Background: Hypoalbuminemia is known to be associated with adverse outcome in critical illness. In this study, we attempted to identify if hypoalbuminemia on emergency department (ED) arrival a reliable predictor for in-hospital mortality in necrotizing fasciitis (NF). patients. Method: A retrospective cohort study of hospitalized patients with NF was conducted in a tertiary teaching hospital in Taiwan between March 2010 and March 2018. Blood samples were collected in the ED upon arrival, and serum albumin levels were determined. we evaluated the predictive value of serum albumin level at ED presentation for in-hospital mortality. All collected data were statistically analyzed. Result: Of the 707 NF patients, 40 (5.66%) died in the hospital. The mean serum albumin level was 3.1 ± 0.9 g/dL and serum albumin levels were significantly lower in the non-survivor group than in the survivor group (2.8± 0.7 g/dL vs. 3.5 ± 0.8 g/dL). In the multivariable logistic regression model, albumin was associated with in-hospital mortality significantly (odds ratio[OR] 0.92, 95% confidential interval (CI) 0.88–0.96, P <0.001). The area under-the-receiver-operating-characteristic curve (AUC) for in-hospital survival was 0.77 (95% CI 0.72–0.82) and corresponding sensitivity, specificity, positive predictive value, negative predictive value, positive and negative likelihood ratio were 66%, 74%, 33%, 88%, 2.25 and 0.48, respectively. High sensitivity (96%) was shown at albumin level of 4.0 g/dL and high specificity (91%) was shown at level of 2.5 g/dL. Conclusion: Initial serum albumin levels were independently associated with in-hospital mortality among adult patients with necrotizing fasciitis and demonstrated fair discriminative performance in the prediction of in-hospital mortality. NF patients with hypoalbuminemia on ED arrival should be closely monitored for signs of deterioration and consider early and aggressive intervention to prevent mortality.

The research is devoted to the study of geotectonic and geodynamics of the Shu-Ile belt and petrographic composition and intrusive complexes geochemical features analysis. The Shu-Ile suture is an important geological structure of Kazakhstan. It is characterized by the presence of various intrusive formations and deep faults. The material composition of these intrusions is of interest for understanding the geological and metallogenic processes in this region. The research used modern scientific methods, including petrographic and geochemical studies of various compositions intrusion samples. Based on the results of material composition studies of intrusive complexes, their possible connections with other geological structures of Kazakhstan and the metallogeny of the region have been established. Based on the data obtained, a conclusion was made about the intrusive complexes origin and evolution of the Shu-Ile belt, which may be important for further geological research and forecasting of mineral resources in the region.

With correct dynamic system parameters (embodied in self-awareness statements), a controller can provide precise signals for tracking desired state trajectories. If dynamic system parameters are initially guessed incorrectly, a learning method may be used to find the correct parameters. In the deterministic artificial intelligence method, self-awareness statements are formed as mathematical expressions of the governing physics. When the nonlinear, coupled expressions are precisely parameterized as the product of known matrix components and unknown victrix (i.e., a regression form) tracking errors may be projected onto the known matrix to update the unknown victrix in an optimal form (in a two-norm sense). In this work, a modified learning method is proposed and proved to have global convergence of both state error and parameter estimation error. The modified learning method is compared with those in the prequels using simulation experiments of three-dimensional rigid body dynamic rotation motion. The modified approach is two magnitudes better than the methods in the prequels in terms of state error convergence.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

The synthesis 2-tert-butyl-4-methylphenol is of great significance because of its widely application in industry, and the development of highly efficient catalyst is necessary to the alkylation of p-cresol and tert-butyl alcohol. Here, an efficient and mild method was established, caprolactam was chosen as hydrogen-bonding acceptor, p-toluenesulfonic acid was employed as hydrogen-bonding donor, and deep eutectic solvent (DES) was prepared to catalyze the alkylation reaction. The structure of the DES catalyst was characterized by 1H NMR spectra, thermogravimetric analysis and fourier transform infrared spectra (FT-IR). In addition, response surface design based on Box-Behnken method was employed to optimize the alkylation reaction process parameters, the study of reaction kinetics was also carried out subsequently. The recycle performance of the catalyst was evaluated by recovery experiments, and a good result was obtained. Comparing with the literature reported, we here provide a mild method to the synthesis of 2-tert-butyl-4-methylphenol.

The rapid development of digital multimedia has resulted in a massive storm of large-scale data. The data compression method reduces data size and lowers transmission costs. As a result, data-hiding research in the compression domain poses significant challenges to researchers. This paper proposes a highly imperceptible data-hiding scheme for a compressed image of Absolute Moment Block Truncation Coding (AMBTC). The combination theory is implemented to ensure the high imperceptibility of the modified compressed images. By only modifying one pixel in a block to embed secret bits, the experimental results show that the proposed method achieved high imperceptibility and high hiding capacity.

As precision medicine such as targeted therapy and immunotherapy often have limited accessibility, low response rate and evolved resistance, it is urgent to develop simple, low-cost, and quick-turnaround personalized diagnostic technologies for drug response prediction with high sensitivity, speed, and accuracy. Major challenges of drug response prediction strategies employing digital database modeling are the scarcity of labeled clinical data, applicable only to a few classes of drugs, and losing the resolution at the individual patient level. Although these challenges have been partially addressed by large-scale cancer cell line datasets and more patient-relevant cell-based systems, the integration of different data types and data translation from pre-clinical to clinical utilities are still far-fetched. To overcome current limitations of precision medicine with a clinically proven drug response prediction assay, we have developed an innovative and proprietary technology based on in vitro patient testing and in silico data analytics. First, a patient-derived gene expression signature was established via transcriptomic profiling of cell-free mRNA (cfmRNA) from the patient’s blood. Second, a gene-to-drug data fusion and overlaying mechanism to transfer data was performed. Finally, a semi-supervised method was used for database searching, matching, annotation and ranking of drug efficacies from a pool of ~700 approved, investigational or clinical trial drug candidates. A personalized drug response report can be delivered to inform clinical decision within a week. The PGA (Patient-derived Gene expression-informed Anticancer drug efficacy) test has significantly improved patient outcomes when compared to the treatment plans without PGA support. Implementation of PGA, which combines patient-unique cfmRNA fingerprints with drug mapping power, has the potential to identify treatment options when patients are no longer responding to therapy and when standard-of-care is exhausted.

We aimed to investigate the mechanism underlying social stress (SS)-induced erectile dysfunction (ED) and evaluate the effects of a single sub-anesthetic dose of ketamine on SS-related ED. Male FVB mice were exposed to retired male C57BL/6 mice for 60 minutes daily over a 4-week period. In the third week, SS mice received intraperitoneal injections of either saline (SSS group) or ketamine (SSK group). Erectile function was assessed by measuring intra-cavernosal pressure (ICP) during electrical stimulation at the major pelvic ganglia. Corpus cavernosum (CC) strips were utilized for wire myography to assess their reactivity. Both SSS and SSK mice exhibited significantly lower ICP in response to electrical stimulation than control. SS mice showed increased contractility of CC induced by phenylephrine. Acetylcholine-induced relaxation was significantly reduced in SSS and SSK mice. Sodium nitroprusside-induced relaxation was higher in SSS mice compared to control and SSK mice. Nicotine-induced neurogenic and nitric oxide (NO)-dependent relaxation was significantly impaired in both SSS and SSK mice. Immunohistochemically analysis revealed co-localization of tyrosine hydroxylase and neuronal nitric oxide synthase (nNOS)-immunoreactive fibers in the CC. These findings highlight the complex nature of SS-related ED and suggest the limited efficacy of ketamine as a therapeutic intervention in this condition.

Background: Cancer patients require cross-professional care during the diagnosis and treatment periods. Therefore, methods for effectively carrying out case management are essential to tumor care. Purpose: To investigate the effects of using the community software LINE Official Ac-count on oral cancer case management. Methods: An experimental design was used; 100 patients were randomly divided into two groups by using a computer-generated random number table. The experimental group used LINE Official Account, which gave them self-care information, timely messages, and one-on-one health-care consultations. The control group followed standard healthcare practices. Results: The experimental group was satisfied with the self-care information provided by LINE Official Account (86.9%), patients regularly checked the self-care information (89.4%) and would check the information when receiving a push notification (54.3%). Ten patients used the one-on-one consultation(20.0%). LINE Official Account had a significant effect on the rate of participation in support groups. Generalized estimating equations indicated a significant difference between the two groups regarding the overall quality of life over 7 days (P = 0.023). Conclusion: Community software applications used in oncological case management can improve self-management and empower, also enable tracking of long-term follow-up effectiveness and reinforce the case manager’s role as a family therapist. Therefore, this study recommends that case manager systems be incorporated into mobile applications to increase the sustainable management, accessibility, effectiveness, and satisfaction of oncological management systems. This study also provides the value of Sustainable Development Goals (SDGs) with Good Health and Well-being, and decreased social withdrawal among patients with oral cancer.

We study the influence of high-order twisting phases on polarization states and optical angular momentum of a vector light field with locally linear polarization and a hybrid state of polarization (SoP). The initial SoP of a twisted vector optical field (TVOF) modulated by the high-order twisting phase possesses various symmetric distributions. The propagating properties of a high-order TVOF with locally linear polarization and hybrid SoP are explored, including the intensity compression, expansion, and conversion between the linear and circular polarization components. In particular, orbital angular momentum (OAM) appears in a high-order TVOF during propagation where no OAM exists in the initial field. The variation of OAM distribution in cross-section becomes more frequent with the increase of the twisting phase order. In addition, a non-symmetric OAM distribution appears in an anisotropic TVOF, leading to the rotation of the beam around the propagation axis during propagation. These results provide a new approach for optical field manipulation in a high-order TVOF.

Background: Selection and application of suture materials, has gained more importance especially with the increasing number of patients seeking oral surgeries. Since lying in a bacterial-filled environment, sutures make the tissue prone to infection. Suture material plays an important role in the reduction of the risk of infection. This study aimed to assess the success rate of an antibacterial suture named Vicryl Plus in preventing bacterial growth in the surgical site of the mandibular third molar. Methods: 27 patients were included in this double-blinded randomized clinical trial study. Surgical Extraction of the mandibular wisdom tooth was done and the incision was managed by randomly using Vicryl Plus and Vicryl sutures. After 7 days, sutures were removed and assessed microbiologically. Predominant species of Streptococcus mutans and Lactobacillus were assessed as well as the total number of colonies on each suture. Results: There was a significant difference between two suture materials in colony number-length ratio of lactobacillus (p-value= 0.031) and total bacterial colonies (p-value=0.016); but not for S. mutans species (p-value=0.201). Conclusion: Antibacterial Vicryl suture can be a useful tool for the reduction in the rate of surgical site infection in high-risk cases and situations.

Fiber coupling efficiency is one of the key technical indicators of atmospheric laser communication, which directly affects the communication system BER. According to the optical fiber coupling efficiency model, the optical fiber coupling model under atmospheric slant link is established, and the relationship between wavelength, zenith angle, receiving aperture, altitude and coupling efficiency is studied through numerical simulation. Based on the principle of adaptive optics turbulence correction, the relationship between fiber coupling efficiency and adaptive optics order is established. A fast method for estimating the coupling efficiency based on Strehl ratio is proposed. According to the principle of laser communication system, the semi-physical simulation experimental system of atmospheric slant-range channel coupling efficiency is constructed, and the coupling efficiency test and analysis are completed.

When a microgrid is grid-tied to a distribution system, it can provide surplus power generation to the distribution system, if any abnormality or interruption occurs in the distribution system, the microgrid can operate in standalone mode to isolate the impact of the abnormality or interruption. However, if the microgrid can not collect enough information from the distribution system, it may cause the failure of generation transferring of distribution feeders, or even further influence the stability of the distribution system. In this paper, a strategy for the resilient control of a microgrid is proposed. It can solve the above-mentioned problem, reduce the duration of the outage of loads. This strategy is experimented in the microgrid in the Institute of Nuclear Energy Research (INER), the reliability is also analyzed to evaluate the unavailability of the microgrid in INER, and it is verified that the proposed strategy can reduce the duration of the outage of loads, and hence the reliability of a microgrid can be upgraded.

In coastal areas around the world, seagrass meadows play a crucial ecological and economic role. A large amount of seagrass beds dominates primary production and contributes to the high secondary productivity of this ecosystem. The microbial loop (consuming bacterial biomass by grazers and using seagrass-derived detritus by bacteria) may be an important mechanism for transferring seagrass-derived organic matter to the aquatic food chain. This study aims to improve our understanding of how bacterial growth and mortality (grazing and viral lysis rates) differ in seagrass and adjacent unvegetated meadow habitats. We found that viral lysis and grazing caused similar mortality rates of bacteria in a seagrass environment during the summer. It has been found, however, that bacterial production is controlled by the availability of resources (bottom-up control) and is cycled within the bacteria-virus-DOC loop in adjacent unvegetated waters. Our study region may be affected by this shift in organic matter fate and cycling.

Hyperbaric oxygen (HBO) treatment has been proven to attenuate neuroinflammation in rats. This study aimed to determine the potential mechanism underlying the anti-inflammatory effects of HBO treatment on burn-induced neuroinflammation in rats. Thirty-six adult male Sprague–Dawley (SD) rats were randomly assigned to the following six groups (n = 6 per group): (1) sham burn with sham HBO treatment, (2) sham burn with HBO treatment, (3) burn with 1-week sham HBO treatment, (4) burn with 2-week sham HBO treatment, (5) burn with 1-week HBO treatment, and (6) burn with 2-week HBO treatment. SD rats that received third-degree burn injury were used as a full-thickness burn injury model. Subsequently, we analyzed the expression of proteins involved in the galectin-3 (Gal-3)-dependent Toll-like receptor-4 (TLR-4) pathway through enzyme-linked immunosorbent assay (ELISA), immunohistochemistry (IHC) analysis, and Western blotting, and a behavior test was also conducted. The behavior test revealed that HBO treatment significantly suppressed mechanical hypersensitivity in the burn with HBO treatment group compared with the burn with sham HBO treatment group (p < 0.05). ELISA results showed that tumor necrosis factor alpha (TNF-α) and interleukin 1 beta (IL-1β) levels in the dorsal horn of the spinal cord and the skin were significantly decreased in the burn with HBO treatment group compared with the burn with sham HBO treatment group (p < 0.05). Western blotting results demonstrated that HBO treatment significantly reduced the expression of Gal-3 and TLR-4 in the dorsal horn of the spinal cord in the burn with HBO treatment group compared with the burn with sham HBO treatment group (p < 0.05). IHC analysis results showed that the expression of Gal-3, TLR-4, CD68, and CD45 in the dorsal horn of the spinal cord was significantly lower in the burn with HBO treatment group than in the burn with sham HBO treatment group (p < 0.05), and the expression of CD68 and macrophage migration inhibitory factor (MIF) in the right hind paw skin was significantly lower. The expression of vimentin and fibroblast growth factor (FGF) in the right hind paw skin was significantly higher after HBO treatment (p < 0.05). This study proved that early HBO treatment relieves neuropathic pain, inhibits the Gal-3-dependent TLR-4 pathway, and suppresses microglia/macrophage activation in a rat model.

Vertical-channel organic dual-gate/base transistors would be highly interesting since vertical organic transistors are the fastest organic transistors demonstrated today. However, incorporating a dual gate/base structure into an ultra-short channel vertical architecture represents a substantial challenge. Here, we successfully realize a new device concept of vertical organic permeable dual-base transistors (OPDBTs), where either of both base electrodes can be used to change the on-currents and tune the threshold voltages. The optimized devices yield a high on-current density of 1.54 A cm^-2 and a large current gain of 9.2×10⁵, corresponding to a high transmission value of 99.998%. The detailed operation mechanisms are investigated by calibrated TCAD simulations with the Poole-Frenkel mobility model, Gaussian density of states and tunneling model. Finally, high-performance logic circuits, e.g. inverter, NAND/AND computation functions are demonstrated with one single OPDBT operating at supply voltages of < 2.0 V. We believe that OPDBTs offer a compact and technologically simple hardware platform with excellent application potential for vertical-channel organic transistors in complex logic circuits.

Polysaccharide from Ficus carica L. (FCP) exert multiple biological activities, as a biological macromolecule, the available knowledge about the specific structures and mechanisms of biological activity of purified 'Brunswick' fig polysaccharide is currently limited. In the present study, by chemical purification and characteristics identified via specific instruments, and then the impact of FCP on the immunomodulation activity in vitro and in vivo was examined. Structural char-acteristics showed that the molecular weight of the FCP was determined to be 127.5 kDa, the primary monosaccharides present in the FCP were galacturonic acid (GalA), arabinose (Ara), galactose (Gal), rhamnose (Rha), glucose (Glc), and xylose (Xyl) at a ratio of 0.321:0.287:0.269:0.091:0.013:0.011. Based on the investigation of in vitro immunomodulatory ac-tivity, FCP was found to stimulate the production of NO, TNF-α, and IL-6 and increased the pi-nocytic activity of macrophages. Further analysis revealed that FCP activated macrophages by interacting with toll-like receptor 4 (TLR4). Moreover, the in vivo test results indicate that FCP showed significant increase serum pro-inflammatory factors in immunosuppressed mice. Overall, this study suggests that FCP has the potential to be utilized as a novel immunomodulator in the pharmaceutical and functional food industries.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

(1) Background: This retrospective study aimed to compare the efficacy and safety of one-stage computed tomography (OSCT)- to that of two-stage computed tomography (TSCT)-guided localization for the surgical removal of small lung nodules. (2) Methods: We collected data from patients with ipsilateral pulmonary nodules who underwent localization before surgical removal at Veteran General Hospital Kaohsiung between October 2017 and January 2022. The patients were divided into the OSCT and TSCT groups. (3) Results: We found that OSCT significantly reduced the localization time and risky time compared to TSCT, and the success rate of localization and incidence of pneumothorax were similar in both groups. However, the time spent under general anesthesia was longer in the OSCT group than in the TSCT group. (4) Conclusions: The OSCT-guided approach to localize pulmonary nodules in hybrid operation room is a safe and effective technique for the surgical removal of small lung nodules.

Cell junction that is usually associated with dynamic cytoskeletons is essential for a wide range of cellular activities such as cell migration, cell communication, barrier function and signal transduction. Real-time observation of cell junction facilitates understanding of the mechanisms by which cell junction regulate relevant cellular activities. In this study, we examined the binding capacity of a modified tridecapeptide from Cx43 to cell junction protein ZO-1 and sought to create a fluorescent peptide that could be used to label cell junction. To introduce the fluorescent peptide into the cells, a cell-penetrating peptide was linked to the modified tridecapeptide and synthesized. The binding of the modified tridecapeptide was tested using pull down and immunoprecipitation assay. The ability of the peptide to label cell junction was assessed by adding it to fixed or cultured Caco-2 cells. Testing assay revealed that the Cx43-derived peptide can bind to ZO-1. Besides, the peptide was able to label cell junction of fixed cell, although no obvious cell junction labeling was observed clearly in living cells, probably due to the inadequate affinity. These results indicate that a peptide-based strategy for labeling cell junction may be feasible, and efforts to improve its affinity are warranted in the future.

In the TANGO study, the long-term noninferior efficacy of switching to dolutegravir/lamivudine (DTG/3TC) compared to continuing tenofovir alafenamide–based regimens was demonstrated in treatment-experienced adults with HIV. However, there is limited real-world data comparing the effectiveness and safety of bictegravir/emtricitabine/tenofovir alafenamide fumarate (BIC/FTC/TAF) and DTG/3TC in Asia. This retrospective observational study, conducted at a designated HIV-care hospital from March 2019 to January 2023, aimed to address this gap. Demographic, clinical, and laboratory data, including HIV viral loads and lipid profiles, were collected and analyzed. The primary outcome was the proportion of patients with HIV RNA <50 copies/mL at week 48 in both groups, utilizing a snapshot, per-protocol–exposed population. A total of 1086 patients were included, with 511 in the DTG/3TC group and 575 in the BIC/FTC/TAF group. At week 48, 98% of patients in the DTG/3TC group and 94% in the BIC/FTC/TAF group achieved HIV RNA <50 copies/mL (p <0.01). Logistic regression analysis identified risk factors for detectable viral loads at week 48, including HIV RNA >100,000 copies/mL (AOR 5.13, 95% CI 1.42–18.53), low-level viremia (AOR 3.91, 95% CI 1.07–14.25), and record of virologic failure ≥2 times (AOR 4.21, 95% CI 1.64–10.85) before the switch. Furthermore, no significant difference was found between the DTG/3TC and BIC/FTC/TAF regimens (AOR: 1.51, 95% CI 0.70–3.24). In conclusion, the study demonstrates that the effectiveness and safety profiles of DTG/3TC and BIC/FTC/TAF were comparable in treatment-experienced adults with HIV, particularly among those with undetectable viral loads at baseline.

Arylsulfatase and β-glucuronidase are two important enzymes in human, which play important role on dynamic equilibrium of steroidal estrogens. This work probably for the first time reported that hydrogen peroxide (H2O2), hypochlorite and peracetic acid (PAA) could effectively inhibit the activities of arylsulfatase and/or β-glucuronidase. The 50 percent of inhibitions (IC50) of H2O2, and PAA on arylsulfatase were found to be 142.90±9.00, 91.83±10.01, and 43.46±2.92 μM, respectively. The corresponding respective IC50 of hypochlorite and PAA on β-glucuronidase were 704.90±41.40 and 23.26±0.82 μM, while H2O2 showed no inhibition on β-glucuronidase. It was further revealed that the inhibition of hypochlorite on both arylsulfatase and β-glucuronidase was irreversible. On the contrary, the inhibition by H2O2 and PAA was reversible. Moreover, it was found that the inhibitions of arylsulfatase and/or β-glucuronidase by these three chemicals were pH-dependent, among which the inhibition by H2O2 was competitive and non-competitive for PAA. In general, H2O2 and hypochlorite can be endogenously produced in human, which suggested that the two compounds are potential endocrine disruption compounds (EDCs) as they can cause endocrine disruption via inhibition of arylsulfatase and β-glucuronidase. This work further indicated that any agent that can induce production of H2O2 or hypochlorite in human is potential EDC, which explains why some EDCs with very weak or no estrogenic potency can cause endocrine disruption that confirmed in epidemiological studies.

Several observational studies have indicated the potential associations between calcium, vitamin D(Vit-D) and irritable bowel syndrome (IBS). However, the causal relationship deduced from these studies is subjected to residual confounding factors and reverse causation. Therefore, we aim to explore the bidirectional causal effects between serum calcium, Vit-D, PTH and IBS at the genetic level by a two-sample Mendelian randomization (MR) analysis. Sensitivity analyses were performed to evaluate the robustness. The estimates were presented as odds ratio (OR) with their 95% confidence intervals (CIs). The results of the inverse-variance-weighted method did not re-veal any causal relationship shared between genetically predisposed calcium (OR = 0.92, 95% CI: 0.80-1.06, P = 0.25) and Vit-D (OR = 0.99, 95% CI: 0.83-1.19, P = 0.94) level and the risk of IBS. The bidirectional analysis demonstrated that genetic predisposition to IBS was associated with a de-creased level of PTH (beta: -0.19, 95%CI: -0.34 to -0.04, P = 0.01). In conclusion, the present study indicates no causal relationship between the serum calcium and Vit-D concentrations and the risk of IBS. The potential mechanisms by which IBS affects serum PTH need to be further investigated.

Keywords: mHealth; peritoneal dialysis; functionality; usability

AI-driven tools can identify nursing students' strengths and weaknesses, thus enabling the development of customized learning plans that target specific areas for improvement. This targeted approach can enhance knowledge retention and skill development, resulting in better prepared healthcare professionals. Nursing students are required to overcome their own psychological stress during their internship in order to understand sick children’s emotional reactions, as well as to be able to interact and communicate with such children. The application of AI picture-based teaching e-books helps nursing students to understand how to use therapeutic games to improve communication with sick children. A comparison of the differences between nursing teachers’ self-efficacy scores and nursing students’ application of AI picture-based teaching e-books (experimental group) and narrative handouts (control group) was achieved via therapeutic games to deal with sick children’s fear of medical examinations and treatments. In addition, a comparison was also conducted on the differences between the impact of the self-efficacy of the experimental group and that of the control group in dealing with sick children’s behavioral responses with respect to fears of medical examinations and treatments. This study is a quasi-experimental study, in which the self-efficacy scores of 30 nursing students were collected and analyzed in both the experimental group and the control group before and after intervention in dealing with sick children’s behavioral responses to fears of medical examinations and treatments. It was found that the self-efficacy score of the experimental group was higher than that of the control group (β coefficient is 0.356) when assessing the self-efficacy scores and behavior of the experimental and control groups in dealing with sick children’s fears of medical examinations and treatments through one-way analysis of covariance (one-way ANCOVA), moreover, a statistically significant difference (p < 0.05) was observed. The experimental group’s score of behavioral responses to the fears of sick children to examinations and treatments was lower than that of the control group (β coefficient was -1.540), wherein a statistically significant difference (p < 0.05) was shown. The self-efficacy of the experimental group in dealing with sick children’s fears of medical examinations and treatments had a statistically significant impact on the sick children’s behavioral responses to the fear of medical examinations and treatments (p < 0.05). In addition, the higher the self-efficacy scores of the experimental group in dealing with sick children’s fear of medical examinations and treatments, the lower the sick children’s behavioral responses to fears of medical examinations and treatments (the β coefficient was -0.914), the control group’s self-efficacy scores in dealing with sick children’s fears of medical examinations and treatments did not have a statistically significant impact on the sick children’s behavioral responses to fears of medical examinations and treatments (p > 0.05). This study proves that the application of AI picture-based teaching e-books by nursing teachers is more effective than narrative handouts in improving nursing students’ self-efficacy when using therapeutic games to deal with, as well as reduce, sick children’s fears of medical examinations and treatments.

Background and Aims: The impact of antibody response after direct-acting antiviral (DAA) therapy in hepatitis C virus (HCV)-infected recipients before and after liver transplantation (LT) is still undetermined. Methods: In this observational cohort study, we aimed to explore the association of changes in anti-HCV antibody titers after pre-LT DAA therapy with allograft injury, including biliary complications (BCs) and acute cellular rejection (ACR). Results: A total of 153 cases were enrolled from January 2015 to February 2021. Serum anti-HCV antibody titers were assessed before and after (day 30) LT. Among all recipients, 31/153 (20.3%) had pre-LT DAA therapy (DAA group) and 122/153 (79.7%) did not undergo pre-LT DAA therapy (DAA-naïve group). Higher incidence of post-LT BCs was observed in the DAA group (P = 0.028). Compared with the DAA-naïve group, the DAA group had a significantly higher mean level of anti-HCV titer upregulation (P = 0.0024); furthermore, among the recipients with BCs (n = 28) and ACR (n = 41), those in the DAA group exhibited significantly higher mean levels of anti-HCV antibody titer upregulation (P < 0.005). Conclusion: In conclusion, we speculated that anti-HCV antibody titer upregulation, which might have been induced by restoration of HCV-specific immune responses with pre-LT DAA therapy, were associated with post-LT allograft injury.

Recently, NOAA has included GNSS (Global Navigation Satellite System) Radio Occultation (RO) data as one of the crucial long-term observables for weather and climate applications. To include more GNSS RO data in the numerical weather prediction system, the NOAA Commercial Weather Data Pilot program (CWDP) started to explore the commercial RO data available on the market. After two rounds of pilot studies, the CDWP decided to award the first Indefinite Delivery Indefinite Quantity (IDIQ) contract to GeoOptics and Spire Incs. in 2020. This study examines the quality of Spire data products for weather and climate applications. Spire RO data are collected from commercial CubeSats through careful comparison with the data from Formosa Satellite Mission 7–Constellation Observing System for Meteorology, Ionosphere, and Climate-2 (COSMIC-2), ERA-5, and high-quality radiosonde data. The results demonstrated that although with lower Signal-Noise-Ratio (SNR) in general, the pattern of the lowest penetration height for Spire is similar to those for COSMIC-2. The Spire and COSMIC-2 penetrate heights are between 0.6 and 0.8 km altitude at the tropical oceans. Although using different GNSS RO receivers, the precision of Spire STRASP receivers is of the same quality as those of COSMIC-2 Global Positioning System - GPS, GALILEO, and GLObal NAvigation Satellite System – GLONASS (TGRS) receivers. The retrieval accuracy from Spire is very compatible with those from COSMIC-2. We validated Spire temperature and water vapor profiles by comparing them with collocated radiosonde data. Generally, over the height region between 8 km and 16.5 km, the Spire temperature profiles match those from RS41 RAOB very well with temperature biases &lt; 0.02 K. Over the height range from 17.8 to 26.4 km, the temperature differences are ~-0.034 K with RS41 RAOB being warmer. We also estimated the error covariance matrix for Spire, COSMIC-2, and KOMPSAT-5. Results showed that the COSMIC-2 estimated error covariance values are slightly more significant over the oceans at the mid-latitudes (45oN-30oN and 30oS-45oS), which may also be owing to COSMIC-2 SNR being lower at those latitudinal zones.

The relentless advancement and integration of mechanization and intelligence within the coal mining industry, combined with the increasing depths of mining operations, necessitate significantly higher safety standards. This necessity arises due to the increasingly complex geological and coal seam conditions encountered as mining operations delve deeper into the earth. Traditionally, 3D seismic exploration technology has been fundamental in ensuring both operational efficiency and safety in the coal mining sector. However, despite its critical role, this technology still has limitations in detecting and characterizing small-scale geological structures which can pose substantial risks if not accurately identified and mitigated. To address these challenges, this paper introduces a sparsity-constrained adaptive hard thresholding algorithm designed to tackle the spectral inversion optimization problem with an norm constraint for the enhanced retrieval of reflection coefficients, thereby establishing a comprehensive workflow for enhancing seismic data resolution through compressed sensing spectral inversion. Real data validation has demonstrated that this method significantly enhances the resolution of seismic data while maintaining the amplitude integrity and fidelity of the original signals. This improvement allows for a more detailed and accurate characterization of small-scale geological features, which are critical in identifying and mitigating potential hazards within coal mining operations, thus offering robust support for the implementation of more effective safety protocols and disaster prevention strategies in coal mines.

Coffee is one of the most popular beverages in the world. Annual coffee consumption continues to increase, but at the same time, it generates a large amount of spent coffee grounds from the brewing process, that arises environmental problems. An appropriate solution to manage these spent coffee grounds becomes crucial. Our project aims to discuss the feasibility of utilizing the spent coffee ground to synthesize polylactic acid as a recycling application for spent coffee ground. This paper will discuss the properties and potential recycling applications of spent coffee grounds, the brief production process of polylactic acid, and the potential process for converting spent coffee ground to lactic acid. From our review, it is feasible to utilize spend coffee ground as the primary sources for lactic acid production by bacteria fermentation, and further produce bioplastics, polylactic acids by ring-opening polymerization. Possible ways to improve the yield and corresponding cost analysis are also discussed.

This is a survey study that dialysis patients were randomly sampled from a medical center in northern Taiwan, and those who gave their consent to participate were included in this study. The purpose of this study was to explore the correlation between depression, hope, and quality of life of dialysis patients. All subjects agreed to take "Beck’s Depression Inventory", " The Chinese version of Herth Hope Index" and " The Chinese version of Kidney Disease Quality of Life" (KDQOL-SFTM). Data were processed using SPSS for descriptive and inferential statistics. The results showed that patients were 12.45±SD 9.03, which was mild depression, the mean score of hope was 34.25, which was equivalent to 72.60%, and was at the middle level. In KDQOL-SFTM, the score in mental composite (M=42.65, SD=8.81) was higher than in physical composite (M=37.38, SD=9.28), and the score was at the intermediate quality of life, and hope and depression were significantly and negatively correlated. This study suggests that dialysis case managers provide nursing guidance to help dialysis patients learn comfortable care methods and support the resilience they need.

In thermodynamic theory, free energy (i.e., available energy) is the concept facilitating the combined applications of the theory’s two fundamental laws, the first and the second laws of thermodynamics. The critical step was taken by Kelvin, then by Helmholtz and Gibbs— that in natural processes, free energy dissipates spontaneously. With the formulation of the second law of entropy growth, this may be referred to as the dissymmetry proposition manifested in the spontaneous increase of system/environment-entropy towards equilibrium. Because of Kelvin’s pre-entropy-law formulation of free energy, our concept of free energy is still defined, energy-centrally, as body’s internal energy or enthalpy, subtracted by energy that is not available within a framework on the premise of primacy of energy, in which free energy dissipates spontaneously and universally. This primacy of energy is called into question because the driving force to cause a system’s change is the purview of the second law. This paper makes a case for an engineering thermodynamics framework, instead, to be based on the premise of the primacy of dissymmetry over free energy. With Gibbsian thermodynamics undergirded with dissymmetry proposition and engineering thermodynamics with the dissymmetry premise, the two branches of thermodynamics are unified to become classical thermodynamics.

This research used an experimental study design in which 60 subjects were randomly assigned to either an experimental (image e-book guidance) group or a control (text guidance) group after meeting the admission conditions and agreeing to participate in the study. It was proven that providing image e-book guidance before surgery significantly changed the behavior of patients and promoted relief of urinary catheter discomfort through self-efficacy to reduce urinary catheter pain after surgery. It was found that providing image e-book guidance can shorten the time for health education and provide patients with repeated medical education and familiarity with health guidance, which can help to address the important clinical service demand issue and the shortage of nursing staff.

The astro-structures with the shape of comet and semi-circle, are found in the electronegative inductively coupled plasmas (ICPs), e.g., Ar/O2 and Ar/SF6. They are formed by means of the self-coagulation theory. This theory is built and based on two-dimensional fluid model simulation dynamic data of the above ICP sources. Concretely, quasi-Helmholtz equation is constructed through the free diffusion transport component and a novel negative chemical source term. The absolute value of recombination rate is higher than the attachment rate and so the net source of simulated anion is negative. This is quite a new chemical phenomenon in the electronegative and gaseous discharging plasmas when compared to the previously reported normal positive chemical source that will generate ambi-polar diffusion potential. In electronegative plasma, the self-coagulation is ambi-polar to sustain the electrical neutrality. Besides, when the anions are accelerated by ambi-polar potential before self-coagulated, the self-coagulation is again advective which leads to the formation of blue sheath. At the ambi-polar self-coagulation of high electronegativity, the electrons dynamics are relatively decoupled from ions and meanwhile they have their own relatively weak, spontaneous, and monopolar self-coagulation in the periphery of astro-structure. At the ambi-polar self-coagulation, both the anion and cation are individually treated as mass point models that carry charge (point charge models, more precisely). When the charge amounts of two individual astr-structures, e.g., semi-circle SF3+ and Ar+, are equal, the coagulated profile of heavy species SF3+ collapses by the expelling effect of Coulomb force that exists between the two point-charges. This is an anti-collective behavior of astro-structure, instead of the collective interaction of plasma, since the collapse of coagulated heavy species creates spatially dispersed charge density that cannot be shielded. The simulation shows that the lighter the species, the easier it self-coagulates, determined by the inertial effect of density quantity. The discharge picture of electronegative plasma is combined by a dynamic continuum transport (e.g., forming the ellipse background) and the mechanical balance contained in the static self-coagulation process (proven by dimensional analysis of continuity equation). The popular astro-structure of electronegative ICP source awaits urgently for the validation of experiment.

Digitized counter-diabatic (CD) optimization algorithms have been proposed and extensively studied to enhance performance in quantum computing by accelerating adiabatic processes while minimizing energy transitions. While adding approximate counter-diabatic terms can initially introduce adiabatic errors that decrease over time, Trotter errors from decomposition approximation persist. On the other hand, increasing the high-order nested commutators for CD terms may improve adiabatic errors but could also introduce additional Trotter errors. In this article, we examine the two-qubit model to explore the interplay between approximate CD, adiabatic errors, Trotter errors, coefficients and commutators. Through these analysis, we aim to gain insights into optimizing these factors for better fidelity, shallower circuit depth, and reduced gate number in near-term gate-based quantum computing.

Study design: Retrospective observational study. Objectives: To evaluate the change in adjacent segment disease (ASD) after hybrid dynamic stabilization with Dynesys-Transition-Optima (DTO). Methods: In 2012–2020, 115 lumbar spinal stenosis patients with spondylolisthesis re-fractory to nonsurgical management received hybrid dynamic stabilization with DTO system in a single medical center from a single neurosurgeon. After excluding those who did not receive L3–L4 dynamic stabilization and L4–L5 transforaminal lumbar interbody fusion fixation and those with incomplete postoperative data (n = 84), the 31 patients studied received follow-up vis-its at 6, 12 and 24 months postoperatively. Radiological assessment applied at the L2–L3, L3–L4 and L5–S1 segments separately included disc height, listhesis distance and angular change while in motion. Implant failure and screw loosening sign were both documented. Results: In the L3–L4 segment, the listhesis distance appeared 1 year after the operation; however, alterations in other segments showed at 6 months. At 2 years, the L3–L4 segment showed significantly less increase in listhesis distance and relatively less disc height reduction than other segments. In motion an-gular change, only the L3–L4 segment had a significant decrease at 2 years. Only the L3–L4 seg-ment maintained negative growth over 2 years in time-dependent assessment of motion angular change. Conclusions: In our study, disc height decreased, listhesis distance increased less and ASD changed later at the index level than the L2–L3 and L5–S1 levels. Angular change was re-duced at the index level while in motion. Although ASD was not significantly prevented, index level degeneration was both minor

The esterification of propylene glycol methanol (PM) and acetic acid (AA) is an important reaction for the production of propylene glycol methyl ether acetate (PMA). Herein, we used macroporous ion exchange resin Amberlyst-35 as a catalyst to explore the effects of reaction conditions on the reaction rate and equilibrium yield of PMA. Under the optimized conditions of reaction temperature of 353 K, initial reactant PM/AA molar ratio of 1:3, and catalyst loading of 10 wt%, PMA equilibrium yield reached 78%, which is the highest equilibrium yield so far. The reaction equilibrium constants and activity coefficients were estimated to obtain reaction thermodynamic properties, indicating the exothermicity of the reaction. Furthermore, Pseudo-homogeneous (PH), Eley-Rideal (ER), and Langmuir-Hinshelwood-Hogen-Watson (LHHW) kinetic models were fitted based on experimental reaction kinetic data. The results demonstrate that the LHHW model is the most consistent with experimental data, indicating surface reaction controlled process and exhibiting an apparent activation energy of 62.0 kJ/mol. This work represents a valuable example of calculating the reaction thermodynamic and kinetics, which are particularly essential for promising industrial reactor design.

Studies on the neurobiological causes of anxiety disorders suggest that the GABA system in-creases synaptic concentration and enhances the affinity of GABAA (type A) receptors for ben-zo-diazepine ligands. Flumazenil antagonizes the benzodiazepine binding site of the GABA (γ-aminobutyric acid) type /benzodiazepine receptor (BZR) complex in the central nervous sys-tem (CNS). The integration of the metabolites of flumazenil by LC-tandem mass spectrometry will complete understanding of the in vivo metabolism of flumazenil and accelerate radio-pharmaceutical inspection and registration. The main goal of our study was to investigate using reversed-phase HPLC (PR-HPLC) coupled with electrospray ionization triple quadrupole tan-dem mass spectrometry (ESI-QqQ MS) for the identification of flumazenil and its metabolites in a hepatic matrix. And a carrier-free nucleophilic fluorination with automatic synthesizer for [18F]flumazenil which applied to in vivo nano-positron emission tomography (Nano-PET)/computed tomography (CT) imaging and ex vivo bio-distribution used to analyze in normal rats. The study showed that 50% of the flumazenil was bio-transformed at 60 min by the rat liver homogenate, while one metabolite (M1) was a methyl transesterification product of flumazenil. In a rat liver microsomes system, two metabolites were identified (M2 and M3) as its carboxylic acid and hydroxylated ethylester forms, respectively. [18F]flumazenil in vivo nanoPET/CT imag-ing and ex vivo bio-distribution assay also showed significant effects on GABAA receptor availa-bility in the amygdala, prefrontal cortex, cortex, and hippocampus in the rat brain, worriless about the formation of metabolites. We showed completion of the bio-transformed course of flumazenil by the hepatic system; and [18F]flumazenil can be a good ligand and serve as a PET agent for determination of GABAA/BZR complex for multiplex neurological syndromes in the clinical stage.

Bacterial wilt (BW), caused by Ralstonia solanacearum is one of the major biotic factors limiting tomato production in the humid tropics. Pyramiding of resistance genes through marker-assisted selection is an efficient way to develop durable BW resistant cultivars. Tomato line ‘Hawaii 7996’ (H7996) is a stable and robust resistance source against various R. solanacearum strains. Major BW resistance quantitative trait loci (QTLs) Bwr-12 and Bwr-6, and several minor or strain specific QTLs have been coarse-mapped in this line, but none has been fine-mapped and validated. The objective of the current study was to construct a high density genetic map using single-nucleotide polymorphism (SNP) markers derived from genotyping-by-sequencing, fine-map Bwr-12 and Bwr-6 and determine the effects of these QTLs using a near isogenic line (NIL) population. A high density genetic map using 1,604 SNP markers with an average distance of 0.82 cM was developed for 188 F9 recombinant inbred lines derived from the cross H7996 × WVa700. A total of seven QTLs associated with BW resistance to race 1-phylotype I or/and race 3-phylotype II strains were located on chromosomes 6 (Bwr-6.1, 6.2, 6.3 and 6.4) and 12 (Bwr-12.1, Bwr-12.2 and Bwr-12.3) with logarithm of odds (LOD) scores of 6.2-15.6 and 6.2-31.1, explaining 14.2-33.4% and 15.9-53.9% of the total phenotypic variation contributed from H7996, respectively. To validate the genetic effects of the two QTL regions, a set of 80 BC3F3 NILs containing different sections of Bwr-6 with or without Bwr-12 was phenotyped for disease severity after challenge with either race 1-phylotype I Pss4 or race 3-phylotype II Pss1632 BW strains over two seasons. Bwr-6.1 specific to Pss4 and Bwr-6.3 specific to Pss1632 were mapped to an interval of 5.0 cM (P < 0.05) between 6_33,444,000_SLM6-47 and 6_33,868,000_SLM6-124 SNP marker, and to 2.7 cM (P < 0.01) between positions 6_35,949,000 _SLM6-107 to 6_36,750,000_SLM6-82 marker, respectively. In addition, the specific effect of Bwr-12 for resistance to Pss4 (LOD score of 5.8-16.1, P < 0.01) was confirmed and markers for this QTL have already been made available previously.

In the field of computational fluid dynamics (CFD) for rotorcraft, two significant challenges are resolving the complex vortex structures in rotor wakes, and representing the moving rotor blades in the ambient airflow. This study addresses the first challenge by using a third-order unstructured finite volume solver, which, compared to its second-order counterpart, has substantially lower dissipation. Consequently, even relatively coarse meshes are capable of resolving small vortices. With this background flow field solver, the second challenge is addressed by modeling each rotor as an Actuator Disk Model (ADM), or describing individual rotor blades as actuator lines, designated as the Actuator Line Model (ALM). Both of these models are equipped with an improved correction for aerodynamic losses at blade tips, which is thoroughly presented in the methodology section. The numerical experiments section centers on analyzing errors linked to various sampling approaches. Additionally, the article discusses comparisons between vortex theory and ALM, specifically regarding calculations for fixed-wing aircraft. Furthermore, high-order precision and parallel efficiency are exemplified in scenarios encompassing rotors engaged in both hovering and forward flight rotors. The results in this paper demonstrate that the combination of the ALM/ADM with the improved tip loss correction and the third-order finite volume solver presents a new way of developing efficient tools for the aerodynamic analysis of helicopter rotors.

In the industrial field, the 3D target detection algorithm PointPillars has gained popularity. Improving target detection accuracy while maintaining high efficiency has been a significant challenge. To address the issue of low target detection accuracy in the PointPillars 3D target detection algorithm, this paper proposes an algorithm based on feature enhancement to improve the backbone network. The algorithm enhances preliminary feature information of the Backbone network by modifying it based on PointPillars with the aid of channel attention and spatial attention mechanisms. To address the inefficiency caused by the excessive number of subsampled parameters in PointPillars, FasterNet (a lightweight and efficient feature extraction network) is utilized for downsampling and forming different scale feature maps. To prevent the loss and blurring of extracted features resulting from the use of inverse convolution, we utilize the lightweight and efficient up-sampling modules Carafe and Dysample for adjusting resolution. Experimental results indicate improved accuracy under all difficulties of the KITTI dataset, demonstrating the superiority of the algorithm over PointPillars.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

To decrease privacy risks, consumers may choose to misrepresent when they are asked to offer personal information. This paper examines the impact of consumer misrepresentation on a monopolistic firm and consumers with an economic model. The results show that consumer misrepresentation may benefit the firm but hurt consumers. In addition, consumers misrepresentation may encourage the firm to provide higher personalized service level in certain scenarios, such as, when the unit cost of personalized service is low. Thirdly, when consumers misrepresent, and the firm only covers part of the market, a greater unit value of consumer’s privacy information will reduce the firm’s profit, but a greater unit cost of personalized service increases the firm’s profit.

Candida glabrata is a yeast of increasing medical relevance, particularly in critically ill patients. It is the second most isolated Candida species associated with invasive candidiasis (IC) behind C. albicans. The attributed higher incidence is primarily due to an increase in the acquired immunodeficiency syndrome (AIDS) population, cancer, and diabetes patients. The elderly population and the frequent use of indwelling medical devices are also predisposing factors. The work aimed to review various virulence factors that facilitate the survival of pathogenic C. glabrata in IC. The available published research articles related to the pathogenicity of C. glabrata were retrieved and reviewed from four credible databases, mainly Google Scholar, ScienceDirect, PubMed, and Scopus. The articles highlighted many virulence factors associated with pathogenicity in C. glabrata, including adherence to a susceptible host surface, evading host defences, and producing hydrolytic enzymes (e.g., phospholipases, proteases, and haemolysins). The factors facilitate infection initiation. Other virulent factors include iron regulation and genetic mutations. Accordingly, biofilm production, tolerance to high-stress environments, and development of resistance to the antifungal drug, notably to fluconazole and other azole derivatives, were reported. The review provided evident pathogenic mechanisms and antifungal resistance associated with C. glabrata in ensuring its sustenance and survival.

Background: In long-term care facilities, there are many residents who do not have the ability to seek shelter by themselves in the case of an emergency. Thus, it is extremely important that the staff of nursing homes are equipped with correct disaster prevention concepts, emergency survival responses, and hazard mitigation measures. Purpose: Discuss the intervention effectiveness of different fire prevention and emergency response trainings at nursing homes and the relationship and predictivity of awareness to self-efficacy. Method: Recruit staff from two nursing homes through purposive sampling, using a two-team pre-and post-test design to collect results from 41 individuals in the experiment group and 40 individuals in the control group. The research tool is the “Nursing Home Fire Prevention and Emergency Response Awareness and Self-Efficacy Scale,” to compare the effectiveness of advanced and general fire safety trainings. Result: After receiving improved advanced fire safety training, the total score and the result of the experiment group on fire prevention and emergency response awareness and self-efficacy had both performed better than the control group who received general fire safety training (p < .001); fire prevention and emergency response awareness has significant and positive correlation with self-efficacy (r=.601, p < .001), and awareness is a significant predictor variable to self-efficacy (p < .001). Conclusion/Practical Application: This study finds that the key to improving learning effectiveness includes adding fire science concept chapter when creating fire safety training material in order to strengthen basic awareness; fire safety training should comprehensively introduce all related duty responsibilities of staff fire defense formation, in turn enabling mutual responsive support for the needs of the site; also, to become familiarized with the knowledge requires appropriate frequency of training and enhancing the staff’s awareness to fire prevention and emergency response, which is the most important key of learning effectiveness.

The emergence of diverse infections worldwide, which is a serious global threat to human existence, necessitate the urgent development of novel therapeutic candidates that can combat these diseases with efficacy. Isatin, a secondary metabolite from tryptophan is considered a privileged scaffold and favorable pharmacophore with a unique structural moiety and varied chemical and biological properties resulting in its widespread applications by medicinal chemists. Molecular hybridization is one of the most common and important techniques use in the synthesis of their bioactive hybrids in drug discovery. This review containing published articles from 2005 to 2022 focuses on isatin hybrids which have been synthesized and reported in the literature alongside a discussion on their biological properties. The purpose of this review is to set up the direction for the design and development of isatin-hybrids with tailored biological properties as effective therapeutic candidates inspired by nature.

The objective of this study aimed to develop biodegradable calcium alginate microspheres carrying doxorubicin (Dox) at the micrometer-scale for sustained-release and the capacity of pH regulatory for transarterial chemoembolization. Ultrasonic atomization and CaCl2 cross-linking technologies were used to prepare the microspheres. A 4 by 5 experiment was first designed to identify imperative parameters. The concentration of CaCl2 and the flow rate of the pump were found to be critical to generate microspheres with a constant volume median diameter (~ 39 m) across 5 groups with different alginate:NaHCO3 ratios using each corresponding flow rate. In each group, the encapsulation efficiency was positively correlated to the Dox-loaded efficiency. Fourier-transform infrared spectroscopy showed that NaHCO3 and Dox were step-by-step incorporated into the calcium alginate microspheres successfully. Microspheres containing alginate:NaHCO3 = 1 exhibited rough and porous surfaces, high Young’s modulus and hardness. In each group with the same alginate:NaHCO3 ratio, the swelling rates of microspheres were higher in PBS containing 10% FBS compared to those in PBS alone. Microspheres with relative high NaHCO3 concentrations in PBS containing 10% FBS maintained better physiological pH and higher accumulated Dox release ratios. In two distinct hepatocellular carcinoma-derived cell lines, treatments with microspheres carrying Dox demonstrated that the cell viabilities decreased in groups with relative high NaHCO3 ratios in time- and dose-dependent manners. Our results suggested that biodegradable alginate microspheres containing relative high NaHCO3 concentrations improved the cytotoxicity effects in vitro.

Directional solidification experiments were carried out to investigate the effect of micro-alloying element Sn and magnetic field on the solidification of Al-Bi immiscible alloys. Experimental results show that the size distribution of the dispersed particles in the low-speed solidified Al-3.4wt%Bi alloy presents two peaks, while it only shows one peak when solidified at a relatively high speed. The addition of Sn not only can enhance the nucleation rate and the number density of the Bi-rich droplets in the sample, but also decrease the Marangoni migration velocity and the axial resultant velocity of minority phase droplets in front of the solidification interface. Thereby it promotes the formation of Al-Bi alloys with a well-dispersed microstructure. A static magnetic with the strength of 0.2T increase the number density of the dispersed particles and decrease the average size and the size distribution width of the dispersed particles. Under the effect of Sn addition and static magnetic field, the average radius of the dispersed particles <R> and the solidification velocity V_0 satisfy <R>∝〖V_0〗^(-1/3) when the alloy was solidified at a relatively low velocity, <R> and V_0 satisfy <R>∝〖V_0〗^(-1/2) when the alloy is solidified at a high velocity.

Today, the various abilities that nurses require to meet patients’ healthcare needs adequately are all affected by AI-enabled systems. This research used an experimental study design in which 60 subjects were randomly assigned to either an experimental (AI image e-book guidance) group or a control (text paper guidance) group after meeting the admission conditions and agreeing to participate in the study. It was proven that providing AI image e-book guidance before surgery significantly changed the behavior of patients and promoted relief of urinary catheter discomfort through self-efficacy to reduce urinary catheter pain after surgery(p=0.000). It was found that providing AI image e-book guidance can shorten the time for health education and provide patients with repeated medical education and familiarity with health guidance, which can help to address the important clinical service demand issue and the shortage of nursing staff.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

Combining Matrix-Assisted Laser Desorption/Ionization Time-of-Flight (MALDI-TOF) spectra data and artificial intelligence (AI) has been introduced for rapid prediction on antibiotic susceptibility test (AST) of S. aureus. Based on the AI predictive probability, the cases with probabilities between low and high cut-offs are defined as “grey zone”. We aimed to investigate the underlying reasons of unconfident (grey zone) or wrong predictive AST. A total 479 S. aureus isolates were collected, analyzed by MALDI-TOF, and AST prediction, standard AST were obtained in a tertiary medical center. The predictions were categorized into the correct prediction group, wrong prediction group, and grey zone group. We analyzed the association between the predictive results and the demographic data, spectral data, and strain types. For MRSA, larger cefoxitin zone size was found in the wrong prediction group. MLST of the MRSA isolates in the grey zone group revealed that uncommon strain types composed 80%. Amid MSSA isolates in the grey zone group, the majority (60%) was composed of over 10 different strain types. In predicting AST based on MALDI-TOF AI, uncommon strains and high diversity would contribute to suboptimal predictive performance.

All humans will experience the process of birth, old age, illness, and death. However, when faced with life-sustaining decisions, the families of patients are often faced with medical decisions as surrogates. In recent years, the families of patients have started to value the importance of the right to palliative care, although this often requires lengthy discussions. Therefore, this study explored the predictability of factors that affect the feeling experienced by patients’ families when signing Do-Not-Resuscitate Consent. This study used a cross-sectional study and interviewed 90 family members using a structural questionnaire. The study hypotheses were tested using a t-test, one-way analysis of variance, product–moment correlation, and hierarchical regression analysis. Attribute variables of family members, such as gender and whether they live with the patient, are predictors that affect the family member’s feeling experience when signing Do-Not-Resuscitate Consent. The emotional support from medical professionals to family members helps the family member to express their negative feelings on signing Do-Not-Resuscitate Consent; more informational support information provided to family members by medical professionals can alleviate negative feelings felt by family members when signing Do-Not-Resuscitate Consent. This study identified that family members’ knowledge about Do-Not-Resuscitate acquired from medical professionals is relatively low. It is suggested that critical care units regularly conduct training on hospice palliative care, implement standard care procedures of hospice palliative care at critical care units, and provide detailed medical information about advanced decisions to family members so as to reduce their emotional stress. This will ensure that intensive care units can also achieve the goal of critically ill hospice palliative care.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

Porous tantalum (Ta) is a promising biomaterial and has been applied in orthopedics and dentistry for nearly two decades. The high porosity and interconnected pore structure of porous Ta promise fine bone ingrowth and new bone formation within the inner space, which further guarantee rapid osteointegration and bone-implant stability in long term. Porous Ta has high wettability and surface energy that can facilitate adherence, proliferation and mineralization of osteoblasts. Meanwhile, low elastic modulus and high friction coefficient of porous Ta can effectively avoid stress shield effect, minimize marginal bone loss and ensure primary stability. Accordingly, the satisfactory clinical application of porous Ta based implants or prostheses are mainly derived from its excellent biological and mechanical properties. With the advent of additive manufacturing, personalized porous Ta based implants or prostheses have shown their clinical value in the treatment of individual patient who need specially designed implant or prosthesis. In addition, many modification methods have been introduced to enhance the bioactivity and antibacterial property of porous Ta with promising in vitro and in vivo research results. In any case, choosing suitable patients is of great importance to guarantee surgical success after porous Ta insertion.

Hyperuricemia (HC) was one of the important risk factors for gout, arteriosclerosis, and cardiovascular disease. Animal studies have shown that Lactobacillus plantarum can improve the microbiota, immune regulation, and inhibit the uric acid production. However, it was not clear whether L. plantarum can improve HC and intestinal microbiota. We used potassium oxonate (PO) to induce HC in male SD rats, and then treated L. plantarum TCI227 in a dose dependent (HC+LD, HC+MD, HC+HD) for 4 weeks, and examined weight organs, biochemical examination of blood and urine, and analyzed the intestinal microbiota in feces by 16s rDNA sequence analysis. In this study, TCI227 improved body weight, decreased creatinine, serum uric acid, and increased urine uric acid compared to the HC group. Furthermore, TCI227 increased short-chain fatty acids (SCFAs). In fecal microbiota (family), TCI227 increased the level of Lactobacillaceae, and then decreased the level of Deferribacteres and Prevotellaceae compared to the HC group. Finally, in fecal microbiota (genus), TCI227 decreased the level of Prevotella, and then increased the level of Lactobacillus and Ruminococcus compared to the HC group. This study suggested that TCI227 can improve HC and change the compositions of the intestinal microbiota in PO induced male HC SD rats.

The world is struggling with the increasing rate at which water bodies are constantly polluted due to rapid modernization and industrialization. The different types of water contaminants include both anthropogenic and natural contaminants. Environmentalists are mainly concerned about heavy metals such as cadmium ions, as they are considered poisonous and carcinogenic even if they are present at a minimum concentration, and they are considered an immediate concern, according to the World Health Organization. Recently, many methods, such as solvent extraction, ion exchange, electrochemical precipitation, and reverse osmosis, have been developed to remove heavy metals from wastewater. These methods have been reported to be expensive and inefficient; hence, more cost-effective and eco-friendly alternative strategies are needed. Amidst these challenges, a ray of hope emerges in the form of biosorbents. These abundant, eco-friendly, and cost-efficient materials have shown promise as an alternative method for removing heavy metals from wastewater. They are equipped with functional groups that can effectively absorb metal ions onto their surfaces, offering a potential solution to our water contamination woes. This review is significant as it delves into the potential use of several biosorbents to decontaminate cadmium ions from wastewater. This review is significant as it delves into the potential use of several biosorbents to decontaminate cadmium ions from wastewater

Mixing is considered as a critical process parameter (CPP) during process development due to its significant influence on reaction selectivity and process safety. Nevertheless, mixing issues are difficult to identify and solve owing to their complexity and dependence on knowledge of kinetics and hydrodynamics. In this paper, we proposed an optimization methodology using Computational Fluid Dynamics (CFD) based compartmental modelling to improve mixing and reaction selectivity. More importantly, we have demonstrated that through the implementation of surrogate-based optimization, the proposed methodology can be used as a computationally non-intensive way for rapid process development of reaction unit operations. For illustration purpose, reaction selectivity of a process with Bourne competitive reaction network is discussed. Results demonstrate that we can improve reaction selectivity by dynamically controlling rates and locations of feeding in the reactor. The proposed methodology incorporates mechanistic understanding of the reaction kinetics together with an efficient optimization algorithm to determine the optimal process operation and thus can serve as a tool for quality-by-design (QbD) during product development stage.

JBIR-99 is a secondary metabolite of marine fungi that has been shown to possess strong antibiotic activity. An efficient approach using a combination of size exclusion chromatography with a Sephadex LH-20 and high-speed counter-current chromatography (HSCCC) has been successfully developed for the isolation and purification of a polyketide from the solid-state fermentation of Meyerozyma guilliermondii. The active compound was isolated with purity >95% by HSCCC using an optimized solvent system composed of petroleum ether–ethyl acetate– 95% ethanol–water (5:3:5:3, v/v/v/v) after size exclusion chromatography. This compound was successfully purified in the quantity of 68 mg from 120 mg of the crude extract. The structure of JBIR-99 was elucidated and assigned by 1D, 2D NMR spectroscopic, and positive HRESITOFMS. Moreover, the relative configuration of compound JBIR-99, displaying a quite complex multi-ring structure, is determined by X-ray crystallography for the first time. The purification method developed for JBIR-99 will facilitate the further investigation and development of this antibiotic agent as a lead compound. Furthermore, it is suggested that the combination of size exclusion chromatography and HSCCC could be more widely applied for the isolation and purification of polyketides from marine fungi.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Cartilage regeneration requires a balance of anabolic and catabolic processes. This study examined the susceptibility of fibromodulin (FMOD) and lumican (LUM) to degradation by MMP-13, ADAMTS-4 and ADAMTS-5, the three major degradative proteinases in articular cartilage in osteoarthritis (OA). Immunolocalisation of FMOD and LUM in foot sections of developmental cartilages demonstrated prominent localisations in metatarsal and phalangeal foetal rudiment cartilages and growth plate. An MMP-13 neoepitope antibody (TsYG11) demonstrated localisation of MMP-13 cleaved FMOD in the hypertrophic chondrocytes of the metatarsal growth plate. FMOD was more prominently localised in the superficial cartilage of normal and fibrillated zones in OA cartilage, TsYG11 positive FMOD was located deeper in the cartilage samples. Ab TsYG11 also identified FMOD fragmentation in Western blots of extracts of normal and fibrillated cartilage and total knee replacement OA cartilage. The C-terminal anti-FMOD used in this study (PR-184) failed to identify FMOD fragmentation due to C terminal processing, an equivalent Ab to the C-terminus of LUM (pAb PR-353) identified 3 prominent LUM fragments in OA human knee cartilages. In-vitro digestion of human knee cartilage with MMP-13, ADAMTS-4 and ADAMTS-5 generated equivalently sized FMOD fragments of 54, 45 and 32kDa to those in blots of OA cartilage, LUM was not less susceptible to fragmention in in-vitro digestions however Ab PR-353 detected N-terminally processed LUM fragments of 39, 38 and 22 kDa in 65-80 year old OA knee cartilage. FMOD and LUM were differentially processed during in-vitro digestions with MMP-13, ADAMTS-4 and ADAMTS-5 with FMOD susceptible to degradation by MMP-13, ADAMTS-4 and to a lesser extent ADAMTS-5 however LUM was less susceptible to fragmentation. FMOD was processed by MMP-13 in metatarsal and phalangeal foetal rudiment developmental cartilages and growth plate indicating a role in skeletogenesis.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

This study explores the relationship between mental and physical therapeutic through three dimensions: man-environment relationships; a sense of place and symbolic landscapes. The study used a combination of qualitative and quantitative research methods. Local residents living in the coastal area of Xinglin Bay are the research objects. Quantitative data analysis revealed that the frequency of residents' visits was an important variable affecting their physical and treatment perceptions. In addition, the significance is higher for females than for males. The text analysis shows that the environment, especially the ecological restoration of water quality and migratory birds, is of great significance to the identity of local residents. Daily activities contribute to a sense of place and are what make the coast a place of therapeutic landscape function.

(1) In recent ten years, with the fast development of digital and engineering manufacturing technology, additive manufacturing has already been more and more widely used in the field of dentistry, from the first personalized surgical guides to the latest personalized restoration crowns and root implants. (2) Especially, the bioprinting of teeth and tissue is of great potential to realize organ regeneration and finally improve the life quality. (3) In this review paper, we firstly presented the workflow of additive manufacturing technology. Then we summarized main applications and recent research progresses of additive manufacturing in dentistry. (4) Lastly, we sketched out some challenges and future directions of additive manufacturing technology in dentistry.

SARS-CoV2 (corona virus) has spread globally at an unprecedented rate; so far, increasing SARS-CoV2-infected individuals have been identified. Although the situation in China is improving and is currently under control, the outbreak in other countries and its pandemic management is only beginning to develop. Based on 154 SARS-CoV2 genome sequence analyses, we used receptor–ligand docking to identify one potential point mutation (V354F) on the spike structure which enhances spike binding to ACE2 receptors underlying potential super infection. Importantly, the V354F site on spike S1 had been identified in 5/10 infected French patients living in Paris, who sharing 100% identical SARS-CoV2 genomes. With Covid-19 cases increasing rapidly in France that could lead to a new explosion, we suggest that the French government should identify all potential super spreaders and treat them accordingly. In summary, our study provides on of the measures to avoid the potential second worldwide explosion of SARS-CoV2.

The era of Internet of Things (IoT) has begun to evolve and with this the devices around us are getting more and more connected. Vehicular Ad-hoc NETworks (VANETs) is one of the applications of IoT. VANET allow vehicles within these networks to communicate effectively with each another. VANETs can provide an extensive range of applications that support and enhance passenger safety and comfort. It is important that VANETs are applied within a safe and reliable network topology; however, the challenging nature of reaching reliable and trustworthy agreement in such distributed systems is one of the most important issues in designing a fault-tolerant system. Therefore, protocols are required so that systems can still be correctly executed, reaching agreement on the same values in a distributed system, even if certain components in the system fail. In this study, the agreement problem is revisited in a VANET with multiple damages. The proposed protocol allows all fault-free nodes (vehicles) to reach agreement with minimal rounds of message exchanges, and tolerates the maximal number of allowable faulty components in the VANET.

The effects of environmental media on the corrosion fatigue fracture behavior of 25CrMo steel were investigated. The media include air, and a 3.5 wt.% and a 5.0 wt.% NaCl solutions. Experimental results indicate that the media induces the initiation of corrosion fatigue cracks at multiple sites. The multi-cracking sites cause the changes in the crack growth directions, the crack growth rate during the coupling action of the media and the stress amplitude. The coupling effects are important for engineering applications and research. The probability and predictions of the corrosion fatigue characteristic life can be estimated using the 3-parameter Weibull distribution function.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Hydrogels, soft materials with 3D polymer networks in aqueous solution, have been developed for engineering and bio-related fields. However, these conventional hydrogels are weak and brittle due to lack of energy dissipation mechanisms. Recently, dual-network hydrogels have been proposed, combining rigid and flexible networks and exhibiting high strength, stretchability, and toughness. This paper explores the rheological properties of dual-network hydrogels based on acrylamide and sodium alginate under large deformations. This dual network is a combination of a covalently crosslinked polyacrylamide network and a supramolecular crosslinked sodium alginate network at the presence of divalent calcium cations. Small and large amplitude oscillatory shear methods with Fourier transform rheology, stress decomposition method, and Chebyshev polynomial analysis of large amplitude oscillatory shear (LAOS) data were employed to evaluate non-linearity limit, toughness, and network rigidity. The concentration of calcium ions affects (concentrations 0-80 mg/ml) the nonlinear transition and limit points, and all gel samples exhibit strain hardening, shear thickening, and shear densification.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The coronavirus disease 2019 (COVID-19) has spread over the world for more than one year. COVID-19 often develops life-threatening hypoxemia. Endothelial injury caused by the viral infection leads to intravascular coagulation and ventilation-perfusion mismatch. However, besides above pathogenic mechanisms, the role of alveolar edema in the disease progression has not been discussed comprehensively. Since the exudation of pulmonary edema fluid was extremely serious in COVID-19 patients, we bring out a hypothesis that severity of alveolar edema may determine the size of poorly-ventilated area and the blood oxygen content. Treatments to pulmonary edema (alcohol-oxygen vapor therapy and fluid management) may be great helpful for reducing occurrence of severe cases. Given that late mechanical ventilation may cause mucus (edema fluid) to be blown to the deep of the small airways, oxygen therapy should be given at the early stages. The optimal time and SpO₂ threshold for oxygen therapy are also discussed.

While being a workaholic supervisor may be viewed as admirable due to their commitment to work, existing findings on its effects on subordinates are mixed. Drawing upon the principle learning perspective and activation theory, we propose a curvilinear relationship between supervisor workaholism and subordinate job performance and investigate the moderating role of subordinate social-related social media usage. Specifically, we suggest that subordinate job performance increases (decreases) as supervisor workaholism increases from low (moderate) to moderate (high) levels and that this inverted U-shaped relationship becomes flatter when subordinates have higher social-related social media usage. The results, based on a multi-source survey collected from 321 supervisor-subordinate dyads, support the predictions. Our research moves beyond linear thinking and suggests that there exists an optimal level of supervisor workaholism that maximizes subordinate job performance. We also provide insights into the ongoing debate and potential ethical concerns surrounding whether employees should use social media at work. Implications for practice and future research are discussed.

The KRAS mutant population has been undruggable for 40 years. G12C inhibitors and immunotherapy are the beginning of success. It is necessary to summarize the successful experience of the existing treatment model and explore the direction of the next treatment. In this review, we discuss the latest developments in targeted therapy and immunotherapy for KRAS-mutation NSCLC, aiming to provide direction or enlightenment for future treatment strategies.

Little is known about family medicine academic staff in Taiwan, and basic data about this workforce may aid healthcare decision makers. We analysed data on Taiwan’s 13 medical schools collected by the Taiwan Association of Family Medicine from June to September 2019. Items included medical school names and total staff, and the gender, age, degree, working title (part-time/full-time), academic level, and sub-specialty of each current family medicine faculty member. A total of 116 family medicine faculty members were reported; most were male (n= 85, 73.3%). Ages ranged between 30 and 69 years, with a mean (SD) age of 43.3 (8.09). Faculty members with a master’s degree were the largest group (n= 49, 42.2%), and most were academic lecturers (n=49, 42.2%). Additionally, only about one-fourth (n=26, 22.4%) of family medicine faculty in medical schools were full-time, while the other three-fourths (n=90, 77.6%) were part-time faculty; most were located in northern Taiwan (n=79, 68.1%) and specialized in gerontology and geriatrics (n=55, 47.4%) and hospice palliative care (n=53, 45.7%). Our research provides the most complete census of family medicine academic physicians in medical schools in Taiwan. The results inform efforts to improve the establishment and development of family medicine departments in Taiwan.

This study was focused on the development of oil-producing microorganisms to generate lipids. The yeast Rhodotorula mucilaginosa (R. mucilaginosa) was selected for liquid-state cultivation, and the conditions for growth of the yeast cells were assessed. Additionally, the relationships between different nutrient elements and the growth of R. mucilaginosa were explored. The lipid accumulation of R. mucilaginosa is increased under nitrogen-restricted conditions. As the concentration of the carbon source increases, the accumulation of lipids is increased. However, if the carbon source concentration is further increased, the growth of yeast is inhibited. From a large-scale liquid fermentation culture with a fixed inoculation amount of 5%, and from a batch of culture experiments, it was determined that a suitable oil-producing culture was obtained on the 6th day, and the optimum conditions involved a carbon source concentration of 60 g/L, a nitrogen source concentration of 0.5 g/L, and a KH2PO4 concentration of 7.0 g/L. After utilizing different carbon sources in this study, it was found that glucose was the carbon source most conducive to the accumulation of R. mucilaginosa lipids. In addition, the extraction method and solvent for the extraction of R. mucilaginosa lipids were chosen. The acid-heat method using the green organic solvent ethyl acetate exhibited the best performance for extraction of yeast lipids under environmentally friendly and safe conditions. The analysis of lipids showed that the fatty acids obtained primarily contained C16:0, C18:1 and C18:2, and especially C18:1 (41%) lipids, indicating that R. mucilaginosa lipids are a good bio-oil source for the production of biodiesel.

The airport ground handling services (AGHS) equipment supplier selection problem involves a safety guarantee on the part of the AGHS company that carries out the daily work. AGHS company can prevent aircraft damage and delays in airlines schedules, and ensure reliable and high-quality ground handling service. In our research, we developed an AGHS equipment supplier selection model based on the analytic hierarchy process and an AHP weighted fuzzy linear programming approach, and we solved the AGHS equipment supplier’s selection problem. The main objective of this article is to create an AHP and AHP-FLP decision model in order to help the AGHS company authorities select the best AGHS equipment supplier. The practical application in AGHS equipment supplier selection decisions can be interpreted as demonstrating that the proposed model provides knowledge and practical value for the AGHS industry.

The framework of product life cycle (PLC) cost analysis is one of the most important evaluation tools for a contemporary high-tech company in an increasingly competitive market environment. The PLC-purchasing strategy provides the framework for a procurement plan and examines the sourcing strategy of a firm. The marketing literature emphasizes that ongoing technological change and shortened life cycles are important elements in commercial organizations. From a strategic viewpoint, the vendor has an important position between supplier, buyer and manufacturer. The buyer seeks to procure the products from a set of vendors to take advantage of economies of scale and to exploit opportunities for strategic relationships. However, previous studies have seldom considered vendor selection (VS) based on PLC cost (VSPLCC) analysis. The purpose of this paper is to solve the VSPLCC problems considering the situation of a single-buyer-multiple-supplier. For this issue, a new VSPLCC procurement model and solution procedure are derived by this paper to minimize net cost, rejection rate, late delivery and PLC cost subject to vendor capacities and budget constraints. Moreover, a real case in Taiwan is provided to show how to solve the VSPLCC procurement problem.

The airport ground handling service (AGHS) equipment vendor selection (AGHSEVS) problem is critical for ramp work safety management, because AGHS equipment malfunctions affect airport ramp work safety. Appropriate vendor selection can prevent aircraft damage and delays in airlines schedules, and ensure reliable and high-quality ground handling service. The AGHSEVS problem is a time-consuming and complex process that requires professional knowledge and experience to make judgments. Specifically, AGHSEVS is a multi-criteria decision-making (MCDM) problem. Previous research has seldom integrated MCDM methods with linear and goal programming to solve the AGHSEVS problem. The objective of this study was to develop a new system evaluation model for AGHSEVS by considering both qualitative and quantitative methods. We test the proposed approach on an AGHS company in Taiwan.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

This paper systematically discusses the application of reinforcement learning in automatic driving system. Reinforcement learning frameworks show significant advantages in optimizing decision making, predictive perception, path planning, and controller design, exceeding the limitations of traditional supervised learning methods. The paper highlights the critical role of components such as scene understanding, positioning, and map making in autonomous driving systems, which provide reliable environmental awareness through deep learning and sensor fusion technologies to support intelligent decision-making in complex urban environments. In addition, the paper discusses innovative approaches to safety reinforcement learning to reduce risk in autonomous driving and ensure that systems adhere strictly to safety constraints while maximizing expected rewards. These findings provide an important theoretical and practical basis for further improving algorithm robustness, managing multi-agent interactions, and integrating ethical considerations in the future.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Under the background that the international technological innovation environment VUCA has been intensifying and the innovation situation of Chinese manufacturing enterprises has been impacted, the innovation dilemma faced by enterprises has attracted increasing attention, while the innovation dilemma is also one of the important factors affecting the operation efficiency of enterprises. Based on the micro-data of China’s A-share manufacturing listed enterprises, this paper empirically analyzes the impact of innovation dilemmas faced by enterprises on operational efficiency (innovation dilemmas are measured by the difference when actual innovation performance is lower than expected innovation performance). The results show that the innovation dilemma of manufacturing enterprises significantly inhibits the operational efficiency of manufacturing enterprises by reducing their risk tolerance, development ability expectation and profitability. After using a series of tests, such as instrumental variable method, propensity score matching method, DID (Differences-in-Differences) and changing variable measure method, the conclusion is still robust. In addition, the inhibitory effect of innovation dilemma on enterprise operation efficiency is more obvious for private enterprises, small and medium-sized enterprises, enterprises in the ascend or decline phase, high-tech enterprises and enterprises in the eastern region. Therefore, the government should strengthen the policy support for the manufacturing enterprises in the innovation dilemma, help the enterprises to overcome the innovation bottleneck. Manufacturing enterprises themselves should enhance their innovation capabilities and strive to get rid of the innovation dilemma in order to maintain a stable footing in the fierce market competition and improve the high-quality development of China’s manufacturing industry.

Theories of reading comprehension emphasize decoding and listening comprehension as two essential components. The current study aimed to investigate how Chinese character decoding and context-driven auditory semantic integration contribute to reading comprehension in Chinese middle school students. Seventy-five middle school students were tested. Context-driven auditory semantic integration was assessed with speech-in-noise tests in which the fundamental frequency (F0) contours of spoken sentences were either kept natural or acoustically flattened with the latter requiring a higher degree of contextual information. Statistical modelling with hierarchical regression was conducted to examine the contributions of Chinese character decoding and context-driven auditory semantic integration to reading comprehension. Performance on Chinese character decoding and auditory semantic integration scores with the flattened (but not natural) F0 sentences significantly predicted reading comprehension. Furthermore, the contributions of these two factors to reading comprehension were better fitted with an additive model instead of a multiplicative model. These findings indicate that reading comprehension in middle schoolers is associated with not only character decoding but also the listening ability to make better use of the sentential context for semantic integration in a severely degraded speech-in-noise condition. The results add to our better understanding of the multi-faceted reading comprehension in children. Future research could further address the age-dependent development and maturation of reading skills by examining and controlling other important cognitive variables, and apply neuroimaging techniques such as functional magmatic resonance imaging to reveal the neural substrates for the contribution of auditory semantic integration and the observed additive model to reading comprehension.

Tomato is one of the most important vegetable crops grown worldwide. Tomato brown rugose fruit virus (ToBRFV), a seed-borne tobamovirus, poses a serious threat to tomato productions due to its ability to break the resistant genes (Tm-1, Tm-2, Tm-22) in tomato. The objective of this work was to identify new resistance source(s) of tomato germplasm against ToBRFV. To achieve this aim, a total of 476 accessions from 12 Solanum species were tested with the ToBRFV US isolate for their resistance and susceptibility. As a result, a total of 44 asymptomatic accessions were identified as resistance/tolerance, including 31 accessions of S. pimpinellifolium, one accession of S. corneliomulleri, four accessions of S. habrochaites, three accessions of S. peruvianum and five accessions of S. subsection lycopersicon hybrid. Further analysis using serological tests identified four highly resistant S. pimpinellifolium lines, PI 390713, PI 390714, PI 390716 and PI 390717. The inheritance of resistance in the selected lines was verified in next generation and confirmed by RT-qPCR. To our knowledge, this is a first report of high resistance to ToBRFV in S. pimpinellifolium. These new genetic resources will expand the genetic pool available for breeders to develop new resistant cultivars of tomato against ToBRFV.

Streptococcal infection is a main infectious diseases for farmed grey mullet (Mugil cephalus). This study were to identify spreptococcal species in diseased farmed grey mullet and to investigate differences in susceptibility to 13 antibiotics and in genotypes between the stains from the grey mullet and non-grey mullet. 170 samples from diseased farmed grey mullet were collected from three county in 2013 -2016. Multiplex PCR identified L. garviea (146) as the main pathogen, S. agalactia (9), S. dysgalactiae (19), and double infection (5), but no S. iniae. The prevalence changed annually and differed among three counties. Pulsed-field gel electrophoresis (PFGE) analysis demonstrated identical genotype with an ApaI-digested DNA pattern. Disc diffusion results demonstrated differences in antibiotic susceptibility between the strains from grey mullet (146) and non-grey mullet (30). Almost all strains resisted to clindamycin and all strains were susceptible to six antibiotic in grey mullet and 4 antibiotics in non-grey mullet. The reduced susceptible strains was more in non-grey mullet than grey mullet group. The reduced susceptible strains were observed the highest in 2014 and in Chiayi county and decreased from 2014 to 2016. However, the strains with reduced susceptibility to ceftriaxone, cirpofoxacin, moxifloxacin, tetracycline for human treatment were observed.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Rotary tillage is a main management tillage practices and widely applied in the North China Plain. However, the long term rotary tillage (depth of 20 cm) results in soil compaction and plow pan formation, which reduces water use efficiency and nutrient uptake, and then impedes the yield increase. In this study, a 3-year field experiment was conducted to investigate the influence of different depths of tillage on soil bulk density, field capacity, water use, photosynthetic rate, nutrients and maize yields in the North China Plain. Three depths of tillage (D20, depth of 20 cm; D25, depth of 25 cm; D30, depth of 30 cm) were assessed. D25 and D30 significantly reduced soil bulk density and improved field capacity in 10-20 and 20-30 cm soil layer, compared to D20. Soil water consumption for D25 was significantly higher 10.12% and 6.61% than that for D20 and D30, respectively. Photosynthetic rate for D25 significantly improved than that for D20 and D30. Total nitrogen in 0-20cm soil layer decreased with the depths of tillage. The maize yields for D25 significantly increased by 20.92% and 21.56% compared to that for D20 and D30, respectively. Structural equation models showed that the total effects of tillage, total nitrogen, photosynthesis and soil water consumption on yields were 0.019, -0.628, 0.121, and 0.895 (path coefficients λ), respectively. The results demonstrated that D25 could improve maize yields, water use efficiency, photosynthetic rate by improving soil water consumption. Depth of 25 cm is optimal tillage practice for the maize production in the North China Plain.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Cucumber green mottle mosaic virus (CGMMV) is a re-emerging threat to greenhouse cucumber and other Cucurbitaceae crop productions worldwide. This seed-borne virus can easily spread from a contaminated seed to seedlings and to adjacent plants through mechanical contact of the foliage of diseased and healthy plants causing extensive yield losses. Additionally, infection may not be limited to the current crop but may also affect subsequent crops due to the long-term persistence of the virus on contaminated crop residues, greenhouse hard surfaces and soil or soil-less greenhouse substrates. In the present work, three greenhouse trials were conducted to develop an integrated pest management strategy towards controlling CGMMV in commercial cucumber greenhouses, by implementing an effective sanitization program and using resistant and grafted cucumber varieties. Results of sanitization trial highlighted that pressure washing and cleansing with an alkaline foam cleanser has eliminated CGMMV on some of the most heavily infested areas. However, three successive applications of cleanser and disinfectants were essential to completely eliminate CGMMV on porous and uneven surfaces, such as cement alleyway, tray gutter and floor mats. The varietal trial revealed that out of 15 cucumber varieties evaluated, two Mini (‘Katrina’ and ‘Khassib’) and three Long English (‘Sepire’, ‘Bomber’ and ‘LC13900’) had reduced or delayed CGMMV infection spread in the greenhouse but were intermediate in yield. The varieties ‘Sunniwell’ and ‘Bonbon’ were the most tolerant to CGMMV. They showed a high CGMMV infection level without compromising yield. These results proved the need for new productive cucumber varieties with CGMMV resistance. Grafting experiment showed only yield increase in case of grafted ‘Picowell’ over ‘Bonbon’ and not marked CGMMV resistance, which is a much desirable result when the grafting experiments are evaluated for their economic potential. In all, the current experimental trials unfold unique methodologies on CGMMV management in commercial greenhouses that are recommended to the growers to be followed for reducing crop losses and get benefitted on revenue compromise.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

This paper presents three approaches to estimating battery parameters of the electrical equivalent circuit model (ECM) based on electrochemical impedance spectroscopy (EIS); these approaches are referred to as (a) least squares (LS), (b) exhaustive search (ES), and (c) nonlinear least squares (NLS). The ES approach is assisted with the LS method for the rough determination of the lower and upper bound of the ECM parameters, and the NLS approach is incorporated with the Monte Carlo run such that different initial guesses can be assigned to improve the goodness of EIS fitting. The proposed approaches are validated using both simulated and real EIS data. Compared to LS approach, the ES and NLS approaches show better fitting accuracy at various noise levels; whereas both in the validation using simulated EIS data and actual EIS data collected from LG 18650 and Molicel 21700 batteries, the NLS approach shows better fitting accuracy than that of LS and ES approaches. In all cases, compared with the ES approach, the computational time of the NLS approach is significantly faster, and compared with the LS approach, the NLS approach shows a minimal difference in computational time and considerably better fitting performance.

We studied the effect of the structure parameters of engine annular cooling fan with outer ring on the aerodynamic performance by means of experiments and model simulation in fluent^®. Firstly, based on the experiment, a computational model is developed to calculate and analyze the aerodynamic performance of the tested annular fan. The model is validated by comparing the test results with the calculated data. Besides, the aerodynamic performance differences between two types of fans (common fan without outer ring and annular fan with outer ring) are discussed. Based on the computational model, the relation between aerodynamic performance and the outer ring structure parameters are investigated. The results show that the relative parameter on the axial direction has great influence on the aerodynamic performance; while the effect of radial relative parameter is minor. In addition, the outer ring with arc chamfer structure in the downstream side can improve its static pressure efficiency effectively.

Compared with the traditional slow charging loads, random integration of large scale fast charging loads will exert more serious impacts on the security of power network operation. Besides, to maximize social benefits, effective scheduling strategy guiding fast charging behaviors should be formulated rather than simply increasing infrastructure construction investments on the power grid. This paper has analyzed the charging users’ various responses to the elastic charging service fee, introduced the index of charging balance degree to a target region by considering the influence of fast charging loads on power grid. Then, a multi-objective optimization model of the fast charging service fee is constructed, whose service fee can be further optimized by employing fuzzy programming method. Therefore, both users’ satisfaction degree and the equilibrium of charging loads can be maintained simultaneously by guiding EVs to different fast charging stations reasonably. The simulation results demonstrate the effectiveness of proposed dynamic charging service pricing and the proposed fast charging load guidance strategy.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

The treatment, disposal, and resource utilization of waste mud are challenges for engineering construction. This study investigates the road performance of waste mud–solidified soil and reveals the mechanism of how solidifying materials influence the strength and deformation characteristics of waste mud. Waste mud, collected from a highway reconstruction project, was mixed with ordinary Portland cement as a solidifying material. Unconfined compressive strength tests, consolidated undrained triaxial shear tests, resonant column tests, and consolidation compression tests were conducted to evaluate the solidification effect. The test results show that with an increase in cement content from 5% to 9%, the unconfined compressive strength of the waste mud–solidified soil increased by over 100%, the curing time was extended from 3 days to 28 days, and the unconfined compressive strength increased by approximately 70%. However, an increase in initial water content from 40% to 60% reduced the unconfined compressive strength by 50%. With the increase of cement content from 5% to 9%, the cohesion and friction angles increased by approximately 78% and 24%, respectively. The initial shear modulus under dynamic shear increased by approximately 38% and the shear strain corresponding to a damping ratio decay to 70% of the initial shear modulus decreased by nearly 11%. The compression coefficient decreased by approximately 55%. Scanning electron microscopy and X-ray diffraction tests showed that a higher cement content led to the formation of more hydration reaction products, especially an increase in the content of AlPO4. The bonding material between soil particles significantly increased, exerting a bonding and filling effect on soil particles and firmly adhering them together. Consequently, the strength of the waste mud–solidified soil increased significantly while its compressibility decreased.

Reactions of N‚N'-bis(3-methylpyridyl)oxalamide (L1), N,N’-bis(3-methylpyridyl)adipoamide (L2) and N,N’-bis(3-methylpyridyl)sebacoamide (L3) with tricarboxylic acids and Cu(II) salts afforded {[Cu(L1)(1,3,5-HBTC)]·H2O}n (1,3,5-H3BTC = 1,3,5-benzenetricarboxylic acid), 1, {[Cu1.5(L2)1.5(1,3,5-BTC)(H2O)2]·6.5H2O}n, 2, [Cu(L2)0.5(1,3,5-HBTB)]n (1,3,5-H3BTB = 1,3,5-tri(4-carboxyphenyl)benzene), 3, [Cu4(L3)(OH)2(1,3,5-BTC)2]n, 4, {[Cu3(L3)2(1,3,5-BTB)2]·2.5MeOH·2H2O}n, 5, and {[Cu3(L3)2(1,3,5-BTB)2 ]·DMF·2H2O}n, 6, which have been structurally characterized by using single crystal X-ray crystallography. Complexes 1 – 4 form a 2D layer with the {44.62}-sql topology, a 2D layer with the (4.62)2(42.62.82)-bex topology, a 3-fold interpenetrated 3D net with the (412.63)-pcu topology and a 3D framework with the (410.632.83)(42.6)2(43.63) topology, respectively, whereas 5 and 6 are 3D frameworks with the (63)2(64.82)(68.85.102) topology. Complex 5 shows a better iodine-adsorption factor of 290.0 mg g-1 at 60 oC for 360 minutes than the other ones, revealing that the flexibility of the spacer ligand governs the structural diversity and the adsorption capacity.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.