Background: Gastric cancer (GC) is the second most prevalent cancer in Korea, significantly impacting morbidity and mortality. While advancements in early detection and treatment have improved survival rates, managing post-surgical recovery remains vital. Herbal medicine (HM) has emerged as a potential adjunct therapy to enhance recovery and quality of life (QoL) in patients post-GC surgery. Methods: This systematic review and meta-analysis evaluated the efficacy and safety of HM in the post-surgical recovery of GC patients. We searched both Korean and international databases, identifying 16 randomized controlled trials (RCTs) meeting our criteria. We assessed study quality using the Cochrane Risk of Bias tool and analyzed data with Review Manager Software (RevMan). Results: Our analysis included 1,546 patients from the selected studies, demonstrating that HM significantly improved gastrointestinal recovery times, including time to first flatus, bowel movement, and return of bowel sounds. Significant improvements were also seen in nutritional markers such as albumin and prealbumin, alongside beneficial effects on immune markers like CD3+ and CD4+ levels. QoL assessments using WHOQOL-BREF and QLQ-C30 scores indicated substantial improvements. HM had a favorable safety profile, showing a reduced incidence of adverse effects compared to controls. Conclusion: The findings suggest that HM can significantly enhance recovery and improve the quality of life following gastric cancer surgery, with a favorable safety profile. However, due to considerable heterogeneity in study results, extended clinical trials and rigorous follow-ups are recommended to assess long-term effects and side effects comprehensively.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

This study investigated the effects of whole-body circuit training using a weighted vest on plasma resistin, cardiovascular disease risk factors, and cardiorespiratory fitness for normal-weight obese women. In this study, thirty- six normal-weight obese women were divided into three groups: Weighted Vest Circuit Training (WVCT) (n = 12), Body Weight Circuit Training (BWCT) (n = 12), and Control (CON) (n = 12). Whole-body circuit training was conducted three times a week for eight weeks to compare and analyze plasma resistin, cardiovascular disease risk factors, and cardiorespiratory fitness before and after training. Although there was no significant baseline difference between the groups regarding skeletal muscle mass, it significantly increased for the WVCT group after eight weeks. percent body fat significantly decreased for the WVCT and BWCT groups, and there was a significant difference when the percent body fat of these two groups were compared to that of the control group. Moreover, the WVCT and BWCT groups displayed a significant decrease in plasma resistin, showing a significant difference from the CON group. The WVCT and BWCT group showed a significant decrease in plasma IL-6, whereas the CON group showed a significant increase. VO2max significantly increased post-training compared to before in the BWCT group and the WVCT group, and the WVCT group showed differences between groups compared to the BWCT group and the CON group. None of the three groups displayed significant changes in plasma hs-CRP, yet there was a significant difference between the hs-CRPs of the WVCT and BWCT group and that of the CON group. In conclusion, whole-body circuit training using a weighted vest efficiently improves body composition, plasma resistin, and cardiopulmonary fitness, reducing cardiovascular disease risk factors in normal-weight obese women.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

Retinal apoptosis plays a critical role in the progression of diabetic retinopathy (DR), a common diabetic complication. Currently, the tight control of blood glucose levels is the standard approach to prevent or delay the progression of DR. However, prevalence of DR among diabetic patients remains high. Focusing on natural nutrients or herbal medicines that can prevent or delay the onset of diabetic complications, we administered an ethanol extract of the aerial portion of Osteomeles Schwerinae (OSSCE), a Chinese herbal medicine, over a period of 17 weeks to spontaneously diabetic Torii (SDT) rats. OSSCE was found to ameliorate retinal apoptosis through the regulation of advanced glycation end products (AGEs) accumulation, oxidative stress, and mitochondrial function via inhibition of NF-κB activity, in turn through the downregulation of PKCδ, P47phox, and ERK1/2. We further demonstrated in 25 mM glucose-treated human retinal microvascular endothelial cells (HRMECs) that hyperoside (3-O-galactoside-quercetin), quercitrin (3-O-rhamnoside-quercetin), and 2''-O-acetylvitexin (8-C-(2''-O-acetyl-glucoside)-apigenin) were the active components of OSSCE that mediated its pharmacological action. Our results provide evidence that OSSCE is a powerful agent that may directly mediate a delay in development or disease improvement in patients of DR.

In this paper, we proposed a novel saddle type FinFET (S-FinFET) to effectively solve problems occurring under the capacitor node of dynamic random-access memory (DRAM) cell and showed how its structure was superior to conventional S-FinFETs in terms of short channel effect (SCE), subthreshold slope (SS), and gate-induced drain leakage (GIDL). The proposed FinFET exhibited 4 times lower Ioff than modified S-FinFET called RFinFET with more improved DIBL characteristics while minimizing Ion reduction compared to RFinFET. Our results also confirmed that the proposed device showed improved DIBL and Ioff characteristics as gate channel length decreased.

The beautiful and stable posture is essential for ballet. Especially the pirouette which dancers balance themselves on their one leg is one of the most impressive postures. During the pirouette motion, loads from the rotation and the body weight are concentrated to the one leg. Proper ballet shoes can reduce the muscle burden and improve the stability. Four types of shoes; bare feet, running shoes, pointe shoes, and dance sneakers are analyzed. The motion capture system and SIMM are used for the analysis of muscle burden and stability during pirouette. The major 6 muscles in the leg (beceps femoris long head, beceps femoris short head, soleus, rectus femoris, gastrocnemius medialis, and gastrocnemius lateralis) are analyzed, and the effect of rotating velocity is considered. Dance sneakers are outstanding for improving the stability and lessening the muscle burdens in all conditions for beginners. That comes from the design feature of the divided shoe soles and protecting the ankle of the axis leg. With the results and analysis, the direction for design optimization of ballet shoes is suggested. Consequently, this research is about the verification of sports equipment using computer simulation with the musculoskeletal model from a scientific viewpoint of biomechanics.

The geographical environment, food culture, and dietary habits are substantially different between the southern and northern regions in China. We investigated the associations with dietary patterns and metabolic syndrome between Chinese adult from the southern and northern regions (North: 1249; South: 1849) using data from the Chinese Health and Nutrition 2009 survey. Respectively, four dietary patterns were identified by factor analysis in the two regions. Each dietary pattern of factor score was calculated for three groups by tertile (T1<T2<T3). In the northern region, the association between the Alcohol and Western pattern and the risk of abdominal obesity (OR: 1.31; 95%:1.01, 1.68), hypertriglyceridemia (OR: 1.35; 95%:1.05, 1.74), high fasting blood glucose (OR: 1.37; 95%: 1.05, 1.80), and hypertension (OR: 1.55; 95%: 1.45, 1.99) was increased. In the southern region, the Convenience Food pattern was positively associated with hypertriglyceridemia (OR: 1.53; 95%: 1.03, 2.26), low HDL-cholesterol (OR: 1.96; 95%: 1.12, 3.43), and metabolic syndrome (OR: 1.79; 95%: 1.03, 3.11). The Alcohol dietary pattern was positively associated with high fasting blood glucose (OR: 1.83, 95%: 1.13, 2.97). There are some dietary pattern differences in the two regions. It is necessary to consider the factors of food culture and food intake habits in order to provide nutrition education to Chinese individuals from different regions in the future.

Surface area and pore size distribution of Eucalyptus samples pretreated by different methods were determined by the Brunauer-Emmett-Teller (BET) technique. Three methods were applied to prepare cellulosic biomass samples for BET measurements: air, freeze, and critical point drying (CPD). Air and freeze drying caused severe collapse of biomass pore structures, but CPD effectively preserved biomass morphology. Surface area of CPD prepared Eucalyptus samples was determined to be 58–161 m2/g, whereas air and freeze dried samples were 0.5–1.3 and 1.0–2.4 m2/g, respectively. Average pore diameter of CPD prepared Eucalyptus samples were 61–70Å. CPD preserved Eucalyptus sample morphology by replacing water with a non-polar solvent, CO2 fluid, which prevented hydrogen bond reformation in the cellulose.

The chemopreventive effects of various mixed cereal grain (MCG) samples on azoxymethane (AOM, 10 mg/kg) and dextran sulfate sodium (DSS, 2% w/v)-induced colorectal cancer (CRC) in C57BL/6J mice were studied. The main MCG preparation consisted of fermented brown rice (FBR), glutinous brown rice, glutinous Sorghum bicolor, glutinous Panicum miliaceum, Coix lacryma-jobi and black soybean at an appropriate mixing ratio. Other MCG preparations contained rice coated with 5% Phellinus linteus and 5% Curcuma longa (MGR-PC), or 10% Phellinus linteus (MCG-P), or 10% Curcuma longa (MCG-C). Consumption of dietary MCG-PC by CRC mice significantly increased colon length, decreased the ratio of colon weight to length, and reduced the number of colon tumors. Similar effects, although to a lower extent, were observed in CRC mice fed with MCG-P, followed by those fed with MCG-C, MCG, FBR or white rice (WR). MCG-PC significantly suppressed colonic neoplasia, and decreased the levels of various cytokines (tumor necrosis factor: Tnf, interleukin 1 beta: Il1b, interleukin 6: Il6, and interferon gamma: Ifng) in serum and colon tissue of the CRC mice. In addition, MCG-PC increased the mRNA expressions of tumor protein p53(Tp53) and cyclin-dependent kinase inhibitor 1A(Cdkn1a), activated pro-apoptotic caspase 3(Casp3), and reduced expression of both mRNA and protein of inducible inducible nitric oxide synthase 2 (Nos2), prostaglandin-endoperoxide synthase 2 (Ptgs2), and cyclin D1(Ccnd1) in colon tissue. These findings suggest that than compared with other cereal grain preparations, MCG-PC had a greater activity against AOM/DSS-induced CRC by reducing intestinal inflammation, and modulating the expression of certain carcinogenesis related factors (Nos2, Ptgs2, Tp53, Cdkn1a, Ccnd1 and Casp3) in colon tissue of CRC mice.

Changes in coastal topography can affect the ecological environment and marine industries. In this study, we analyzed the patterns and causes of changes in shoreline and undersea topography in the Nakdong River estuary in the southeast of South Korea using depth and shoreline surveys of the estuary, as well as data on discharge, suspended sediments, and precipitation in the Nakdong River basin. The results showed that erosion and sedimentation occurred repeatedly owing to complex factors such as the discharge of the estuary and invasion by open sea waves. However, no clear unilateral trend was observed. Unlike previous survey data, a large amount of erosion occurred in the second half of 2020. Previously, sedimentation was the main process, but erosion occurred rapidly, which was observed in the summer of 2020 when the erosion was three times higher than that in other periods owing to the severe rainy season and torrential rains for over a month. In addition, regarding the flow rate and force of the river water outflow, the amount of discharge increased rapidly, causing erosion. Moreover, a strong typhoon in the summer of 2020 affected the topography of the estuary.

Various vestibuloplasty techniques have been reported to increase the attached mucosa (AM) and vestibular depth around dental implants. However, these surgical methods have disadvantages, such as limitations in manipulation, necessity of suturing, postoperative discomfort, swelling, and pain. This study aimed to evaluate the efficacy of laser-assisted periosteal fenestration (LA-PF) in treating a patient with a shallow vestibule and insufficient AM around dental implants. The LA-PF technique was performed using an Er:YAG laser. First, a partial-thickness apically positioned flap (APF) was performed. Horizontal periosteal fenestration was performed using an Er:YAG laser to expose the bones. Periosteal suturing was not required. After 12 months, sufficient AM and deepened vestibule were obtained and maintained. Thus, the LA-PF technique may be a simple and predictable treatment modality for vestibuloplasty around dental implants.

The purpose of this study is to develop and evaluate the effectiveness of a medical helicopter air transport training program for emergency medical personnel. The program was developed according to Rapid Prototyping Instructional System Design (RPISD) and finalized after content validity and usability evaluation. The effectiveness of the program was evaluated using a single-arm pre-post design to measure the performance of 11 convenience-sampled emergency medical technicians after the program was applied. Data analysis was performed using the SPSS 26.0 Program and Wilcoxon Signed-Rank test. The results of this study are summarized as follows. First, the developed doctor helicopter air transport training program applied RPISD, and the development stage was divided into analysis, design and usability evaluation, and development stages; the final program was derived. Secondly, the developed medical helicopter air transport training program is composed of a blended learning training program that combines online theory lectures and offline simulations for a total of 8 sessions. Third, as a result of applying the developed doctor helicopter air transport training program to 11 emergency medical workers, both pre- and post-air transport subjective job performance and objective job performance were statistically significantly increased. The Dr. Helicopter air transport training program developed in this study was found to be a program that can sufficiently evaluate the job performance of emergency medical personnel in air transport. Through this study, we hope that this training program can directly contribute to improving the survival rate of critically ill patients in the actual air transport field.

Urbanization and industrialization processes in Mongolia have been significant and rapid for the last half-century. During this period, changes in political and economic systems, growth in the population, and the occasional harsh climate conditions were subject to fluctuations in the natural resource usage. The total Ecological Footprint (EF) in Mongolia has increased from 6.8 million global hectares (gha) in 1961 to 14.6 million gha in 2012. However, Biocapacity (BC) has decreased from 50.6 million gha in 1961 to 39.0 million gha in 2012. The study shows that grazing land Footprint and carbon uptake land Footprint are the two major contributors of the recent intensified use of biological resources. To ensure stable economic development and sustainable use of natural resources, environmental planning is required to consider both the population’s pressure on the environment and the ecosystem’s regeneration capacity, simultaneously. We have proposed a few possible strategies for sustainable utilization of grazing land Footprint and carbon Footprint. For grazing land Footprint, efficient management of both herding practice and number of animals should be considered. In case of carbon Footprint, it is estimated that with the improved combustion efficiencies of coal-based power plants and the maximum use of renewable energy, carbon dioxide (CO₂) emissions in Mongolia can be reduced up to 30% compared to the base line business as usual case in 2030.

The purpose of this study was to examine the relationships between smartphone addiction of middle school students and smartphone usage types, depression, attention deficit hyperactivity disorder (ADHD), stress, interpersonal problems, and parenting attitude. This study was also performed with the aim of verifying the relationships among depression, ADHD, perceived stress, interpersonal problems, and parenting attitude, which are predictors of smartphone addiction. The subjects of this study were 487 local middle school students (234 males and 253 females). The measurement instruments used were the smartphone addiction scale, depression scale (PHQ-9), ADHD scale (K-ARS), perceived stress scale (PSS), interpersonal problem scale (KIIP-SC), and the parenting attitude scale. This study identified the relationships between the variables with correlation analysis and examined the predictors of smartphone addiction with hierarchical multiple regression analysis. According to the study results, the factors that influenced smartphone addiction were gender, stress, and interpersonal problems. In addition, when the confounding variables of smartphone addiction were controlled to examine the effects of smartphone usage types on smartphone addiction, social media use and music/videos were found to have a positively significant effect on smartphone addiction while study had a negatively significant effect. The order of the usage types with the highest influence on smartphone addiction was enjoying music/videos, social media use, and study. This suggests that selective intervention depending on the main smartphone usage type can be effective.

Recently, federated learning (FL) has been receiving great attention as an effective machine learning method to avoid the security issue in raw data collection as well as to distribute the computing load to edge devices. However, even though wireless communications is a essential part for implementing FL in edge networks, there have been a few works that analyze the effect of wireless networks on FL. In this paper, we investigate FL in small-cell networks where multiple base stations (BSs) and users are located according to homogeneous Poisson point process (PPP) with different densities. We comprehensively analyze the effects of geographic node deployment on the model aggregation in FL on the basis of stochastic geometry-based analysis. We derive the closed-form expressions of coverage probability with tractable approximations and discuss the minimum required BS density for achieving a target model aggregation rate in small-cell networks. Our analysis and simulation results provide insightful information for understanding the behaviors of FL in small-cell networks, and it can be exploited as a guideline for designing the network facilitating the wireless FL.

Recently, various applications of indoor location-based services using Wi-Fi fingerprint data have been studied. However, since fingerprint data collected at a specific location does not have continuous information between signals and correlation information between signals, path data cannot exist in principle. Therefore, most indoor positioning technologies are based on predicting the position of a stationary positioner at a specific location based on signal data collected at a specific location in the indoor space. Due to the discontinuous nature of these signals, they are unable to account for user movement. Therefore, there is a need for techniques to improve the accuracy of indoor positioning in moving situations. This paper proposes a method for enriching all data points with relevant information to obtain improved indoor positioning results and an improved technique for generating movement path data. The proposed technique generates relevant information with continuity by expressing data points as Bounding Boxes (BB) and subsequently clustering them using grid cells. Through the proposed method, we represented and expanded the indoor location data, which consists of data points, as BB. However, data points represented by BB do not have any adjacency information with each other, and as a result, it is not possible to create a movement path between neighboring BB. To solve the problem, we used clustering, a machine learning technique that categorizes data points into groups, to group BBs. This was done by constructing a YOLO (You Only Look Once) grid cell that included all BBs and clustered them into grid cells that were divided into specific regions through the suggestion phase. The clustering results align with the indoor structure of the building, indicating that the data points have been appropriately clustered. BBs inside a grid cell are contained within a moveable area and have related information. We also generated association information between neighboring grid cells through the proposal technique, and then generated path information that can be traveled between grid cells. In this paper, we use the movement path information generated from a dataset as training data for machine learning, and through this, we propose an enhanced indoor positioning technology.

This study aimed to evaluate the diagnostic roles of various immunohistochemical markers in urothelial carcinoma in situ (uCIS) through a meta-analysis and review of diagnostic test accuracy. Immunohistochemical markers CK20, CD44, AMACR, and p53 were evaluated in the present study. We analyzed the expression rates of immunohistochemical markers and compared their diagnostic accuracies. The estimated expression rates were 0.803 (95% confidence interval [CI]: 0.726–0.862), 0.142 (95% CI: 0.033–0.449), 0.824 (95% CI: 0.720–0.895), and 0.600 (95% CI: 0.510–0.683) for CK20, CD44, AMACR, and p53, respectively. In the comparison between uCIS and reactive/normal urothelium, the expression of CK20, AMACR, and p53 in uCIS was significantly higher than in reactive/normal urothelium. CD44 showed significantly lower expression in uCIS than in the reactive/normal urothelium. Among the markers, AMACR had the highest sensitivity, specificity, and diagnostic odds ratio. The AUC on SROC was the highest for CK20. In conclusion, immunohistochemical markers, such as CK20, CD44, AMACR, and p53, can be useful in differentiating uCIS from reactive/normal urothelium.

In this paper, we define new kind of Daehee numbers, the degenerate Daehee numbers of the third kind, using degenerate log function as generating function. We obtain some identities for the degenerate Daehee numbers of the third kind associated with the Daehee, degenerate Daehee and degenerate Daehee numbers of the second kind. In addition, we derive a differential equation associated with the degenerate log function. We deduce some identities from the differential equation.

This study aimed to evaluate the diagnostic and prognostic roles of GATA3 immunohistochemistry in urothelial carcinoma (UC) through a meta-analysis. We investigated GATA3 immunohistochemical expression rates and performed a subgroup analysis based on tumor site, study location, and histological subtypes. The overall survival rates of patients with GATA3-positive and negative UC were compared. The estimated GATA3 expression rate was 0.748 (95% confidence interval [CI]: 0.704–0.787). GATA3 expression rates in the urinary bladder and urinary tract were 0.775 (95% CI: 0.727–0.818) and 0.614 (95% CI: 0.426–0.774), respectively. The GATA expression rates of noninvasive and invasive UCs were 0.965 (95% CI: 0.938–0.980) and 0.644 (95% CI: 0.581–0.702), respectively. In invasive UCs, there was a significant difference in GATA3 expression between non-muscular invasion and muscular invasion subgroups (0.937, 95% CI: 0.883–0.967 vs. 0.753, 95% CI: 0.645–0.836). GATA3 expression was the highest in the microcytic subtype among the histologic subtypes (0.952, 95% CI: 0.724–0.993). There was a significant correlation between GATA3 expression and better prognosis (hazard ratio: 0.402, 95% CI: 0.311–0.521). Taken together, GATA3 expression significantly correlated with low-stage and better prognosis in UC. GATA3 expression is highly variable across histological subtypes and it is careful interpreting GATA3 expression.

Oxidative stress is a major contributor to muscle aging and loss of muscle tissue. Jakyakgamcho-tang has been used in traditional Eastern medicine to treat muscle pain. Here, we compared various solvent-based Jakyakgamcho-tang extracts in terms of their effects against hydrogen peroxide-induced oxidative stress in murine C2C12 skeletal muscle cells. Total phenolic content and total flavonoid content in 30% ethanol extracts of Jakyakgamcho-tang were higher than those of water extracts of Jakyakgamcho-tang. Ethanol extracts of Jakyakgamcho-tang had stronger antioxidant and 2,2-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid and 2,2´-diphenyl-1-picrylhydrazyl-scavenging activity than water extracts of Jakyakgamcho-tang. The ethanol extract of Jakyakgamcho-tang inhibited peroxide-induced cell viability and intracellular reactive oxygen species generation more effectively than the water extract of Jakyakgamcho-tang in a dose-dependent manner. These results suggest that the ethanol extract of Jakyakgamcho-tang is relatively more efficacious at protecting against oxidative stress-induced muscle cell death because it prevents reactive oxygen species generation in C2C12 cells. Moreover, the current study indicated that the effective dose of the ethanol extract of Jakyakgamcho-tang required to alleviate muscle pain might be lower than that required for Jakyakgamcho-tang.

The current study investigated the use of two-dimensional spatial distribution mapping representing the chlorophyll-a level in a river generated via an unmanned aerial vehicle (UAV) and an unmanned surface vehicle (USV). A domestically developed UAV (Remo-M, Uconsystem Inc., Korea) and a USV developed by our research team were used to collect data from the Nae Seong stream in Korea. An adaptation of the “Data Cleaner” tool was developed and used for USV data processing and analysis. The operation of the autonomous USV was successful. Four previously described indices for quantifying algal blooms in rivers were utilized to create chlorophyll-a images, the normalized difference vegetation index (NDVI), the normalized green red difference index, the green normalized difference vegetation index (GNDVI), and the normalized difference red edge index. The suitability of the linear regression analysis of the correlation between the spectral indices obtained using the UAV and the in situ chlorophyll-a data obtained using the USV was evaluated with the coefficient of determination (R2) at a significance level of p &lt; 0.001. In field application and correlational analysis the NDVI was strongly correlated with chlorophyll-a (R2 = 0.88, p < 0.001), and the GNDVI was moderately correlated with chlorophyll-a (R2 = 0.74, p < 0.001). The map of chlorophyll-a was successfully quantified using the UAV and USV hybrid platforms.

Stress can reduce the accuracy of radiation therapy owing to muscle contraction and changes in breathing patterns. This study aimed to predict stress in patients before each treatment session using artificial intelligence (AI) from biological signals to enhance treatment accuracy. We measured 123 stress cases in 41 patients and calculated stress scores by analyzing seven stress-related features derived from heart rate variability obtained from photoplethysmography. The study analyzed stress score distribution and observed its trend changes throughout the treatment. Before-treatment information was used to predict changes in stress features during treatment. AI models included both non-pre-trained (Decision Tree, Random Forest, Support Vector Machine, Long Short-Term Memory (LSTM), Transformer) and pre-trained (ChatGPT) models. The performance was evaluated using 10-fold cross-validation, exact match ratio, accuracy, recall, precision, and F1 score. More than 90% of the patients experienced stress during radiation therapy. From all the classifications, LSTM and prompt engineering GPT4.0 had the highest accuracy (feature classification, LSTM: 0.703, GPT4.0: 0.659, stress classification: LSTM: 0.846, GPT4.0: 0.769). Our research pioneers the use of AI and biological signals for stress prediction in radiation therapy, potentially identifying patients needing psychological support, and suggesting methods to improve radiotherapy effectiveness through stress management.

The aim of this study was to determine the association of metabolic syndrome (MetS) with kidney cancer and the impact of age and gender on such association. Using Korean National Health Insurance Service database, 9,932,670 subjects who had check-up in 2009 were followed up until the diagnosis of kidney cancer or death or until 2019. Kidney cancer was significantly associated with MetS (HR 1.56). This association was higher in the younger age group (HR: 1.82, 1.5, and 1.37 in 20-39 years, 40-64 years, and ≥65 years, respectively). In terms of the association of kidney cancer with obesity and central obesity, young-aged males showed higher HR for kidney cancer than old-aged ones (HR of obesity: 1.96, 1.52, and 1.25; HR of central obesity: 1.94, 1.53, and 1.3 in 20-39 years, 40-64 years, ≥65 years, respectively), while young-aged females showed lower HR. Kidney cancer was associated with obesity and MetS. The association was higher in younger aged population than in older ones. Regarding gender, MetS, obesity, and central obesity showed higher associations with kidney cancer in younger aged male population, while there was no significant difference in such association according to age in females.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Background: Schizophrenia is a severe psychiatric disorder that has a large impact on patients’ lives. In addition to Western medicine, the use of additional treatments, such as acupuncture, in treating the positive, negative, and cognitive symptoms is increasing. Methods: We conducted a systematic review on the use of acupuncture as an add-on treatment for patients with schizophrenia that are in regular care, with a special focus on the treatment of the often accompanying co-morbid sleep disorders. In this study, we searched the Medline, ScienceDirect, Cochrane Library, Scopus, and ERIC databases with a cut-off date of December 31, 2017, thereby following the guidelines of the Preferred Reporting Items for Systematic Reviews and Meta-analysis (PRISMA) protocol. Results: Our search resulted in 26 eligible studies. Most studies showed limited evidence for the use of acupuncture as add-on therapy in the treatment of clinical symptoms, but beneficial effects have been reported in the treatment of co-morbid sleep disorders. Conclusions: Limited evidence was found for the use of acupuncture as add-on therapy in the treatment of patients with schizophrenia; however, positive results were found in the treatment of sleep disorders, but this result needs to be confirmed in large, randomized, controlled trials.

Background Patients with severe dysphagia are usually fed using a nasogastric tube (NGT). Many patients who receive long-term NGT feeding are unable to obtain sufficient nutrients orally immediately after NGT removal. Thus, a transitional period involving oral diet training is required to transition from NGT feeding to exclusive oral feeding. We aimed to investigate the therapeutic effect of oral diet training in indwelling NGT patients with prolonged dysphagia. Methods A total of 175 patients who were fed using an NGT for more than 4 weeks were enrolled. Their swallowing function was evaluated by a videofluoroscopic swallowing study (VFSS). During the VFSS, patients received thick and thin barium while the NGT was insulted. Then, the patients underwent a VFSS without an NGT thirty minutes after NGT removal. If a patient had no aspiration with NGT inserted during the VFSS, oral diet training combined with NGT feeding was recommended. Results Of the 49 indwelling NGT patients who were recommended to receive oral diet training, 39 (79.6%) transitioned to exclusive oral feeding. A transition period of 2-8 weeks was required for them to achieve full oral feeding. Patients who were eligible for oral feeding trials showed no significant aspiration during the VFSS with an NGT inserted and had sufficient cough function. Patients who required prolonged NGT feeding and who could not complete oral trials showed significant aspiration during the VFSS when an NGT was inserted. Conclusion This study demonstrated that oral diet training combined with NGT feeding was safe in patients with prolonged dysphagia who had sufficient cough function and no aspiration during VFSS. We suggest that if the patient is a proper candidate for NGT removal, direct oral feeding training with an NGT inserted could be a useful therapeutic strategy during the transitional period from long-term NGT feeding to successful oral feeding.

Hepatitis B virus (HBV) infection is a major factor in development of various liver diseases such as hepatocellular carcinoma (HCC). Among HBV encoded proteins, HBV X protein (HBx) is known to play key role in development of HCC. Hepatocyte nuclear factor 4α (HNF4α) is a nuclear transcription factor which is critical for hepatocyte differentiation. However, the expression level as well as its regulatory mechanism in HBV infection have yet to be clarified. Here, we observed the suppression of HNF4α in cells which stably express HBV whole genome or HBx protein alone, while transient transfection of HBV replicon or HBx plasmid had no effect on the HNF4α level. Importantly, in the stable HBV- or HBx-expressing hepatocytes, the downregulated level of HNF4α was restored by inhibiting ERK signaling pathway. Our data showed that HNF4α was suppressed during long-term HBV infection in cultured HepG2-NTCP cells as well as in mouse model following hydrodynamic injection of pAAV-HBV or in mice intravenously infected with rAAV-HBV. Importantly, HNF4α downregulation increased cell proliferation which contributed to the formation and development of tumor in xenograft nude mice. The data presented here provided several proofs for the effect of HBV infection in manipulating HNF4α regulatory pathway in HCC development.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Chilling injury (CI), which causes seed browning in pepper, may arise following long-term cold storage, and is a major cause of postharvest losses. To explore potential strategies of minimizing the associated postharvest losses, the present study investigated the optimal pepper harvest time that could reduce levels of seed browning, in addition to the relationship between fruit maturity and seed browning. Fruit harvested 15 days after flowering (DAF) were sensitive to cold storage at 4°C and exhibited 100% seed browning (CI index, 4.0); in contrast, the seed browning rate of fruit harvested 35 DAF was 10% (CI index, 0.4) within 7 d of cold storage. Seed antioxidant activity was higher in seeds harvested at early stages (15 DAF to 20 DAF) than in seeds harvested at later stages (40 DAF to 50 DAF) at the beginning of storage. Pericarps of fruit harvested at 50 DAF exhibited the highest antioxidant activity. Lipoxygenase, catalase, and peroxidase activity, and the expression levels of cell wall-related genes, pectin methylesterase-like protein, and endo-β-1,4-glucanase were higher in seeds of immature fruit harvested 15 DAF than in seeds of mature fruit harvested 35 DAF. The endosperm separated from the seed coat in fruit harvested 35 DAF and the seeds did not brown under low-temperature storage. The lack of seed browning observed in mature fruit under low-temperature storage could be attributed to physical protection provided by the seed coat rather than cold stress resistance conferred by antioxidants.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Curcumin, a natural polyphenolic compound isolated from the plant Curcuma longa, is known to induce autophagy in various cancer cells, including lung cancer. In the present study, we also confirmed by LC3 immunofluorescence and immunoblotting analyses that curcumin triggers autophagy in human lung adenocarcinoma A549 cell line. In parallel with autophagy induction, gene expression of human GD3 synthase (hST8Sia I) responsible for ganglioside GD3 synthesis was markedly elevated in response to curcumin in A549 cells. To investigate transcriptional activation of hST8Sia I associated with autophagy formation in curcumin-treated A549 cells, functional characterization of the 5’-flanking region of the hST8Sia I gene was carried out using luciferase reporter assay system. Deletion analysis demonstrated that the -1146 to -646 region, which includes putative c-Ets-1, CREB, AP-1 and NF-κB binding sites, functions as the curcumin-responsive promoter of hST8Sia I in A549 cells. Site-directed mutagenesis and chromatin immunoprecipitation assay demonstrated that the NF-κB binding site at -731 to -722 was indispensable for the curcumin-induced hST8Sia I gene expression in A549 cells. Moreover, the transcriptional activation of hST8Sia I by curcumin A549 cells was strongly inhibited by compound C, an inhibitor of AMP-activated protein kinase (AMPK). These results suggest that curcumin controls hST8Sia I gene expression via AMPK signal pathway in A549 cells.

The effect of CO2 pre-treatments on tomato quality prior to cold storage was investigated using physiochemical and transcriptome changes. Three hours CO2 treated fruits were firmer than untreated fruits and had a good appearance even after being transferred from 4°C storage to 20°C for 8 d. CO2 pretreatment with cold storage showed a synergistic effect on delayed ripening through reduced respiration; these tomatoes exhibited a lower lycopene content than untreated fruit under cold storage. Tomatoes treated with 30% CO2 had fewer pits than untreated fruits subjected to chilling temperatures, even after being transferred to 20°C for 8 d. Functional enrichment analyses from transcriptome and metabolome commonly showed that CO2-responsive genes or metabolites were involved in the sucrose and starch and biosynthesis of secondary metabolisms. The most frequently detected domain, ethylene-responsive factor domain and reduced glycolysis provide insights into the mechanism that CO2 regulates tomato quality.

(1) Background: Extremely low alanine aminotransferase (ALT) levels are be-ing recognized as a risk factor of increasing mortality in the elderly in relation to frailty. In the elderly, both frailty and ischemic stroke are not only common, but also associated with mortality. This study aimed to investigate whether extremely low ALT levels increase the all-cause mortality rate in the elderly after ischemic stroke. (2) Methods: A retrospective review was performed on 901 patients with ischemic stroke admitted to a university-affiliated hospital between February 2014 and April 2019. The multivariate Cox proportional hazard analysis was performed to determine whether extremely low ALT lev-els are an independent risk factor of mortality in elderly patients after ischem-ic stroke. (3) Results: This study enrolled 323 older adults (age ≥65 years) who were first diagnosed with ischemic stroke. The mean age of the participants was 76.5 ± 6.6 years, mean survival time was 37.1 ± 20.4 months, and the num-ber of deaths was 96 (29.7%). The multivariate Cox proportional hazard analy-sis revealed that the risk factors for all-cause mortality in the elderly after is-chemic stroke were age, initial National Institutes of Health Stroke Scale score, serum creatinine, and extremely low ALT level (<10 U/L) at the time of diag-nosis (adjusted hazard ratio: 3.243, 95% confidence interval: 1.945–5.408; P < 0.001) (4) Conclusions: Extremely low ALT level at the time of diagnosis (<10 U/L) is an independent risk factor that increases the mortality rate in the el-derly after ischemic stroke.

Curcumin has attracted attention for its nontoxic chemopreventive effects; however, the specific pathways underlying its anticancer effects in colon cancer remain unclear. This study investigated the potential interplay between curcumin and integrin β1 in colon cancer. HCT116 and fibroblast cells were treated with curcumin, and cell proliferation was assessed using MTT assay and western blotting. We analyzed integrin β1 expression after curcumin treatment of HCT116 cells using western blotting and confocal microscopy. The roles of talin and rab25 in integrin β1 activation by curcumin were investigated using the same methods. Curcumin treatment significantly decreased the survival of HCT 116 cells but did not significantly affect the survival of fibroblast cells. Moreover, curcumin significantly increased integrin β1 expression in HCT 116 cells, which was primarily mediated by talin. In contrast, rab25 expression remained unchanged after curcumin treatment. Using rab25-specific siRNA knockdown experiments, we confirmed that curcumin increased integrin β1 expression even in the absence of rab25. Confocal microscopy revealed a dose-dependent increase in integrin β1 and talin expression, with consistent spatial distribution patterns in response to curcumin. This study highlights the clinical significance of curcumin as a selective anticancer agent in colon cancer by modulating integrin β1 expression through a talin-mediated pathway rather than through rab25.

Recently, astroviruses (AstVs) have been associated with neurological symptoms in pigs, cattle, sheep, minks, muskoxes, alpacas, and humans. To investigate genotypes of porcine astrovirus (PAstV) and neuroinvasive (Ni) PAstV in South Korea, five domestic pigs with neurological symptoms from three farms were tested using reverse transcriptase PCR, histopathology, and in situ hybridization (ISH). All five genotypes of PAstV were detected in brain tissues and coinfection of PAstV with multiple genotypes was observed. To the best of our knowledge, this is the first study to report pig infection by Ni-PAstV with multiple genotypes in South Korea.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

This study investigated defect formation and strain distribution in high Mg content Al-Mg alloys during normal rolling and cross-rolling processes. The finite element analysis (FEA) revealed the presence of wave defects and strain localization-induced zipper cracks in normal cold rolling, which were confirmed by experimental results. The concentration of shear strain played a significant role in crack formation and propagation. However, the influence of wave defects was minimal in the cross-rolling process, which exhibited a relatively uniform strain distribution. Nonetheless, strain concentration at the edge and center regions led to the formation of zipper cracks and edge cracks, with more pronounced propagation observed in the experiments compared to FEA predictions. Furthermore, texture evolution was found to be a crucial factor affecting crack propagation, particularly with the development of the Goss texture component which is observed by electron backscattered diffraction analysis at bending points. The Goss texture hindered crack propagation, while the Brass texture allowed cracks to pass through. This phenomenon was consistent with both FEA and experimental observations. To mitigate edge crack formation and propagation, potential strategies involve promoting the formation of the Goss texture at the edge through alloy and process conditions, as well as implementing intermediate annealing to alleviate stress accumulation. These measures can enhance the overall quality and reliability of Al-Mg alloys during cross-rolling processes. In summary, understanding the mechanisms of defect formation and strain distribution in Al-Mg alloys during rolling processes is crucial for optimizing their mechanical properties. The findings of this study provide insights into the challenges associated with wave defects, strain localization, and crack propagation. Future research and optimization efforts should focus on implementing strategies to minimize defects and improve the overall quality of Al-Mg alloys in industrial applications.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Background: Malnutrition in critically ill paitents is closely linked with clinical outcomes. During acute inflammatory states, nutrition cannot reverse the loss of body cell mass completely. Studies on nutritional screening and strategy considering metabolic changes not yet been conducted. We aimed to identify nutrition strategies using the modified Nutrition Risk in the Critically ill (mNUTIRC) score. Methods: Nutrition support data, laboratory nutrition indicators, and prognosis indices were prospectively collected on the 2nd and 7th day after admission. It is to identify the effect of changes on the metabolic status and critical target of nutrition intervention. To discriminate the high-risk group of malnutrition, receiver operating characteristic curves were plotted. Risk factors associated with 28 day-mortality were evaluated using multivariable Cox proportional hazards regression. Results: A total of 490 and 266 patients were analyzed on the 2nd and 7th day, respectively. Only the mNUTRIC score showed significant differences in nutritional risk stratification. The use of vasopressors, hypo-protein supply (< 1.0 g/kg/day), high mNUTRIC score and hypoalbuminemia (<2.5 mg/dl) in the recovery phase was strongly associated with 28-day mortality. Conclusions: The implementation of the mNUTRIC score and protein supply in the post-acute phase is critical to improve 28-day mortality in critically ill patients.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

The objective of this study is to investigate the aquatic-toxic effects of glyoxal-containing cellulose ether with four different glyoxal concentrations (0, 1.4, 2.3 and 6.3%) in response to global chemical regulations, e.g., European Union Classification, Labeling and Packaging (EU CLP). Tests of the aquatic-toxic effects of glyoxal-containing cellulose ether on 11 freeze-dried microbial strains, Microcystis aeruginosa, Daphnia magna and zebrafish embryos were designed as an initial stage for toxicity screening, and were performed with the standardized toxicity test guidelines. Glyoxal-containing cellulose ether showed no significant toxic effects in the toxicity tests for the 11 freeze-dried microbial strains, Daphnia magna and zebrafish embryos. Alternatively, 6.3% glyoxal-containing cellulose ether led to more than a 60% reduction of Microcystis aeruginosa growth after 7 days of exposure. Approximately 10% developmental abnormalities (e.g., bent spine) in zebrafish embryos were also observed in the group exposed to 6.3% glyoxal-containing cellulose ether after 6 days of exposure. These results imply that <6.3% glyoxal-containing cellulose ether results in non-toxic effects on the acute toxicity of aquatic organisms. However, ≥6.3% glyoxal-containing cellulose ether may affect the health of aquatic organisms with long-term exposure. In order to better evaluate the eco-safety of cellulosic products contained in glyoxal, further studies regarding the toxic effects of glyoxal-containing cellulose ether with long-term exposure are required. The results from this study allow us to evaluate the auatic-toxic effects of glyoxal-containing cellulosic products, under EU chemical regulations, on the health of aquatic organisms.

Aim: To improve risk stratification in early-stage endometrial cancer (EC), we performed mo-lecular classification, and L1CAM immunohistochemistry (IHC) for additional risk assessment. Method: We analyzed archival tumor tissue from 247 early-stage EC patients. POLE mutations were detected using a Droplet digital polymerase chain reaction assay and Sanger sequencing, while the mismatch repair (MMR) status was determined by MMR protein IHC and MSI test. Additionally, we conducted IHC of p53 and L1CAM. Results: The 247 ECs were categorized into four subgroups: POLE-mutated (13.0%), MMR-deficient (27.9%), p53-abnormal (8.5%), and non-specific molecular profile (NSMP, 50.6%). We further subcategorized NSMP subgroup into NSMP-L1CAMneg (44.9%) and NSMP-L1CAMpos (5.7%), which we refer to as the molecu-lar-L1CAM classification. The molecular-L1CAM classification was an independent prognostic factor for recurrence-free survival (RFS) and overall survival (OS) (p <0.001, each). Similarly, the simplified L1CAM-p53 categorization, for practical use, remained an independent prognostic factor for RFS and OS (p <0.001, p =0.003, respectively). Conclusion: Integrating the molecu-lar-L1CAM classification or the simplified L1CAM/p53 categorization can enhance risk stratifi-cation in early-stage EC, providing valuable prognostic information to guide treatment deci-sions and improve patient outcomes.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Novel genetic and epigenetic factors involved in the development and prognosis of idiopathic pulmonary fibrosis (IPF) have been identified. We previously observed that EPB41L3 increased in the lung fibroblasts of IPF patients. Thus, we investigated the role of EPB41L3 in IPF by comparing EPB41L3 mRNA and protein expression of lung fibroblast between patients with IPF and controls. We also investigated the regulation of the epithelial-mesenchymal transition (EMT) in an epithelial cell line (A549), and the fibroblast-to-myofibroblast transition (FMT) in a fibroblast cell line (MRC5), by overexpressing and silencing EPB41L3. EPB41L3 mRNA and protein levels, as measured by RT-PCR, real-time PCR, and western blot, were significantly higher in fibroblasts derived from 14 IPF patients than in those from 10 controls. The mRNA and protein expression of EPB41L3 was upregulated during transforming growth factor-β-induced EMT and FMT. Overexpression of EPB41L3 in A549 cells using lenti-EPB41L3 transfection suppressed the mRNA and protein expression of N-cadherin and COL1A1. Treatment with EPB41L3 siRNA upregulated mRNA and protein expression of N-cadherin. Overexpression of EPB41L3 in MRC5 cells using lenti-EPB41L3 transfection suppressed mRNA and protein expression of fibronectin and α-SMA. Finally, treatment with EPB41L3 siRNA upregulated mRNA and protein expression of FN1, COL1A1, and VIM. Overall, these data strongly support an inhibitory effect of EPB41L3 on the process of fibrosis and suggest therapeutic potential of EPB41L3 as an anti-fibrotic mediator.

The indigenous communities across the globe especially in the rural areas consume locally available plants known as Traditional Food Plants (TFPs) for their nutritional and health-related needs. Recent research shows that many of the traditional food plants are highly nutritious as they contain health beneficial metabolites, vitamins, mineral elements and other nutrients. Excessive reliance on the mainstream staple crops has its own disadvantages. TFPs are nowadays considered important crops of the future and can act as supplementary foods for the burgeoning global population. They can also act as emergency foods in times of pandemics and other situations like COVID-19. The current situation necessitates locally available alternative nutritious TFPs for sustainable food production. To increase the cultivation or improve the traits in TFPs, it is essential to understand the molecular basis of the genes that regulate some important traits such as nutritional components and resilience to biotic and abiotic stresses. The integrated use of modern omics and gene editing technologies provide great opportunities to better understand the genetic and molecular basis of superior nutrient content, climate-resilient traits and adaptation to local agroclimatic zones. Recently, realising the importance and benefits of TFPs, scientists have shown interest in the prospection and sequencing of traditional food plants for their improvements, further cultivation and mainstreaming. Integrated omics such as genomics, transcriptomics, proteomics, metabolomics and ionomics are successfully used in plants and have provided a comprehensive understanding of gene-protein-metabolite networks. Combined use of omics and editing tools has led to successful editing of beneficial traits in few TFPs. This suggests that there is ample scope of integrated use of modern omics and editing tools/techniques for improvement of TFPs and their use for sustainable food production. In this article, we highlight the importance, scope and progress towards improvement of TFPs for valuable traits by integrated use of omics and gene editing techniques.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

Transcription factors (TFs) are crucial in modulating gene expression and sculpting cellular and organismal phenotypes. The identification of TF-target gene interactions is pivotal for comprehending molecular pathways and disease etiologies but has been hindered by the demanding nature of traditional experimental approaches. This paper introduces a novel web application, utilizing the R programming language, which predicts TF-target gene relationships and vice versa. Our application integrates the predictive power of various bioinformatic tools, leveraging their combined strengths to provide robust predictions. It merges databases for enhanced precision, incorporates gene expression correlation for accuracy, and employs pan-tissue correlation analysis for context-specific insights. The application also enables the integration of user data with established resources to analyze TF-target gene networks. Despite its current limitation to human data, it provides a platform for exploring gene regulatory mechanisms comprehensively. This integrated, systematic approach offers researchers an invaluable tool for dissecting the complexities of gene regulation, with the potential for future expansions to include a broader range of species.

This paper proposes a new approach for multi-focus images fusion based on Region Mosaicing on Contrast Pyramids (REMCP). A density-based region growing method is developed to construct a focused region mask for multi-focus images. The segmented focused region mask is decomposed into a mask pyramid, which is then used for supervised region mosaicking on a contrast pyramid. In this way, the focus measurement and the continuity of focused regions are incorporated and the pixel level pyramid fusion is improved at the region level. Objective and subjective experiments show that the proposed REMCP is more robust to noise than compared algorithms and can fully preserves the focus information of the multi-focus images meanwhile reducing distortions of the fused images.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

In this paper, we investigate the new degenerate Daehee polynomials and numbers which are called the degenerate Daehee polynomials of the second kind, and derive some new and interesting identities and properties of those polynomials.

Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

The Android-based IoT platform just like the existing Android provides an environment that makes it easy to utilize Google's infrastructure services including development tools and APIs through which it helps to control the sensors of IoT devices. Applications running on the Android-based IoT platform are often UI free and are used without the user’s consent to registered permissions. It is difficult to respond to the misuse of permissions as well as to check them when they are registered indiscriminately while updating applications. This paper analyzes the versions of before and after an application the update running on the Android-based IoT platform and the collected permission lists. It aims to identify the same permissions before and after the update, and deleted and newly added permissions after the update were identified, and thereby respond to security threats that can arise from the permissions that is not needed for IoT devices to perform certain functions.

In order to accurately identify the external economic situation in China and analyze the situation of economic development in Northeast China, based on the Strengths, Weaknesses, Opportunities and Threats (SWOT) analysis framework, this article analyses the economy in Northeast China from the four factors of SWOT. To solve the lack of quantitative analysis in SWOT analysis, this article applies Analytic Hierarchy Process (AHP) to the analysis, and finally forms a complete system framework with the combination of qualitative and quantitative factors, through the analysis of the important degree of various factors and the consistency test, the key factors influencing the economic development in Northeast China are analyzed, and constructive countermeasures are proposed.

A new design scheme is proposed for twisting the walls of a microchannel, and its performance is demonstrated numerically. The numerical study was carried out for a T-shaped microchannel with twist angles in the range of 0 to 34π. The Reynolds number range was 0.15 to 6. The T-shaped microchannel consists of two inlet branches and an outlet branch. The mixing performance was analyzed in terms of the degree of mixing and relative mixing cost. All numerical results show that the twisting scheme is an effective way to enhance the mixing in a T-shaped microchannel. The mixing enhancement is realized by the swirling of two fluids in the cross section and is more prominent as the Reynolds number decreases. The twist angle was optimized to maximize the DOM, which increases with the length of the outlet branch. The twist angle was also optimized in terms of the relative mixing. The two optimum twisting angles are generally not coincident. The optimum twist angle shows a dependence on the length of the outlet branch but it is not affected much by the Reynolds number.

In recent years, demand has been increasing for target detection and tracking from aerial imagery via drones using onboard powered sensors and devices. We propose a very effective method for this application based on a deep learning framework. A state-of-art embedded hardware system empowers small flying robots to carry out the real-time onboard computation necessary for object tracking. Two types of embedded modules were developed: one is designed using a Jetson TX or AGX Xavier, and the other is based on an Intel Neural Compute Stick. These are suitable for real-time onboard computing power on small flying drones with limited space. A comparative analysis of current state-of-art deep-learning-based multi-object detection algorithms was carried out utilizing the designated GPU-based embedded computing modules to obtain detailed metric data about frame rates as well as the computation power. We also introduce an effective target tracking approach for moving objects. The algorithm for tracking moving objects is based on the extension of simple online and real-time tracking. It was developed by integrating a deep-learning-based association metric approach (Deep SORT), which uses a hypothesis tracking methodology with Kalman filtering and a deep-learning-based association metric. In addition, a guidance system that tracks the target position using a GPU-based algorithm is introduced. Finally, we demonstrate the effectiveness of the proposed algorithms by real-time experiments with a small multi-rotor drone.

Reinforcement Learning (RL) has demonstrated considerable potential in solving challenges across various domains, notably in autonomous driving. Nevertheless, implementing RL in autonomous driving comes with its own set of difficulties, such as the overestimation phenomenon, extensive learning time, and sparse reward problems. Although solutions like Hindsight Experience Replay (HER) have been proposed to alleviate these issues, the direct utilization of RL in autonomous vehicles remains constrained due to the intricate fusion of information and the possibility of system failures during the learning process. In this paper, we present a novel RL-based autonomous driving system technology that combines Obstacle Dependent Gaussian (ODG) RL, Soft Actor-Critic (SAC), and meta-learning algorithms. Our approach addresses key issues in RL, including the overestimation phenomenon and sparse reward problems, by incorporating prior knowledge derived from the ODG algorithm. We evaluated our proposed algorithm on official F1 circuits, using high-fidelity racing simulations with complex dynamics. The results demonstrate exceptional performance, with our method achieving up to 89% faster learning speed compared to existing algorithms in these environments.

As the global demand for clean and sustainable energy sources intensifies, hydrogen emerges as a promising alternative fuel. The widespread adoption of hydrogen, however, is impeded by the lack of efficient systems for storage and transportation. This review aims to summarize the recent advancements and prevailing challenges within the realm of hydrogen storage and transportation, thereby providing guidance and impetus for future research and practical applications in this domain. Through a systematic selection and analysis of the latest literature, this study highlights the strengths, limitations, and technological progress of various hydrogen storage methods, including compressed gaseous hydrogen, cryogenic liquid hydrogen, organic liquids hydrogen, solid materials hydrogen storage, as well as the feasibility, efficiency, and infrastructure requirements of different transportation modes such as pipelines, road and seaborne transportation. The findings reveal that challenges such as low storage density, high costs, and inadequate infrastructure persist despite progress in high-pressure storage and cryogenic liquefaction. The review also underscores the potential of emerging technologies and innovative concepts, including metal-organic frameworks, nanomaterials, and underground storage, along with the potential synergies with renewable energy integration and hydrogen production facilities. In conclusion, interdisciplinary collaboration, policy support, and ongoing research are essential in harnessing hydrogen’s full potential as a clean energy carrier. This review concludes that research in hydrogen storage and transportation is vital to global energy transformation and climate change mitigation.

In Korea, the underground silo structure for low- and intermediate-level radioactive waste disposal facilities has been constructed and operated since 2014. Large-scale earthquakes occurred in 2016 and 2017, respectively, in Gyeongju and Pohang areas near the underground silo structures, and interest in the stability of the underground silo increased significantly. In this paper, one-dimensional free field analyses have been carried out before the three-dimensional silo dynamic analyses subjected to earthquake loadings. As an additional study, a new form of finite element equilibrium equation is derived in terms of relative motions, which is essentially the same equation as that expressed in terms of total motions where the base shear force is applied for earthquake load. The accuracy of conventional finite element solutions is evaluated by directly comparing them with closed-form solutions by frequency domain analysis such as SHAKE91.

As human activities of the countries in the East Asia have been remarkably expanding over recent decades, various problems in relation to ships, such as oil spill and many other coastal marine pollution, are continuously occurring in the coastal region. In order to conserve marine resources and prepare for possible ship accidents in advance, the need for efficient ship management is increasing over time. Multi-satellite, multi-sensor, multi-wavelength or multi-frequency observations make it possible to monitor a variety of vessels in the coastal region. This study presents the results of ship detection methodology applied to multi-spectral satellite images in the seas around Korean Peninsula based on optical, hyperspectral, and microwave remote sensing. To detect ships from hyperspectral images with a few hundreds of spectral channels, spectral matching algorithms are used to investigate similarity between the spectra and in-situ measurements. In the case of SAR (Synthetic Aperture Radar) images, the Constant False Alarm Rate (CFAR) algorithm is used to discriminate the vessels from backscattering coefficients of Sentinel-1 SAR and ALOS-2 PALSAR2 images. The present ship detection methods can be extensively utilized for optical, hyperspectral, and SAR images for comprehensive coastal management purposes toward perpetual sustainability in the future.

This study examines the negative impacts of dark stores on the urban environment from three perspectives: land use, transportation, and streetscape. It is conducted on B-Mart, a representative dark store in South Korea. First, in terms of land use, we find that dark stores that function as logistics facilities conflict with the surrounding land use. Second, by analyzing the location of dark stores and the hourly traffic volume of delivery vehicles, we find that the impact on the surrounding transportation infrastructure and pedestrian traffic is not as significant as previously claimed. However, during the transportation and loading process of the dark store, several problems such as traffic violations, illegal parking, and illegal loading were observed, posing a risk to nearby vehicles and pedestrians. Third, in terms of streetscapes, the location of dark stores on the ground floor of buildings can harm streetscapes. The current urban planning system in South Korea does not clearly define the status and function of dark stores, making it unclear how to manage them. Therefore, it is necessary to clarify their legal definition and introduce urban planning and design guidelines that are consistent with their appropriate location and appearance.

Our previous studies demonstrated that quercetin (Q) could be ingested and metabolized by macrophages and exerted prophylactic immuno-stimulatory activity and therapeutic anti-inflammatory effects on lipopolysaccharide (LPS)-treated macrophages ex vivo. To further clarify its possible anti-inflammatory mechanism, Q was selected to treat mouse peritoneal macrophages that obtained from female BALB/c mice exposed to LPS i.p. for 12 h. Relative gene expression of pro-/anti-inflammatory (TNF-α/IL-10) cytokines and components of inflammation-related intracellular signaling pathways (TLR2, TLR4, NF-κB, JAK2 and STAT3) was analyzed using two-step reverse transcription (RT) and real-time quantitative polymerase chain reaction (qPCR). STAT3 protein phosphorylation was determined using an in-cell ELISA method. As a result, Q and its metabolite quercetin-3-O-β-D-glucuronide (Q3G) decreased TNF-α gene expression amounts and ratios of pro-/anti-inflammatory (TNF-α/IL-10) cytokine gene expressions, but increased IL-10 gene expression amounts in activated inflammatory macrophages, supporting a substantial anti-inflammatory potential of Q and Q3G treatments. However, Q3G had lower effects than those of Q. Importantly, Q inhibited TLR2 gene expression and phosphorylation of STAT3 protein in the inflamed cells. Our results are the first report to suggest that Q inhibits LPS-induced inflammation ex vivo through suppressing TLR2 gene expression and STAT3 protein phosphorylation in activated inflammatory macrophages. Q has potential to further apply for treating inflammation-associated diseases.

Diatomite (DME) consists of natural ordered porous structures that are excellent candidates as microcontainers. However, to the best of our knowledge, the application of DME loaded with corrosion inhibitors in anti-corrosion coatings has not hitherto been reported. In this study, DME has been used as a source of microcontainers to load benzotriazole (BTA) inhibitor by an immersion method. In order to prevent unwanted early release of the small molecule BTA inhibitor from the DME microcontainers, inspired by the adhesion characteristics of catechol and amine in mussel adhesion protein, polydopamine (PDA) was coated on their surfaces to generate BTA@DME/PDA microcapsules. Because of the depolymerization characteristics of PDA at low pH, the synthesize microcapsules showed a controllable release function. The SEM morphology, chemical structure, and loading capacity of the synthesized BTA@DME/PDA microcapsules were characterized. The corrosion resistances of epoxy coatings with different contents of BTA@DME/PDA microcapsules were compared by saline immersion and electrochemical impedance tests. A scratched coating with 5wt.% BTA@DME/PDA microcapsules showed the best anti-corrosion effect.

In the past decade, it has been discovered that intestinal flora can influence various organ-specific cancers by altering the body's energy balance, increasing obesity, synthesizing genetic toxins and small signaling molecules, initiating and modulating immune responses, and metabolizing indigestible dietary components, exogenous substances, and drugs. In this review, we will focus on elucidating the role of gut flora based on its molecular mechanisms and its potential therapeutic implications in head and neck tumors in the near future.

Recently, doubts were raised about the existence of the bilingual advantage in cognitive control. The aim of the present review was to investigate the bilingual advantage and its modulating factors. We searched the Medline, ScienceDirect, Scopus, and ERIC databases for all original data and reviewed studies on bilingualism and cognitive control, with a cut-off date of October 31, 2018, thereby following the guidelines of the Preferred Reporting Items for Systematic Reviews and Meta-analysis (PRISMA) protocol. The results of the 46 original studies show that, indeed, the majority, 54.3%, reported beneficial effects of bilingualism on cognitive control tasks; however, 28.3% found mixed results, and 17.4% found evidence against its existence. Methodological differences seem to explain these mixed results: particularly, the varying selection of the bilingual participants, the use of non-standardized tests, and the fact that individual differences were often neglected, and that longitudinal designs were rare. Therefore, a serious risk for bias exists in both directions (i.e., in favor of and against the bilingual advantage). To conclude, we found some evidence for a bilingual advantage in cognitive control; however, if significant progress is to be made, better study designs, bigger data, and more longitudinal studies are needed.

The number of patients with bone metabolic disorders including osteoporosis is increasing worldwide. These disorders often facilitate bone fractures, which seriously impact the patient’s quality of life and could lead to further health complications. Bone homeostasis is tightly regulated to balance bone resorption and formation. However, many anti-osteoporotic agents are broadly categorized as either bone forming or anti-resorptive, and their therapeutic use is often limited due to unwanted side effects. Therefore, safe and effective therapeutic agents are needed for osteoporosis. This study aims to clarify the bone protecting effects of oat bran water extract (OBWE) and its mode of action. OBWE inhibited RANKL-induced osteoclast differentiation by blocking c-Fos/NFATc1 through the alteration of I-κB. Furthermore, we found that OBWE enhanced BMP-2-stimulated osteoblast differentiation by the induction of Runx2 via Smad signaling molecules. In addition, the anti-osteoporotic activity of OBWE was also evaluated using an in vivo model. OBWE significantly restored ovariectomy-induced bone loss. These in vitro and in vivo results showed that OBWE has the potential to combat bone metabolic disorders including osteoporosis

Intestinal epithelial cell activities during homeostasis and regeneration are well described, but their potential interactions with stromal cells remain unresolved. Exploring the functions of these heterogeneous intestinal mesenchymal stromal cells (iMSCs) remains challenging due to the lack of specific markers for most functionally homogenous subpopulations. In recent years, however, novel clustering techniques such as single-cell RNA sequencing (scRNA-seq), fluorescence-activated cell sorting (FACS), confocal microscope, and computational remodeling of intestinal anatomy have helped identify and characterize some specific iMSC subsets. These methods help researchers learn more about the localization and functions of iMSC populations during intestinal morphogenic and homeostatic conditions. Furthermore, it is imperative to understand their cellular pathways for activation and how they interact with surrounding cellular components, particularly during intestinal epithelial regeneration that follows mucosal injury. This review provides insights into the spatial distribution and functions of some identified iMSC subtypes in intestinal morphogenesis, homeostasis, and regeneration. We reviewed related signaling mechanisms implicated during epithelial and subepithelial stromal cell crosstalk. Future research should focus on elucidating the molecular intermediates of these regulatory pathways to open a new frontier for potential therapeutic targets that can alleviate intestinal mucosa-related injuries.

Spatial crowdsourcing emerges as a new computing paradigm that enables mobile users to accomplish spatio- temporal tasks in order to solve human-intrinsic problems. Existing crowdsourcing systems critically use centralized servers for interacting with workers and making task assignment decisions. These systems are hence susceptible to issues such as the single point of failure and the lack of operational transparency. Prior work, therefore, turns to blockchain-based decentralized crowdsourcing systems, yet still suffers from problems of lacking efficient task assignment scheme, requiring a deposit to an untrusted system, low block generation speed, and high transaction fees. To address these issues, we design a blockchain-based decentralized framework for spatial crowdsourcing, which we call SC-EOS. Our system does not rely on any trusted servers, while providing efficient and user-customizable task assignment, low monetary cost, and fast block generation. More importantly, it frees users from making a deposit into an untrusted system. Our framework can also be extended and applied to generic crowdsourcing systems. We implemented the proposed system on the EOS blockchain. Trace-driven evaluations involving real users show that our system attains the comparable task assignment performance against a clairvoyant scheme. It also achieves 10× cost savings than an Ethereum-based implementation.