In this paper, a multi-mode waveguide-based optical resonator is proposed for an integrated optical refractive index sensor. Conventional optical resonators have been studied for single-mode waveguide-based resonators to enhance the performance, but mass production is limited owing to the high fabrication costs of nano-scale structures. To overcome this problem, we designed an S-bend resonator based on a micro-scale multi-mode waveguide. In general, multi-mode waveguides cannot be utilized as optical resonators, because of a performance degradation resulting from modal dispersion and an output transmission with multi-peaks. Therefore, we exploited the mode discrimination phenomenon using the bending loss, and the resulting S-bend resonator yielded an output transmission without multi-peaks. This phenomenon is utilized to remove higher-order modes efficiently using the difference in the effective refractive index between the higher-order and fundamental modes. As a result, the resonator achieved a Q-factor and sensitivity of 2.3x10³ and 52 nm/RIU, respectively, using the variational finite-difference time-domain method. These results show that the multi-mode waveguide-based S-bend resonator with a wide line width can be utilized as a refractive index sensor.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

The corrosion of prestressing steel in prestressed concrete bridges is a critical issue for bridge maintenance. To assess structures with corroded strands, it is necessary to define the mechanical properties of the strands and their influence on the structural behavior. In this study, corroded strands are taken from external tendons in existing bridges and tested to define the effects of corrosion on the tensile properties of the strand. Empirical equations for the tensile strength and ductility of the corroded strand are proposed using test results. The most corroded wire governs the mechanical properties of the strand. Experiments on prestressed concrete beams with a single corroded strand are conducted to investigate the structural behavior. A reduction in the flexural strength and maximum deformation is observed from the experiment. According to the section loss of a wire in a strand and its location in a beam, the flexural capacity can be evaluated using the proposed equation. The reduced ultimate strain of the corroded strand can be the governing factor of the flexural strength.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

This study investigated the effects of silibinin, derived from milk thistle (Silybum marianum), on lipopolysaccharide (LPS)-induced morphological changes in mouse macrophages. Silibinin was treated at various doses and time points to assess its effects on macrophage activation including morphological changes and phagocytosis. Silibinin effectively inhibited LPS-induced pseudopodia formation and size increase, while unstimulated cells remained round. Silibinin's impact on phagocytosis was dose- and time-dependent, showing a decrease. We explored its mechanism of action on kinases using a MAPK array. Among the three MAPK family members tested, silibinin had a limited effect on JNK and p38 but significantly inhibited ERK1/2 and related RSK1/2. Silibinin also inhibited MKK6, AKT3, MSK2, p70S6K, and GSK-3β. These findings highlight silibinin's potent inhibitory effects on phagocytosis and morphological changes in macrophages. We suggest its potential as an anti-inflammatory agent due to its ability to target key inflammatory pathways involving ERK1/2 and related kinases. Overall, this study demonstrates the promising therapeutic properties of silibinin in modulating macrophage function and inflammation.

In the past decade, it has been discovered that intestinal flora can influence various organ-specific cancers by altering the body's energy balance, increasing obesity, synthesizing genetic toxins and small signaling molecules, initiating and modulating immune responses, and metabolizing indigestible dietary components, exogenous substances, and drugs. In this review, we will focus on elucidating the role of gut flora based on its molecular mechanisms and its potential therapeutic implications in head and neck tumors in the near future.

Veterinary antibiotics (VAs) have been indiscriminately used in animal feed for the past five decades to increase and ensure profits with negligible environmental considerations. The VAs amoxicillin (AMX), chlortetracycline (CTC), and oxytetracycline (OTC), which can be unintentionally introduced by irrigation water during rice cultivation, were evaluated for their phytotoxic effects, absorption-translocation into plants, and soil residues using a randomized complete block design. It was found that exposure to VAs can severely affect the photosynthetic pathway of rice plants. The uptake and translocation of VAs by rice plants varied significantly. CTC and OTC translocated more easily than AMX, a member of the β-lactam class, which accumulated at the lowest concentration compared to CTC and OTC across all treatments. Rice yield was about 4.3 - 5.7% lower in the experimental plots that received fifty-fold the background levels of VAs compared to the control. The findings indicate that these widely used veterinary antibiotics can hamper crop production, leave residues in the soil, and constitute a risk to human health if introduced into the agro-ecosystem unintentionally.

This study investigated a novel radioimmunotherapy strategy for targeting tumor angiogenesis. We developed a radiopharmaceutical complex by labeling an anti-adenosine triphosphate syn-thase (ATPS) monoclonal antibody (mAb) with the radioisotope 177Lu using DOTA as a chelating agent. 177Lu-DOTA-ATPS mAb demonstrated high labeling efficiency (99.0%) and stability in se-rum. MKN-45 cancer cells exhibited the highest cellular uptake, which could be specifically blocked by unlabeled ATPS mAb. In mice, 177Lu-DOTA-ATPS mAb accumulated significantly in tumors, with a tumor uptake of 16.0 ± 1.5%ID/g on day 7. 177Lu-DOTA-ATPS mAb treatment sig-nificantly reduced the viability of MKN-45 cells in a dose-dependent manner. In a xenograft tumor model, this radioimmunotherapy strategy led to substantial tumor growth inhibition (82.8%). Furthermore, combining 177Lu-DOTA-ATPS mAb with sunitinib, an anti-angiogenic drug, en-hanced the therapeutic efficacy of sunitinib in the mouse model. Our study successfully developed 177Lu-DOTA-ATPS mAb, a radioimmunotherapy agent targeting tumor blood vessels. This ap-proach demonstrates significant promise for inhibiting tumor growth, both as a single therapy and in combination with other anti-cancer drugs.

We investigate, whereas the SU(4)/SU(2) model, is viable for describing strong interactions. The existing problems of confinement and asymptotic freedom, two phenomena that can not be described by the SU(3) model, might indicate that we need something "larger" than the SU(3) model. The considered coset SU(4)/SU(2) or the Stiefel manifold V^2(C_4) contains an su(3) algebra, plus additional degrees of freedom that resembes the Feddev-Poppov concept. The richer structure of this coset, give us enough room, to seek for new phenomena, as its dimensionality is 12. The consideration of the SU(4)/SU(2) model flavors firstly the unification of nuclear fields (strong and weak) in an SU(4) model.

This paper discusses two major applications of SU(3) theory, the first being the question of quantum brachistochrones and problems in time optimal control theory, the second being the use of spherical tensor decompositions of the special functions which are associated to SU(3) via the isotropic oscillator. We discuss the derivation of the quantum brachistochrone problem more generally from the perspective of von Neumann equations and matrix mechanics, arriving at an equivalent formulation to the Lagrangian method. Discussion is given to the application of such advanced methods in quantum computation, and some future directions that may be amenable to a similar sort of an

An 8-month-old, 3.4 kg, castrated male Toy Poodle was referred for progressive tetraparesis and respiratory disorder without a history of trauma. Diagnostic imaging, including dynamic CT and MRI, revealed concurrent atlanto-occipital dislocation (AOD) and atlantoaxial instability (AAI) with spinal cord compression. This case was unique due to its congenital nature and the absence of trauma. The surgical intervention involved precise removal of the C1 vertebra's ventral articular facet, which was compressing on the spinal cord, attributed to its fixed and malaligned position within the atlantooccipital joint. Following facetectomy, the stabilization of the occipital bone to the C2 vertebra was achieved by screws, wire, and polymethyl methacrylate. Postoperative recovery was monitored with CT and radiographs, showing successful decompression and gradual improvement in gait, despite mild residual ataxia. The dog experienced postoperative complications with screw loosening at 114 days, which was managed successfully by extracting the problematic screws. Postoperatively, the dog showed a near-normal gait and experienced no pain through 21 months of monitoring. This case represents the first report of concurrent congenital AOD and AAI treated with ventral surgical approach, contributing new insights to the understanding and management of such complex cranio-cervical junction disorders in veterinary neurosurgery.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

The purpose of this study is to analyze the causes of cost variation in natural disaster prevention projects (NDPP) in Gyeongsangbuk-do and to develop effective cost and risk management strategies. The study collected data by conducting an online survey of 244 stakeholders. Binary logistic regression was used to analyze the impact of various variables on cost deviation, in-cluding project management risk (PMR), project costing and execution risk (PCER), project exe-cution strategy risk (PESR), construction project risk (CPR), project cost and schedule risk (PCSR), project management challenges (PMC), and construction project subcontractor and safety man-agement (CPSSM). The results showed that PMR (OR=3.744, 95% C.I. [1.657, 8.457]), PCER (OR=5.068, 95% C.I. [2.236, 11.484]), PESR (OR=3.447, 95% C.I. [1. 853, 6.413]), CPR (OR=2.292, 95% C.I. [1.020, 5.151]), PCSR (OR=4.817, 95% C.I. [2.250, 10.317]), PMC (OR=2.954, 95% C.I. [1.452, 6. 013]), and CPSSM (OR=2.419, 95% C.I. [1.297, 4.515]) had statistically significant effects on cost deviation. In particular, PMR, PCER, and PESR were identified as the main causes, and the effects of additional factors such as CPSSM were also important. The developed predictive model plays an important role in helping stakeholders of NDPP to manage risks in advance and take appro-priate preventive measures to ensure the success of the project. This study empirically supports the theoretical hypotheses of previous studies and provides a clear understanding of the causes of cost deviation in NDPP, which provides important insights for strategic decision-making and provides a new perspective on risk management.

In Korea, rice is a major staple grain and is mainly cultivated using various agricultural machinery. Air pollutants emitted from agricultural machinery have their origins mainly from the exhaustion of internal combustion engines. In this study, emission characteristics of five main air pollutants by European Environment Agency's Tier 1 method for rice cultivation was analyzed. Diesel is a main fuel for agricultural machinery and gasoline is generally used only for rice transplanters as a fuel in Korea. Tractors consume 46% of total fuel consumption and 56% of diesel fuel consumption. Gasoline used for rice transplanters accounts for 17% of total fuel consumption each year. Tractors and rice transplanters are emitting 82% of all total pollutants. From 2011 to 2019, the total amount of air pollutant emissions was decrease by 15%. That accounted for the reduction of rice cultivation fields in those periods. Rice transplanting operation was in charge of 42% of total emissions. Then, harrowing, harvesting, tilling, leveling, and pest control operations generated 10%, 10%, 8%, 8% and 7% of total emissions, respectively. The contribution of each air pollutant held 54% of CO, 39% of NOx, 5% of NMVOC, and 2% of TSP from the total emission inventory. The three major regions emitting air pollutants from mechanized agricultural practices were Jeollanam-do, Chungcheongnam-do, and Jeollabuk-do, which consume 55% of total fuel usage in rice farming. The total amount of air pollutant emissions from rice cultivation practices in 2019 was calculated as 8,448 Mg in Korea.

Deep learning is widely used in image segmentation, effectively identifying crops and weeds and contributing to the reduction of herbicide use. Traditional methods of applying pesticides over large areas are inefficient in dealing with weeds as needed, leading to massive waste of pesticides, high-cost production, and serious environmental pollution. This affects crop yield and quality. Although weed recognition using conventional deep learning methods has evolved over time, there are still challenges in weed extraction, detection, and segmentation. Accurate recognition and detection of weeds are essential prerequisites for implementing variable spraying. This paper proposes a semantic segmentation method based on UNet++ for complex environments where accurate identification of plants and weeds is challenging, targeting weeds in sugar beets, peas, and rice. An attention module is integrated into the upsampling process of UNet++, and UNet++ is used as a backbone network to effectively integrate multi-scale information, efficiently suppressing external noise interference. The UNet++ model with an integrated attention mechanism module achieves higher IOU than the general UNet++ model used in medical image analysis. This method effectively detects crops and weeds in complex backgrounds, providing reference material for the accurate application of robotic herbicides.

Shale gas content is the key parameter for shale gas potential evaluation and favorable area prediction. Therefore, it is very important to determine shale gas content accurately. Generally, we use the USBM method for coal reservoirs to calculate gas content of shale reservoirs. However, shale reservoirs are different from coal reservoirs in depth, pressure, core collection, etc. This method would inevitably cause problems. In order to make the USBM method more suitable for shale reservoir, an improved USBM method is put forward on the basis of systematic analysis of core pressure history and temperature history during shale gas desorption. The improved USBM method modifies the calculation method of the lost time, and determines the temperature balance time of water heating. In addition, we give the calculation method of adsorption gas content and free gas content, especially the new method of calculating the oil dissolved gas content and water dissolved gas content which are easily neglected. We used the direct method (USBM and the improved USBM) and the indirect method (adsorption gas, free gas and dissolved gas) to calculate the shale gas content of 16 shale samples of the Triassic Yanchang Formation in the Southeastern Ordos Basin, China. The results of the improved USBM method show that the total shale gas content is high, with an average of 3.97 m³/t, and the lost shale gas content is the largest proportion with an average of 62%. The total shale gas content calculated by the improved USBM method is greater than that of the USBM method. The results of the indirect method show that the total shale gas content is large, with an average of 4.11 m³/t, and the adsorption shale gas content is the largest proportion with an average of 71%. The oil dissolved shale gas content which should be taken attention accounts for about 7.8%. The relative error between the improved USBM method and indirect method is much smaller than that between USBM method and indirect method, which verifies the accuracy of the improved USBM method.

: Cnidium officinale Makino, a perennial crop in the Umbeliperae family, is harvested in the summer for medicinal purposes. The average temperature in Korea has recently increased, and consequently, the area used to cultivate C. officinale has been reduced, and plant disease and soil sickness have increased. In this study, rhizosphere bacteria were isolated from C. officinale, and their antagonistic activity evaluated against Fusarium solani, which is a major issue during repeated cultivation. Twenty-eight strains were isolated from the root and rhizosphere soil, of which seven showed antagonistic activity against F. solani and were further investigated. An in planta test found that the dead rate of shoots was significantly lower in the group inoculated with PT1 isolated from the root tissue and that the fresh and dry weights were also higher, when compared with the other groups. PT1 was thus considered to have antagonistic activity against F. solani. The 16S rRNA analysis identified the PT1 as Leclercia adecarboxylata, and downstream studies confirmed the production of enzymes related to antagonism, such as siderophore and N-acetyl-β-glucosaminidase. The phosphorous solubilizing ability and secretion of related enzymes were also confirmed. The results indicate that PT1 could be utilized as a PGPR to help control fusarium wilt.

Artificial intelligence (AI) agents are widely used in the retail and distribution industry, often in-corporating human-like elements such as possessing names and genders. This paper examines the influence of AI agent gender and brand concepts on trust and grounding within virtual brand spaces; exploring the correlation between user identification with AI agents and subsequent brand recommendations. The study revealed that in virtual brand spaces centered around a functional concept, male AI agents generated higher levels of trust than female AI agents, whereas, when focused on an experiential concept, female AI agents induced higher levels of grounding than male AI agents. Furthermore, this research indicates that the association between customers’ iden-tification with AI agents and recommendations for actual brand purchases is mediated by trust and grounding. These findings support the idea that users who strongly identify with AI agents are more inclined to recommend brand products after engaging in conversations within the virtu-al brand space.

Introduction With the global population increasingly relying on the internet for information, YouTube has emerged as a significant platform for communication and information sharing, particularly in the field of medicine. However, concerns persist regarding the reliability and quality of medical information on YouTube, given the lack of regulation and guidelines. This study aims to systematically evaluate the reliability of health-related information on YouTube. Methods: Data collection was conducted in September 2023 on YouTube, with stringent selection criteria for videos. Videos were evaluated using the "Internet Health Information Certification Standards" by the Korean Medical Association and the Global Quality Scale. A plastic surgeon assessed information quality based on specific criteria. The study analyzed the influence of keywords on information accessibility and compared the evaluation tools. Results: 76 Korean search results were analyzed using keywords. Certified South Korean medical providers appeared more in "ptosis surgery" results (50%) than "droopy eyelid diagnosis" (5%). Medical professionals produced 86.7% of videos, with some non-medical content. "Ptosis surgery" had the highest KMA scale score (16.3), "droopy eyelid diagnosis" the lowest (13.8). Out of 76 videos, 39 by plastic surgeons, 20 by ophthalmologists, and 5 by dermatologists. A GQS comparison showed specialists with higher scores (3.12) than non-specialists (1.53). Conclusion: YouTube and similar platforms offer valuable access to medical information, but quality and reliability remain significant concerns. Collaborative efforts from government agencies, medical organizations, and users are essential to enhance the quality of online health information. Users should also cultivate critical thinking skills to discern trustworthy information.

Ecklonia cava (E.cava) can alleviate vascular dysfunction in diseases associated with poor circulation. E. cava contains various polyphenols with different functions, but few studies have compared the effects of these polyphenols. Here, we comparatively investigated four major compounds present in an ethanoic extract of E. cava. These four major compounds were isolated and their effects were examined on monocyte-associated vascular inflammation and dysfunctions. Pyrogallol-phloroglucinol-6,6-bieckol (PPB) significantly inhibited monocyte migration in vitro by reducing levels of inflammatory macrophage differentiation and of its related molecular factors. In addition, PPB protected against monocyte-associated endothelial cell death by increasing the phosphorylations of PI3K-AKT and AMPK, decreasing caspase levels, and reducing monocyte-associated vascular smooth muscle cell proliferation and migration by decreasing the phosphorylations of ERK and AKT. The results of this study show that four compounds were effective for reduction of monocyte-associated vascular inflammation and dysfunctions, but PPB might be more useful for the treatment of vascular dysfunction in diseases associated with poor circulation.

Hizikia fusiformis is a common, edible marine alga found in Asia. Although the anticancer activity of its extracts has previously been investigated, its active compounds have not been identified. In this study, saringosterol acetate (SA) was isolated from H. fusiformis extracts by centrifugal partition chromatography (CPC) system (two phase solvents condition: n-hexane:ethyl acetate/methanol:water = 5:3:7:1, v/v), exhibited anticancer effects in the human lung adenocarcinoma epithelial cell line, A549, by inducing apoptosis and sub-G1 phase cell cycle arrest. In addition, SA increased the expression of the pro-apoptotic proteins, Bax and cleaved caspase 3, and decreased that of the anti-apoptotic protein Bcl-xL. Although, SA did not affect the expression of p53, induces expression of Bid and caspase 8. In conclusion, we suggested that SA induces apoptosis against A549 cells via Bid and caspase 8 dependent pathway.

The development of printing technologies has enabled the realization of electric circuit fabrication on flexible substrate. However, the current technique remains restricted to single-layer patterning. In this paper, we demonstrate a fully solution-processable patterning approach for multi-layer circuits using a combined method of laser sintering and ablation. Selective laser sintering of silver (Ag) nanoparticle-based ink is applied to make conductive patterns on a heat-sensitive substrate and insulating layer. The laser beam path and irradiation fluence are controlled to create circuit patterns for flexible electronics. Microvia drilling using femtosecond laser through the polyvinylphenol-film insulating layer by laser ablation, as well as sequential coating of Ag ink and laser sintering, achieves an interlayer interconnection between multi-layer circuits. The dimension of microvia is determined by a sophisticated adjustment of laser focal position and intensity. Based on these methods, the flexible electronic circuit with chip-size-package light-emitting diodes was successfully fabricated and demonstrated with functional operations.

The cyclic lipopeptide produced from Bacillus pumilus strain HY1 was isolated from Korean soybean sauce. The chemical structures of the surfactin isomers were analyzed using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) and electrospray ionization tandem mass spectrometry (ESI-MS/MS). The five potential surfactin isoforms were detected with protonated masses of m/z 994.7, 1,008.7, 1022.7, 1036.7, and 1,050.7 and different structures in combination with Na+, K+, and Ca2+ ions. ESI-MS/MS analysis revealed that the isolated surfactin possessed the precise amino acid sequence LLVDLL and hydroxyl fatty acids with 12 to 16 carbons. The surfactin content during cheonggukjang fermentation increased from 0.3 to 51.2 mg/kg over 60 h of fermentation. The surfactin extraction of cheonggukjang inhibited the growth of two cancer cell lines. The growth of both MCF-7 and Caco-2 cells was strongly inhibited with 100 μg/μL surfactin. These results suggest that surfactins produced from strain HY1 have anticancer properties.

We report on recent experimental results on β decay into self-conjugate (N=Z) nuclei with mass number 58≤A≤70. Super-allowed β decays from the Jπ=0+ ground state of a Z=N+2 parent nucleus are to the isobaric analogue state, through so-called Fermi transitions, and to Jπ=1+ states, by way of Gamow–Teller (GT) transitions. The operator of the latter decay is a generator of Wigner’s SU(4) algebra and as a consequence GT transitions obey selection rules associated with this symmetry. Since SU(4) is progressively broken with increasing A, mainly as a consequence of the spin–orbit interaction, this symmetry is not relevant for the nuclei considered here. We argue, however, that the pseudo-spin–orbit splitting can be small in nuclei with 58≤A≤70, in which case nuclear states exhibit an approximate pseudo-SU(4) symmetry. To test this conjecture, GT decay strength is calculated with use of a schematic Hamiltonian with pseudo-SU(4) symmetry. Some generic features of the GT β decay due to pseudo-SU(4) symmetry are pointed out. The experimentally observed GT strength indicates a restoration of pseudo-SU(4) symmetry for A=70.

In this study, we evaluated the antibacterial effect against Staphylococcus aureus and Salmonella Typhimurium in fried fish paste using floating electrode-dielectric barrier discharge (FE-DBD) plasma (1.1 kV, 43 kHz, N2 1.5 m/s, 1-60 min). In addition, quality evaluation (pH, VBN) of fried fish paste was conducted after FE-DBD plasma treatment. When FE-DBD plasma was treated for 1, 5, 10, 20, 30 and 60 min, S. aureus decreased by 0.16-1.13 log10 CFU/g, and S. Typhimurium decreased 0.25-1.13 log10 CFU/g. Both decreased > log10 CFU/g at 60 min. The D-value was 58.92 and R2 was 0.97 for S. aureus using first-order kinetics, and the D-value was 43.60 and R2 was 0.97 for S. Typhimurium using the Weibull model. There was no significant difference in pH after FE-DBD plasma treatment (p > 0.05). However, volatile basic nitrogen (VBN) significantly decreased as the treatment time increased (p < 0.05), and it was the lowest at 60 min to 3.46. Therefore, FE-DBD plasma treatment could be considered as a technology for preserving the quality of processed foods.

This paper studies the evaporative heat transfer characteristics of R744 at low temperatures in a horizontal smooth tube as a cascade refrigeration system (CRS) among hybrid cascade refrigeration systems (HCRSs). There is a lack of research on the low-temperature evaporative heat transfer characteristics of R744 under the operating conditions of evaporators used in actual CRSs used in supermarkets. Therefore, this study aims to provide basic data on the evaporative heat transfer characteristics of R744 in the evaporators of refrigerators used in supermarkets. The tube used in the evaporation experiment conducted herein was a smooth horizontal copper tube with an inner diameter and length of 11.46 mm and 8000 mm, respectively. The experimental pa-rameters were as follows: heat fluxes of 12–21.5 kW/m2, mass fluxes of 75–225 kg/(m2·s), and saturation temperatures of −50–−30 °C. The main results are summarized as follows. (1) When designing the R744 evaporator, the mass and heat fluxes must be maximized within the operating conditions, and the saturation temperature must be designed to be as low as possible. (2) The evaporative heat transfer coefficient of R744 can be predicted well by using the correlation formula of Chen at the evaporation temperature of −40 °C in the CRS.

The deterioration of soil-cement in corrosive environment leads to the reduction of strength and the increase of permeability. Effective methods of determining deteriorated layer permeability coefficient of soil-cement are currently lacking. A laboratory test method for permeability coefficient of deteriorated layer was proposed using the modified permeability coefficient testing apparatus. According to the proposed method, the permeability coefficient of deteriorated layer can be obtained after testing the permeability coefficient of the soil-cement specimen in curing room and the equivalent permeability coefficient and deterioration depth of the soil-cement specimen in corrosion environment. Taking the marine dredger fill of Jiaozhou Bay for example, the deteriorated layer permeability coefficients of soil-cements with different cement contents were tested. It turned out that the permeability of deteriorated layer increases with the increase of age. At the beginning of curing age, larger cement content leads to smaller permeability coefficient of the deteriorated layer of soil-cement. As the curing age increases, the deteriorated layer permeability coefficient of the soil-cement with larger cement content becomes larger. The evolution of the permeability coefficient of deteriorated layer with age can be formulated as the Logistic function. This study provides a support for anti-permeability designs of soil-cement structures in corrosive environment.

The scalp is a unique anatomical region with distinct challenges for reconstruction, especially in cases of melanoma excision. This study explores the utilization of the O-Z flap technique as an alternative approach for patients with melanoma, where traditional free flap reconstruction may not be feasible due to age or underlying health conditions. However, in this case, the patient had a history of angina and was unwilling to undergo a long operation due to his advanced age. This study highlights the importance of following NCCN guidelines for melanoma resection margins based on tumor thickness and underscores the value of staged resection planning to minimize deficits. This requires an individualized approach as each patient may have different circumstances (general health condition, age, compliance, etc.). So we planned a staged excision first. In the first surgery, we would resect the tumor minimally and then determine the exact size of the tumor. Then, in the second surgery, we resected it with a safety margin according to the guidelines. The O-Z flap, a local flap with an "O"-shaped defect and "Z"-shaped incision line, is introduced as a reconstructive option. The surgical procedure, advantages, and limitations of this approach are discussed. This study provides valuable insights into achieving successful scalp reconstruction while considering aesthetic outcomes and patient-specific factors.

This study aimed to elucidate the antibacterial efficacy and unique chemical compositions generated from plasma-activated water (PAW) when utilized a novel vaginal cleansing device. We conducted an analysis of antibacterial activity against probiotics and several chemical compositions including ions under various operational parameters of PAW, including electrical power (12 and 24 V), treatment duration (1, 10, and 20 min), and stay duration (immediate, 30 and 60 min). Our findings revealed that as treatment duration increased, hypochlorous acid (HOCl), Ca2+, and Mg2+ concentrations increased and Cl−concentrations decreased. Higher electrical power and longer treatment duration resulted in increased HOCl levels, which acts to prevent the growth of general microorganisms. Notably, PAW exhibited no antibacterial effects against a type of probiotic, Lactobacillus reuteri that produces lactic acid for vaginal health. This result demonstrated the ability of the vaginal cleaning device to generate ions, primarily HOCl and some cations (Ca2+ and Mg2+), thereby providing vaginal mucosa protecting and cleansing effects with the vaginal environment.

Power system decentralization has been an emerging topic for the past decade in an effort to improve power quality and environment protection via increased integration of renewable energy sources. Towards these objectives, decentralized microgrids have been proposed and thoroughly investigated in terms of technical capabilities and economic performance. In fact, the planning and actual operation of small-scale, decentralized microgrids has started in countries such as Canada, Japan, USA, UK and other countries. It is expected that the research in this area will progress and eventually take over the existing paradigm of large-scale power generation in the future. These small-size decentralized microgrids could be connected with nearby microgrids under normal operating conditions, but under special events, such as natural or man-made disasters, they would be disconnected and run in islanded mode. Under such high impact – low probability events, the microgrid must have resiliency to successfully re-connect with other microgrids and the main grid. In this paper, an Energy Management System (EMS) for a microgrid having a resiliency function, allowing to operate under islanded mode after an accident, is proposed. The proposed tool, called Resilient Energy Management System (ResEMS), aims at procuring reserve power into the microgrid’s Battery Energy Storage System (BESS) effectively, by importing it from the nearby connected power system. The accident is assumed to be a predictable natural disaster, which means that the accident occurrence time, duration and level of damage can be estimated. The proposed ResEMS has been applied to a microgrid comprising of a BESS, a diesel generator and several photovoltaic devices. The simulation results verify its beneficial operation.

This study investigated the impact of boron and copper on the microstructure and mechanical properties of Spheroidal graphite Cast Iron (SCI). The addition of boron increased the ferrite content, while copper increased the stability of pearlite. The interaction between boron and copper significantly increased the ferrite content. Differential Scanning Calorimetry (DSC) revealed that boron decreased the enthalpy change of the α + Fe3C -> γ transformation and increased the enthalpy change of the α -> γ transformation. The addition of boron and copper reduced the tensile and yield strength but increased elongation and impact energy. The findings provide valuable insights into the effect of boron and copper on SCI, facilitating the design and development of high-performance SCI materials.

Mumps is the second-most reported infectious disease in South Korea; however, due to the low pathogen confirmation rate in laboratory diagnoses, we proposed a method for reevaluating the high incidence rate via the laboratory verification of other viral diseases. In 2021, 63 cases of pharyngeal or cheek mucosal swabs of suspected mumps cases in Gwangju, South Korea, were assessed for causative pathogens using massive simultaneous pathogen testing (TaqManTM Array Cards). More than one respiratory virus was detected in 60 cases (95.2%), 44 (73.3%) of which were co-detected. Human rhinovirus was detected in 47 cases, followed by human herpesvirus (HHV)6 in 30; HHV4 (17), human bocavirus (17), HHV5 (10), and human parainfluenza virus 3 (6) were also detected. Our findings suggest the need for further investigations on the pathogenesis of diseases mimicking mumps, which are considered to aid with appropriate public health responses, treatment, and the prevention of infectious disease outbreaks.

In the first part of this talk we review some prerequisites for and essential arguments involved in the construction of the thermal-ground-state estimate for the deconfining phase in the thermodynamics of SU(2) Quantum Yang-Mills theory and how this structure supports its distinct excitations. The second part applies deconfining SU(2) Yang-Mills thermodynamics to the Cosmic Microwave Background in view of (i) a modified temperature-redshift relation with an interesting link to correlation-length criticality in the 3D Ising model, (ii) the implied minimal changes in the dark sector of the cosmological model, and (iii) best-fit parameter values of this model when confronted with the spectra of the angular two-point functions TT, TE, and EE, excluding the low-$l$ physics. The latter, which is treated in an incomplete way because of the omission of radiative effects, is addressed in passing towards future work.

Ovarian cancer poses a significant therapeutic challenge owing to the lack of specific targets for treatment. New treatment strategies are needed to improve patient outcomes and reduce the toxicity of existing therapies. This study aimed to investigate the synergistic effects of recombi-nant human apurinic/apyrimidinic endonuclease 1/redox factor 1 (rhAPE1/Ref-1) and aspirin on PEO14 and CAOV-3 ovarian cancer cells and human umbilical vein endothelial cells (HUVECs). Specifically, this study examined the mechanisms underlying the effect of rhAPE1/Ref-1 and as-pirin on cell death and the associated pathways. Cell viability was assessed using the MTT assay, and flow cytometry analysis and caspase-3/7 activity assays were conducted to determine apop-tosis. Western blotting was performed to evaluate the cleavage of poly(ADP-ribose) polymerase (PARP). Exposure to aspirin (3 mM) for 24 h did not affect cell viability in PEO14. Co-incubation of aspirin with rhAPE1/Ref-1 in PEO14 cells led to rhAPE1/Ref-1 acetylation and intracellular hyperacetylation. Co-treatment with aspirin (3 mM) and rhAPE1/Ref-1 induced a rhAPE1/Ref-1 concentration-dependent increase in cell death, particularly in PEO14 cells, as well as apoptosis, caspase-3/7 activation, and PARP cleavage. Furthermore, this combination treatment significantly increased paclitaxel-induced PEO14 cell death. Therefore, co-administration with rhAPE1/Ref-1 and aspirin is a potential strategy for ovarian cancer treatment.

Age-related hearing loss (ARHL) is the most common sensory disorder in the elderly. It is associated with aging and hair cell death due to oxidative stress-induced mitochondrial dysfunction. Although transgenic mice and long-term cultures for induction of aging have been used to study ARHL, there are presently no ARHL animal models stimulated by intermittent environmental change for aging. In this study, an ARHL animal model was established by inducing continuous oxidative stress to promote short-term aging of cells, determined based on the expression of the hearing loss-induced phenotype and aging related factors in the short term. The incidence of hearing loss was significantly different among the groups subjected to intermittent hypoxic environment, high-fat diet (HFD), and injection with D-galactose. Continuous oxidative stress and HFD were factors that accelerated cellular aging. Increase in UCP2 affected oxidative stress and mitochondrial dysfunction. CDH23, SLC26A4, KCNQ4, Myo7a, and Myo6, which are ARHL-related factors, were modified by oxidative stress in cells of the hearing organ. We found that intermittent hypoxic, HFD, and galactose injection accelerated cellular aging in the short term. Thus, we anticipate that the development of this hearing loss animal model, which reflects intermittent environmental changes, will benefit future research on ARHL.

Gauge fields control the dynamics of fermions, also a back reaction of fermions on the gauge field is expected. This back reaction is investigated within the vortex picture of the QCD vacuum. We show that the center vortex model reproduces the string tension of the full theory also with the presence of fermionic fields.

Gauge fields control the dynamics of fermions. On the other hand a back reaction of fermions on the gauge field is expected. This back reaction is investigated within the vortex picture of the QCD vacuum.

The number of fishers working on commercial fishing vessels worldwide is approximately 159,800 according to the Food and Agriculture Organization of the United Nations. The International Labour Organization estimates that the mean annual number of deaths during fishing is approximately 24,000. Most guidelines for the prevention of marine accidents have been developed with a focus on vessels involved in international navigation. As these guidelines may have parts that are unsuitable for application in small-scale boats operating in coastal areas, appropriate modifications are required. This study analyzed quantitative data on 1,790 marine accidents that occurred in trap fishery, a globally common type of fishery, and data obtained through a survey of 101 fishers in South Korea. A guideline to reduce the rate of fatal accidents was developed using the Bayesian network, a method used for the analysis of accidents, as suggested in the formal safety assessment protocol. The results of data analysis and the developed guidelines are expected to be beneficial to all fishers involved in trap fishery across many countries worldwide.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

A two-qubit Hamiltonian model exhibiting an SU(2) symmetry is considered. The related dynamical problem results to be then exactly solvable both in the time-independent and in the time-dependent case. Basing on the formal, general form of the related time evolution operator, the time-dependence of the level of entanglement of some initial conditions is studied within both the Rabi and the Landau-Majorana-Stückelber-Zener scenarios.

New analysis regarding the structure of center vortices and their color structure is presented: Using data from gluonic SU(2) lattice simulation with Wilson action a correlation of fluctuations in color space to curvature of vortex fluxes was found. Finite size effects of the S2-homogeneity hint at color homogeneous regions on the vortex surface.

In pursuit of carbon neutrality, the demand for metals that are necessary for the development of clean energy technologies is rapidly increasing. Metallurgical waste, such as slag, presents a promising secondary source of these key metals. This research aims to develop an eco-friendly hydrometallurgical process to recover Cu, Ni, and Co from discarded copper/nickel slag. The high-pressure acid leaching (HPAL) was used to selectively leach Ni, Cu, and Co from the fayalite slag, yielding high leaching efficiencies of 99.9%, 89.4%, and 99.9%, respectively, with low Fe and Si tenors to the pregnant leach solution (PLS). The solvent extraction (SX) technique utilizing LIX 984N was used to selectively extract and enrich copper from the dilute PLS to about 23 g/L Cu with a very low Fe concentration of 0.05 g/L. Potassium amyl xanthate (PAX) solution was used to form Ni and Co xanthate complexes from the raffinate solution. Nickel was selectively recovered using ammonia solution, while cobalt xanthate complex was thermally decomposed and recovered as cobalt oxide solids of about 25 wt.% Co. A comprehensive process flowsheet is presented, furthermore, to realize the real application of the developed slag cleaning process, a preliminary economic evaluation was performed.

Halide perovskite materials gain enormous attention for their semiconducting properties, higher power conversion efficiency and potential applications in a wide range field of studies along with their two key limitations: stability and toxicity. In spite of great progress made on the halide perovskites and many promising research developments, overcoming these limitations is not realized yet. Therefore, coordination engineering of new framework for obtaining alternative new halide perovskite materials and fundamental understanding of the coordination chemistry and electronic interactions forming the structure of these newly engineered halide perovskite materials might be one way in order to overcome the issues related to both stability and toxicity. In this review, the current development of halide perovskite families, both lead halide perovskites and lead free halide perovskites followed by coordination engineering of the new frameworks to engineer new halide perovskite materials will be reviewed comprehensively. Moreover, all the concerns of the fundamental ideas of coordination chemistry and electronic interactions that are keys in forming the halide perovskite structures are discussed in detail and form the main aim of this review. Interestingly, we also discuss recent potential energy applications beyond photovoltaic and this review has completed with an essential and open question: ‘what could happen in the future of halide perovskites?’ in order to excite commercial enterprises and research institutions again as well as to get motivating new predictions on the future continuity of this field.

In the past decade, targeted therapies for solid tumors, including non-small cell lung cancer (NSCLC), have advanced significantly, offering tailored treatment options for patients. However, individuals without targetable mutations pose a clinical challenge, as they may not respond to standard treatments like immune-checkpoint inhibitors (ICIs) and novel targeted therapies. While the mechanism of action of ICIs seems promising, the lack of a robust response limits their widespread use. Although the expression levels of programmed death ligand 1 (PD-L1) on tumor cells are used to predict ICI response, identifying new biomarkers, particularly those associated with the tumor microenvironment (TME), is crucial to address this unmet need. Recently, inflammatory cytokines such as interleukin-1 beta (IL-1β) have emerged as a key area of focus and hold significant potential implications for future clinical practice. Combinatorial approaches of IL-1β inhibitors and ICIs may provide a potential therapeutic modality for NSCLC patients without targetable mutations. In this review, we discuss the role of IL-1β in NSCLC, its involvement in inflammatory pathways, and explore its potential role in the treatment of NSCLC.

To reduce the carbon emissions during heating in the manufacturing process, microwaves have attracted significant attention. Microwave has a lot of advantages rather than traditional heating method such as rapid heating, lower thermal damage and eco-friendly process. In order to apply microwaves to manufacturing process, uniform and efficient heating is required. We have analyzed the effect of various design parameters such as cavity heights, the application of the reflector, and the number and positions of waveguides for uniform and efficient heating by numerical simulation and verified that by experiment. The results showed that a slight change in the cavity height altered the electromagnetic field distribution and heating parameters, such as the coefficient of variance and power absorption efficiency. With reflectors installed, uniform heating was achieved and power absorption was improved, with the spherical reflector showing the maximum efficiency. The use of double waveguides heated the target material in a uniform manner. An increase in the power supply also led to uniform heating. This large-scale analysis will be helpful in applying microwaves to actual industrial sites.

In this paper, we present a study of various ZnO/SiO2-stacked thin film structures for flexible micro-energy harvesting devices. Two groups of micro-energy harvesting devices, SiO2/ZnO/SiO2 micro-energy generators (SZS-MGs) and ZnO/SiO2/ZnO micro-energy generators (ZSZ-MGs), were fabricated by stacking both SiO2 and ZnO thin films, and the resulting devices were characterized. With a particular interest in the fabrication of flexible devices, all the ZnO and SiO2 thin films were deposited on ITO-coated PEN substrates using an RF magnetron sputtering technique. The effects of the thickness and/or position of the SiO2 films on the device performance were investigated by observing the variations of output voltage in comparison with that of a control sample. As a result, compared to the ZnO single-layer device, all the ZSZ-MGs showed much better output voltages, while all the SZS-MG showed only slightly better output voltages. Among the ZSZ-MGs, the highest output voltages were obtained from the ZSZ-MGs where the SiO2 thin films were deposited using a deposition power of 150 W. Overall, the device performance seems to depend significantly on the position as well as the thickness of the SiO2 thin films in the ZnO/ SiO2-stacked multilayer structures, in addition to the processing conditions.

Background: Angelica gigas Nakai, Korean dang-gui, has long been widely used in traditional treatment methods. There have been a number of studies of the health effects of A. gigas and related compounds, but studies addressing effects on blood triglycerides (TG) are lacking. To investigate the effects of A. gigas Nakai extract (AGNE) on TG in Korean subjects, we carried out a 12-week, randomized, double-blind, placebo-controlled clinical trial. Methods: Subjects who met the inclusion criterion (130 mg/dL ≤ fasting blood TG ≤ 200 mg/dL) were recruited for this study. One hundred subjects were assigned to the AGNE group (n=50) or the placebo group (n=50), who were given 1g/day of AGNE (as a gigas Nakai extract 200mg/d) in capsules, and the control group for 12 weeks. Outcomes were efficacy TG, lipid profiles, atherogenic index, and safety parameters were assessed initially for a baseline measurement and after 12 weeks. Results: After 12 weeks of supplementation, TG and very low-density lipoprotein cholesterol (VLDL-C) concentration and TG/HDL-C ratio in the AGNE group were significantly reduced compared to the placebo group (p <0.05). No significant changes in any safety parameter were observed. Conclusions: These results suggest that ingestion of AGNE may improve TG and be useful to manage or prevent hypertriglyceridemia.

We report the use of four-layer graphene (4LG) as a highly reliable transparent conductive electrode (TCE) for polymer-dispersed liquid crystal (PDLC)-based smart window devices. The adhesion between 4LG and the substrate was successfully improved through a water-induced interface-cleaning (WIIC) process. We compared the performance of a device with a WIIC-processed 4LG electrode with that of devices with a conventional Indium tin oxide (ITO) electrode and a 4LG electrode without a WIIC. With the application of the WIIC process, the PDLC smart window with a 4LG electrode exhibited reduced turn-on voltage and haze compared to 4LG without the WIIC process and characteristics comparable to those of the ITO electrode. Based on our observations, we conclude that 4LG with WIIC is a promising TCE for flexible smart windows.

Since the controllers of the variable speed seawater pump and the 3-way valve of a ship central cooling system receive the feedback signal from the same output, the two controllers may interfere and operate inefficiently under certain conditions. Therefore, studying an efficient control tuning method for the central cooling water system is necessary. The central cooling water system was modeled in this study using MATLAB Simulink, utilizing actual operation data, and unknown parameters are estimated to fine-tune. The model is then verified using another operating data set. Additionally, transfer functions are developed for freshwater output temperature against 3-way valve openness input and seawater pump motor electric power frequency input. Then, the two PI controllers are tuned through the Internal Model Control guide, supposing the two systems are decoupled. Moreover, the modified IMC tuning method is suggested for the seawater pump system, which has larger time constants because of a heat exchanger. This method simplifies combining the two PI controller tuning, enhancing the seawater pump's overall efficiency and 3-way valve operation. This study determined that the proposed tuning methods through the IMC guide confirmed the efficiency of controlling the seawater pump speed and 3-way valve with reasonable control of freshwater outlet temperature.

This paper describes the first results of an Image Recognition Based Location (IRBL) for mobile application focusing on the procedure to generate a Database of range images (RGB-D). In an indoor environment, to estimate the camera position and orientation, a prior spatial knowledge of the surrounding is needed. In order to achieve this objective a complete 3D survey of two different environment (Bangbae metro station of Seoul and E.T.R.I. building in Daejeon – Republic of Korea) was performed using LiDAR (Light Detection And Ranging) instrument and the obtained scans were processed in order to obtain a spatial model of the environments. From this, two databases of reference images were generated using a specific software realized by the Geomatics group of Politecnico di Torino (ScanToRGBDImage). This tool allow to generate synthetically different RGB-D images) centered in the each scan position in the environment. Later, the external parameters (X, Y, Z, ω, φ, κ) and the range information extracted from the DB images retrieved, are used as reference information for pose estimation of a set of acquired mobile pictures in the IRBL procedure. In this paper the survey operations, the approach for generating the RGB-D images and the IRB strategy are reported. Finally the analysis of the results and the validation test are described.

In this study, the effect of NaOCl (10–200 ppm of Cl2) on the inactivation of human norovirus (HuNV) GII.4 and hepatitis A virus (HAV) in groundwater was investigated using PMA/RT­qPCR. Initially, 4.00 log copies/μL of HuNV GII.4 or 5.50 log copies/μL of HAV were artificially inoculated in ground water. The titers of HuNV GII.4 and HAV decreased significantly (p < 0.05) with increasing Cl2 concentrations. Ground water was treated with 10, 30, 50, 100, 150, and 200 ppm of Cl2, and the viable HuNV GII.4 was significantly (p < 0.05) reduced to 3.28 (0.21 log reduction), 3.18 (0.31 log reduction), 3.01 (0.48 log reduction), 2.75 (0.74 log reduction), 2.54 (0.95 log reduction), and 2.34 (1.15 log reduction) log copies/μL, respectively. The viable HAV was also significantly (p < 0.05) reduced to 4.99 (0.23 log reduction), 4.76 (0.46 log reduction), 4.55 (0.67 log reduction), 4.21 (1.01 log reduction), 3.89 (1.33 log reduction), and 3.64 (1.58 log reduction) log copies/μL, respectively. The decimal reduction time (D-value) (1-log reduction) of HuNV GII.4 and HAV infectivity in ground water was predicted as 116.7 and 98.9 ppm of Cl2, respectively using the first-order kinetics model (HuNV GII.4 ; y = - 0.0054x + 3.3585, R2= 0.97, HAV ; y = - 0.0091x + 5.0470, R2= 0.97). The result specifically suggests that 150–200 ppm Cl2 can potentially be used for the inactivation of > 1 log copies/μL HuNV GII.4 and HAV in ground water.

This study was undertaken to investigate and analyze noise pollution in a large Chinese governmental hospital’s medical intensive care unit and compare to the WHO guidelines.This cross-sectional study was conducted in a MICU at a public governmental teaching hospital in Fujian province between July and August of 2017. A WENSN® WS1361 Integrated Sound Level Meter (China) was used for continuous every five seconds one week noise levels recording. After this measurement, the decibel meter was used for recording different location of isolation rooms and open bays, including occupied and unoccupied patient, and recording sound events occurs in the ICU to identify sources of noise. Peak and average noise levels were obtained from the meter, and data were downloaded from the WS1361 into a laptop computer. The measured mean equivalent sound pressure levels (L) and standard Aeq deviation over one week period were 66.64±7.57 dB(A), with acute spikes reaching 119.7 dB(A), the average sound level for a 24 hour period in a work day was 68.03±5.07 dB(A). These are higher than the current daytime environmental noise limit of 40-45 decibels in China and WHO. Mean work day noise was significantly louder than weekend time, there was a significant difference in work days and weekend (t=16.85;P=0.000).There was a statistical difference between the day time and night time shifts (t=34.67;P=0.000). The isolation rooms were significantly quieter than the open-bay rooms(t=46.15; p=0.00), sound levels in the occupied and unoccupied rooms also had significant difference(t=17.26; P=0.000).Two types of noise resources, including twenty kinds sources were identified and measured, mean noise levels ranged from of 61.33 to 79.21 dB(A). This study shows noise levels in intensive care units were exceeded the recommended. The study of the influence of noise on patient and staff is needed, and noise reduction strategies must be conduct in ICU.

A flexible structure is applied to improve the lubrication performance of a misaligned journal bearing. The journal bearing is representative sliding bearing and there are damages due to metal-to-metal contact by misalignment. Since misalignment is an unavoidable phenomenon, a journal bearing with a flexible structure was proposed as a way to improve it. The lubrication characteristics of the bearing are evaluated numerically under steady-state condition. EHL (elastohydrodynamic lubrication) analysis considering elastic deformation was performed. The lubrication performance is compared in accordance with variation of the geometry of the flexible structure and evaluated based on the minimum film thickness. Moreover, the results of the journal bearing with flexible structure are compared with those of the journal bearing without the flexible structure. The flexible structure is then applied in the form of a groove to the area supporting high load on the journal bearing; it is elastically deformed by the generated oil-film pressure, which helps to obscure a larger oil film. Through numerical analysis, it is found that the journal bearing with flexible structure can improve the lubrication performance in the misaligned condition.

Topological states of matter have attracted significant attention due to their intrinsic wave-guiding and localization capabilities robust against disorders and defects in electronic, photonic, and phononic systems. Despite the above topological features phononic crystals share with their electronic and photonic counterparts, finite-frequency topological states in phononic crystals may not always survive. In this work, we discuss the survivability of topological states in Su-Schrieffer-Heeger models with both local and non-local interactions with larger symmetry perturbation. Although such a discussion is still about ideal mass-spring models, the insights from this study set the expectations in continuum phononic crystals, which can further instruct the applications of phononic crystals for practical purposes.

Climate change is expected to result in rising temperatures, leading to increased occurrences of extreme weather events like heat waves and cold spells. Urban planning responses are crucial for improving the adaptive capacity of cities and communities in dealing with significant temperature variations across seasons. This study aims to investigate the relationship between urban temperature fluctuations and urban morphology throughout the four seasons. Through quadrant and statistical analyses, the study identifies built-environment factors that contribute to moderate seasonal land surface temperatures (LST). The research focuses on Seoul, South Korea as a case study and calculates seasonal LST values at both the grid level (100m×100m) and street-block level, incorporating factors such as vegetation density, land use patterns, albedo, two- and three-dimensional building forms, and gravity indices for natural reserves. The quadrant analysis reveals spatial segregation between areas demonstrating high LST adaptability (cooler summers and warmer winters) and those displaying LST vulnerability (hotter summers and colder winters), with significant differences in vegetation and building forms. The spatial regression analysis demonstrates that higher vegetation density and proximity to water bodies play key roles in moderating LST, leading to cooler summers and warmer winters. Building characteristics have an invariant impact on LST across all seasons, where horizontal expansion contributes to higher LST, while vertical expansion reduces LST. These findings are consistent for both grid- and block-level analyses. The study emphasizes the flexible role of the natural environment in moderating temperatures.

As lung cancer shows the highest mortality in cancer related death, serum biomarkers are demanded for the lung cancer diagnosis and its treatment. To discover lung cancer protein biomarkers, secreted proteins from primary cultured lung cancer and adjacent normal tissues from patients were subjected to LC/MS-MS proteomic analysis. Quescin sulfhydryl oxidase(QSOX1) was selected as a biomarker candidate from the proteins enriched in the secretion of lung cancer cells. QSOX1levels were higher in 82% (51 of 62 tissues) of lung cancer tissues compared to adjacent normal tissues. Importantly, QSOX1 serum levels were significantly higher in cancer patients (p<0.05, AUC=0.89), when measured by multiple reaction monitoring(MRM). Higher levels of QSOX1 are also uniquely detected in lung cancer tissues among several other solid cancers by immunohistochemistry. QSOX1 knock-downed Lewis lung cancer (LLC) cells was less viable from oxidative stress and had reduced migration and invasion. In addition, LLC mouse models with QSOX1 knock-down also proved that QSOX1 functions in promoting cancer metastasis. In conclusion, QSOX1 might be a lung cancer tissue-derived biomarker and involved in the promotion of lung cancers, and thus can be a therapeutic target for lung cancers.

In this paper, a new axial-type magnetic gear with auxiliary flux-enhancing structure (AFS-AMG) is proposed. Compared to conventional AFS-AMG, it has the higher torque density and higher permanent magnet (PM) utilization factor. Firstly, the design rules and operating principles of proposed AFS-AMG are elaborated. Then, the mapping relation between the radial-type magnetic gears (RMGs) and AMGs are elucidated. Compared to its counterpart in RMGs, AFS-AMGs achieve small size. Then, the geometrical parameters of AFS-AMGs are optimized to obtain the better electromagnetic performances, where the torque density per volume and per PM volume is adopted as the evaluation standard. Finally, three different AMG topologies are constructed in finite element analysis (FEA) software for comparison. It is proven that the AFS-AMG has the largest torque density per volume and per PM volume.

In this paper, a 100CMM regenerative thermal oxidizer (RTO) system based on a high heating device for low-emission combustion is implemented at a volatile organic compound (VOCs) gas generation workplace. Existing RTO has a structure that repeats the inflow and discharge of VOCs gas into a cylindrical drum-type rotating disk and has excellent energy efficiency with a heat recovery rate of 95% or more. However, when used for a long time, there is a problem that rotation stops or explodes due to the discharge of pollutants due to dust and thermal expansion due to high temperature of 800℃. To overcome this, a RTO based on a high heating device was developed to reduce low-emission combustion emissions and energy use. Through 177 hours of demonstration time, the oxidation efficiency of VOCs was 97.87%; the waste heat recovery rate was reduced by 95.78%, the fuel consumption was reduced by 21.95%, and the nitrogen oxide concentration was 3.9 ppm

This study developed Makgeolli (Korean traditional alcoholic beverage) by adding raw 20% Codium fragile (Cf), a green seaweed, to a mixed base consisting of rice and oats (1:1 ratio) (COM) and analyzed its quality characteristics and antioxidant activity. The rice based Makgeolli supplemented with raw 20% Cf was designated as control (CRM). The physicochemical (pH, acidity), microbiological (yeast, lactic acid bacteria), antioxidant (DPPH, ABTS), and sensory properties (7-henodonic scale) of CRM and COM were investigated during 7 days of fermentation. The pH/acidity levels of CRM and COM reached 3.66/0.68 and 3.69/0.95 after 7 days of fermentation, respectively. Compared to CRM, COM had lower alcohol and sugar contents (P < 0.05) (CRM: 14.5%/9.8 Brix, COM: 11.2%/7.4 Brix). However, COM contained more yeast and lactic acid bacteria (P < 0.05) (CRM: 1.30/4.28 log, COM: 6.04/6.09 log) compared to CRM. The antioxidant activity of DPPH/ABTS (P < 0.05) in COM was approximately 1.5 times that of CRM (CRM: 40.00/51.57%, COM: 56.76/70.91%). In addition, COM had an excellent sensory preference score (P < 0.05) due to its overall fresh flavor and savory taste (CRM: 4.93, COM: 6.06). Therefore, COM was shown to be Makgeolli with enhanced antioxidant function, with yeast and lactic acid bacteria, and improved flavor, suggesting the possibility of commercializing this Makgeolli.

This paper addresses the cosmological constant problem, a significant discrepancy highlighted by \cite{Weinberg:1988cp} that underlines a fundamental inconsistency between quantum field theory (QFT) and general relativity (GR). QFT examines matter dynamics within Lorentzian spacetime under standard model symmetry, while GR uses Riemannian geometry but adapts it to ensure local Lorentzian behavior in small regions. Despite the experimental successes of both theories, a major challenge exists in theoretical understanding. This letter seeks to clarify this critical misunderstanding. As the universe cools from its hot beginning, the \(SU(3) \times SU(2) \times U(1)\) standard model gauge symmetry evolves. This symmetry breaks to \(SU(3) \times U(1)\) upon cooling at the electroweak scale and ultimately to \(SU(3)\) alone as temperatures approach near-absolute zero kelvin, facilitated by the experimental Meissner effect. This suggests that \(SU(3)\) symmetry forms the foundational "atoms" of vacuum energy. Calculating the number of \(SU(3)\) vacuum atoms across the universe results in a value that perfectly aligns the theoretical predictions with the observed vacuum energy densities, thereby resolving the cosmological constant problem. Since \(SU(3)\) atoms account for the cosmological constant, they must be unbreakable. The third law of thermodynamics, which states that it is impossible to reach absolute zero Kelvin, provides the protection that prevents SU(3) atoms from breaking at zero Kelvin. This reveals the connection between the third law of thermodynamics and the quark confinement. This leads to the \(SU(3)\) atom creating a mass gap within the universe. This solution serves as a symmetric evidence of gauge-gravity duality as well as gravity-superconductor duality.

Acetic acid bacteria (AAB) are major contributors to the production of fermented vinegar, offering various cultural, culinary, and health benefits. Although the residual unpasteurized AAB after vinegar production are not pathogens, these are necessary the safety evaluations including antibiotic resistance for the use as starters. In this research, we investigated the antibiotics resistance profiles of 26 AAB strains, including various species of Komagataeibacter and Acetobacter, against ten different antibiotics using the E-test method. All strains exhibited resistance to aztreonam and clindamycin. Komagataeibacter species demonstrated a 50% resistance rate to ciprofloxacin, analogous to Acetobacter species, but showed twice the resistance rates to chloramphenicol and erythromycin. Genomic analysis of K. saccharivorans CV1 identified intrinsic resistance mechanisms, such as multidrug efflux pumps, thereby enhancing our understanding of antibiotic resistance in acetic acid-producing bacteria. These findings enhance understanding of antibiotic resistance in AAB for food safety and new antimicrobial strategies, suggesting the need for standardized testing methods and molecular genetic study.

Inflammasomes are multiprotein complexes that activate inflammatory responses by inducing pyroptosis and secretion of pro-inflammatory cytokines. Along with many previous studies on inflammatory responses and diseases induced by canonical inflammasomes, an increasing number of studies have demonstrated that non-canonical inflammasomes, such as mouse caspase-11 and human caspase-4 inflammasomes, are emerging key players in inflammatory responses and various diseases. Flavonoids are natural bioactive compounds found in plants, fruits, vegetables, and teas and have pharmacological properties in a wide range of human diseases. Many studies have successfully demonstrated that flavonoids play an anti-inflammatory role and ameliorate many inflammatory diseases by inhibiting canonical inflammasomes. Others have demonstrated the anti-inflammatory roles of flavonoids in inflammatory responses and various diseases, with a new mechanism by which flavonoids inhibit non-canonical inflammasomes. This review discusses recent studies that have investigated the anti-inflammatory roles and pharmacological properties of flavonoids in inflammatory responses and diseases induced by non-canonical inflammasomes and further provides insight into developing flavonoid-based therapeutics as potential nutraceuticals against human inflammatory diseases.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

We demonstrate a method for realization of highly nonlinear optical 4-(4-dimethylaminostyryl)-1-methylpyridinium tosylate (DAST) two-dimensional structures by a double step technique. The desired polymeric structures have been first fabricated by using the multiple-exposure of two-beam interference technique, and the DAST nanoscrystals were then prepared inside the air-voids of these photoresist templates, resulting in nonlinear periodic structures. The nonlinear properties were characterized by optical and scanning microscopies, as well as by second-harmonic generation technique. This nonlinear modulation is very promising for the enhancement nonlinear conversion rates, such as terahertz generation, by using the quasi-phase matching technique.

In light of the prevalent pest and disease issues faced by greenhouse cucumbers, a staple vegetable during winter, this study introduces a detection method based on the enhanced YOLOv8s model. This method aims to provide technical support for detecting and classifying pests and diseases in cucumber agricultural production. The model integrates the 'MultiCat' module for multiscale feature fusion and employs the 'C2fe' and 'ADC2f'modules to strengthen spatial and channel attention. The 'Block2d' function also facilitates the choice between average pooling and attention-based spatial pooling. Channel fusion is achieved through additive and multiplicative operations, allowing the model to delve deeper into feature learning. Experimental results confirm that our approach outperforms the original YOLOv8s model in pest detection, particularly excelling in the identification of small-scale and overlapping afflictions.

This study compared condylar volume, length, and articular eminence (AE) characteristics in normal individuals and those with unilateral and bilateral juvenile idiopathic osteoarthritis (JOA). The 116 patients were divided into four groups: control (n=16), affected condyle of unilateral JOA (Aff-Uni) (n=36), non-affected condyle of JOA (NonAff-uni) (n=36), and bilateral JOA (Bi-JOA) (n=28). Volume and length differences in the condyle and AE were analyzed using ANOVA and Bonferroni post hoc tests. The results showed that Bi-JOA had significantly different condylar volume, especially in the condylar head (p&lt;0.01), specifically the middle, anterior, and medial parts (p&lt;0.05). Condylar length also differed among the groups, with differences observed between the control group and the other three groups, as well as between the bilateral group and the other three groups (p&lt;0.01). AE total volume differed between the control group and Aff-Uni. In the detailed comparison, Aff-Uni and NonAff-Uni were smaller than the control group in the posterior, lateral, and medial sections (p&lt;0.05). In conclusion, depending on the involvement of unilateral or bilateral JOA, there were differences in condylar volume and AE compared to the normal control group. Therefore, prognosis should be evaluated by distinguishing between patients with unilateral and bilateral JOA.

As symbionts of fungi and algae, lichens produce a variety of secondary products which pharmacological activities. This study aimed to investigate the anti-inflammatory activities of Heterodermia hypoleuca and its main compound, atraric acid. The results confirmed that atraric acid could regulating induced pro-inflammatory cytokine, nitric oxide, induced nitric oxide synthase and cyclooxygenase-2 expression by lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Means while, atraric acid down-regulated expression of phosphorylated IκB, ERK and nuclear factor kappa B (NFκB) signaling pathway to exhibit anti-inflammatory effects in LPS-stimulated RAW264.7 cells. Based on these results, the anti-inflammatory effect of atraric acid during LPS-induced endotoxin shock in a mouse model was confirmed. In the atraric acid treated-group, cytokine production was decreased in the peritoneum and serum, and each organ damaged by LPS-stimulation was recovered. These results show that atraric acid has an anti-inflammatory effect and its molecular mechanism may be involved in the inactivation of the ERK/NFκB signaling pathway, demonstrating its value as a potential therapeutic for inflammatory diseases.

This general review assesses the impact of physical exercise on oxidative and nitrosative stress and the counteractive role of antioxidants, drawing from a systematic literature search up to March 2024 in databases like PubMed and Web of Science. The review highlights studies on the effect of exercise on the production of reactive oxygen species (ROS) and reactive nitrogen species (RNS) and antioxidant responses in both human and animal models based on rigorous inclusion and exclusion criteria. Due to the variety of exercise types and participants' characteristics, a narrative synthesis approach was adopted. The findings indicate that moderate exercise boosts antioxidant defenses, known as hormesis, whereas excessive physical activity may increase oxidative and nitrosative damage. The review also explores the complex effects of antioxidant supplementation, revealing that while natural dietary antioxidants support health, high-dose supplements could potentially hinder positive adaptations to exercise. Recommendations for athletes and the general active population highlight the importance of balancing exercise and dietary intake to optimize health benefits. The review concludes with a call for more detailed research on tailored exercise and nutrition plans to dissect these intricate relationships further.

Impact characterization of linear resonant actuator (LRA) is studied experimentally by newly developed drop tester, which can control various experimental uncertainty such as rotational moment, air resistance, secondary impact and so on. The feasibility of this test apparatus was verified by comparison with free fall test. By utilizing a high-speed camera and measuring the vibrational displacement of spring material, the impact behavior was captured and the damping ratio of the system was defined. Based on the above processes, the finite element model was established and the experimental and analytical results were successfully correlated. Finally, the damage of the system from impact loading can be expected by developed model and as a result, this research can improve the impact reliability of LRA.

Turbine generator operates with complex cooling system due to the challenge in controlling the peak temperature of the stator bar caused by ohm loss, which is unavoidable. Therefore, it is important to characterise and quantifies the thermal performance of the cooling system. The focus of the present research is to investigate the heat transfer and pressure loss characteristics of typical cooling system, so-called stator ventilation duct. A real scale model was built at its operating conditions for the present study. The direction of cooling air is varied to consider its operation condition, so that there are (1) outward flow and (2) inward flow cases. In addition, the effect of (3) cross flow (inward with cross flow case) is also studied. The transient heat transfer method using thermochromic liquid crystals is implemented to measure full surface heat transfer distribution. A series of Computational Fluid Dynamics analysis is also conducted to support the observation from the experiment. For the inward flow case, the results suggest that the average Nusselt number of the 2nd duct is about 30% higher than the 3rd duct. The trend is similar with the effect of cross flow. The CFD results are in good agreement with the experimental data.

This paper considers a hybrid relay network consisting of the source, the amplify-and-forward (AF) relay, the decode-and-forward (DF) relay, and the destination. We propose the optimal power allocation schemes between two different relays which maximize the achievable rate under a sum relay power constraint for given channel gains and transmit power from source. By solving the optimization problem to maximize the achievable rate for each relay network, the transmit power values in closed-form are derived. When the channel gains are the same, the optimal power allocation scheme for AF-DF relay network proves that a more power should be allocated at the first relay to maximize the achievable rate. In case of the DF-AF relay network, we derive the optimal power allocation scheme for the possible four cases. Under the same SNR condition at the first hop, we show that the achievable rate of AF-DF relay network is greater than that of DF-AF relay network when the channel gain between two relays is higher than that between the second relay and destination. Simulation results show that the proposed power allocation schemes provide a higher achievable rate than the equal power allocation schemes.

Background: Oenothera biennis (evening primrose) produces bioactive substances with a diverse range of pharmacological functions. However, it is currently unknown whether extract prepared from the aerial parts of O. biennis (APOB) can protect the skin against oxidative stress. To investigate the protective effects of APOB against oxidative stress-induced damage in human skin keratinocytes (HaCaT) and elucidate the underlying mechanisms. Methods: We pretreated HaCaT cells with various concentrations of APOB or the antioxidant N-acetyl-L-cysteine before applying H2O2. We then compared the cell viability, intracellular reactive oxygen species (ROS) production, and DNA and mitochondrial damage between pretreated and untreated control cells using a range of assays, flow cytometry, and Western blot analysis and also examined the reducing power and DPPH free radical-scavenging activity of APOB. Results: APOB pretreatment significantly increased cell viability, effectively attenuated H2O2-induced comet tail formation, and inhibited H2O2-induced phosphorylation of the histone γH2AX, as well as the number of apoptotic bodies and Annexin V-positive cells. APOB was found to have a high reducing power and DPPH radical-scavenging activity and also exhibited scavenging activity against intracellular ROS accumulation and restored the loss of mitochondrial membrane potential caused by H2O2. APOB pretreatment almost totally reversed the enhanced cleavage of caspase-3, the degradation of poly (ADP-ribose)-polymerase (PARP), DNA fragmentation that usually occurs in the presence of H2O2 and increased the levels of heme oxygenase-1 (HO-1), a potent antioxidant enzyme that is associated with the induction of nuclear factor-erythroid 2-related factor 2 (Nrf2). Conclusions: APOB can protect HaCaT cells from H2O2-induced DNA damage and cell death by blocking cellular damage related to oxidative stress via a mechanism that affects ROS elimination and by activating the Nrf2/HO-1 signaling pathway.

With the integrated development of the Internet, wireless sensor technology, cloud computing, and mobile Internet, there has been a lot of attention given to research about and applications of the Internet of Things. A Wireless Sensor Network (WSN) is one of the important information technologies in the Internet of Things; it integrates multi-technology to detect and gather information in a network environment by mutual cooperation, using a variety of methods to process and analyze data, implement awareness, and perform tests. This paper mainly researches the localization algorithm of sensor nodes in a wireless sensor network. Firstly, a multi-granularity region partition is proposed to divide the location region. In the range-based method, the RSSI (Received Signal Strength indicator, RSSI) is used to estimate distance. The optimal RSSI value is computed by the Gaussian fitting method. Furthermore, a Voronoi diagram is characterized by the use of dividing region. Rach anchor node is regarded as the center of each region; the whole position region is divided into several regions and the sub-region of neighboring nodes is combined into triangles while the unknown node is locked in the ultimate area. Secondly, the multi-granularity regional division and Lagrange multiplier method are used to calculate the final coordinates. Because nodes are influenced by many factors in the practical application, two kinds of positioning methods are designed: the unknown node is in the positioning unit or not. When the unknown node is on the side of the positioning unit, we use the method of vector similarity. Moreover, we use the centroid algorithm to calculate the ultimate coordinates of unknown node. When the unknown node is not on the side of the positioning unit, we establish a Lagrange equation containing the constraint condition to calculate the first coordinates. Furthermore, we use the Taylor expansion formula to correct the coordinates of the unknown node. In addition, this localization method has been validated by establishing the real environment.

The object of this research is designing of new robot-to-robot communication system working in the middle of highway/roads to support mobile safety for approaching vehicles. The result of research project directs to a group of safety robot devices which induce a vehicle on a bypass route, as a vehicle guidance method using the same, and a vehicle safety guidance system. According to an embodiment of the present invention, a safety device includes a detector configured to detect a vehicle approaching the safety device, and an image projector configured to project an image onto a road surface approaching the vehicle when the detector recognizes an approach of the vehicle. It can include. According to the present invention, when it is necessary to guide the vehicle to the bypass route, the driver of the vehicle can grasp the detour route in time and move the vehicle to the next lane.

We examined the relationship between living alone and the prevalence of depressive symptoms in older Korean widows and assessed the individual contributions of health, social ties, and socioeconomic factors to the development of depressive symptoms. The study was a secondary analysis using data from widows 65 years of age and older who participated in the Living Profiles of Older People Survey (LPOPS). A logistic regression analysis was used to evaluate the contributions of health, social ties, and socioeconomic factors to the development of depressive symptoms. Working status and equivalent household income were significantly associated with depressive symptoms in both those living with others and those living alone. Adjustment for health status and social ties did not change the impact of living alone on the prevalence of depressive symptoms. However, adjustment for equivalent household income eliminated the negative association between living alone and depressive symptoms. Our findings indicate that economic resources are more important than health and social ties for alleviating the negative impact of living alone on the development of depressive symptoms in older widows.

The center vortex model of quantum-chromodynamics can explain confinement and chiral symmetry breaking. We present a possible resolution for problems of the vortex detection in smooth configurations and discuss improvements for the detection of center vortices.

Quantum Computation, in the gate array version, uses logical gates adopting convenient forms for computational algorithms based on those of classical computation. There, two-level quantum systems are the basic elements connecting the binary nature of classical computation with the settlement of quantum processing. Despite, their design depends on specific quantum systems and physical interactions involved, exacerbating the dynamics analysis. Predictable and controllable manipulation should be addressed to control the quantum states, but resources are restricted to limitations imposed by the physical settlement. This work presents a formalism to decompose the quantum information dynamics in SU(2^2d) for 2d-partite two-level systems into 2^2d-1 SU(2) quantum subsystems. Decomposition lets to set control procedures, to generate large entangled states and to design specialized dedicated quantum gates. There, easy and traditional operations proposed by quantum computation are recovered for more complex and large systems. Alternating the parameters of local and non-local interactions, the procedure states a universal exchange semantics on the generalized Bell states basis. It could be understood as a momentary splitting of the 2d information channels into 2^2d-1 pairs of 2 level quantum information subsystems and a settlement of the quantum information manipulation free of the imposed restrictions by the underlying physical system.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Background: Autonomic neuropathy commonly arises as a long-term complication in end stage kidney disease (ESKD) and can be diagnosed from heart rate variability (HRV), calculated from electrocardiogram (ECG) recordings. There is limited data about HRV using real-time ECG to predict HD efficiency in patients with ESKD who are routinely doing HD in real-world practice. Methods: Total of 50 patients (62.1 ± 10.7 years) with ESKD underwent continuous real-time ECG monitor (237.4 ± 15.3 min) during HD for HRV using remote monitoring system and checked electrolyte levels before/after HD. And we compared HRV according to electrolyte levels. Results: During the monitor, we checked total 2374 times of ECG and electrolyte level simultaneously of all patients. Both time and frequency domain HRV were higher when the patients had lower K+ level (&lt;0.5 mEq/L) and P+ level change (&lt;2 mEq/L) before/after HD as compared with those with higher K+ level (≥0.5 mEq/L) and P+ level (≥2 mEq/L) change respectively. In addition, there were higher incidence of arrhythmic events including atrial/ventricular premature complexes, even though no difference of mean heart rate in patients with lower K+ and P+ level change group (p &lt; 0.001). Conclusions: Higher HRV was independently associated with poor controlled K+ and P+ level during hemodialysis in patients with ESKD. This is further substantiated by independent continuous associations between real-time measures of higher HRV and K+ and P+ level. These data strongly suggest that cardiac autonomic dysfunction can be caused by lower change of electrolytes before/after hemodialysis alone.

According to the IPCC guidelines, CO₂ emissions from biomass should be excluded from the entire amount of CO₂ emissions when calculating CO₂ emissions and should be separately reported due to the “carbon neutrality.” Sewage sludge is one of the representative biomass fuels. And it is mixed with fossil fuels in terms of greenhouse gas reduction or is used as fuel to replace fossil fuels by itself. According to the results of this study, biomass contents of both the sewage sludge and the sewage sludge incineration exhaust gases did not amount to 100%. At present, in many countries(South Korea, Japan, and Germany), when calculating greenhouse gas emissions from sewage sludge incinerator, all CO₂ emissions from sewage sludge are judged to be biomass and only those greenhouse gas emissions that correspond to Non-CO₂ gases are calculated as greenhouse gas emissions. However, since, according our results, the content of sewage sludge is not 100% biomass, if CO₂ emissions are excluded according to the existing greenhouse gas emission calculation method, the amount of emissions may be underestimated. Therefore, to accurately calculate greenhouse gas emissions from sewage sludge incinerator, CO₂ emissions should be calculated in consideration of the fossil carbon contents of sewage sludge.

We previously found a novel a new sirtuin (SIRT) inhibitor MHY2256 that exerts anticancer activity through p53 acetylation in MCF-7 human breast cancer cells. Here, we investigated the anticancer activity of MHY2256 against hormone-related cancer, which is an endometrial cancer with poor prognosis. We found that MHY2256 markedly reduced cellular proliferation at low concentrations against Ishikawa endometrial cancer cells. The IC50 values of MHY2256 were much lower than that of salermide. Furthermore, MHY2256 significantly reduced the protein expression and activities of SIRT1, 2, and 3 with similar effects as salermide, a well-known SIRT inhibitor. Particularly, MHY2256 markedly inhibited tumor growth in a tumor xenograft mouse model of Ishikawa cancer cells. During the experimental period, there was no significant change in the body weight of mice treated with MHY2256. Detailed analysis of the sensitization mechanisms of Ishikawa cells revealed that late apoptosis was largely increased by MHY2256. Additionally, MHY2256 increased G1 arrest and reduced cell cyclic-related proteins, suggesting that apoptosis by MHY2256 was achieved by cellular arrest. Particularly, p21 was greatly increased by MHY225656, suggesting that cell cycle arrest by p21 is a major factor in MHY2256 sensitization in Ishikawa cells. We also detected a significant increase in acetylated p53, a target protein of SIRT1, in Ishikawa cells after MHY2256 treatment. In a mouse xenograft model, MHY2256 significantly reduced tumor growth and weight without apparent side effects. These results suggest that MHY2256 exerts its anticancer activity through p53 acetylation in endometrial cancer and can be used for targeting hormone-related cancers.

The synergistic efficacy of combined treatment mild heat (MH) and dielectric barrier discharge (DBD) plasma in Bacillus cereus-contaminated red pepper powder was tested. A cocktail of three strains of B. cereus (NCCP 10623, NCCP 14579, ATCC 11778) was inoculated onto red pepper powder and then treated with MH (60 ℃ for 5-20 min) and DBD plasma (5-20 min). Treatment with MH and DBD plasma alone for 5~20 min resulted in reductions of 0.23~1.43 and 0.12~0.96 log CFU/g, respectively. Combined treatment with MH and DBD plasma was the most effective at reducing B. cereus counts on red pepper powder and resulted in log-reductions of ≥ 6.0 log CFU/g. The largest synergistic values (4.24-4.42 log) against B. cereus in red pepper powder were obtained by the combination of 20 min MH and 5~15 min DBD plasma. Hunter color ‘‘L’’, ‘‘a’’, and ‘‘b’’ values of the combination-treated samples were not significantly different from those of non-treated samples. Also, no significant (p > 0.05) differences in pH values between samples were observed. Therefore, these results suggest that the combination of MH treatment and DBD plasma can be potentially utilized in the food industry to effectively inactivate B. cereus without incurring quality deterioration of red pepper powder.

Due to the rapid development of unmanned aerial vehicles (UAVs) communication technology, UAVs are gradually competing with primary users (PUs) for spectrum resources. Cognitive radio (CR) is a promising solution to meet the needs. Cooperative spectrum sensing (CSS) is considered as an effective method to detect the PU signal and identify available spectrum resources for UAVs in a cognitive UAV network (CUAVN). However, the cooperative mode among multiple UAVs may incur a high overhead, resulting in performance degradation. Therefore, we introduce a differential sequential 1 (DS1), which incorporates a differential mechanism and leverages the sequential idea based on the classical voting rule to enhance cooperative performance and efficiency. In view of this, we formulate three scenarios to characterize the PU activity and introduce a multi-slot cooperative mode within a single UAV to realize cooperative gain. Further, only the information change about the PU status is sequentially calculated in DS1, and combined with a sequential idea, the efficiency of the voting rule is greatly improved. Moreover, the application of support vector machines (SVM) in dynamic selection enables the selection of the most suitable voting rule based on diverse sensing parameters. This dynamic selection process ensures optimal performance and efficiency by adapting the voting rule to the specific characteristics of the given scenario. Finally, simulation results demonstrate that the superiority of our proposal with respect to the detection performance, sample size and the energy efficiency is evident, which proves the high performance of the proposed policy.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Lodging is one of the important factors affecting the high and stable yield of wheat worldwide. Solid-stemmed wheat has higher stem strength and lodging resistance than hollow-stemmed wheat. There are many solid stemmed varieties, landraces and old varieties of durum wheat. However, the transfer of solid stem genes from durum wheat is suppressed by the suppressor gene located on chromosome 3D in common wheat, and only hollow-stemmed lines have been created. However, synthetic hexaploid wheat can serve as a bridge to transfer solid stem genes from tetraploid wheat to common wheat. In this study, the F1, F2, and F2:3 generations of the cross between solid-stemmed Syn-SAU-119 and semisolid-stemmed Syn-SAU-117 were developed. A single dominant gene, tentatively designated Su-TdDof, was identified in synthetic hexaploid wheat Syn-SAU-117 by genetic analysis, which suppresses stem solidity. Using bulked segregant RNA-seq (BSR-seq) analysis, Su-TdDof was mapped to chromosome 7DS and flanked by markers KASP-669 and KASP-1055 within a 4.53 cM genetic interval corresponding to 3.86 Mb and 2.29Mb physical region in the Chinese Spring (IWGSC RefSeq v1.1) and Ae. tauschii (AL8/78 v4.0) genome, respectively, in which three genes related to solid stem development were annotated. Su-TdDof differed from a previously reported solid stem suppressor gene based on its origin and position. Su-TdDof would provide a valuable example for research on the suppression phenomenon. The flanking markers developed in this study would be useful for screening Ae. tauschii accessions with no suppressor gene (Su-TdDof) to develop more synthetic hexaploid wheat lines for wheat lodging resistance breeding and further cloning the suppressor gene Su-TdDof.

We review consequences for the radiation and dark sectors of the cosmological model arising from the postulate that the CMB is governed by an SU(2) rather than a U(1) gauge principle. We also speculate on the possibility of actively assisted structure formation due to the de-percolation of lump-like configurations of condensed ultralight axions with a Peccei-Quinn scale comparable to the Planck mass. The chiral-anomaly induced potential of the axion condensate receives contributions from SU(2)/SU(3) Yang-Mills factors of hierarchically separated scales which act in a screened (reduced) way in confining phases.

Chemical investigation of the Chinese soft coral Lobophytum sp. has resulted in the isolation of six new compounds, namely lobosteroids A–F (1–6), along with four known compounds. Their structures were determined by extensive spectroscopic analysis and comparison with the spectral data reported in the literature. Among them, the absolute configuration of 1 was determined by X-ray diffraction analysis. These steroids characterized by either the presence of an α,β-αꞌ,βꞌ-unsaturated carbonyl or an α,β-unsaturated carbonyl moiety in ring A, or the existence of a 5α,8α-epidioxy system in ring B, as well as diverse oxidation sites of side chains. The prelimi-nary antibacterial bioassay showed all compounds exhibited significant antibacterial activities against the fish pathogenic bacteria Streptococcus parauberis FP KSP28 and Phoyobacterium damselae FP2244 with all inhibition rates more than 90% at the concentration of 150 µM. And at the same concentration, compounds 2, 6–10 also displayed potent inhibitory effects against vancomy-cin-resistant Enterococcus faecium bacteria G7 with all inhibition rates more than 90%.

It is important for researchers in material domain to reconstruct and visualize the microstructure of alloy, which helps discover morphologies and properties that can only be found in three dimensional and microscopic space. However, because of the limitation of state-of-the-art sensors, the internal microstructure of the material is not easy to obtain. In this paper, a novel automatic 3D reconstruction method is proposed using diffraction contrast tomography technology to capture the 3D microstructure of Al-La alloy. The pipeline of the proposed method starts from the imaging of Al-La alloy with the LabDCT technique from Carl Zeiss AG, which produces a sequence of 2D microstructure sections. Then, a segmentation algorithm based on superpixel and lifted multicut is proposed to extract the 2D microstructure in an image section. Finally, 2D segmentations are joined together to reconstruct and visulize the 3D microstructure. As a result, a novel morphology of Al-La alloy is recovered with both dendrite and lamellar morphologies. The proposed method has the advantage of the ability to losslessly recover the internal microstructure.

Using the local bijectivity of Keller maps, we give a proof of two-dimensional Jacobian conjecture.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Although numerous citrus varieties have recently been developed to enhance their quality, information on their quality characteristics is limited. We assessed the quality characteristics of Yellowball, a novel citrus variety, by evaluating its appearance, storability, sensory properties, functionality, and metabolite profiles and comparing these characteristics with those of its parent varieties: Haruka and Kiyomi. The metabolite profiles between the citrus varieties differed significantly, resulting in distinct physicochemical and functional qualities. The storability of Yellowball was significantly increased compared with that of its parent varieties owing to its strong antifungal activity and unique peel morphology, including the stoma and albedo layers. While we did not investigate the volatile compounds, overall functional activities, and detailed characteristics of each metabolite, our data provide valuable insights into the relationship between citrus metabolites, peel morphology, physicochemical properties, and storability and demonstrate the potential of Yellowball as a promising variety in the citrus industry.

Excessive alcohol consumption is one of the significant causes of morbidity and mortality worldwide. Alcohol is oxidized to toxic and carcinogenic acetaldehyde by alcohol dehydrogenase (ADH) and further oxidized to a non-toxic acetate by aldehyde dehydrogenase (ALDH). Emerging evidence shows that Lactobacillus and Bifidobacterium species encode alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH) mediate alcohol and acetaldehyde metabolism, respectively. This study involves supplementation of Lactobacillus and Bifidobacterium probiotic mixture in humans and assessed their effects on alcohol and acetaldehyde metabolism. Here, twenty-seven wild types (ALDH2*1/*1) and the same number ofheterozygotes (ALDH2*2/*1) were recruited for the study. The enrolled participants were randomly divided into either the probiotic (Duolac ProAP4) or the placebo group. Each group received a probiotic or placebo capsule for 15 days with subsequent crossover. Primary outcomes were measurement of alcohol and acetaldehyde in the blood after the alcohol intake. Blood levels of alcohol and acetaldehyde in the ALDH2 heterozygote group were significantly downregulated in the probiotic-supplemented group with no changes in hangover score symptoms than the placebo group. No clinically significant changes were observed in safety parameters. These results suggest that probiotic has a potential to downregulate the alcohol and acetaldehyde concentrations, and their effects depend on the presence or absence of polymorphism on the ALDH2 gene.

Consciousness pervades our daily experiences, yet it remains largely unaccounted for in contemporary physics and chemistry theories. Several existing theories, such as the Integrated Information Theory (IIT), Global Workspace Theory (GWT), Electromagnetic Field Theory (EMF Theory of Consciousness), and Orchestrated Objective Reduction Theory (Orch-OR), attempt to clarify the essence of consciousness. Yet, they often encounter significant challenges. These challenges arise due to the intricate nature of our neural systems and the limitations of current measurement and computational technologies, which often prevent these theories from being rigorously mathematically described or quantitatively tested. Here we introduce a novel theory that hypothesizes consciousness as an inherent property of certain particle configurations. Specifically, when a group of particles align in a particular state, they exhibit consciousness. This relationship between particle states and conscious perceptions is governed by what we term the "universal consciousness code". And we propose a possible practical mathematical method to decipher the complex relationship between neural activities and consciousness and to test our theory using the latest artificial intelligence technologies.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

This research examines the fire resistance of geopolymer composites (GCs), formulated using alka-li-activated metakaolin and aluminum powder. The production method involves spray-coating carbon steel plates with fresh GCs, followed by a 28-day curing period at room temperature. Sub-sequently, fire performance and aging tests are conducted to evaluate fire resistance. The study investigates GC properties, including apparent density, bending strength, compression strength, thermal conductivity, porosity, and production cost. Morphological changes before and after fire and aging tests are analyzed using scanning electron microscopy (SEM). Results demonstrate GC foams' outstanding thermal insulation, providing up to 75 minutes of fire resistance with a 6 mm coating, reducing temperatures by 300 °C compared to uncoated steel. GCs exhibit a density of 670 kg/m³, thermal conductivity of 0.166 W/m·K, 68% porosity, and cost efficiency at 250 dollars per cubic meter. This study underscores the potential of foamed geopolymer coatings for effective and economical surface protection.

Life is supported by metabolism, a vital physiological activity. It guarantees enough energy available to power every cellular activity. The primary cellular substrate, glucose, is where the majority of the energy needed by the cell to support all other life activities and the growth of living creatures is derived. The quality of life is greatly impacted by any disease or flaw that alters the metabolism of glucose. There is no known cure for the metabolic illness known as diabetes. As diabetes is so varied, the only effective treatments would be based on precision medicine and a molecular strategy. This review covers a wide range of topics, including the ability to recognize the various forms of diabetes, the anthropogenic and genetic influence of the cause of diabetes, the severity of the various forms of diabetes, its potential existential risk, the disease burden, and clinical methods for diagnosing them. The most recent research goes on to recommend ways to ameliorate the disease, including diet-based management, biotherapies, and other individual lifestyle choices. Futuristic therapy using molecular biology approach was suggested. Recent research found a direct correlation between an individual's lifestyle and the rate of gene mutation in diabetes. There is an existential risk associated with the sickness as the rate of the spread of the disease among population globally is faster than the world's population growth rate. It is possible to think of diabetes as a silent pandemic.

Mutations in the SACS gene are associated with autosomal recessive spastic ataxia of Charlevoix-Saguenay disease (ARSACS) or complex clinical phenotypes of Charcot-Marie-Tooth disease (CMT). This study aimed to identify SACS mutations in a Korean CMT cohort with cerebellar ataxia and spasticity. As a result, eight pathogenic SACS mutations in four families were identified as the underlying causes of these complex phenotypes. The prevalence of CMT families with SACS mutations was determined to be 0.3%. All the patients showed sensory, motor, and gait disturbances with increased deep tendon reflexes. Lower limb magnetic resonance imaging (MRI) was done in four patients, and all had fatty replacements. Of note, they all had similar fatty infiltrations between the proximal and distal lower limb muscles, different from the neuromuscular imaging feature in most CMT patients without SACS mutations who had distal dominant fatty involvement. Therefore, these findings were considered a characteristic feature in CMT patients with SACS mutations. Although further studies with more cases are needed, our results highlight lower extremity MRI findings in CMT patients with SACS mutations and broaden the clinical spectrum. We suggest screening for SACS in recessive CMT patients with complex phenotypes of ataxia and spasticity.