methyl-N-(pyrid-2-yl)amino)pyrazine (dapz) derivative with various substituents and bpy is 2,2′-bipyridine. The photophyscial and electrochemical properties of these compounds have been examined. The solid-state structure of complex 3(PF6)2 is studied by single crystal X-ray analysis. These complexes show two well-separated emission bands centered at 451 and 646 nm (max = 195 nm) for 1(PF6)2, 465 and 627 nm (max = 162 nm) for 2(PF6)2, and 455 and 608 nm (max = 153 nm) for 3(PF6)2 in dilute acetonitrile solution, respectively. The emission maxima of the higher-energy emission bands of these complexes are similar, while the lower-energy emission bands are dependent on the electronic nature of substituents. These complexes display two consecutive redox couples owing to the stepwise oxidation of the N(CH3)-bridged ligand and ruthenium component. In addition, density functional theory (DFT) and time-dependent density functional theory (TD-DFT) calculations are carried out to elucidate these experimental findings.

Currently, historical areas in China are facing issues of color authenticity and excessive commercialization. Colors, as an important element of historical areas, reflect their history and culture. However, there are some flaws in the existing research methods, so a more scientific and systematic method is needed to obtain accurate and objective color visualization results to promote the sustainable development of historical areas. In order to explore the methods and applications of visualizing the environmental color genes of historical areas, Shiquan Street in Suzhou, China was taken as the research object, ArcGIS 10.5 was used to obtain the street veiw photo samples, Matlab was used to summarize the architectural colors of the historical areas, and K-means clustering was used to generate the central color card of the historical areas, thus completing the color visualization of the historical areas, followed by further searching for the color patterns and central colors, so as to explore the strategies for sustainable development of historical areas. The various quantified color models of historical areas can explore the regional uniqueness and color locality of historical areas, which avoids problems such as homogenization of block colors, unclear styles and features, and excessive proportion of commercial colors caused by poor color guidance and control in the design related to historical areas, providing approaches to the research on the harmonious unity of environmental colors and features related to historical areas.

Autonomous aerial refueling technology is an effective solution to extend flight duration of unmanned aerial vehicles, and also a great challenge due to its high risk. For autonomous probe-and-drogue refueling tasks, relative navigation to provide relative position between the receiver aircraft and the refueling drogue is the first and essential step, and vision-based method is the most frequently used. A new monocular vision navigation sensor with image processing strategy consisting of the drogue detection method and the tracking method is developed for autonomous aerial refueling in this paper. In the drogue detection method, thresholding and mathematical morphology method are adopted to eliminate image interference, and contours extraction method is applied to obtain all contours, which are then subsequently checked to achieve target contour of drogue. In the tracking method, a rectangle of interest (ROI) of current frame image is determined by positioning results of last frame, and then processed by the previous drogue detection method. Finally, the proposed image processing strategy in monocular vision navigation sensor is validated using real flight images, which are captured from an autonomous aerial refueling testbed using a micro six-rotor aircraft as receiver aircraft.

In this study, we improved the photovoltaic (PV) properties and storage stabilities of inverted perovskite solar cells (PVSCs) based on methylammonium lead iodide (MAPbI3) by employing bathocuproine (BCP)/poly(methyl methacrylate) (PMMA) and BCP/polyvinylpyrrolidone (PVP) as hole-blocking and electron-transporting interfacial layers. The architecture of the PVSCs was indium tin oxide/poly(3,4-ethylenedioxythiophene):polystyrenesulfonate/MAPbI3/[6,6]-phenyl-C61-butyric acid methyl ester/BCP:PMMA or BCP:PVP/Ag. The presence of PMMA and PVP affected the morphological stability of the BCP and MAPbI3 layers. The storage-stability of the BCP/PMMA-based PVSCs was enhanced significantly relative to that of the corresponding unmodified BCP-based PVSC. Moreover, the PV performance of the BCP/PVP-based PVSCs was enhanced when compared with that of the unmodified BCP-based PVSC. Thus, incorporating hydrophobic polymers into BCP-based hole-blocking/electron-transporting interfacial layers can improve the PV performance and storage stability of PVSCs.

It’s been reported that Mori Folium (MF) and Eucommiae Cortex (EC) exhibit pharmacological effects on the treatment of immunosuppression. However, the mechanism of MF and EC against immunosuppression remains unclear. This study aims to explore the mechanism of action of MF and EC for the treatment of immunosuppression through network pharmacology, molecular docking, molecular dynamics simulations and animal experiments. As a result, 11 critical components, 9 hub targets, and related-signaling pathways of treatment of immunosuppression were obtained based on network pharmacology. The molecular docking suggested that 11 critical components exhibited great binding affinity to 9 hub targets of immunosuppression. The molecular dynamics simulations results showed that (-)-Tabernemontanine-AR, beta-sitosterol-AR and Dehydrodieugenol-HSP90AA1 complexes are stably bound. Additionally, in the animal experiments, the treated group results compared to the control group suggest that MF and EC have a significant effect on the treatment of immunosuppression. Therefore, the MF and EC treatment for immunosuppression may take effects in a multi-component, multi-target, and multi-pathway manner. The results would provide novel insights into the treatment of immunosuppression in humans.

In recent years, a large-scale afforestation campaign has taken place in Inner Mongolia, China, to control desertification and soil erosion. However, the water consumption associated with large-scale afforestation significantly impacts the water resources in Inner Mongolia, resulting in a substantial ecological risk. This study aimed to evaluate the ecological risk of water resources caused by afforestation in the region. In this study, based on land cover data, Normalized Difference Vegetation Index (NDVI) data, and meteorological data, used trend analysis, water balance equation, and Water resources Security Index (WSI) index to analyze the ecological risks of water resources caused by afforestation in Inner Mongolia from 2000 to 2020. The results show that:(1) The afforestation area in Inner Mongolia was 5.37×104 km2 in 2000-2020; (2) Afforestation in arid and semi-arid areas leads to the reduction of water resources. (3) Afforestation reduces water resources in the study area by 0.76×108m3/year; (4) ~76% of afforestation regions face ecological risks of water resources.

Hyperbaric oxygen (HBO) treatment has been proven to attenuate neuroinflammation in rats. This study aimed to determine the potential mechanism underlying the anti-inflammatory effects of HBO treatment on burn-induced neuroinflammation in rats. Thirty-six adult male Sprague–Dawley (SD) rats were randomly assigned to the following six groups (n = 6 per group): (1) sham burn with sham HBO treatment, (2) sham burn with HBO treatment, (3) burn with 1-week sham HBO treatment, (4) burn with 2-week sham HBO treatment, (5) burn with 1-week HBO treatment, and (6) burn with 2-week HBO treatment. SD rats that received third-degree burn injury were used as a full-thickness burn injury model. Subsequently, we analyzed the expression of proteins involved in the galectin-3 (Gal-3)-dependent Toll-like receptor-4 (TLR-4) pathway through enzyme-linked immunosorbent assay (ELISA), immunohistochemistry (IHC) analysis, and Western blotting, and a behavior test was also conducted. The behavior test revealed that HBO treatment significantly suppressed mechanical hypersensitivity in the burn with HBO treatment group compared with the burn with sham HBO treatment group (p < 0.05). ELISA results showed that tumor necrosis factor alpha (TNF-α) and interleukin 1 beta (IL-1β) levels in the dorsal horn of the spinal cord and the skin were significantly decreased in the burn with HBO treatment group compared with the burn with sham HBO treatment group (p < 0.05). Western blotting results demonstrated that HBO treatment significantly reduced the expression of Gal-3 and TLR-4 in the dorsal horn of the spinal cord in the burn with HBO treatment group compared with the burn with sham HBO treatment group (p < 0.05). IHC analysis results showed that the expression of Gal-3, TLR-4, CD68, and CD45 in the dorsal horn of the spinal cord was significantly lower in the burn with HBO treatment group than in the burn with sham HBO treatment group (p < 0.05), and the expression of CD68 and macrophage migration inhibitory factor (MIF) in the right hind paw skin was significantly lower. The expression of vimentin and fibroblast growth factor (FGF) in the right hind paw skin was significantly higher after HBO treatment (p < 0.05). This study proved that early HBO treatment relieves neuropathic pain, inhibits the Gal-3-dependent TLR-4 pathway, and suppresses microglia/macrophage activation in a rat model.

Neurogenesis in the adult brain plays a major role in the cognitive ability of animals including learning and memory. Poria cocos (Schw.) Wolf (P. cocos) has been known as a traditional Chinese edible medicinal herb with the potential effect to improve learning and memory. However, the effect mechanisms are still elusive. In this study, significant neuronal differentiation-promoting activities of the ethanol extracts of P. cocos (EEPC) were tested in Neuro-2a cells and mouse cortical neural stem/progenitor cells (NSPCs). Subsequently, 97 compounds of EEPC were identified using UHPLC-Q-Exactive-MS/MS. After investigation of neuronal differentiation-promoting activities of 4 major compounds (Ethyl palmitoleate, L-(-)-Arabitol, Choline and Adenosine), only Choline has significant neuronal differentiation-promoting activity. In summary, we investigated the neuronal differentiation-promoting activity and chemical compositions of EEPC, the study of the neuronal differentiation-promoting effect of ether extract of P. cocos indicated P. cocos’s positive effect on learning and memory functions. This is the first investigation of the neuronal differentiation-promoting effect of ether extract of P. cocos based on similar research references.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

Cadmium(Cd) is a highly toxic and cumulative environmental pollutant. Siderophores are heavy metal chelators with high tolerance to heavy metals such as Cd. Furthermore, ryegrass (Lolium perenne L.) has potential remediation capacity for soils contaminated by heavy metals. Consequently, using ryegrass alongside beneficial soil microorganisms that produce siderophores may be an effective means to remediate soils contaminated with Cd. In this study, Bacillus strains WL1210 and CD303 that were previously isolated from the rhizospheres of Nitraria tangutorum in Wulan and Peganum harmala L in Dachaidan, respectively, both arid sandy environments, were evaluated for heavy metal pollution mitigation. The results indicate that both strains of Bacillus exhibit favorable biological characteristics and stress resistance, and they are both producers of siderophores, which promote the growth of ryegrass under Cd stress.

In the new period, the state has made every effort to promote the new urbanization of public sports service. Entropy method, coupled coordination model, cold hot spot analysis is used to explore the dynamic relationship between public sports services and the development of new urbanization in China from 2008 to 2017. The results show that: (1) The development of the internal subsystem of public sports service is not balanced, the sports financial investment system grows rapidly, but the development of professional sports talent team is slow. (2) The imbalance of regional development cannot be ignored, and the public sports service level shows a decreasing gradient from east to west. (3) The regional development features are different. The eastern region is dominated by the coordinated development of sports public service and urbanization, while the central region is mainly in the type of public sports service lag, while the western region has multiple complex characteristics of low-level coordination and public sports service lag. Therefore, it is proposed that the construction of modern public sports service system should be investigated in the context of the development of new urbanization. It should be promoted from the following aspects: promoting the extension of public sports service to rural areas, engendering the "citizen's right" of sports health to the migrant population, conforming to the trend of mass sports intelligence, developing green sports and revitalizing idle sports assets in cities.

Tamm Plasmon Polariton (TPP) is a nanophotonic phenomenon that has attracted much attention due to its spatial strong field confinement, ease of mode excitation and polarization independence. TPP has applications in sensing, storage, lasing, perfect absorber, solar cell, nonlinear optics, and many others. In this work, we demonstrate a biosensing platform based on TPP resonant mode. Both theoretical analyses based on Transfer Matrix Method and experimental validation through nonspecific detection of liquids of different refractive indices and specific detection of SARS-CoV-2 nucleocapsid protein (N-protein) are presented. Results show that TPP biosensor has high sensitivity and good specificity. For N-protein detection, the sensitivity is 1.5 nm/(µg/ml) and the limit of detection can reach down to below 7 ng/ml with spectrometer of 0.01 nm resolution of wavelength shift. This work paves the way for design, optimization, fabrication, characterization, and performance analysis of TPP based biosensors

Preclinical studies have identified glial cells as pivotal players in the genesis and maintenance of neuropathic pain after nerve injury associated with diabetes, chemotherapy, major surgeries, and virus infections. Satellite glial cells (SGCs) in the dorsal root and trigeminal ganglia of the peripheral nervous system (PNS) and astrocytes in the central nervous system (CNS) express similar molecular markers and are protective under physiological conditions. They also serve similar functions in the genesis and maintenance of neuropathic pain, downregulating some of their homeostatic functions and driving pro-inflammatory neuro-glial interactions in the PNS and CNS, i.e. “gliopathy”. However, the role of SGCs in neuropathic pain is not simply as “peripheral astrocytes”. We delineate how these peripheral and central glia participate in neuropathic pain by producing different mediators, engaging different parts of neurons, and becoming active at different stages following nerve injury. Finally, we highlight the recent findings that SGCs are enriched with proteins related to fatty acid metabolism and signaling such as Apo-E, FABP7, and LPAR1. Targeting SGCs and astrocytes may lead to novel therapeutics for the treatment of neuropathic pain.

Multi-view stereo (MVS) employs multi-point photography for image point positioning and three-dimensional reconstruction technology. Recently, this technology has been introduced into the monitoring of road slopes due to advances in photography and computing technology. In general, the various phases of post-image processing procedures are applied to various photographic data. In this study a novel, automated image-monitoring system is proposed to improve the ability of automatic processing. First, an Internet of things (IoT)-based digital photography system architecture was constructed to provide automatic control of camera photography and real-time transmission of image data. In addition, a visual SfM-MVS 3D reconstruction technique was used to develop related software and hardware interfaces based on the built-in Python computing framework of Photoscan Pro. The software integrates fully automatic photography, image transmission, monitoring of data processing and product release programs. The experimental results show that the system architecture can be applied to fully automatic three-dimensional monitoring of road slopes.

To determine promethazine (PMZ) and its metabolites promethazine sulfoxide (PMZSO) and monodesmethyl-promethazine (Nor1PMZ) in swine muscle, fat, kidney, and liver, a sample preparation and high-performance liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis method were established and validated. The sample was extracted with 0.1% formic acid-acetonitrile, and the extract was purified with acetonitrile-saturated n-hexane. After concentration by rotary evaporation, the extract was re-dissolved in 0.1% formic acid-water and acetonitrile (80:20, v/v). The HPLC-MS/MS column used was a Waters Symmetry C18 (100 mm × 2.1 mm i.d., 3.5 μm), with 0.1% formic acid-water and acetonitrile as the mobile phase, and the target compounds were determined by positive ion scan and multiple reaction monitoring. PMZ and Nor1PMZ were quantified with deuterated promethazine (PMZ-d6) as the internal standard, while PMZSO was quantified by external standard method. The limits of detection (LOD) and limits of quantification (LOQ) of PMZ and PMZSO in muscle, liver, and kidney spiked samples were 0.05 μg/kg and 0.1 μg/kg, respectively, while those of Nor1PMZ were 0.1 μg/kg and 0.5 μg/kg, respectively. The LOD and LOQ of analytes in fat spiked sample were 0.05 μg/kg and 0.1 μg/kg, respectively. The sensitivity of this method reaches or exceeds its presented in previous reports. The analytes PMZ and PMZSO showed good linearity within the range of 0.1 μg/kg to 50 μg/kg, while Nor1PMZ showed good linearity within the range of 0.5 μg/kg to 50 μg/kg, with correlation coefficients (r) greater than 0.99. The recoveries of the target compounds in the sam-ples were between 81.73% and 107.17%, and the precision ranged from 1.78% to 10.47%. This study developed for the first time an HPLC-MS/MS method for the determination of PMZ and its metabolites PMZSO and Nor1PMZ in four swine edible tissues, comprehensively covered target tissues of monitoring object, which is applicable for monitoring veterinary drug residues in ani-mal-derived foods and ensuring food safety.

Dust storms play a crucial role in the climate system and the space environment of Mars and have a great impact on human’s Mars exploration activities. The Martian dust storms exhibit significant regional, seasonal and interannual variations due to various controlling factors such as the large-scale atmospheric circulation, varying solar radiation forcing, and Martial orbital and rotational motions and their coupling to the atmospheric dynamics. This paper focuses on the review of cur-rent understandings on Martian dust storms. This paper begins by elucidating the basic properties of dust storms, and their driving mechanisms and impacts on atmospheric dynamics, atmospheric electric property, space environment, topography, and Mars explorations. Then it introduces the observation methods on different platforms including orbiters and landers/rovers, and the da-tasets constructed based on these historical observations for Martian dust storms. Finally, we pro-posed the dust storm monitoring and forecasting for the upcoming Chinese Tianwen-3 Mars sam-pling returning mission. It concludes by depicting the future research topics to systematically un-derstand the Martian dust storms.

The parameter estimation problem for polynomial phase signals (PPSs) arises in a number of fields, including radar, sonar, biology, etc. In this paper, a fast algorithm of parameter estimation for monocomponent PPS is considered. We propose the so-called LSU-EKF estimator, which combines the least squares unwrapping (LSU) estimator and the extended Kalman filter (EKF). First, the coarse estimates of the parameters of PPS are obtained by the LSU estimator using a small number of samples. Subsequently, these coarse estimates are used to initial the EKF. Monte-Carlo simulations show that the computation complexity of the LSU-EKF estimator is much less than that of the LSU estimator, with little performance loss. Similar to the LSU estimator, the proposed algorithm is able to work over the entire identifiable region. Moreover, in the EKF stage, the accurate estimated results can be output point-by-point, which is useful in real applications.

IMPORTANCE: On December 10, 2021, the FDA published a Determination Letter, along with a Statistical Review and Evaluation Report, and concluded that under the non-informative prior, the local Bayesian optimal interval design (BOIN) design, in its revised form, can be designated fit-for-purpose for identifying the maximum tolerated dose of a new drug, assuming that dose-toxicity relationship is monotonically increasing. Although setting the BOIN design parameter p.tox = 1.4 * target.DLT.rate is recommended in almost all BOIN methodology articles and is the default value in the R package BOIN, it's unclear if the choice of p.tox should only depend on the target DLT rate and if certain range of p.tox could produce the same BOIN boundary table. DESIGN: In this simulation study, following parameters were varied one at a time, using R package BOIN, to explore their effects on the equivalence intervals of p.saf and p.tox: 1) target DLT rate, 2) n.earlystop, 3) cutoff.eli, 4) cohortsize, and 5) ncohort. And a simple 3+3 design was used as an example to explore equivalent sets of BOIN design parameters that can generate the same boundary table. RESULTS: When the early stopping parameter n.earlystop is relatively small or the cohortsize value is not optimized via simulation, it might be better to use p.tox < 1.4 * target.DLT.rate, or try out different cohort sizes, or increase n.earlystop, whichever is both feasible and provides better operating characteristics. This is because if the cohortsize was not optimized via simulation, even when n.earlystop = 12 and cohortsize > 3, the BOIN escalation/de-escalation rules generated using p.tox = 1.4 * target.DLT.rate could be exactly the same as those calculated using p.tox > 3 * target.DLT.rate, which might not be acceptable for some pediatric trials targeting 10% DLT rate. The traditional 3+3 design stops the dose finding process when 3 patients have been treated at the current dose level, 0 DLT has been observed, and the next higher dose has already been eliminated. If additional 3 patients were required to be treated at the current dose in the situation described above, the decision rules of this commonly used 3+3 design could be generated using BOIN design with target DLT rates ranging from 18% to 29%, p.saf ranging from 8% to 26%, and different p.tox values ranging from 39% to 99%. These BOIN parameters also need to satisfy a set of conditions. Meaning: This study demonstrates the importance of interpreting BOIN design parameter p.tox as an interval of toxicity rates that are considered too toxic, rather than one prespecified value that corresponds to the lowest toxicity probability that is deemed overly toxic. When designing a dose-finding trial using BOIN, it is important to perform simulation studies to identify equivalent sets of BOIN design parameters that can generate the same boundary table so that we can better compare the safety properties of different boundary tables.

In the neuroscience research field, specific for medical imaging analysis, how to mining more latent medical information from big medical data is significant for us to find the solution of diseases. In this review, we focus on neuroimaging data that is functional Magnetic Resonance Imaging (fMRI) which non-invasive techniques, it already becomes popular tools in the clinical neuroscience and functional cognitive science research. After we get fMRI data, we actually have various software and computer programming that including open source and commercial, it's very hard to choose the best software to analyze data. What's worse, it would cause final result imbalance and unstable when we combine more than software together, so that's why we want to make a pipeline to analyze data. On the other hand, with the growing of machine learning, Python has already become one of very hot and popular computer programming. In addition, it is an open source and dynamic computer programming, the communities, libraries and contributors fast increase in the recent year. Through this review, we hope that can make neuroimaging data analysis more easy, stable and uniform base the one platform system.

Helicobacter Pylori (H. Pylori) is a common pathogen with high prevalence of infection in human populations. Diagnosis of H. Pylori infection is critical for its treatment, eradication, and prognosis. Biosensors have been demonstrated to be powerful for rapid onsite detection of pathogens, particularly for point-of-care test (POCT) scenarios. In this work, we propose a novel optical biosensor, based on nanomaterial porous silicon (PSi) and photonic surface state Tamm Plasmon Polariton (TPP), for detection of cytotoxin-associated antigen A (CagA) antigen of H. Pylori bacterium. We fabricated the PSi TPP biosensor, analysed its optical characteristics and demonstrated through experiments towards sensing of CagA antigen, that TPP biosensor has sensitivity of 100 pm/(ng/ml), limit of detection of 0.01 ng/ml, and specificity in terms of positive-to-negative ratio of more than six. From these performance factors, it can be concluded that TPP biosensor can serve as an effective tool for diagnosis of H. Pylori infection, either in analytical labs or in POCT applications.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Benzimidazole fungicides are a class of highly effective, low-toxicity, systemic broad-spectrum fungicides developed in the 1960s and 1970s, based on the fungicidal activity of the benzimidazole ring structure. They exhibit biological activities including anticancer, antibacterial, and antiparasitic effects. Due to their particularly outstanding antibacterial properties, they are widely used in agriculture to prevent and control various plant diseases caused by fungi. The main products of benzimidazole fungicides include benomyl, carbendazim, thiabendazole, albendazole, thiophanate, thiophanate-methyl, fuberidazole, carbamic acid, and carbendazim salicylate. This article mainly reviews the physicochemical properties, toxicological properties, and disease control efficacy, and pesticide residue and detection technologies of the aforementioned nine benzimidazole fungicides and their main metabolite (2-aminobenzimidazole). On this basis, a brief outlook on the future research directions of benzimidazole fungicides is presented.

In recent years, unmanned aerial vehicles (UAVs) have become a valuable platform for many applications, including communication networks. UAV-enabled wireless communication faces challenges in complex urban and dynamic environments. UAVs can suffer from power limitations and path losses caused by non-line-of-sight connections, which may hamper better communication performance. To address these issues, reconfigurable intelligent surfaces (RIS) have been proposed as a helpful tool to enhance UAV communication networks. However, due to the high mobility of UAV, complex channel environments, and dynamic RIS configurations, it is challenging to estimate the link quality of ground users. In this paper, we propose a link quality estimation model using a gated recurrent unit (GRU) to assess the link quality of ground users for a multi-user RIS-assisted UAV-enabled wireless communication system. Our proposed framework uses a time series of user channel data and RIS phase shift information to estimate the quality of the link for each ground user. Simulation results showed that the proposed GRU model effectively and accurately estimates the link quality of the ground users in the RIS-assisted UAV-enabled wireless communication network.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

Earthquake-triggered landslides are one of the most significant hazards worldwide. These landslides, involving small or large volumes, can develop in debris flow or avalanche with high mobility and long-runout distance. The motion processes of this kind of landslide also quite complicated. This study reproduced the motion processes of two landslides using the LS-RAPID program. The Aso Bridge landslide occurred on April 16, 2016, with rapid and long-runout distance characteristics. The Kataragai landslide occurred on April 9, 2018, travelling with flow-like behavior. Through field investigations and laboratory experiments, features and mechanical parameters of these two landslides were obtained. In the LS-RAPID program, the pre-failure models and motion processes of these two landslides were established and reproduced. Results indicated that sliding speed and travelling morphology at different intervals were considered as two indicators to describe their motion process. However, while sliding speed of these two landslides have significant differences with sliding speeds of actual landslides, the final morphologies after failure were consistent with those observed in the field investigation.

Trace amine-associated receptor 5 (TAAR5) is a G protein-coupled receptor that belongs to the TAARs family (TAAR1-TAAR9). TAAR5 is expressed in the olfactory epithelium and is responsible for sensing 3-methylamine (TMA). However, recent studies showed that TAAR5 is also expressed in the limbic brain regions and is involved in the regulation of emotional behaviour and adult neurogenesis, suggesting that TAAR5 antagonism may represent a novel therapeutic strategy for anxiety and depression. We used the AtomNet® model, the first deep learning neural network for structure-based drug discovery, to identify putative TAAR5 ligands and tested them in an in vitro BRET assay. We found two mTAAR5 antagonists with low to submicromolar activity that are able to inhibit the cAMP production induced by TMA. Moreover, these two compounds also inhibited the mTAAR5 downstream signalling, such as the phosphorylation of CREB and ERK. These two hits exhibit drug-like properties and could be used to develop further more potent TAAR5 ligands with putative anxiolytic and antidepressant activity.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

Adult neurogenesis involves generation of functional neurons from neural progenitor cells, which have the potential to complement and restore damaged neurons and neural circuits. Therefore, the development of drugs that stimulate neurogenesis represents a promising strategy in stem cell therapy and neural regeneration, greatly facilitating the reconstruction of neural circuits in cases of neurodegeneration and brain injury. Our study reveals that compound A5, previously designed and synthesized by our team, exhibits remarkable neuritogenic activities, effectively inducing neurogenesis in neural stem/progenitor cells (NSPCs). Subsequently, transcriptome analysis using high-throughput Illumina RNA-seq technology was performed to further elucidate the underlying molecular mechanisms by which compound A5 promotes neurogenesis. Notably, comparative transcriptome analysis showed that the up-regulated genes were mainly associated with neurogenesis and the down-regulated genes were mainly concerned with cell cycle progression. Furthermore, we confirmed that compound A5 significantly affected the expression of transcription factors related to neurogenesis and cell cycle regulatory proteins. Collectively, these findings identify a new compound with neurogenic activity and may provide insights into drug discovery for neural repair and regeneration.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Based on the analysis of the working principle, circuit design and working loss of the common charger DC/DC converter, this paper designs a ZVS half-bridge three-level DC/DC converter based on non-phase-shift control mode, and proposes a multi-stage constant current and voltage limiting charging control strategy based on modulation wave selection control. The simulation results show that the proposed method and control strategy have faster voltage regulation ability and wider stability margin, and can achieve stable current sharing control in the charging process.

We describe a machine learning (ML) approach to process the signals collected from Covid-19 optical-based detector. Multilayer Perceptron (MLP) and Support Vector Machine (SVM) were used to process both raw data and feature engineering data, and high performances for qualitative detection of the SARS-CoV-2 virus with concentration down to 1 TCID50/ml has been achieved. Valid detection experiments contain 486 negative and 108 positive samples; and control experiments, in which biosensors without antibody functionalization were used to detect SARS-CoV-2, contains 36 negative samples and 732 positive samples. Data distribution patterns of the valid and control detection dataset, based on T-distributed Stochastic Neighbor Embedding (t-SNE), was used to study the distinguishability between positive and negative samples, and explain the ML prediction performances. This work demonstrates that ML can be a generalized effective approach to process signals and dataset of biosensors dependent on resonant modes as biosensing mechanism.

Due to their short range (2–500 nm), Auger electrons (Auger e-) have the potential to induce nano-scale physiochemical damage to biomolecules. Although DNA is the primary target of Au-ger e-, it remains challenging to maximize the interaction between Auger e- and DNA. To assess the DNA-damaging effect of Auger e- released as close as possible to DNA without chemical damage, we radio-synthesized no-carrier-added (n.c.a.) [189, 191Pt]cisplatin and evaluated both its in vitro properties and DNA-damaging effect. Cellular uptake, intracellular distribution, and DNA binding were investigated, and DNA double-strand breaks (DSBs) were evaluated by im-munofluorescence staining of γH2AX and gel electrophoresis of plasmid DNA. Approximately 20% of intracellular radio-Pt was in a nucleus, and about 2% of intra-nucleus radio-Pt bound to DNA, although uptake of n.c.a. radio-cisplatin was low (0.6% incubated dose after 25-h incuba-tion), resulting in the frequency of cells with γH2AX foci was low (1%). Nevertheless, some cells treated with radio-cisplatin had γH2AX aggregates unlike non-radioactive cisplatin. These findings suggest n.c.a. radio-cisplatin binding to DNA causes severe DSBs by release of Auger e- very close to DNA without chemical damage by carriers. Efficient radio-drug delivery to DNA is necessary for successful clinical application of Auger e-.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

Passive marine listening, involving the acoustic monitoring of underwater environments, has become increasingly vital for scientific research, environmental monitoring, and defense applications. However, the success of such applications critically depends on the ability to extract meaningful information from the often noisy and dynamic underwater acoustic environment. In this context, Mel-frequency cepstral coefficients (MFCCs) have emerged as an essential tool for feature extraction, capturing the spectral characteristics of marine sounds and making them ideal for species identification and sound event detection. This research presents an innovative approach to enhance the robustness of MFCC-based passive marine listening through adaptive noise reduction techniques. The proposed approach utilizes dynamic spectral subtraction to counter underwater noise, resulting in enhanced signal-to-noise ratios for desired sounds. This adaptive system adjusts to dynamic underwater noise, allowing it to concentrate on target sounds and suppress interference effectively. The experimentation further validates the effectiveness of the proposed approach, with results reaching 99% on the full dataset of 570 mammals and vessels, demonstrating the effectiveness of SVM and Random Forests in the classification of underwater audio.

The pop-in effect in nanoindentation of metals represents a major collective dislocation phenome-non that displays sensitivity in the local surface microstructure and residual stresses. To under-stand the deformation mechanisms behind pop-ins in metals, large scale molecular dynamics simulations are carried out to investigate the pop-in behavior and indentation size effect in unde-formed and deformed Cu single crystals. Tensile loading, unloading and reloading simulations are performed to create a series of samples subjected to a broad range of tensile strains with/without pre-existing dislocations. The subsequent nanoindentation simulations are con-ducted to study the coupled effects of pre-strain, the presence of resulting dislocations and surface morphology, as well as indenter size effects on the mechanical response in indentation processes. Our work provides detailed insights into the deformation mechanisms and microstruc-ture-property relationships of nanoindentation in the presence of residual stresses and strains.

Deep reinforcement learning is one of the research hotspots in artificial intelligence and has been successfully applied in many research areas, however, the low training efficiency and high demand for samples are problems that limit the application To address these problems, a hierarchical episodic control model extending episodic memory to the domain of hierarchical reinforcement learning is proposed in this paper. The model is theoretically justified and employs a hierarchical implicit memory planning approach for counterfactual trajectory value estimation. Starting from the final step and recursively moving back along the trajectory, a hidden plan is formed within the episodic memory. Experience is aggregated both along trajectories and across trajectories, and the model is updated using a multi-headed backpropagation similar to bootstrapped neural networks. This model extends the parameterized episodic memory framework to the realm of hierarchical reinforcement learning and is theoretically analyzed to demonstrate its convergence and effectiveness. Experiments conducted in Four Room, Mujoco, and UE4-based active tracking , highlight that the hierarchical episodic control model effectively enhances training efficiency. It demonstrates notable improvements in both low-dimensional and high-dimensional environments, even in cases of sparse rewards.

Deoxynivalenol (DON) is a mycotoxin produced by Fusarium spp. that causes Fusarium head blight (FHB) disease in cereal crops. Ingestion of food contaminated with DON poses serious human health complications. However, the DON cytotoxicity has been mostly deduced from animal studies. In this study, we used the nematode Caenorhabditis elegans (C. elegans) as a tractable animal model to dissect the toxic effect of DON. Our results indicate that DON reduces the fecundity and lifespan of C. elegans. The real-time RT-PCR analysis showed that DON upregulates innate immunity-related genes including C17H12.8 and K08D8.5 encoding PMK-1 (mitogen activated protein kinase-1)-regulated immune effectors, and F35E12.5 encoding a CUB-like domain-containing protein. Furthermore, our RNAseq data demonstrate that out of ~ 17,000 C. elegans genes, 313 are upregulated and 166 were downregulated by DON treatment. Among the DON-upregulated genes, several are ugt genes encoding UDP-glucuronosyl transferase (UGTs) which are known to be involved in chemical detoxification. The three upregulated genes, F52F10.4 (oac-32), C10H11.6 (ugt-26) and C10H11.4 (ugt-28) encoding the O-acyltransferase homolog, UGT26 and UGT 28, respectively, are shown to contribute to DON tolerance by RNAi bacterial feeding experiment. The results of this study provide insights to the targets of DON cytotoxicity and potential mitigation measures.

Arthropods, the most abundant group in ecosystems, play crucial roles in human production. Soil physicochemical properties reflect soil health and are linked to arthropods through cascading effects. Gravel-sand mulching, commonly practiced in dry farming regions, initially aids in water retention and temperature regulation. However, long-term cultivation can lead to land degradation and habitat fragmentation. This study aimed to investigate field systems using multiple comparison, linear, and nonlinear correlation analyses to explore the effects of different tillage durations on soil properties and arthropod diversity under gravel-sand mulching. Results indicate that arthro-pod diversity was lower while the fields maintained better soil fertility than the desert steppe. Both soil fertility and arthropod diversity declined significantly with increased years of cultivation. Mantel tests revealed no significant response of desert steppe arthropods to the altered soil properties of gravel-sand mulched fields. However, the Generalized Additive Model analysis indicated significant linear correlations between arthropod occurrence and total nitrogen (positive), available phosphorus, and water content (negative). Arthropod abundance showed significant nonlinear correlations with total potassium, alkali hydrolyzable nitrogen, and organic matter (OM), with OM changes having the most pronounced impact. Thus, gravel-sand mulching can maintain soil fertility over time but at the expense of local arthropod diversity.

Reducing CO2 emissions is urgently needed to slow down the impacts of climate change. CO2 capture using an amine solution has been developed and implemented on pilot and commercial scales. However, amine scrubbing, in particular, produces a lot of degraded solvent as waste and is energy intensive. Solid sorbents have been called to overcome those drawbacks. In this work, waste biomass-derived carbon materials were developed and tested for CO2 capture and conversion. Advanced thermal chemical processes i.e. hydrothermal and pyrolysis were applied to produce materials from agri-food waste such as soybean and okara. It was found that the number of functional groups (-C=O and -OH) in activated carbon appears in the synthesized materials, implying the generation of surface oxygenated groups. Preliminary results showed that the synthesized activated carbons are obtained with good yields, and a relatively high surface area, which may be applied as CO2 adsorption materials to solve the CO2 emission problems.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The entry and exit method is a simple and practical method to determine the critical slip surface of slope. However, it has the drawback of sacrificing computational efficiency to improve search accuracy. To solve this problem, this paper proposes an improved entry and exit method to search for the critical slip surface. Based on the random fields generated by using Karhunen–Loève expansion method, the simplified Bishop’s method combined with the improved entry and exit method is used to determine the critical slip surface and its corresponding minimum factor of safety. Then, the failure probability is calculated by conducting Monte Carlo simulation. Two examples are reanalyzed to verify the accuracy and efficiency of the proposed method. Meaningful comparisons are made to demonstrate the calculating accuracy and calculating efficiency of the improved entry and exit method in searching for the minimum safety factor of slope, based on which the effect of the reduced searching range on slope reliability was explored. The results indicate that the proposed method provides a practical tool for evaluating the reliability of slopes in spatially variable soils. It can greatly improve the computational efficiency in relatively high-computational accuracy of slope reliability analysis.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

CO2 has characteristic properties and reactions at converter smelting temperature, and the chemical reaction between CO2 and elements such as C and Si in the molten pool has bubble proliferation and cooling effects, which can effectively improve the kinetic and thermodynamic conditions of converter smelting. Here, an experimental study and industrial test on the application of CO2 in converter smelting were carried out. The smelting effects of Mode-1 and Mode-2 with total CO₂ injection amounts of 229 Nm³ and 196 Nm³, respectively, were compared, and the changes in molten steel and slag compositions, dust removal, and gas are analyzed. The test results show that converter top and bottom blowing CO₂ technology (COMI-B)technology had significant metallurgical advantages over the N-Mode; the dephosphorization rate increased by 4.2%, slag (FeO) content was reduced by 2.04%, end point nitrogen content of molten steel was reduced by 20%, gas recovery increased by 8.29 Nm³/t, and soot production reduced by 14.7%. The results of the study provide reference for the application of COMI-B technology in converters in the iron and steel industry and develop a new path for resource utilization of CO₂.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

Infrared dim and small target detection is a key technology of various detection tasks. However, due to the lack of shape, texture, and other information, it is a challenging task to detect dim and small targets. Recently, since many traditional algorithms ingore global information of infrared images, they generate some false alarms in complicated environments. To address this problem, in this paper, a coarse-to-fine deep learning-based method is proposed to detect dim and small targets. Firstly, a coarse-to-fine detection framework integrating deep learning and background prediction is applied for detecting targets. The framework contains of coarse detection module and fine detection module. In coarse detection stage, Region Proposal Network (RPN) is employed to generate masks in target candidate regions. Then, for further optimize the result, inpainting is utilized to predict the background by the global semnantic of images. In this paper, inpainting algorithm with a mask aware dynamic filtering module is incorporated into the fine detection stage to estimate background in candidate target areas. Finally, compared with existing algorithms, the experimental results indicate that the proposed framework have effective detection capability and robustness for complex surroundings.

This paper systematically discusses the application of reinforcement learning in automatic driving system. Reinforcement learning frameworks show significant advantages in optimizing decision making, predictive perception, path planning, and controller design, exceeding the limitations of traditional supervised learning methods. The paper highlights the critical role of components such as scene understanding, positioning, and map making in autonomous driving systems, which provide reliable environmental awareness through deep learning and sensor fusion technologies to support intelligent decision-making in complex urban environments. In addition, the paper discusses innovative approaches to safety reinforcement learning to reduce risk in autonomous driving and ensure that systems adhere strictly to safety constraints while maximizing expected rewards. These findings provide an important theoretical and practical basis for further improving algorithm robustness, managing multi-agent interactions, and integrating ethical considerations in the future.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

The emergence of various electronic devices and equipment such as electric vehicles and drones requires higher energy density energy storage devices. Lithium-sulfur batteries (LSBs) are considered as the most promising new generation energy storage system owing to high theoretical specific capacity and energy density. However, the severe shuttle behaviors of soluble lithium polysulfides (LiPSs) and the slow redox kinetics lead to low sulfur utilization and poor cycling stability, which seriously hinder the commercial application of LSBs. Therefore, various catalytic materials have been employed to solve these troublesome problems. High entropy materials (HEMs), as advanced materials, can provide unique surface and electronic structures that expose plentiful catalytic active sites, which opens new ideas for the regulation of LiPSs redox kinetics. Notwithstanding many instructive reviews in the land of LSBs, while this review aims to offer a complete and shrewd summary of the current progresses in HEMs-based LSBs, including in-depth interpretation of design principles and mechanistic electrocatalysis functions as well as pragmatic perspectives.

Severe COVID-19 is a major cause of morbidity and mortality worldwide, especially to those with co-morbidities, the elderly and the immunocompromised. However, the molecular determinants critical for severe COVID-19 progression remain to be fully elucidated. Meta-analysis of transcriptomic RNAseq and single-cell sequencing datasets comparing between severe and mild COVID-19 patients have demonstrated that the early expansion of myeloid-derived suppressor cells (MDSCs) could a key feature of severe COVID-19 progression. Besides serving as potential early prognostic biomarkers for severe COVID-19 progression, several studies have also indicated the functional roles of MDSCs in severe COVID-19 pathogenesis and possibly even long COVID. Given the potential links between MDSCs and severe COVID-19, we examined the existing literature summarizing the characteristics of MDSCs, the evidence of MDSCs in facilitating severe COVID-19 pathogenesis and discuss the potential therapeutic avenues that can be explored to reduce the risk and burden of severe COVID-19. We also provide a web app where users can visualise the temporal changes of specific genes or MDSC-related gene sets during severe COVID-19 progression and disease resolution at https://temporal-severe-covid.streamlit.app/, based on our previous study described by Ong et al., 2021.

Background: Antiplatelet medications such as aspirin and clopidogrel are used following thrombotic stroke or transient ischemic attack (TIA) to prevent a recurrent stroke. However, the antiplatelet treatments fail frequently, and patients experience recurrent stroke. One approach to lower the rates of recurrence, may be the individualized antiplatelet therapies (antiplatelet therapy modification (ATM)) based on the results of platelet function analysis (PFA). This review was undertaken to gather and analyse the evidence about the effectiveness of such approaches. Methods: We searched Medline, CINAHL, Embase, Web of Science and Cochrane databases to 7 January 2020. Results: Two observational studies involving 1136 patients were included. The overall effects of PFA-based ATM on recurrent strokes (OR 1.05; 95% CI 0.69 to 1.58), any bleeding risk (OR 1.39; 95% CI 0.92 to 2.10) or death hazard from any cause (OR 1.19; 95% CI 0.62 to 2.29) were not significantly different from the standard antiplatelet therapy without ATM. Conclusions: The two studies showed opposite effects of PFA-guided ATM on the recurrent strokes in aspirin non-responders, leading to an insignificant difference in the subgroup meta-analysis (OR 1.59; 95% CI 0.07 to 33.77), while the rates of any bleeding events (OR 1.04; 95% CI 0.49 to 2.17) or death from any cause (OR 1.17; 95% CI 0.41 to 3.35) were not significantly different between aspirin non-responders with ATM and those without ATM. There is a need for large randomized controlled trials which account for potential confounders such as ischemic stroke subtypes, technical variations in the testing protocols, patient adherence to therapy, and pharmacogenetic differences.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Acute lung injury (ALI) is characterized by inflammation of the lung tissue and oxidative injury caused by excessive accumulation of reactive oxygen species. Studies have suggested that anti-inflammatory or antioxidant agents could be used for the treatment of ALI with a good outcome. Therefore, our study aimed to test whether the mycelium extract of Sanghuangporus sanghuang (SS-1), believed to exhibit antioxidant and anti-inflammatory properties, could be used against the excessive inflammatory response associated with LPS-induced ALI in mice and to investigate its possible mechanism of action. The experimental results showed that the administration of SS-1 could inhibit LPS-induced inflammation. SS-1 could reduce the number of inflammatory cells, inhibit MPO activity, regulate the TLR4/PI3K/Akt/mTOR pathway and the signal transduction of NF-κB and MAPK pathways in the lung tissue, and inhibit HNGB1 activity in BALF. In addition, SS-1 could affect the synthesis of antioxidant enzymes HO-1 and Trx-1 in the lung tissue and regulate signal transduction in the KAP1/Nrf2/Keap1 pathway. Histological results showed that administration of SS-1 prior to induction could inhibit the large-scale LPS-induced neutrophil infiltration of the lung tissue. Therefore, based on all experimental results, we propose that SS-1 exhibits a protective effect against LPS-induced (ALI) in mice. The mycelium of S. sanghuang can potentially be used for the treatment or prevention of inflammation-related diseases

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

For Synthetic Aperture Radar (SAR) image registration, successive processes following feature extraction are required by both the traditional feature-based method and the deep learning method. Among these processes, the feature matching process—whose time and space complexity are related to the number of feature points extracted from sensed and reference images, as well as the dimension of feature descriptors—proves to be particularly time-consuming. Additionally, the successive processes introduce data sharing and memory occupancy issues, requiring an elaborate design to prevent memory leaks. To address these challenges, this paper introduces the OptionEM-based reinforcement learning framework to achieve end-to-end SAR image registration. This framework outputs registered images directly without requiring feature matching and calculation of the transformation matrix, leading to significant processing time savings. The Transformer architecture is employed to learn image features, while a correlation network is introduced to learn the correlation and transformation matrix between image pairs. Reinforcement learning, as a decision process, can dynamically correct errors, making it more efficient and robust compared to supervised learning mechanisms like deep learning. We present a hierarchical reinforcement learning framework combined with episodic memory to mitigate the inherent problem of invalid exploration in generalized reinforcement learning algorithms. This approach effectively combines coarse and fine registration, further enhancing training efficiency. Experiments conducted on three sets of SAR images, acquired by TerraSAR-X and Sentinel-1A, demonstrate that the proposed method’s average runtime is sub-second, achieving subpixel registration accuracy.

The Station logo is a way for a TV station to claim copyright, which can realize the analysis and understanding of the video by the identification of the station logo, so as to ensure that the broadcasted TV signal will not be illegally interfered. In this paper, we design a station logo detection method based on Convolutional Neural Network by the characteristics of the station, such as small scale-to-height ratio change and relatively fixed position. Firstly, in order to realize the preprocessing and feature extraction of the station data, the video samples are collected, filtered, framed, labeled and processed. Then, the training sample data and the test sample data are divided proportionally to train the station detection model. Finally, the sample is tested to evaluate the effect of the training model in practice. The simulation experiments prove its validity.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

In this paper we study a class of impulsive delayed neural networks with parameter uncertainties and reaction-diffusion terms. Using the properties of M-matrices and some inequality techniques, some sufficient conditions are derived to guarantee the global exponential stability of the given system. The results obtained are presented by simple algebraic inequalities, which are certainly more concise than previous methods. Finally, the validity and usefulness of our results are illustrated by arithmetic examples.

A simple design of an ultrathin six-band polarization-insensitive terahertz perfect metamaterial absorber (PMMA) composed of a metal cross-cave-patch resonator (CCPR) placed over a ground plane was proposed and investigated numerically. The numerical simulation results demonstrate that the average absorption peaks are up to 95% at six resonance frequencies with high quality-factors (>65). In addition, the absorption properties can be kept stability for both normal incident transverse magnetic (TM) and transverse electric (TE) waves. The physical mechanism behind the observed high level absorption is illustrated by the electric and power loss density distributions. The different absorption mainly originates from the higher order multipolar and multipolar plasmon resonance of the structure, which are sharp different to the most previous studies of the PMMAs. Furthermore, the resonance absorption of the PMMA can be tunable by varying the geometric parameters of the unit cell.

A simple design of an ultrathin six-band polarization-insensitive terahertz perfect metamaterial absorber (PMMA) composed of a metal cross-cave-patch resonator (CCPR) placed over a ground plane was proposed and investigated numerically. The numerical simulation results demonstrate that the average absorption peaks are up to 95% at six resonance frequencies with high quality-factors (>65). In addition, the absorption properties can be kept stability for both normal incident transverse magnetic (TM) and transverse electric (TE) waves. The physical mechanism behind the observed high level absorption is illustrated by the electric and power loss density distributions. The different absorption mainly originates from the higher order multipolar and multipolar plasmon resonance of the structure, which are sharp different to the most previous studies of the PMMAs. Furthermore, the resonance absorption of the PMMA can be tunable by varying the geometric parameters of the unit cell.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

Semiconductor photocatalytic performances can be modulated through morphology modification. Herein porous hierarchical BiOBr microspheres (BiOBr-MS) of ~3 m was firstly self-assembled without the assistance of a template via a facile solvothermal synthesis in triethylene glycol (TEG) at 150 oC for 3 h. KBrO3 was exploited as a bromine source, which slowly provided bromide ions upon reduction in TEG and controlled the growth and self-assembly of primary BiOBr nanoplates. The addition of PVP during solvothermal synthesis of BiOBr-MS reduced the particle size by about three-fold to generate BiOBr sub-microspheres (BiOBr-sMS) of <1 m. BiOBr-sMS exhibited significantly higher photocatalytic activity than BiOBr-MS for aerobic photooxidation of benzyl alcohol (BzOH) to benzaldehyde (BzH) under simulated sunlight irradiation (conversions of BzOH (50 mM) over BiOBr-sMS and BiOBr-MS were respectively 51.3% and 29.6% with 100% selectivity to BzH after Xenon illumination for 2 h at 25 oC). The photogenerated holes and •O2- were found to be main reactive species for the BzOH oxidation over BiOBr spheres by scavenging tests and spin-trapping EPR spectra. The higher photocatalytic activity of BiOBr-sMS was attributed to its more open hierarchical structure, efficient charge separation, more negative conduction band position and generation of larger amounts of •O2-.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

Survival models have become popular for credit risk estimation. Most current credit risk survival models use an underlying linear model. This is beneficial in terms of interpretability but is restrictive for real-life applications since it cannot discover hidden nonlinearities and interactions within the data. This study uses discrete time survival models with embedded neural networks as estimators of time to default. This provides flexibility to express nonlinearities and interactions between variables, and hence allows for models with better overall model fit. Additionally, the neural networks are used to estimate Age-Period-Cohort (APC) models so that default risk can be decomposed into time components for loan age (maturity), origination (vintage) and environment (e.g., economic, operational and social effects). These can be built as general models, or as local APC models for specific customer segments. The local APC models reveal special conditions for different customer groups. The corresponding APC identification problem is solved by a combination of regularization and fitting the decomposed environment time risk component to macroeconomic data, since the environmental risk is expected to have a strong relationship with macroeconomic conditions. Our approach is shown to be effective when tested on a large publicly available US mortgage data set. This novel framework can be adapted by practitioners in the financial industry to improve modelling, estimation and assessment of credit risk.

Rational delineation of urban–rural boundaries is a foundational prerequisite for holistic urban and rural development planning and rational resource allocation. However, the results of division of urban–rural boundaries extracted using a single data source are non-comprehensive. To address this problem, the present study proposes a method for using multiple sources such as population data, nighttime light data, land use, and points of interest (POI) data to extract urban–rural boundaries. Considering Guizhou Province for a case study, we here present a two-step method for identifying urban–rural boundaries. First, the random forest model was combined with the dasymetric mapping method to obtain the population spatialization data with a 30-m resolution in the studied province. Second, using the breaking point method, we extracted the urban–rural boundary for Guizhou Province in 2020 based on the spatialized population. This method fully integrated the benefits of various data and judiciously extracted the boundaries of the main urban areas and small- and medium-sized towns of each city in the study province at the same spatial scale. The stratified random sampling method revealed that the average overall accuracy was 88.05%. The method proposed has certain universality and application value and allows identifying the urban–rural boundaries more accurately and practically.

Nicotine is a pharmacologically active component of tobacco which adversely affects the male reproductive system and fertility and Icariin (ICA) is the main active ingredient of Epimedium herba which has been used to treat several male reproductive problems. This study was aimed at investigating the protective or ameliorative effect of ICA against reproductive toxicity induced by intraperitoneal injection of nicotine in mice. Forty male mice were randomly divided into 4 groups: control, nicotine (0.75 mg/kg intraperitoneally), icariin (ICA, 75 mg/kg), and icariin plus nicotine (ICA + nicotine) group. After 35 days of treatment, the mice were weighed, sacrificed, and their reproductive organs were collected and examined for further studies. In the nicotine-treated group, epididymal sperm density and serum testosterone concentrations significantly decreased relative to the control group. Nicotine also caused oxidative damage as shown by significant reduction in the activities of antioxidant enzymes and an elevation in Malondialdehyde (MDA) levels. Icariin on the other hand, improved the reduction in sperm characteristics, hormone levels, and activities of antioxidant enzymes alterations observed in the nicotine treated mice. These findings indicate that the nicotine-induced reproductive toxicity and oxidative damages on male reproductive tissues can be effectively attenuated by icariin.

As a high fatal disease, fat embolism syndrome is complication, which brought great pain to patient and their family served as a serious social burden. The mechanism of FES remains unclear. Autophagy controls the cell survival and homeostasis by removing the mis-folded proteins and damaged organelles as well as intracellular pathogens through a lysosomal degradation pathway. Increasing research documented that autophagy was wildly involved in variety of human diseases and had huge therapeutic potential. In our study, we first established the rat model of FES with the liquid fat by tail vein injection. We observed the up-regulated MPO expression and activity, increased Wet-to-Dry (W/D) lung weight, promoted quantity of fat granules, and the dominant disorder in the lung rat model of FES, compared to the control group. These observations demonstrated that we successfully build the rat model of FES. Then, we sought to dissect the role of the autophagy in the rat model of FES. The western blots analysis showed that the autophagy was inhibited in the rat model of FES constructed with liquid fat. Furthermore, Rapamycin could restore the repression of autophagy in rat model of FES. These investigations illustrated that autophagy was involved in FES. In addition, our experiments showed that Rapamycin could alleviate the symptoms of FES. Taken together, our study demonstrated the participation of autophagy in FES and further, as a potential therapeutic target, the modulation of autophagy could affect the symptom of rat model of FES.

Fully mechanized mining face production involves complex geological conditions; mining pressure; gas, water, fire and other mining environments. The working face needs a shearer, hydraulic support, a scraper conveyor and other equipment for coordination. The deep integration of intelligent technology with factors such as "humans, machines, the environment, and management" in the workplace is the core content of intelligent coal mines. This paper puts forward an advanced framework for coal mining robot technology systems, including single robots, robotized equipment, robot clusters and unmanned systems. The framework clarifies the common key technologies of coal mining robot research and development and cross-integration with new technologies such as 5G, the industrial internet, big data, artificial intelligence, and digital twins to improve the autonomous and intelligent application of coal mining robots. By establishing a scientific and complete standard system for coal mining robots, we aim to achieve customized research and development and standardized production of various types of robots. A specific analysis was conducted on the research progress of common key technologies such as explosion-proof design, mechanical system innovation, power drive, intelligent sensing, positioning and navigation, and underground communication of coal mining robots. The current research and application status of various types of coal mining robots in China are summarized. A new direction for future coal mine robot research and development is proposed. Moreover, robotic mining systems should be promoted to enhance the overall intelligence level and mining efficiency of mining equipment. To develop human‒machine environment-integrated robots to improve the autonomy and collaboration level of coal mining robots. The digital twinning of the entire mine robot system should be accelerated, the normalized operation level of coal mine robots should be improved, research on coal mining robots, support robots, and transportation robots should be carried out, intelligence should be achieved in fully mechanized mining faces, and equipment support for fewer and unmanned fully mechanized mining faces should be provided. The practical process of implementing coal mining robotization has been summarized, and the technical and engineering feasibility of the coal mining machine population has been verified.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

In March 2013, a novel avian influenza A H7N9 virus was emerged in China, which cause rapidly progressive pneumonia and with a high fatality rate. Serologic studies to evaluate neutralizing antibodies of infected patients and birds are invaluable tools for immunogenicity research of H7N9 and epidemiological investigation. Conventional neutralization assays are laborious and time-consuming which also hampered by biosafety requirement. In this study, We construct and produce pseudovirus bearing the full-length hemagglutinin (HA) of H7N9 virus in the Env-defective, luciferase-expressing HIV-1 backbone. The production of lentiviral pseudovirus was analysed by HA gene specific real-time reverse-transcription PCR, transmission electron microscopy (TEM), and Western Blot assay to prove the nucleic acid replication, the morphology of virus, and the expression of HA protein in pseudovirus. After that pseudovirus based inhibition assay was established to detect neutralizing antibodies of a panel of serum samples. Our results demonstrated that H7N9 pseudovirus which had single-cycle infection was generated. By comparing the neutralization antibody titers, pseudovirus based neutralization test could be recognized as an alternative of conventional microneutralization (MN). Hence, we conclude that it is possible to use pseudovirus inhibition assay to screen sera samples, as well as evaluate vaccine-induced neutralizing antibodies against H7N9 virus.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

This paper proposed emotion recognition methods for consecutive facial images, and implements the inference of neural network model on a field-programmable gate array (FPGA). The proposed emotion recognition methods are based on a neural network model architecture that combines convolution neural networks (CNNs), long short-term memory (LSTM), and fully connected neural networks (FCNNs), called CLDNN or ConvLSTM-FCN. This type of neural network mod-el can analyze the local feature sequences obtained through convolution of data, making it suita-ble for processing time-series data such as consecutive facial images. In this paper, sequences of facial images are sampled from videos corresponding to various emotional state of subjects. The sampled images are then pre-processed with the processes includes facial detection, greyscale conversion, resize, and data augmentation if necessary. The 2-D CNN in ConvLSTM-FCN is used for feature extraction for these pre-processed facial images. These sequences of facial im-age features are time sequences with dependent properties between the elements within them. The LSTM is then used to model these time sequences followed by fully connected neural net-works (FCNNs) for classification. The proposed consecutive facial emotion recognition method achieves an average recognition rate of 99.51% on RAVDESS dataset, 87.80% on BAUM-1s dataset and 96.82% on eNTERFACE’05 data set, using 10-fold cross-validation on the PC. Some com-parisons of recognition accuracies between the proposed method and the other existing related works are conducted in this paper. According to the comparisons, the proposed emotion recog-nition methods outperform the existing related researches. The proposed emotion recognition methods are then implemented on an FPGA chip using the neural network model inference algo-rithms in this paper, and the accuracies of the experiments conducted on the FPGA chip are iden-tical to those obtained on the PC. This verifies that the proposed neural network model imple-mented on the FPGA chip performs well.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Long noncoding RNAs (lncRNAs) of virus origin accumulate in cells infected by many positive strand (+) RNA viruses to bolster viral infectivity. Their biogenesis mostly utilizes exoribonucleases of host cells that degrade viral genomic or subgenomic RNAs in the 5’-to-3’ direction until being stalled by well-defined RNA structures. Here we report a viral lncRNA that is produced by a novel replication-dependent mechanism. This lncRNA corresponds to the last 283 nucleotides of the turnip crinkle virus (TCV) genome, hence is designated tiny TCV subgenomic RNA (ttsgR). ttsgR accumulated to high levels in TCV-infected Nicotiana benthamiana cells when the TCV-encoded RNA-dependent RNA polymerase (RdRp), also known as p88, was overexpressed. Both (+) and (-) strand forms of ttsgR were produced in these cells in a manner dependent on the RdRp functionality. Strikingly, templates as short as ttsgR itself were sufficient to program ttsgR amplification, as long as the TCV-encoded replication proteins, p28 and p88, were provided in trans. Consistent with its replicational origin, ttsgR accumulation required a 5’ terminal G₃(A/U)₄ motif shown by others to be crucial for the replication of a TCV satellite RNA. More importantly, introducing a new G₃(A/U)₄ motif elsewhere in the TCV genome was alone sufficient to cause the emergence of another lncRNA. Collectively our results unveil a replication-dependent mechanism for the biogenesis of viral lncRNAs, thus suggesting that multiple mechanisms, individually or in combination, may be responsible for viral lncRNA production.

This study aims to develop an elderly care system for improving the interpersonal relationship of the elderly with mild cognitive impairment (MCI) by employing the speaker recognition technique and association functionality of social network platforms. Firstly, the speaker recognition units based on the Gaussian Mixture Model (GMM) and Gaussian Mixture Model-Universal Background Model (GMM-UBM) are implemented to identify the visitor via individual input utterance. After the visitor is identified, the proposed system will be linked to the private database and social network platforms to extract the associated message of two parties. Experimental results indicate that the speaker recognition unit based on GMM-UBM achieves the best performance. Finally, five elderly persons are invited to measure the usability of the proposed system. A questionnaire is used to survey the five elderly persons, and the result indicates that the proposed system is highly potentially applicable in improving the interpersonal relationship of the elderly with MCI.

Bionic robotic hand can perform many movements similar to human hand. But there is still a significant gap in manipulation between robot and human hand. It is necessary to understand the finger kinematics and motion patterns of human hand to improve the performance of robotic hand. This study aimed to comprehensively investigate normal hand motion patterns by evaluating the kinematics of hand grip and release in healthy individuals. The data corresponding to rapid grip and release were collected from the dominant hand of 22 healthy people by sensory glove. The kinematics of 14 finger joints were analyzed, including the dynamic range of motion (ROM), peak velocity, joint sequence and finger sequence. The results show that the proximal interphalangeal (PIP) joint had a largest dynamic ROM than metacarpophalangeal (MCP) and distal interphalangeal (DIP) joints. Besides, the PIP joint had the highest peak velocity, both in flexion and extension. For joint sequence, the PIP joint moved prior to the DIP or MCP joints during flexion, while extension started in DIP or MCP joints, followed by PIP joint. Regarding the finger sequence, the thumb started to move before four fingers, and stopped moving after the fingers during both grip and release. This study explored the normal motion patterns in hand grip and release, which provided kinematic reference for the design of robotic hand and thus contribute to its development.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

Design changes seem inevitable in engineering, procurement and construction EPC projects. Such changes create a need for a proactive approach to adjusting project scope, cost and time (the triple constraints) for efficiency and effectiveness in overall delivery. This study investigates the causes and implications of design changes in order to improve design change management practices. Data for the study was obtained through online interviews with New Zealand industry practitioners. Thematic analysis was used to collate the results into meaningful data. The study found that design changes were predominantly caused by clients' inadequate strategic planning, insufficient attention to design, EPC contractors' inadequate design ability, and on-site variations. There were three categories of such design changes: direct impact on the project, the reciprocal and complementary effect on stakeholders, and the far-reaching impact on the community. The study concludes by suggesting improvements, such as strengthening the integration of project teams to enhance design quality, strategic alignment of stakeholders at the planning stage, early contractor involvement (ECI) between the planning and design phases, and improving collaboration between design and construction teams. Further, a combination of high technical skills (e.g. design ability) and soft skills (can-do attitude, interpersonal skills, problem-solving skills, documentation skills, etc.) are needed to effect the desired improvement in design change management.

Geminiviruses possess single-stranded, circular DNA genomes, and control the transcription of their late genes, including BV1 of many bipartite begomoviruses, through transcriptional activation by the early expressing AC2 protein. DNA binding by AC2 is not sequence-specific, hence the specificity of AC2 activation is thought to be conferred by plant transcription factors (TFs) recruited by AC2 in infected cells. However, the exact TFs AC2 recruits are not known for most viruses. Here we report a systematic examination of the BV1 promoter (PBV1) of mungbean yellow mosaic virus (MYMV) for conserved promoter motifs. We found that MYMV PBV1 contains three abscisic acid (ABA)-responsive elements (ABREs) within its first 70 nucleotides. Deleting these ABREs, or mutating them all via site-directed mutagenesis, abolished the capacity of PBV1 to respond to AC2-mediated transcriptional activation. Furthermore, ABRE and other related ABA-responsive elements were prevalent in more than a dozen Old World begomoviruses we inspected. Together these findings suggest that ABA-responsive TFs may be recruited by AC2 to BV1 promoters of these viruses to confer specificity to AC2 activation. These observations are expected to guide the search for the actual TF(s), furthering our understanding of the mechanism of AC2 action.

In Taiwan, colorectal cancer is ranked second and third in terms of mortality and cancer incidence, respectively. In addition, medical expenditures related to colorectal cancer are considered to be the third highest. While advances in treatment strategies have provided cancer patients with longer survival, potentially harmful second primary cancers can occur. Therefore, second primary colorectal cancer analysis is an important issue with regard to clinical management. In this study, a novel predictive scheme was developed for predicting the risk factors associated with second colorectal cancer in patients with colorectal cancer by integrating five data mining classification techniques, including support vector machine, random forest, multivariate adaptive regression splines, extreme learning machine, and extreme gradient boosting. In total, 4,287 patients in the datasets provided by three hospital tumor registries were used. Our empirical results revealed that this proposed predictive scheme provided promising classification results and the identification of important risk factors for predicting second colorectal cancer based on accuracy, sensitivity, specificity, and area under the curve metrics. Collectively, our clinical findings suggested that the most important risk factors were the combined stage, age at diagnosis, BMI, surgical margins of the primary site, tumor size, sex, regional lymph nodes positive, grade/differentiation, primary site, and drinking behavior. Accordingly, these risk factors should be monitored for the early detection of second primary tumors in order to improve treatment and intervention strategies.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

We investigate the ammonium removal abilities of natural and synthetic zeolites, which have distinct Si/Al ratios and various surface areas, to study how adsorption and ion-exchange processes in zeolites perform under different ammonium concentrations and different temperatures. Five zeolites including natural mordenite, chabazite, erionite, clinoptilolite and synthetic merlinoite were immersed in 20 mg/kg, 50 mg/kg and 100 mg/kg ammonium solutions. The results demonstrate that zeolites under high ammonium concentrations (100 mg/kg) possess higher physical adsorption capacity (0.398–0.468 meq/g), whereas those under lower ammonium concentrations (20 mg/kg) possess greater ion-exchange property (64–99%). The ion-exchange ability of zeolites are extremely dependent on the cation content of the zeolites, and the cation content is affected by the Si/Al ratio. The surface area of zeolites also has a partial influence on its physical adsorption ability. When the surface area is less than 100 m²/g, the adsorption ability of zeolite increases obviously with surface area; however, adsorption ability is saturated as the surface area becomes larger than this critical value of 100 m²/g. When we carried out the zeolites in 50 mg/kg ammonium concentration at different temperatures (5~50 ℃), we found that zeolites exhibit the highest ammonium removal ability at 30°C and the potassium release was enhanced at 30~40 ℃.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

The surface behavior of the ZnO-based films could be modulated via a postannealing and ultraviolet (UV) irradiation with different powers and time, respectively. These present results could provide modulate the microstructure related in grain-size distribution and photocatalytic behavior for potential guide in the field of wide bandgap semiconducting oxides. The ZnO films were prepared onto Corning-1737 glass substrates by using radio-frequency magnetron sputtering without supplying oxygen source at room temperature. For the purpose of obtaining modulable grain microstructures, the as-prepared ZnO films (Z0) were treated via a postannealing modification in vacuum furnace at 300°C for 30 minutes after deposition (Z300) accompanied with the adjustable internal stress. The contact angle (CA) value of ZnO film reduced from 95° to 68° was owning to the different grain microstructure accompanied by a change in size variation. In addition, the UV light with different irradiation powers could also be used to improve the hydrophilicity varied from hydrophobic status to superhydrophilic status due to the desirable surface characteristics of the photocatalytic action. In addition, the photocatalytic activity of ZnO film exhibited efficient photodegradation of methylene blue (MB) under UV irradiation, with a chemical reaction constant of 2.93×10-3 min−1. In this present work, we demonstrated that the CA value of the ZnO films not only caused from hydrophobic to hydrophilic status accompanied by a change in grain size combined with internal stress but also induced by the UV light irradiation combined with photocatalytic activity simultaneously. On the other hand, the enhanced surface plasmonic resonance could be observed that is due to couple electron and photon oscillations and can be generated at the interface between a flat, continuous Pt capping nanolayer. This designed structure could also be considered as a Pt electrode pattern onto ZnO (metal Pt/ ceramic ZnO) for multifunctional heterostructured sensors and devices in near future.

Abstract: Because of outstanding heat resistance and processing qualities, benzoxazine resins are widely employed in a variety of applications. However, traditional benzoxazine resins still confront hurdles in today's engineering applications, such as can’t long-term service in high-temperature settings and inadequate toughness. Four alkyne-functionalized benzoxazines with phthalide side group and cyano group of varying molecular weights were produced in this study. Fourier trans-form infrared spectroscopy (FT-IR) and hydrogen nuclear magnetic resonance spectroscopy ( 1H-NMR ) were used to characterize the resin structure, and differential scanning calorimetry (DSC) was used to investigate the thermal curing kinetics at different warming rates, the apparent activation energy was 116.9 kJ/mol. In-situ FTIR was used to investigate the cure mechanism. Dynamic mechanical analysis (DMA) was used to evaluate the gelationation time of BOZ series resins at various temperatures, and the curing process was designed by combined the results of DSC. The Tg of the composites made using BOZ-1N21 as the matrix was 336°C, which was much higher than the Tg of the BP-a resin made with aniline, phenolphthalein, and formaldehyde (Tg=251°C). As a result, the resin system is expected to be employed in applications requiring high-temperature resistance and toughness.

Climate change is a global issue that draws widespread attention from the international society. As an important component of the climate system, the water cycle is directly affected by climate change. Thus, it is very important to study the influences of climate change on the basin water cycle with respect to maintenance of healthy rivers, sustainable use of water resources, and sustainable socioeconomic development in the basin. In this study, by assessing the suitability of multiple General Circulation Models (GCMs) recommended by the Intergovernmental Panel on Climate Change, Statistical Downscaling Model (SDSM) and Automated Statistical Downscaling model (ASD) were used to generate future climate change scenarios. These were then used to drive distributed hydrologic models (Variable Infiltration Capacity, Soil and Water Assessment Tool) for hydrological simulation of the Yangtze River and Yellow River basins, thereby quantifying the effects of climate change on the basin water cycle. The results showed that suitability assessment adopted in this study could effectively reduce the uncertainty of GCMs, and that statistical downscaling was able to greatly improve precipitation and temperature outputs in global climate mode. Compared to a baseline period (1961–1990), projected future periods (2046–2065 and 2081–2100) had a slightly decreasing tendency of runoff in the lower reaches of the Yangtze River basin. In particular, a significant increase in runoff was observed during flood seasons in the southeast part. However, runoff of the upper Yellow River basin decreased continuously. The results provide a reference for studying climate change in major river basins of China.

Antibiotic resistance (ABR) is concerning issue due to its direct and indirect repercusions on public health, since decreased therapeutic effect of certain antibiotic to treatment complications that can cause death. There are several mechanism as to how ABR can be transferred from one microoorganisms to another, and many of them are dependant many environmental factors. The food supply chain is a environment in which ABR gene transfer can occur is multiple pathways, which generate concerns regarding food safety. Here, we summarize relevant mechanisms which are implied in ABR in food supply chain but also we are addressing routes of transmission and prevalence of ABR, implications on public health, and the application of new alternatives to antibiotics such as antimicrobial peptides, mainly bacteriocins, in order to countermeasure ABR.

As major natural disasters in grassland areas, fires and dust events seriously threaten human safety, property, and animal husbandry. Furthermore, these phenomena may be mutually reinforcing, which can lead to more severe cascading disasters. However, few studies have been on the mechanisms of grassland fire and dust events disaster chain. Therefore, we selected Dornod aimag (province), a typical temperate grassland, as the study area and analyzed the spatiotemporal variation patterns of grassland fires and dust weather, as well as the effect of grassland fires on dust weather based on MCD64A1 Burnt Area data and SYNOP dust data. The mechanism of grassland fires on dust weather was further investigated using the MOD13A3 vegetation index product and ERA5 wind speed, wind direction, and precipitation data. The results revealed that grassland fires and dust weather varied spatially across the study area. Furthermore, grassland fires occurred mainly in spring (April to May), summer (June), and autumn (October), while dust weather mainly occurred in spring (March to May). Moreover, autumn, winter, and spring cumulative grassland fires (both days and area) substantially affected the spring total dust weather days and dust storm days, particularly the spring cumulative dust storm days. Additionally, higher precipitation in the summer of 2014 resulted in higher vegetation coverage and more fuel in the autumn and winter of 2014, and even in the spring of 2015. As a result, the cumulative grassland fire days was higher, and the area was larger from September 2014 to April 2015, leading to a considerable increase in the cumulative dust storm days in May 2015. This study has important implications for disaster prevention and mitigation, ecological and environmental protection, and sustainable development in grasslands.