An experiment was conducted to investigate the role of single nucleotide polymorphisms of the gene RNF34 3′UTR-588 G>A and RNF128 I1-2380C>T with carcass and meat quality traits of Chinese Simmental-cross steers. METHOD: We performed sequencing and restriction enzyme digestion to detect genotypes of RNF34 3′UTR-588 G>A and RNF128 I1-2380C>T. Then, we analyzed the association of novel single nucleotide polymorphisms in intron regions of the RNF128 gene and in the 3′UTR region of RNF34 and meat quality traits of Chinese Simmental-cross steers. RESULTS: Statistical analyses revealed that SNP of RNF128 (I1-2380C>T) was significantly associated with dressed weight, forepaw weight, carcass depth, carcass brisket depth, hind legs length (P<0.05), etc. And RNF34 (3′UTR-588 G>A) were significantly associated with testis weight, kidney weight, tare weight (P<0.05), etc. CONCLUSION: Our findings suggest that polymorphisms in RNF34 and RNF128 might be important genetic factors that influence carcass and meat quality in beef cattle. Thus, they might be useful markers for meat quality traits in future marker-assisted selection programs in beef cattle breeding and production.

Diastolic dysfunction, a prevalent condition characterized by impaired relaxation and filling of the left ventricle, significantly contributes to heart failure with preserved ejection fraction (HFpEF). Galectin-3, a β-galactoside-binding lectin, has garnered attention as a potential biomarker and mediator of fibrosis and inflammation in cardiovascular diseases. This comprehensive review investigates the impact of galectin-3 on diastolic dysfunction. We explore its molecular mechanisms, including its involvement in cellular signaling pathways and interaction with components of the extracellular matrix. Evidence from both animal models and clinical studies elucidates galectin-3's role in cardiac remodeling, inflammation, and fibrosis, shedding light on the underlying pathophysiology of diastolic dysfunction. Additionally, we examine the diagnostic and therapeutic implications of galectin-3 in diastolic dysfunction, emphasizing its potential as both a biomarker and a therapeutic target. This review underscores the significance of comprehending galectin-3's role in diastolic dysfunction and its promise in enhancing diagnosis and treatment approaches for HFpEF patients.

This study was undertaken to investigate and analyze noise pollution in a large Chinese governmental hospital’s medical intensive care unit and compare to the WHO guidelines.This cross-sectional study was conducted in a MICU at a public governmental teaching hospital in Fujian province between July and August of 2017. A WENSN® WS1361 Integrated Sound Level Meter (China) was used for continuous every five seconds one week noise levels recording. After this measurement, the decibel meter was used for recording different location of isolation rooms and open bays, including occupied and unoccupied patient, and recording sound events occurs in the ICU to identify sources of noise. Peak and average noise levels were obtained from the meter, and data were downloaded from the WS1361 into a laptop computer. The measured mean equivalent sound pressure levels (L) and standard Aeq deviation over one week period were 66.64±7.57 dB(A), with acute spikes reaching 119.7 dB(A), the average sound level for a 24 hour period in a work day was 68.03±5.07 dB(A). These are higher than the current daytime environmental noise limit of 40-45 decibels in China and WHO. Mean work day noise was significantly louder than weekend time, there was a significant difference in work days and weekend (t=16.85;P=0.000).There was a statistical difference between the day time and night time shifts (t=34.67;P=0.000). The isolation rooms were significantly quieter than the open-bay rooms(t=46.15; p=0.00), sound levels in the occupied and unoccupied rooms also had significant difference(t=17.26; P=0.000).Two types of noise resources, including twenty kinds sources were identified and measured, mean noise levels ranged from of 61.33 to 79.21 dB(A). This study shows noise levels in intensive care units were exceeded the recommended. The study of the influence of noise on patient and staff is needed, and noise reduction strategies must be conduct in ICU.

3,4-Dihydroquinolin-2(1H)-ones represent a class of valuable bioactive compounds with six-membered nitrogen-containing heterocyclic structures. The development of simple, mild and efficient synthetic methods has been widely concerned by synthetic chemists. In this review, we have summarized a series of different synthetic strategies for the synthesis of dihydroquinoline-2(1H)-ones via catalytic annulation of α,β-unsaturated N-arylamides in the past decade, including covering electrophilic cyclization, radical initiated cyclization and photochemical cyclization reactions. Besides, the substrate scope and mechanistic details are also discussed. This paper will provide a useful reference for the development of diverse synthesis methodologies of 3,4-dihydroquinolin-2(1H)-ones.

Elevated antimony concentrations in aqueous environments from anthropogenic sources is becoming of global concern, here iron oxides are known to strongly adsorb aqueous antimony species with different oxidation states, but the effect of silica on the removal characteristics is not well understood despite being a common component in the environment. In this study, ferrihydrite was synthesized at various Si/Fe molar ratios to investigate its adsorption and co-precipitation behaviors with aqueous antimony anionic species, Sb(III) and Sb(V). The XRD analyses of the precipitates showed two broad diffraction features at approximately 35° and 62° 2θ, which are characteristic of 2-line ferrihydrite, no significant shifts in peak positions in the ferrihydrite regardless of the Si/Fe ratios. The infrared spectra showed a sharp band at ~990 cm⁻¹, corresponding to asymmetric stretching vibrations of Si-O-Fe bonds which increased in intensity with increasing Si/Fe molar ratios. Further, the surface charge on the precipitates became more negative with increasing Si/Fe molar ratios. The adsorption experiments indicated that Sb(V) was preferentially adsorbed at acidic conditions and decreased dramatically with increasing pH while the adsorption rate of Sb(III) ions was independent of pH, however, the presence of silica suppressed the adsorption of both Sb(III) and Sb(V) ions. The results showed that Sb(III) and Sb(V) ions were significantly inhibited by co-precipitation with ferrihydrite even in the presence of silica by isomorphous substitution in the ferrihydrite crystal structure.

Imitation learning, also known as programming by demonstration, has been shown to be a promising paradigm for intuitive robot programming by non-expert users. However, the classical kinesthetic approach with physical hand guidance suffers from generalizability across different robot types and is impractical for demonstrating tasks with long horizons. Visual imitation learning enables the recording of multi-step tasks as a single continuous video, allowing non-experts to demonstrate tasks naturally. Existing approaches typically require a large amount of data to develop end-to-end deep learning models that map raw pixels to robot actions. This paper explores the application of visual imitation learning from one-shot demonstration, significantly reducing the data requirements and simplifying the programming process. To achieve this target, a framework is proposed to map hand trajectories to the robot end-effector, consisting of four essential components: hand detection; object detection; segmentation of the trajectories into elemental skills; and learning the skills. Methods are developed for each component and evaluated on recorded videos to demonstrate the effectiveness of the proposed framework.

8-Hydroxydeoxyguanosine (8-OHdG) was the most widely used oxidative stress biomarker of the free radical-induced oxidative damage product of DNA, which may allow a premature assessment of various diseases. This paper designed a label-free, portable biosensor device to direct detect 8-OHdG by plasma coupled electrochemistry on transparent and conductive indium tin oxide (ITO) electrode. We reported a flexible printed ITO electrode made from particle-free silver and carbon inks. After inkjet printing, the working electrode was sequentially assembled by gold nanotriangles (AuNTAs) and platinum nanoparticles (PtNPs). This nanomaterial-modified portable biosensor showed excellent electrochemical performance for 8-OHdG detection from 10 μg/mL to 100 μg/mL by our self-developed constant voltage source integrated circuit system. This work demonstrated a portable biosensor for simultaneously integrating nanostructure, electroconductivity, and biocompatibility to construct advanced biosensors for oxidative damage biomarkers. The proposed nanomaterial modified ITO-based electrochemical portable device was a potential biosensor to approach 8-OHdG point-of-care testing (POCT) in various biological fluid samples, such as saliva and urine samples.

Cancer is a common illness with a high mortality. Compared to traditional technologies, biomarkers detection, with low cost and simple operation, has higher sensitivity and faster speed in early screening and prognosis of cancer. Therefore, extensive research has been focused on the development of biosensors and the construction of sensing interfaces. Molybdenum disulfide (MoS2) is a promising two-dimensional (2D) nanomaterial, whose unique adjustable bandgap shows excellent electronic and optical properties in the construction of biosensor interfaces. It not only has the advantages of high catalytic activity and low manufacturing costs, but also can further expand the application of hybrid structures by different functionalization, and is widely used in various biosensors fields. Herein, the application of electrochemical and optical sensing platforms based on MoS2 in the detection of cancer biomarkers was comprehensively reviewed. Firstly, the structure and preparation method of MoS2 were introduced, and its applicable characteristics in the field of biosensors were explored. Secondly, we comprehensively reviewed the recent construction and application of sensing platform based on MoS2 in the field of cancer biomarkers detection in both electrochemical and optical aspects. The prime characteristics and application performances of MoS2 and its composites were emphasized. Additionally, we also involved some other types of biosensors based on MoS2. Finally, we summarized the challenges and development prospects of MoS2 in the application of cancer biomarkers detection, and provided some insights for the application potential of this kind of emerging nano-materials in a broader field.

Most of existing fuzzy forecasting models partition historical training time series into fuzzy time series and build fuzzy-trend logical relationship groups to generate forecasting rules. The determination process of intervals is complex and uncertainty. In this paper, we present a novel fuzzy forecasting model based on high-order fuzzy-fluctuation trends and the fuzzy-fluctuation logical relationships of the training time series. Firstly, we compare each data with the data of its previous day in historical training time series to generate a new fluctuation trend time series(FTTS). Then, fuzzify the FTTS into fuzzy-fluctuation time series(FFTS) according to the up, equal or down range and orientation of the fluctuations. Since the relationship between historical FFTS and the fluctuation trend of future is nonlinear, Particle Swarm Optimization (PSO) algorithm is employed to estimate the required parameters. Finally, use the acquired parameters to forecast the future fluctuations. In order to compare the performance of the proposed model with that of the other models, we apply the proposed method to forecast the Taiwan Stock Exchange Capitalization Weighted Stock Index (TAIEX) time series datasets. The experimental results and the comparison results show that the proposed method can be successfully applied in stock market forecasting or such kinds of time series. We also apply the proposed method to forecast Shanghai Stock Exchange Composite Index (SHSECI) to verify its effectiveness and universality.

[Objective] To investigate the expression of ALDH2 in hepatocellular carcinoma and its correlation with macrophage infiltration and with the activation of specific subtypes of macrophages. [Methods] Transcriptome and clinical data from patients with hepatocellular carcinoma were downloaded from The Cancer Genome Atlas (TCGA) and the International Cancer Genome Consortium (ICGC) databases and analyzed and collated using R and Perl software. In the TCGA hepatocellular carcinoma dataset, the Wilcoxon test was used to identify macrophage activation-related gene sets that show differential expression between hepatocellular carcinoma and normal tissues. Single-cell sequencing combined with bulk data was used to analyze macrophage infiltration of hepatocellular carcinoma immune cells and the activation and recruitment of different subtypes of macrophages. Single-factor Cox regression and minimum absolute convergence and selection operator (Lasso) were used to identify survival-related genes and construct prognostic models of HCC. The patients were divided into two groups based on their model scores. The Wilcoxon test was used to identify differentially expressed genes (DEGs) between the two groups, and gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) functional enrichment analyses of the DEGs were performed. Single-sample gene set enrichment analysis (ssGSEA) was performed to explore the possible mechanism underlying the differences in prognosis. The reliability of the model was verified using the ICGC hepatocellular carcinoma dataset. A Kaplan‒Meier curve was constructed and used to analyze the influence of macrophage activation-related gene expression on survival and prognosis in patients with hepatocellular carcinoma. The log-rank test and the independent t test were used to analyze survival time data and to compare immune cell infiltration in the two groups. [Results] In a comparison of hepatocellular carcinoma and paracancerous tissues, the expression of six of 137 macrophage activation-related genes (ALDH2, CCNB2, CYP2C9, CYP3A4, F9 and KLKB1) was found to be significantly correlated with overall survival time (OS) in patients with hepatocellular carcinoma. Based on this finding, a prognosis assessment model for hepatocellular carcinoma was constructed. The OS of the patients in the high-scoring group was significantly shorter than the OS of the patients in the low-scoring group (P<0.05), and the model predicted the prognosis of patients with hepatocellular carcinoma independently of sex, age, tumor grade and stage. The area under the receiver operating characteristic (ROC) curve of the model used to predict 1-, 2-, and 3-year survival was greater than 0.7 in both the test set and the validation set. GO enrichment of DEGs between the high- and low-scoring groups of the model suggested that the DEGs are mainly related to immune function. GSEA suggested that the tumor-infiltrating immune cells in the high-scoring group were macrophages, Th2 cells and Treg cells and showed that the number of tumor-infiltrating immune cells, including NK cells, was lower in the high-scoring group than in the low-scoring group. With respect to immune function, the immune checkpoint of the high-scoring group was higher than that of the low-scoring group. Single-cell sequencing data indicated the recruitment of B cells, M0 cells, M1 cells and M2 cells to the hepatocellular carcinoma microenvironment and suggested that ALDH2 regulates related signaling pathways in a way that promotes the differentiation of macrophages into M2-type macrophages. [Conclusion] M2-type macrophages are the dominant type of macrophages associated with immune infiltration in hepatocellular carcinoma. The macrophage-associated activation gene ALDH2 activates the macrophage polarization signaling pathway and negatively regulates the differentiation of macrophages into M2-type macrophages.

Cafestol, a bioactive compound found in coffee, has attracted considerable attention due to its potential impact on cardiovascular health. This review aims to comprehensively explore the association between cafestol and cardiovascular diseases. We delve into the mechanisms through which cafestol influences lipid metabolism, inflammation, and endothelial function, all of which are pivotal in cardiovascular pathophysiology. Moreover, we meticulously analyze epidemiological studies and clinical trials to elucidate the relationship between cafestol and cardiovascular outcomes. Through a critical examination of existing literature, we aim to provide insights into the potential benefits and risks associated with cafestol concerning cardiovascular health.

With the popularization of intelligent sensing and the improvement of modern medical technology, intelligent medical sensing technology has emerged as the times require. This technology combines basic disciplines such as physics, mathematics, and materials with modern technologies such as semiconductors, integrated circuits, and artificial intelligence, and has become one of the most promising focuses in the medical field. The core of intelligent medical sensor technology is to make existing medical sensors intelligent, portable, and wearable with full consideration of ergonomics and sensor power consumption issues, for conforming to the current trends in cloud medicine, personalized medicine, and health monitoring. With the development of automation and intelligence in measurement and control systems, it is required that sensors have high accuracy, reliability, stability, as well as certain data processing capabilities, self-checking, self-calibration, and self-compensation，while traditional medical sensors cannot meet such requirements. In addition, in order to manufacture high-performance sensors, it is also difficult to improve the material process alone, and it is necessary to combine computer technology with sensor technology to make up for its performance shortcomings. Intelligent medical sensing technology combines medical sensors with microprocessors to produce powerful intelligent medical sensors. On the basis of the original sensor functions, intelligent medical sensors also have functions such as self-compensation, self-calibration, self-diagnosis, numerical processing, two-way communication, information storage, and digital output. This review focuses on the application of intelligent medical sensing technology in biomedical sensing detection from three aspects: physical sensor, chemical sensor, and biosensor.

The portal website of a university or a college usually represents the cultural characteristics and teaching advantages and plays a vital role in higher education, showing the style of the university or college to society and improving the admission rate. Mississippi State (MS) is bounded by the Mississippi River in the west and the Gulf of Mexico in the south, with a population of 3.1 million. It has a rich cultural heritage, and many universities, especially historically black colleges and universities (HBCUS), have strong scientific research strength in agriculture, medicine, petrochemicals and papermaking. Therefore, this article will analyze the design of the portal websites of four HBCUs in Mississippi from two aspects: user experience (UE) and functional architecture (FA), determine their advantages, disadvantages, similarities and differences, and propose some optimization suggestions.

Harsh parenting could be regarded as a harsh form of behavior, feelings and attitude towards children in the process of parenting. According to the theory of intergenerational transmission of violence, harsh parenting is an important factor affecting children's aggressive behavior, but the theory does not clarify the specific action path between the harsh parenting and aggressive behavior. In order to reveal the relationship between harsh parenting and aggressive behavior of juvenile delinquents, 604 male juvenile delinquents (N=604, Mage=16.57 years, SD=0.612 years) were investigated using Harsh Parenting Questionnaire, Buss-Perry Aggression Questionnaire, Multidimensional Peer-Victimization Scale, and the Word Sentence Association Paradigm for Hostility in Chinese version. Analysis using structural equation modeling procedures showed that (a) all variables were positively associated with each others; (b) the partial indirect effect of harsh parenting on aggressive behaviors was realized through the mediator of peer victimization and hostile attribution bias independently, (c) as well as the partial indirect effect through the mediator of peer victimization and hostile attribution bias sequentially. The results suggested that harsh parenting can explain the high aggressive behavior of male juvenile delinquents. Moreover, harsh parenting may also lead to the formation of hostile attribution bias by increasing the risk of peer victimization, and ultimately lead to the formation of highly aggressive behaviors.

Flood inundation causes socioeconomic losses for coastal tourism under climate extremes, progressively attracting global attention. Mapping, evaluating, and predicting the flood inundation risk (FIR) is significant for coastal tourism. The study develops a spatial tourism–aimed framework integrating a weighted k-Nearest Neighbors (WkNN), Geographic Information Systems, and flood-related spatially environmental criteria such as precipitation, elevation, soil, and drainage systems. These model inputs were standardized and weighted using distance, and integrated into WkNN to infer regional probability and distribution of FIR. Zhejiang province, China, was selected as a case study. The resulting map was pictured to denote the likelihood of the criteria at various risk categories, which was validated by historical Maximum Inundation Extent (MIE) extracted from World Environment Situation Room. The result indicates 80.59% of WkNN results reasonably confirm the MIE. Precipitation and elevation make a negative contribution to high-medium risk, and drainage systems positively alleviate the regional stress of FIR. The results can help stakeholders make suitable strategies to protect coastal tourism, and also weigh WkNN is superior to kNN in FIR assessment. The framework provides a productive way to yield a reliable assessment of FIR and can also be extended to other risk-related environmental studies under climate change.

(1) Background: As Patient-reported outcome measures face challenges with low response rate on surveys, different incentive mechanism have been proposed to achieve a higher response rate. However, it seems that monetary incentives are the only mechanism with proven effect. Nevertheless, it is less likely to be used than other mechanisms due to the monetary cost. (2) Methods: In this research work, a cryptographic scheme for rewarding patients with cryptographic tokens is developed and implemented on the Ethereum test network. (3) Results: The model is able to distribute decentralised tokens to patients who complete the PROMs in a fair, private, decentralised approach. The token can be further used by patients to exchange more healthcare services, encouraging more patients to participate in PROMs. At the same time, an IER detection method is built to improve the quality of PROMs, avoiding the healthcare provider paying for meaningless PROMs from patients who barely participate for incentives. (4) Conclusions: This work provides an privacy-preserving incentive model to increase the response rate for PROMs surveys. Our model prevents patients providing invalid responses to gain rewards.

Despite the expectation that social media use in the public sector contributes to enhancing government's transparency, few studies have been investigated whether social media use actually leads to more disclosure during environmental incidents in practice and how social media influence local governments and their officials' information disclosure. In this article, we model information disclosure during environmental incidents as an evolutionary game process between the central government and local government in social media context, and examine the internal mechanism that how social media influence the progress of information disclosure during environmental incidents. The findings indicate that social media plays an active constructive role in central-local government game relations. Specific- ally, social media can provides an efficient information channels for the central government supervise regional officials in environmental incidents, and thus improves its supervision efficiency, and it also provides an important means for internet mobilization and online-offline interaction by encouraging the public exchange information and express their views, and in turn forces local governments and their officials tend to disclosure ahead.

The utilization of Artificial Intelligence (AI) in biotechnology is widespread, addressing challenges such as elucidating disease pathophysiology and novel therapeutic approaches. AI plays a critical role in tasks such as drug manufacturing, chemical analysis, RNA and DNA sequencing, and enzyme studies by automating processes and expediting data collection and analysis. AI has particularly transformed the analysis of omics data for researchers, providing tools to handle complex and multifaceted datasets effectively. Through AI, integrative analysis of multi-omics data can be conducted in efficient ways. This article discusses the application of multi-omics and AI technologies in studying various diseases related to infection (COVID-19), mutation (cancer), and senescence (alopecia) to understand their pathophysiology. The applications of AI were performed as the aspect of the diagnosis, prognosis, and treatment for each disease. We introduce AI-driven analysis of pathophysiology can overcome traditional limitations in pathology, with diverse features showing potential in defining the causes of diseases, and potentially enhancing primary omics data in the distinguish the subtype of diseases. In this context, integrated approaches using multi-omics data and AI technology could provide fresh biological insights by comprehending the molecular mechanism of diseases and is instrumental in advancing precision medicine. We anticipate that the rapidly advancing AI-based multi-omics data analysis will significantly contribute to promoting healthy longevity.

The human body is inhabited by unique microbial communities that protect and regulate the host against pathogens and inflammation. To address issues related to disrupted microbial composition, microbial transfer therapy (MTT) has emerged as a potential treatment option. The most popular form of MTT is fecal microbiota transplantation (FMT), which has been successful in treating various diseases. Another emerging form of MTT is vaginal microbiota transplantation (VMT), transferring of the vaginal microbiota from a healthy female donor to a diseased patient's vaginal cavity, which aims to restore normal vaginal microbial composition. However, VMT is vastly unexplored due to safety concerns and lack of research. This paper explores the mechanisms involved in VMT's therapeutic effect and discusses future perspectives. Further research is needed to advance VMT's clinical applications and techniques.

This article focuses on the leader-following consensus of fuzzy fractional order singular perturbation multi-agent systems (FOSPMASs) with order in 0,2. By employing the T-S fuzzy modeling approach, a fuzzy FOSPMAS is constructed. Subsequently, a fuzzy observer-based controller is designed and the error system corresponding to each agent is derived. Through a series of equivalent transformations, the error system is decomposed into fuzzy singular fractional order systems (SFOSs). According to the admissibility of SFOSs, the consensus conditions of the fuzzy FOSPMAS are obtained based on linear matrix inequalities (LMIs) without equality constraint. Finally, the effectiveness of the criteria is verified through an RLC circuit model.

Mice are one of the frequently used animal models in science research whose behavioral characteristics can provide much valuable information in biology, neuroscience, and pharmacology. Nowadays, artificial intelligence is widely used in mice behavior analysis. Integrated AI systems such as ChatGPT and VisualGPT are already available, and we discuss the feasibility of MiceGPT to help researchers identify and classify mouse behavior more easily. We review the applications of mice behavior analysis, analyze the tasks of deep learning on these applications based on an AI pyramid, and finally summarize the AI approaches to solve these tasks. Based on these summaries, we propose three MiceGPT architectures to demonstrate the theoretical feasibility of MiceGPT.

In the pursuit of China’s dual carbon goals, identifying spatio-temporal changes in industrial carbon emission efficiency and their influencing factors in cities at different stages of development is the key to effective formulation of countermeasures to promote the low-carbon transformation of Chinese national industry and achieve high-quality economic development. In this study, we used balanced panel data of 270 Chinese cities from 2005 to 2020 as a research object: (1) to show spatio-temporal evolution patterns in urban industrial carbon emission efficiency; (2) to analyze the aggregation characteristics of industrial carbon emission efficiency in Chinese cities using Global Moran's I statistics; and (3) to use the hierarchical regression model for panel data to assess the non-linear impact of the digital economy on the industrial carbon emission efficiency of cities. The results show the following: (1) the industrial carbon emission efficiency of Chinese cities exhibited an upward trend from 2005 to 2020, with a spatial distribution pattern of high in the south and low in the north; (2) China's urban industrial carbon emission efficiency is characterized by significant spatial autocorrelation, with increasing and stabilizing correlation, and a relatively fixed pattern of spatial agglomeration; (3) there is a significant inverted-U-shaped relationship between the digital economy and the industrial carbon emission efficiency of cities. The digital economy increases carbon emissions and inhibits industrial carbon-emission efficiency in the early stages of development, but inhibits carbon emissions and promotes industrial carbon emission efficiency in mature developmental stages. Therefore, cities at all levels should reduce pollution and carbon emissions from high-energy-consuming and high-polluting enterprises, gradually reduce carbon-intensive industries, and accelerate the digital transformation and upgrading of enterprises. Western, central and eastern regions especially should seek to promote the sharing of innovation resources, strengthen exchanges and interactions relating to scientific and technological innovation, and jointly explore coordinated development routes for the digital economy.

Based on the high-precision quantitative measurement ability, the S-band subsystem of China's high- resolution aviation system carried out the agricultural application test for the first time in Jilin elm, China. The experiment is mainly carried out in combination with vegetation growth, soil moisture content inversion, wheat straw returning and ground feature classification. Through the design of quantitative measurement scheme, the results of different straw coverage and observation at different times are compared, which shows the prospect of S-band full polarization synthetic aperture radar system in the field of agricultural application.

At the nanoscale, metals exhibit special electrochemical and optical properties, which play an important role in nanobiosensing. In particular, the surface plasmon resonance based on precious metal nanoparticles, as a kind of tag free biosensor technology, has brought high sensitivity, high reliability and convenient operation to the sensor detection. By applying an electrochemical excitation signal on the nano plasma device, modulating its surface electron density and realizing electrochemical coupling surface plasmon resonance, it can effectively complete the joint transmission of electrical signals and optical signals, increase the resonance shift of the spectrum, and further improve the sensitivity of the designed biosensor. In addition, smartphone is playing an increasingly important role in portable mobile sensor detection systems. These systems typically connect sensing devices to smartphone to perceive different types of information, from optical signals to electrochemical signals, providing ideas for the portability and low-cost design of these sensing systems. Among them, electrochemiluminescence, as a special electrochemical coupled optical technology, has good application prospects in mobile sensing detection due to its strong anti-interference ability, which is not affected by background light. In this review, the surface plasmon resonance is introduced from nanoparticles, and its response process is analyzed theoretically. Then, the mechanism and sensing application of electrochemistry coupled surface plasmon resonance and electrochemiluminescence are emphatically introduced. Finally, it extends to the related research of electrochemical coupled optical sensing on mobile detection platforms.

Primulina serrulata is a valuable ornamental herb with rosette leaves and vibrant flowers. Some leaves exhibit a bright and distinct white color along the upper veins, enhancing their ornamental value, while others are less white or entirely green. This variation is observed among adult leaves in natural habitats and among young leaves from seedlings grown in the laboratory. TMT-labeled proteomic technology was employed to study the protein-level biogenesis of white-veined (WV) leaves of P. serrulata. The chlorophyll (Chl) content was significantly lower in the WV group than in the control group. A total of 6,261 proteins were identified, revealing 69 differentially expressed proteins (DEPs), with 44 down-regulated and 25 up-regulated in WV plants. Some DEPs associated with chloroplasts and Chl biosynthesis were down-regulated, leading to the absence of green coloration. Concurrently, gene ontology enrichment analysis further underscored an insufficiency of magnesium , the key element in Chl biosynthesis. Many DEPs associated with abiotic or biotic stresses were down-regulated, suggesting an overall weakening of stress resistance with certain compensatory mechanisms in place. Similarly, many DEPs related to biomacromolecule modification were down-regulated, possibly influenced by the decrease in proteins involved in photosynthesis and stress resistance. Some DEPs containing iron were up-regulated, indicating that iron was mainly used to synthesize heme and ferritin instead of Chl. Additionally, several DEPs related to sulfur or sulfate were up-regulated, implying strengthened respiration. Expansin-A4 and pectinesterase displayed up-regulation, coinciding with the emergence of a rough and bright surface in the white area, indicative of the elongation and gelation processes in cell walls. These findings provide new insights that could be utilized by future studies to explore the mechanism of color formation in WV leaves.

We successfully fabricated Ag@Cu2O core-shell decorated on reduced graphene oxide (rGO) nanocomposites (ACRN) by a simple and convenient in situ substitution method. The properties of these ACRN with heterostructure layers were characterized by scanning and transmission electron microscopies and absorption spectroscopy. We used p-nitrophenol (4-NP) as a probe molecule to determine the chemical catalytic activity of the ACRN. Upon introduction of rGO, a high electron transfer efficiency was achieved; thus, the catalytic activity was improved significantly. Therefore, the ACRN exhibited significantly improved catalytic activity for the reduction of 4-NP and showed the high application value in the removal of toxic and harmful substances from water. In addition, the fabricated ACRN was used for the reduction of organic dyes and explosive pollutants to generate nontoxic products. Furthermore, the high charge redistribution and transfer among Ag, Cu2O and rGO in the ACRN induced the high catalytic reduction of organic pollutants, indicating the excellent potential of these materials for applications in water pollution treatment.

Increasing clinical and preclinical evidences implicate gut microbiome (GM) dysbiosis as a key susceptibility factor for neurodegenerative disorders, including Alzheimer’s disease (AD) and Parkinson’s diseases (PD). In recent years, neurodegenerative diseases have not been viewed as driven solely by defects in brain, and the role of GM in modulating the central nervous system function via gut-brain axis has attracted considerable interest. Encouraged by GM researches, the next-generation probiotics may lead to tangible impacts on the treatment of neurodegenerative disorders. This review summarizes the current understandings of GM composition and characteristics associated with neurodegenerative diseases, and the demonstrations of molecules from GM affecting neurodegeneration. Particularly, applications of next-generation probiotics such as Clostridium butyricum, Akkermansia muciniphila, Faecalibacterium prausnitzii, and Bacteroides fragilis for remediation of neurodegenerative diseases are discussed.

By shifting the focus from aggregate-level analysis to individual-level analysis, we believe that the DAD model can contribute to a more comprehensive understanding of driving behavior. Combing DAD with a conflict identification (CIM) model can potentially enhance the effectiveness of Advanced Driver Assistance Systems (ADAS) in terms of crash evasion capabilities. This paper is part of our research titled Automatic Safety Diagnosis in Connected Vehicle Environment, which received funding from the Southeastern Transportation Research, Innovation, Development, and Education Center.

In forests, the microbial populations living in the soil can directly affect the carbon decomposed by the surface plants, and promote carbon storage and stability. In this study, 3 plots of 25.82 m×25.82 m were set up in 5 stand types, respectively. Soil samples were collected from 0~20 cm, 20~40 cm and 40~60 cm layers. Soil microbial composition, organic carbon component, pH, water content, bulk density, nitrogen, phosphorus, potassium and other physicochemical indexes and correlations were determined, and the correlations between soil carbon components and soil microbial functional modules in different mixed modes were analyzed. The results showed that: (1) The SOC of the same soil layer varied significantly, which also showed significant differences on the composition of soil bacteria and fungal microbial communities. Moreover, the bacterial community was more sensitive to the vegetation change environment, and the fungal community structure was more resistant to the influence of soil environment changes. (2) Fun_mod 1,6 and Bac_mod 7 were the microbial functional modules that played a decisive role in the process of soil carbon pool change, and the diversity and composition of bacterial community had more positive effects on soil organic carbon than that of fungal community. (3) Linear fitting and RDA results showed that POC in soil had the strongest correlation with SOC content, indicating that soil microorganisms affected the storage and stability of soil carbon mainly by regulating the conversion of surface plants (carbon sources) into POC. The soil environment of different mixed modes has different effects on soil carbon accumulation. Soil microorganisms affect soil carbon storage and stability mainly by regulating the conversion of surface plants (carbon sources) into POC forms.

We analyze a time-delayed SIQR model that considers the transportation-related infections and entry-exit screening. This model aims to determine the measures for preventing and controlling major emergent infectious diseases and the associated costs. We calculate the basic reproduction number (R0), apply the linearization method, and construct an appropriate Lyapunov function to determine the stability of the disease-free equilibrium in the local and global. We collect COVID-19 infection data from two regions in the United States in 2020 for data fitting, obtain a set of optimal parameter values, and show that the model is suitable for simulating the outbreak and spread of emerging infectious diseases. We find that transportation-related infections increase the basic reproduction number, enhancing the impact on disease spread. Entry-exit screening effectively suppress the spread of disease by reducing the basic reproduction number. Furthermore, we investigate the influence of the incubation period on disease and find that a shorter incubation period results in a shorter duration but a larger scale of infection, and the peaks are reduced. We conduct a sensitivity analysis of the R0 and propose three measures to prevent the spread of new infectious diseases based on the most sensitive parameters: wearing masks, implementing urban closures, and administering medication to sick but not yet hospitalized patients promptly. In the case of COVID-19, we use Pontryagin’s minimum principle to get time-varying control measures to control the spread of the outbreak. Optimal control effectively controls the development and deterioration of the disease. Finally, several control measures are compared through cost-effectiveness analysis, and the results show that wearing masks is the most cost-effective measure. Our study provides some practical guidance for controlling the spread of major emerging infectious diseases.

Mitochondrial alternative oxidase 1a (AOX1a) plays an extremely important role in critical node of seed viability. However, the regulatory mechanism is still poorly understood. The study aims to identify regulatory mechanisms by comparing between OsAOX1a-RNAi and wild type (WT) rice seed during artificial aging treatment. Gain weight and P50 significantly decreased in OsAOX1a-RNAi rice seed, indicating that there might be impaired in seed development and storability. Compared to WT seeds in the 100%, 90%, 80%, and 70% germination, respectively, NADH and succinate-dependent O2 consumption, the activity mitochondrial malate dehydro-genase and ATP contents were decreased in OsAOX1a-RNAi seeds in the 100%, 90%, 80%, and 70% germination, respectively, indicating that mitochondrial status in the OsAOX1a-RNAi seeds after imbibition was weaken than the WT. In addition to, the reduced abundance of complex I N and P module subunits might showed that the capacity of mitochondrial electron transfer chain was significantly inhibited in the OsAOX1a-RNAi seed at critical node of seed viability. Above results might indicated that the ATP production was impaired in OsAOX1a-RNAi seeds during ageing. Therefore, we conclude that the activities of mitochondrial metabolism and alternative pathways were severely inhibited in OsAOX1a-RNAi seeds at critical node of viability, which was leading to accelerate the collapse of seed viability. The precise regulatory mechanism of the alternative pathway at the critical node of viability still needs to be further analyzed.

The ANFC/ABPE-10 composite film was prepared by ABPE-10 impregnating into ANFC films under negative pressure. And the composite film had meted high performance FOLED substrate requirement even when ANFC dosage was high for approximately 70%, which was consistent with for low cost efficiency, recyclability, and environmentally friendly. The enhanced properties of ANFC films were mainly because of the nature of ABPE-10 itself and the IPN structure formed between ABPE-10 and ANFC film. The transparency of composite films with different ANFC dosage was significantly increased from 67% to 88% by UV-Vis analysis. The composite film inherited the properties of AFNC, obtaining low CTE characteristics and ductile compact structure. The contact angles of ANFC films increased by 102% from 49.2° to 102.9°after dipping ABPE-10. Additionally, the composite films had outstanding mechanical properties such as tensile strength 173.72 MPa, Young’s modulus 4.06 GPa, and elongation at break 5.81%.

Xanthogranulomatous orchitis is a chronic, non-neoplastic inflammation that is quite rare. In this paper, we discuss the case of a 79-year-old male patient who presented with bilateral scrotum swelling and dysuria that persisted for two weeks. Despite two weeks of anti-infection treatment, the patient's symptoms persisted, leading to a decision to perform transurethral prostate resection and bilateral orchiectomy after careful consideration. After the surgery, the postoperative pathology indicated that the patient had xanthogranulomatous orchitis on the left side and acute positive orchitis with hemorrhage on the right side. Fortunately, three months after the procedure, the patient experienced no negative events and was pleased with the postoperative results.

Background: This study aimed to identify the association between occupational stress and depression-well-being by proposing a comprehensive and flexible job burden-capital model with its corresponding hypotheses. Methods: For this research, 1618 valid samples were gathered from the electronic manufacturing service industry in Hunan Province, China; self-rated questionnaires were administered to participants for data collection after obtaining their written consent. The proposed model was fitted and tested through structural equation model analysis. Results: Single-factor correlation analysis results indicated that coefficients between all items and dimensions had statistical significance. The final model demonstrated satisfactory global goodness of fit (CMIN/DF=5.37, AGFI=0.915, NNFI=0.945, IFI=0.952, RMSEA=0.052). Both the measurement and structural models showed acceptable path loadings. Job burden and capital were directly associated with depression and well-being or indirectly related to them through personality. Multi-group structural equation model analyses indicated general applicability of the proposed model to basic features of such a population. Gender, marriage and education led to differences in the relation between occupational stress and health outcomes. Conclusions: The job burden-capital model of occupational stress-depression and well-being was found to be more systematic and comprehensive than previous models.

The saphenous vein is the conduit of choice for bypass grafting. Unfortunately, the hemodynamic stress associated with the arterial environment of the bypass vein graft leads to the development of intimal hyperplasia (IH), an excessive cellular growth and collagen deposition that results in restenosis and secondary graft occlusion. Hydrogen sulfide (H2S) is a ubiquitous redox-modifying gasotransmitter that inhibits IH. H2S is produced via the reverse trans-sulfuration pathway by 3 enzymes: cystathionine γ-lyase (CSE), cystathionine β-synthase (CBS), and 3-mercaptopyruvate sulfurtransferase (3-MST). However, the expression and regulation of these enzymes in the human vasculature remains unclear. Here, we investigated the expression of CSE, CBS and 3-MST in segments of native human saphenous vein and large arteries. Furthermore, we evaluated the regulation of these enzymes in vein segments cultured under static, venous (7 mmHg pressure) or arterial (100 mmHg pressure) pressure. CSE was expressed in the media, neointima and intima of the vessels and was negatively regulated by arterial shear stress. Adenoviral-mediated CSE overexpression or RNA interference-mediated CSE knock-down revealed that CSE inhibited primary human VSMC migration but not proliferation. We propose that high shear stress in arteriovenous bypass grafts inhibits CSE expression in both the media and endothelium, which may contribute to increased VSMC migration in the context of IH.

Keywords: mHealth; peritoneal dialysis; functionality; usability

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Global dust events have become more frequent due to climate change and increased human activity, significantly impacting air quality and human health. Previous studies have often focused on simulating cross-regional dust transport based on atmospheric parameters; however, comprehensive monitoring of dust events remains challenging. Therefore, this study utilized Fengyun-4A (FY-4A) satellite Advanced Geostationary Radiation Imager (AGRI) imagery, Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observation (CALIPSO) lidar, and other auxiliary data to conduct three-dimensional spatiotemporal monitoring and cross-regional transport analysis of two typical dust events in the Beijing–Tianjin–Hebei (BTH) region of China using four dust intensity indices (Icsd, Dust Detection Index (DDI), Dust value (DV), and Dust Strength Index (DSI)) and the HYSPLIT model. We found that among the four indices, DDI was the most suitable for studying dust in the BTH region, with a detection accuracy (POCD) of > 88% at all times and reaching a maximum of 96.14%. Both the 2021 and 2023 dust events originated from large-scale deforestation in southern Mongolia and the border area of Inner Mongolia, with dust plumes distributed between 2 and 12 km being transported across regions to the BTH area. Further, when dust aerosols are primarily concentrated below 4 km and PM10 concentrations consistently exceed 600 µg/m³, large dust storms are more likely to occur in the BTH region. The findings of this study provide valuable insights into the sources, transport pathways, and environmental impacts of dust aerosols.

Cathode materials play a key role in the development and application of lithium-ion batteries, but the unfavorable factors such as structural phase transformation and low conductivity in the cycling process restrict the further improvement of battery performance, so the development and modification of high-performance cathode materials is a current research hotspot. LiNixCoyMn1-x-yO2(x≥0.6), a high-nickel cathode material, has the advantages of high platform potential, high energy density and low cost, and is an ideal material to achieve the goal of 300 Wh kg-1 and above for batteries. However, its poor thermal stability, poor interface stability, safety and life cannot meet the requirements of current power batteries. In this paper, the research status of high-nickel cathode materials is introduced, including bulk doping and surface coating, and the modification method of doping and coating integration is also introduced. Finally, we put forward the prospect of the future development trend of high-nickel cathode materials.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

Allergic diseases are becoming a major healthcare issue in many developed nations, where living environment and lifestyle are most predominantly distinct. Such differences include urbanized, industrialized living environments, overused hygiene products, antibiotics, stationary lifestyle, and fast-food based diets tend to reduce microbial diversity and lead to impared immune protection, which further increase the development of allergic diseases. In the same time, studies also showed that modulating microbiomes can ameliorate allergic symptoms. Therefore, in this paper, we aimed to review recent findings on the potential role of the human microbiome in the gastrointestinal tract, surface of skin and respiratory tract for the development of allergic diseases. Furthermore, we addressed a potential therapeutic or even preventive strategy for such allergic diseases by modulating the human microbial composition.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

Abstract—Hydraulic switching actuators are high efficiency, fast response, and low cost solutions for hydraulic control systems. One of the challenging problems is throttling losses during valve transitions. Previously the authors proposed a zero-flowrate switching method to reduce throttling energy loss of the switching valve, where a hydraulic resonator is applied to make the flowrates through the lines approaching zero before the valves are switched off. The major challenge of this approach is fast switching valves whose transition times are less than 2 ms. In this paper, an improved zero-flowrate switching method is presented. It utilizes the capacity with independent inlet/outlet ports to regulate flowrates through the lines. Models of capacity applied in a simple line with different pressure signals are developed to explore characteristics of the capacity, based on which a complete actuation system is developed. In the complete model, resistance and inductance are optimized to achieve desired flowrate response. The improved zero-flowrate switching method reduces throttling energy losses by 99.945% compared to a hard switching system. The simulation results demonstrated that the improved zero-flowrate switching method performs as expected in the design condition. A capacity with proper volume is able to regulate flowrates through all the lines to zero, with the help of appropriate resistance and inductance. Compared to previous zero-flowrate switching method, the novel strategy allows slower switching valves applied in hydraulic actuation systems and achieves better efficiency performance. This research paves a new avenue for reducing throttling energy losses and improves system efficiency in hydraulic switching actuators, as well as most of the hydraulic switch-mode circuits.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

The Songpan-Ganze Orogenic Belt (SGOB) is bounded by the South China, North China, and Qiang-tang blocks and forms the eastern margin of the Tibetan Plateau. The Tiechanghe granite is located at the junction of the southeast margin of the SGOB and the western margin of the Yangtze Block. To elucidate the genetic relationship between the Tiechanghe granite and the surrounding molybdenum deposits in Western Sichuan, in this study, we conducted U-Pb zircon and molybdenite Re-Os isotopic dating. The results indicate that the Tiechanghe granite predominantly consists of monzogranite, with minor occur-rences of syenogranite, while the molybdenum deposits are mainly found in skarn and quartz veins. The laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) U-Pb zircon ages of the Tiechanghe granite range from 162.9±0.7 Ma to 163.4±0.6 Ma, and the zircon LA-ICP-MS U-Pb age of the pegmatite veins is 164.1±0.9 Ma. These ages are consistent with the weighted average Re-Os age of the Ziershi molybdenite (160.3±1.6 Ma) within the error margins. These findings and previously ob-tained magmatic and metallogenic ages for the region suggest that a magmatic and mineralization event involving granite, molybdenum, tungsten, and copper occurred at around 162–164 Ma in the study area. This discovery broadens the exploration perspective for mineral resources in the Jiulong area of Western Sichuan and the entirety of Western Sichuan.

Li-rich manganese-based cathode materials (LRMs) are considered one of the most promising cathode materials for the next generation lithium-ion batteries (LIBs) because of their high energy density. However, there are problems such as capacity decay, poor rate performance, and continuous voltage drop, which seriously limit their large-scale commercial applications. In this work, Li1.2Mn0.54Co0.13Ni0.13O2 coated with Li2MoO4 with unique spinel structure was prepared by wet chemistry method and the subsequent calcination process. The Li2MoO4 coating layer with spinel structure can provide a 3D Li+ transport channel, which is beneficial for improving rate performance, while protecting LRMs from electrolyte corrosion, suppressing interface side reactions, and improving cycling stability. The capacity retention rate of LRMs coated with 3wt% Li2MoO4 increased from 69.25% to 81.85% after 100 cycles at 1C, and the voltage attenuation decreased from 7.06 to 4.98 mV per cycle. The lower Rct also exhibits improved magnification performance. The results indicate that the Li2MoO4 coating effectively improves the cyclic stability and electrochemical performance of LRMs.

The exponential growth of digital media content has introduced new challenges in managing and classifying internet traffic. Digital media traffic is composed of various applications such as video, audio, social media, and search, and its data structure is complex, incorporating a vast array of features. The classification of traffic data is a crucial aspect of internet traffic management and network security, and it forms the basis for several scenarios, including content distribution, advertising recommendations, and data analysis. Traditional classification methods rely mainly on deep packet inspection and port-based techniques, which have become increasingly ineffective due to the rapid evolution of network traffic. To address this issue, this study proposes a machine learning-based traffic classification method aimed at enhancing the accuracy and efficiency of digital media traffic classification to meet the current needs of traffic management and network security. The paper also analyzes and evaluates the classification effect and prediction capability of various algorithms under different training set sizes to validate the feasibility and effectiveness of the proposed method. The result demonstrates that the neural network algorithm has superior classification and prediction capabilities compared to the decision tree and support vector machine algorithms. Furthermore, our proposed method achieves the highest accuracy of 96.88% with a large training sample of 40,000 data streams, proving its superiority in handling high-dimensional data and complex datasets. The research results are significant for the development of digital media traffic classification and prediction methods and are expected to be applied in practical scenarios.

MicroRNAs (miRNAs) are a class of small non-coding RNAs, which function as regulators of gene expression and contribute in numerous physiological processes. However, little is known referring to miRNAs function in insect chemosensation. In the current study, nine small RNA libraries were constructed and sequenced from the antennae of nymphs, adult males and females of Apolygus lucorum. In total, 399 miRNAs were identified including 275 known and 124 novel miRNAs. Known miRNAs were classified into 71 families, amongst which, 23 families were insect-specific. Expression profile analysis showed that miR-7-5p_1 was the most abundant miRNAs in the antennae of A. lucorum. Altogether, 69708 target genes related to biogenesis, membrane and binding activities were predicted for 399 miRNAs. Particularly, 15 miRNAs were found to target 16 olfactory genes. These miRNAs could be involved in regulation of olfactory-associated genes ex-pression. Comparing the antennae of nymphs, adult males and females, 94 miRNAs were found to be differentially expressed. The expression levels of some differentially expressed miRNAs measured by qPCR were consistent with sequencing results. This study provides a global miRNAs transcriptome in the antennae of A. lucorum and valuable information for further investigation on miRNA-mRNA interactions, especially the functions of miRNAs in regulating chemosensation.

As the first pilot ecological civilization zone in China, Fujian Province has an excellent ecological environment quality, and its ecological environment-related indices continue to be among the highest in the country. In order to investigate the causes of the excellent ecological quality in Fujian Province in the past 15 years, this paper selects MODIS images, land use data and provincial and municipal statistical yearbook data of Fujian province from 2005 to 2020 as data sources, evaluates the ecological system health of Fujian Province by remote-sensing ecological index (i.e. RSEI), constructs the land use intensity system of Fujian Province at the same time, and uses a coupled coordination model to analyze the coupling between RSEI and The coupled coordination model was used to analyze the coupling relationship between RSEI and land use intensity, and finally the spatial and temporal evolution of ecological health in Fujian Province from 2005 to 2020 was analyzed. The results show that the coupled coordination between land use intensity and ecosystem health in Fujian province showed a continuous increase between 2005 and 2020, especially in Ningde, where the increase was most significant, from 0.0993 to 0.963, this pattern of spatial distribution is lower in the south-eastern coastal region than in the north-western interior, higher in the south-western region than in the north-western region, and higher in the north-eastern region than in the south-eastern region. In terms of the type of role, the land use intensity of most cities in Fujian Province in 2005 played an obvious role in blocking the degree of ecosystem health, but as time changed, urban land use continued to be optimized and reached moderate or even high quality coordination with the quality of the ecological environment, but Xiamen City developed relatively slowly and its 2020 coupling degree value was 0.315, which was still in mild disorder. This study fills a gap in the research mechanism of the interaction between the degree of ecosystem health and land use intensity, and also provides a new perspective for the construction of ecological civilization and the assessment of the degree of ecosystem health in Fujian Province and the whole country.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

The survey findings reveal that rivers worldwide carry an annual sediment load of 15 billion tons into the sea, and the Yellow River basin alone contributes 1.6 billion tons of sand. Therefore, understanding the science of wind and sand in the Yellow River is crucial to ensuring the safe development of similar basins across China and the world. This study examines the midstream wind and sand area of the Xiliugou tributary, a part of the upper Yellow River. The researchers used a stepped sand collector combined with an anemometer to measure the sand transport flux at 0-50 cm height on various underlying surfaces of the basin. Then, they estimated the amount of wind and sand entering the Yellow River using a function model based on the measured factors. Furthermore, the team analyzed the particle size composition of wind-eroded sand to better understand the principles of wind and sand erosion and accumulation in the basin. The results of the study show that the sand transport flux per unit area varies significantly across different underlying surfaces. Moreover, the contribution of moving sandy land, semi-fixed sand, and fixed sand to wind and sand deposition in the Yellow River basin was 77.08%, 15.30%, and 7.62%, respectively. The vertical change of sand transport rate on the basin's surface demonstrates that the total sand transport rate is an exponential function of wind speed. Based on this relationship, the researchers estimated that the total annual average wind and sand entering the Yellow River basin via the Xiliugou tributary is approximately 8.09×105t. Due to the basin's unique geography and sand source, the particle size composition of wind-eroded sand differs between the east and west sides of the river channel. On the west side, desert sand, mainly fine sand, and very fine sand constitutes the sand source. Conversely, on the east side, sand collected in the riverbed by secondary wind erosion is the primary sand source. Furthermore, human activities have disturbed the grain composition, mainly comprising powder and clay particles. This phenomenon, known as "wind-blown mud and water-washed sand," is evident in this geographical unit. In conclusion, the Yellow River basin still faces significant ecological security hazards. Understanding the coupling relationship between desert-basin-sand and wind is the foundation for effectively controlling wind and sand flow into the Yellow River basin.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

A series of novel sulfonylurea benzothiazoline were designed by splicing active groups and bioisosterism. A solvent-free synthetic route was developed for the sulfonylurea benzothiazoline derivatives via the cyclization and carbamylation. All the compounds were characterized by IR, 1H-NMR, 13C-NMR, HRMS. The biological activity tests indicated the compounds could protect maize against the injury caused by chlorsulfuron to some extent. The molecular docking result showed that the new compound competed with chlorosulfuron to bind with the herbicide target enzyme active site to attain detoxification.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Communication infrastructures may be partially or completely destroyed due to the natural disasters, especially the disruption of a few critical network devices, leading to the collapse of communication services.To address this issue, we constructed a layered, multi-domain data transmission architecture based on a UAV-assisted resilient network. Initially, the UAV controllers perceived the network status and learning the temporal- spatial characteristics of air-to-ground networks links. Subsequently, we developed a multi-domain routing algorithm based on federated reinforcement distillation, called FedRDR, enhancing the generalization capabilities of routing decision model through the augmentation of training data samples.We conducted simulation experiments, and the results indicate that the FedRDR algorithm has an average communication data volume of approximately 45.3KB between each domain controller and server. Compared to parameter transmission through the federated reinforcement learning algorithm, FedRDR can reduce the amount of transmitted parameters by approximately 29\%. Therefore, the FedRDR routing algorithm promotes knowledge transfer, accelerates the training process of intra-domain intelligent agents, and decreases the communication data volume between domain controllers and servers.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (&gt;90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

In this paper, we present a full coverage path planning (CPP) algorithm for the marine surveys conducted in the convex polygon shaped search area. The survey is supposed to carry out by torpedo-type AUVs (autonomous underwater vehicles). Due to their nonholonomic mechanical characteristics, these vehicles have nonzero minimum turning radius. For any given polygon shaped search area, it can always be partitioned into one or more convex polygons. With this in mind, this paper proposes a novel search algorithm called CbSPSA (Calculation based Shortest Path Search Algorithm) for full coverage of any given convex polygon shaped search area. By aligning the search inter-tracks alongside the edge with the minimum height, we can guarantee the minimum number of the vehicle’s turns. In addition, the proposed method can guarantee the planned path is strictly located inside the polygon area without overlapped or crossed path lines, and also has the total path length as short as possible. Considering the vehicle’s nonzero minimum turning radius, we also propose a sort of smoothing algorithm to smooth the waypoint path searched by CbSPSA so as for the vehicle to exactly follow it. The smoothed path is also guaranteed to be strictly located inside the polygon. Numerical simulation analyses are also carried out to verify the effectiveness of the proposed schemes.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

Percutaneous kyphoplasty (PKP) is a highly successful treatment option for Kümmell's disease (KD). Due to the obstruction of the fibrocartilaginous membrane at the periphery of the intervertebral vacuum cleft (IVC) and inadequate osteointegration of conventional bone cement, there is insufficient locking strength between trabecular bone and bone cement in Kümmell's disease (KD), leading to postoperative displacement of the bone cement and sub-sequent early surgical failure. However, there is no standard strategy managing this complica-tion at present. We reported a rare case of premature bone cement displacement resulting in adjacent vertebra fracture. An 80-year-old male with Kümmell's disease at T10 received per-cutaneous kyphoplasty (PKP) with bone cement leaking into the upper disc. Only 3 days after the surgery, the patient complained of severe back pain again. X-ray and MRI showed bone cement displacement at T10, adjacent vertebra fracture at T9. In consideration of poor toler-ance of open surgery for the old patient, we successfully revised by using percutaneous ky-phoplasty with multi-point anchoring technique (A-PKP). During a 10-month postoperative follow-up, the patient reported pain relief. X-ray and three-dimensional CT scan revealed no obvious progress of bone cement displacement. Although the exact mechanism underlying this rare complication remains unclear, we observed that the premature bone cement dis-placement can result in adjacent vertebra fracture especially when the pattern of bone cement is blocky. Percutaneous kyphoplasty with multi-point anchoring technique (A-PKP) appears effective in managing this complication.

A switchable and tunable terahertz (THz) metamaterial based on photosensitive silicon and Vanadium dioxide (VO2) was proposed. By using finite-difference time-domain (FDTD) method, the transmission and reflective properties of the metamaterial were investigated theoretically. The results imply that, the metamaterial can realize a dual electromagnetically induced transparency (EIT) or two narrow-band absorption depending on the temperature of the VO2. Additionally, the magnitude of the EIT and two narrow-band absorption can be tuned by varying the conductivity of photosensitive silicon (PSi) via pumping light. Correspondingly, the slow light effect accompanying the EIT can also be adjusted.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Air pollution is an important factor affecting human health and daily life. Chinese government is making vigorous efforts to control air pollution. The upgrading of industrial structure is a problem-solving tool in environment and economic growth cases. This paper aims to explore the relationships among environmental regulation, the upgrading of industrial structure and air pollution. The PVAR (Panel Vector Auto Regression) model and moderation effect model has been used to conduct empirical analysis based on panel data of 30 provinces in China from 2004 to 2020. The results of analysis indicate (1) the environmental regulation can significantly reduce the air pollution, but the deterioration of air quality could not effectively influence environmental regulations. (2) The upgrading of industrial structure can weaken the air pollution and air pollution hinders the upgrading of industrial structure. (3) With the improvement of environmental regulation, the industrial structure is constantly upgraded, but the upgrading of the industrial structure has a negative effect on the improvement of environmental regulation. (4) The upgrading of industrial structure can positively moderate the influence of environmental regulation on air pollution.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Reeling from the global supply chain crisis created by the COVID-19 pandemic, the maritime industry still faces multifaceted challenges for its sustainable survival. Those challenges include shifts in trade routes, congestion at major seaports, container shortages, volatility in fuel prices, the scarcity of skilled maritime labor, and potential technical glitches stemming from digitized maritime operations. To help the maritime industry handle these challenges, this paper identifies major drivers and deterrents that affect the efficiency of ocean carriers’ performances over time using two different versions of data envelopment analysis (DEA) models and the Malmquist Productivity Index (MPI). After evaluating the operating efficiencies of multinational ocean carriers across the globe over extended periods (pre- and post-pandemic periods), we developed a benchmark standard that can guide best-in-class sustainable maritime practices.

Machine learning has gained significant recognition within healthcare organizations as a potent technology for medical image analytics. Among various medical image modalities, Contrast-Enhanced CT (CECT) is widely utilized to acquire additional diagnostic information that can help to better visualize and evaluate certain structures or abnormalities in the human body. Accordingly, there is an increasing demand for machine learning systems for disease analytics using CECT. However, developing such systems presents two significant challenges: high technical complexity and high development effort. This paper presents a software platform that can effectively remedy these challenges. This platform embodies a unified software process for CECT-specific disease diagnosis including oncological diseases, cardiovascular diseases, and gastrointestinal diseases. It integrates multiple types of machine learning models into the disease diagnosis process, where the models can diagnose lesions, malignancies, tumors, medical features of tumors, temporal transitions with a contrast agent, and disease progress. The platform has been implemented in Python using Scikit-learn and TensorFlow libraries. To validate its applicability and reusability, a Hepatocellular Carcinoma (HCC) diagnosis system has been implemented.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

Lipid nanoparticles (LNPs) have attracted extensive attention in tumor immunotherapy in recent years. The strategy of targeting immune cells in cancer therapy has become a research area of great interest. mRNA vaccines are a potential choice for tumor immunotherapy due to their ability to directly encode antigen proteins and stimulate a strong immune response. However, the mode of delivery and lack of stability of mRNA are key issues limiting its application. LNPs are an excellent mRNA delivery vector, and their structural stability and biocompatibility make them an effective means to deliver mRNA to specific targets. This study summarizes the research progress in LNP delivery vector-assisted targeted controlled release mRNA vaccines in tumor immunity. The role of LNPs in improving mRNA stability, immunogenicity and targeting is discussed. In addition, combined with the cutting-edge research results, the potential mechanisms and application prospects of LNP-mRNA vaccines in tumor immunotherapy were further analyzed. This review aims to systematically summarize the latest research progress in LNP delivery carrier-assisted targeted controlled-release mRNA vaccines in tumor immunity to provide new ideas and strategies for tumor immunotherapy and provide more effective treatment plans for patients.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Maternal obesity and gestational diabetes mellitus (GDM) are linked with impaired placental function and early onset of non-communicable cardiometabolic diseases in offspring. Previous studies have highlighted that the dietary non-esterified fatty acids (NEFAs), palmitate (PA) and oleate (OA), key dietary metabolites associated with maternal obesity and GDM, are potential modulators of placental lipid processing. Using the BeWo cell line model, the current study integrated transcriptomic (mRNA microarray), metabolomic, and lipidomic readouts to characterize the underlying impacts of exogenous PA and OA on placental villous trophoblast cell metabolism. Targeted gas chromatography and thin layer chromatography highlighted that saturated and monounsaturated NEFAs differentially impact BeWo cell lipid profiles. Furthermore, cellular lipid profiles differed when exposed to single and multiple NEFA species. Additional multi-omic analyses suggested that PA exposure is associated with enrichment in β-oxidation pathways, while OA exposure is associated with enrichment in anti-inflammatory and antioxidant pathways. Overall, this study further demonstrated that dietary PA and OA are important regulators of placental lipid metabolism. Encouraging appropriate dietary advise and implementing dietary interventions that maintain appropriate placental function by limiting excessive exposure to saturated NEFAs such as PA, will continue to be crucial in the clinical management of at-risk obese and GDM pregnancies.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

In this paper, a sensitivity sensor of dual-core photonic crystal fiber (DC-PCF) filled with magnetic liquid is introduced and investigated by the finite element method (FEM). To regulate the energy coupling involving the two cores, the magnetic fluid is filled into the pore between the two cores. To adjust the coupling between the supermodes in the DC-PCF, the refractive index of the magnetic fluid-filled air hole may change due to the external magnetic field. This specifically created a magnetic fluid-filled DC-PCF, the magnetic fluid-filled hole is not used as the core for energy transmission, thus avoiding transmission loss. The dip wavelength and the magnetic field displayed an excellent linear connection between 80 and 260 Oe, depending on the numerical data. The detection sensitivity of the magnetic field reached 515.75 pm/Oe at a short fiber length of 482 m. The designed magnetic fluid-filled DC-PCF has high sensitivity and small volume and has great application prospects in medical and industrial field magnetic field detection.

Reinforcement Learning (RL) has demonstrated considerable potential in solving challenges across various domains, notably in autonomous driving. Nevertheless, implementing RL in autonomous driving comes with its own set of difficulties, such as the overestimation phenomenon, extensive learning time, and sparse reward problems. Although solutions like Hindsight Experience Replay (HER) have been proposed to alleviate these issues, the direct utilization of RL in autonomous vehicles remains constrained due to the intricate fusion of information and the possibility of system failures during the learning process. In this paper, we present a novel RL-based autonomous driving system technology that combines Obstacle Dependent Gaussian (ODG) RL, Soft Actor-Critic (SAC), and meta-learning algorithms. Our approach addresses key issues in RL, including the overestimation phenomenon and sparse reward problems, by incorporating prior knowledge derived from the ODG algorithm. We evaluated our proposed algorithm on official F1 circuits, using high-fidelity racing simulations with complex dynamics. The results demonstrate exceptional performance, with our method achieving up to 89% faster learning speed compared to existing algorithms in these environments.

The effects of reaction temperature, reaction time, heating rate, nitrogen flow rate and catalyst quality on the oil yield and oxygen content in the oil were investigated by using the single factor principle. Too high and too low reaction temperature, nitrogen flow rate, heating rate and reaction time have improved the yield of bio-oil, but the oxygen content in bio-oil is higher. The reduction of catalytic dose is beneficial to the increase of oil yield but not conducive to the increase of aromatic compound content. The optimal reaction conditions were observed as reaction temperature of 500℃, nitrogen flow rate of 110 mL/min, heating rate of 20℃/min, reaction time of 15min, mass ratio of catalyst to coconut coat powder was 1, and the oil yield was 4.97%, aquatic yield was 35.80%, and solid yield was 30.78%. The gas yield was 28.45%, the oxygen content was 10.3%, and the aromatic compound content was 89.7%.The analysis of catalytic cracking mechanism shows that most of the oxygen-containing compounds in the bio-oil are generated into water and aromatic compounds by catalytic cracking reaction at high temperature, thus removing oxygen.

In this paper, we investigate the new degenerate Daehee polynomials and numbers which are called the degenerate Daehee polynomials of the second kind, and derive some new and interesting identities and properties of those polynomials.

As human activities of the countries in the East Asia have been remarkably expanding over recent decades, various problems in relation to ships, such as oil spill and many other coastal marine pollution, are continuously occurring in the coastal region. In order to conserve marine resources and prepare for possible ship accidents in advance, the need for efficient ship management is increasing over time. Multi-satellite, multi-sensor, multi-wavelength or multi-frequency observations make it possible to monitor a variety of vessels in the coastal region. This study presents the results of ship detection methodology applied to multi-spectral satellite images in the seas around Korean Peninsula based on optical, hyperspectral, and microwave remote sensing. To detect ships from hyperspectral images with a few hundreds of spectral channels, spectral matching algorithms are used to investigate similarity between the spectra and in-situ measurements. In the case of SAR (Synthetic Aperture Radar) images, the Constant False Alarm Rate (CFAR) algorithm is used to discriminate the vessels from backscattering coefficients of Sentinel-1 SAR and ALOS-2 PALSAR2 images. The present ship detection methods can be extensively utilized for optical, hyperspectral, and SAR images for comprehensive coastal management purposes toward perpetual sustainability in the future.

Background: Ice formation on power transmission lines presents significant risks, including structural damage and power outages. Traditional methods for detecting ice on these lines have limitations, particularly in challenging environmental conditions. This study aims to enhance ice detection accuracy by introducing a novel image segmentation and edge detection methodology using improved multi-scale Retinex and advanced morphological operations. Method: The proposed method integrates multi-stage image processing techniques, including image enhancement, grayscale conversion, thresholding, segmentation, object isolation, and edge detection. High-resolution binocular cameras were used to capture images of ice formations on transmission lines. The effectiveness of the method was assessed through a series of metrics, including accuracy, sensitivity, specificity, and precision, and compared with existing methodologies. Results: The proposed method demonstrated superior performance in both ice detection and thickness measurement. The method effectively identified and isolated ice formations under various conditions with an average accuracy of 98.35%, sensitivity of 91.63%, specificity of 99.42%, and precision of 96.03%. Additionally, the analysis of ice thickness measurements further highlighted the method’s accuracy, with a notably low root mean squared error (RMSE) of 1.20 mm and mean absolute error (MAE) of 1.10 mm, along with a strong R-squared value of 0.95. These statistical metrics show that the proposed method not only outperforms previous methods in consistency and alignment with manual measurements but also stands out as the most reliable option for tasks requiring precise measurements, offering significant advancements in accuracy and reliability over existing methodologies. Conclusions: The enhanced image segmentation and edge detection approach provides a more accurate and reliable method for monitoring ice formations on power transmission lines.

Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

The Android-based IoT platform just like the existing Android provides an environment that makes it easy to utilize Google's infrastructure services including development tools and APIs through which it helps to control the sensors of IoT devices. Applications running on the Android-based IoT platform are often UI free and are used without the user’s consent to registered permissions. It is difficult to respond to the misuse of permissions as well as to check them when they are registered indiscriminately while updating applications. This paper analyzes the versions of before and after an application the update running on the Android-based IoT platform and the collected permission lists. It aims to identify the same permissions before and after the update, and deleted and newly added permissions after the update were identified, and thereby respond to security threats that can arise from the permissions that is not needed for IoT devices to perform certain functions.

Diatomite (DME) consists of natural ordered porous structures that are excellent candidates as microcontainers. However, to the best of our knowledge, the application of DME loaded with corrosion inhibitors in anti-corrosion coatings has not hitherto been reported. In this study, DME has been used as a source of microcontainers to load benzotriazole (BTA) inhibitor by an immersion method. In order to prevent unwanted early release of the small molecule BTA inhibitor from the DME microcontainers, inspired by the adhesion characteristics of catechol and amine in mussel adhesion protein, polydopamine (PDA) was coated on their surfaces to generate BTA@DME/PDA microcapsules. Because of the depolymerization characteristics of PDA at low pH, the synthesize microcapsules showed a controllable release function. The SEM morphology, chemical structure, and loading capacity of the synthesized BTA@DME/PDA microcapsules were characterized. The corrosion resistances of epoxy coatings with different contents of BTA@DME/PDA microcapsules were compared by saline immersion and electrochemical impedance tests. A scratched coating with 5wt.% BTA@DME/PDA microcapsules showed the best anti-corrosion effect.

Goal-conditioned reinforcement learning (RL) holds promise for addressing intricate control challenges by enabling agents to learn and execute desired skills through separate decision modules. However, the irregular occurrence of required skills poses a significant challenge to effective learning. In this paper, we demonstrate the detrimental effects of this imbalanced skill(sub-goal) distribution and propose a novel training approach, Classified Experience Replay (CER), designed to mitigate this challenge. We demonstrate that adapting our method to conventional RL methods significantly enhances the performance of the RL agent. Considering the challenges inherent in tasks such as driving, characterized by biased occurrences of required sub-goals, our study demonstrates the improvement in trained outcomes facilitated by the proposed method. In addition, we introduce a specialized framework tailored for self-driving tasks on highways, integrating Model Predictive Control (MPC) into our RL trajectory optimization training paradigm. Our approach, utilizing CER with the suggested framework, yields remarkable advancements in trajectory optimization for RL agents operating in highway environments.

In recent years, demand has been increasing for target detection and tracking from aerial imagery via drones using onboard powered sensors and devices. We propose a very effective method for this application based on a deep learning framework. A state-of-art embedded hardware system empowers small flying robots to carry out the real-time onboard computation necessary for object tracking. Two types of embedded modules were developed: one is designed using a Jetson TX or AGX Xavier, and the other is based on an Intel Neural Compute Stick. These are suitable for real-time onboard computing power on small flying drones with limited space. A comparative analysis of current state-of-art deep-learning-based multi-object detection algorithms was carried out utilizing the designated GPU-based embedded computing modules to obtain detailed metric data about frame rates as well as the computation power. We also introduce an effective target tracking approach for moving objects. The algorithm for tracking moving objects is based on the extension of simple online and real-time tracking. It was developed by integrating a deep-learning-based association metric approach (Deep SORT), which uses a hypothesis tracking methodology with Kalman filtering and a deep-learning-based association metric. In addition, a guidance system that tracks the target position using a GPU-based algorithm is introduced. Finally, we demonstrate the effectiveness of the proposed algorithms by real-time experiments with a small multi-rotor drone.