The objective of this study is to design and synthesize substituted η6-chromium tricarbonyl metal complexes carrying o-carborane units as potential boron neutron capture therapy (BNCT) agents. In this study, 1,2-Diphenyl-o-carborane units were used as starting materials to generate biologically active species. We investigated how the structural changes of 1,2-diphenyl-o-carborane substituted with chromium(0) tricarbonyl affect the biological properties; [(CO)3Cr]Ph2C2 (2) and [(CO)3Cr]2Ph2C2 (3) species were produced in moderate yields. The molecular structures of compounds 1–3 were identified and established by infrared (IR), 1H, 11B, and 13C nuclear magnetic resonance (NMR), and X-ray crystallography analyses. Crystal structures of o-carboranyl chromium complexes 1 [a = 10.859(1) Å, b = 24.953(3) Å, c = 13.938(2) Å, β = 111.854(2)º], 2 [a = 10.621(3) Å, b = 17.056(5) Å, c = 12.174(4) Å, β = 106.622(5)º], and 3 [a = 17.540(2) Å, b = 18.060(2) Å, c = 19.484(4) Å, α = 105.746(2)º, β = 110.226(2)º, γ = 91.256(2)º] were obtained. In vitro study using B16 and CT26 cancer cells containing the triphenyl-o-carboranyl chromium (0) complexes Ph3C2BCr2 and Ph3C2BCr3, which we have previously reported, the compounds 2 and 3 accumulated at higher levels than compounds Ph3C2BCr2 and Ph3C2BCr3. However, the phenylated o-carboranyl chromium(0) complexes have been found to be more cytotoxic than p-boronophenylalanine (BPA).

Fibrillin (FBN) is a plastid lipid-associated protein found in photosynthetic organisms from cyanobacteria to plants. In this study, 10 CsaFBN genes were identified in genomic DNA sequences of cucumber (Chinese long and Gy14) through database searches using the conserved domain of FBN and the 14 FBN genes of Arabidopsis. Phylogenetic analysis of CsaFBN protein sequences showed that there was no counterpart of Arabidopsis and rice FBN5 in the cucumber genome. FBN5 is essential for growth in Arabidopsis and rice; its absence in cucumber may be because of incomplete genome sequences or that another FBN carries out its functions. Among the 10 CsaFBN genes, CsaFBN1 and CsaFBN9 were the most divergent in terms of nucleotide sequences. Most of the CsaFBN genes were expressed in the leaf, stem, and fruit. CsaFBN4 showed the highest mRNA expression levels in various tissues, followed by CsaFBN6, CsaFBN1, and CsaFBN9. High-light stress combined with low temperature decreased photosynthetic efficiency and highly induced transcript levels of CsaFBN1, CsaFBN6, and CsaFBN11, which decreased after 24 h treatment. Transcript levels of the other seven genes were changed only slightly. This result suggests that CsaFBN1, CsaFBN6, and CsaFBN11 may be involved in photoprotection under high-light conditions at low temperature.

Glucagon-like peptide-1 (GLP-1) is an incretin hormone that acts on the pancreas to increase insulin and decrease glucagon secretion. Albuminuria is the pivotal marker for diabetic nephropathy, which is the leading microvascular complication of diabetes mellitus. Most of the previous studies mainly focused on the clinical trials of the therapeutic renal protective effect after administration of GLP-1 receptor agonists (GLP-1 RAs), not prior to administration. Therefore, this study aimed to investigate the association between fasting plasma GLP-1 levels and albuminuria before GLP-1 RA administration. A cross-sectional study was designed to evaluate the association between fasting plasma GLP-1 levels and albuminuria in patients with type 2 diabetes mellitus (T2DM). A total of 68 T2DM participants were analyzed from the data at Wonkwang University Hospital in Iksan, Korea. Logistic regression analysis was performed to evaluate the odds ratio (OR) and 95% confidence interval (CI) of the incidence of albuminuria between the GLP-1 low group (Group L) and the high group (Group H). The OR (95% CI) for the incidence of albuminuria comparing the Group L with the Group H of fasting plasma GLP-1 levels was 3.410 (1.160-10.023), p = 0.026 after adjustment for age, gender, fasting plasma glucose, HbA1c, C-peptide, the use of ACE inhibitors or ARBs, SGLT-2 inhibitors, and DPP-4 inhibitors. As a continuous variable, the OR (95% CI) for the incidence of albuminuria associated with the reduction of each 1 pmol/L in fasting plasma GLP-1 levels was 1.673 (1.173-1.870), p = 0.018, after full adjustment. This study showed the negative association between fasting plasma GLP-1 levels and the incidence of albuminuria in Korean patients with T2DM, before GLP-1 RA administration. This result suggests that endogenous GLP-1 may play a role in attenuating albuminuria.

Human Pose Estimation (HPE) is a technique in computer vision and AI for detecting and tracking human body parts and poses from images or videos. Widely used in augmented reality, animation, fitness applications, and surveillance, HPE methods using monocular cameras are highly versatile due to their applicability in standard video and CCTV footage. These methods have evolved from 2D to 3D pose estimation. However, current 3D HPE methods trained on laboratory-based motion capture data encounter challenges such as limited training data, depth perception ambiguity, left/right switching, and issues with occlusions when applied in real-world environments. This study compares two representative 3D HPE methods by assessing their strengths and weaknesses with real-world videos. Then, we propose data processing techniques to eliminate and correct anomalies like left/right inversion and false detections of joint positions in daily life motions. Finally, we obtain joint angle trajectories using an optimization method based on a 3D humanoid simulator, taking as input the joint coordinate data corrected by applying the proposed human joint data processing technique. The efficacy of the proposed 3D HPE method is verified by applying it to three-dimensional freehand gymnastics exercises and comparing the joint angle trajectories during the motion.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (<1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

Excessive alcohol consumption is one of the significant causes of morbidity and mortality worldwide. Alcohol is oxidized to toxic and carcinogenic acetaldehyde by alcohol dehydrogenase (ADH) and further oxidized to a non-toxic acetate by aldehyde dehydrogenase (ALDH). Emerging evidence shows that Lactobacillus and Bifidobacterium species encode alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH) mediate alcohol and acetaldehyde metabolism, respectively. This study involves supplementation of Lactobacillus and Bifidobacterium probiotic mixture in humans and assessed their effects on alcohol and acetaldehyde metabolism. Here, twenty-seven wild types (ALDH2*1/*1) and the same number ofheterozygotes (ALDH2*2/*1) were recruited for the study. The enrolled participants were randomly divided into either the probiotic (Duolac ProAP4) or the placebo group. Each group received a probiotic or placebo capsule for 15 days with subsequent crossover. Primary outcomes were measurement of alcohol and acetaldehyde in the blood after the alcohol intake. Blood levels of alcohol and acetaldehyde in the ALDH2 heterozygote group were significantly downregulated in the probiotic-supplemented group with no changes in hangover score symptoms than the placebo group. No clinically significant changes were observed in safety parameters. These results suggest that probiotic has a potential to downregulate the alcohol and acetaldehyde concentrations, and their effects depend on the presence or absence of polymorphism on the ALDH2 gene.

For the effective utilization of rice husk, organosolv fractionation was investigated to separate three main components (glucan, xylose, and lignin) with low acid concentration. Reaction temperatures of 170–190 °C, ethanol concentrations of 50–70% (v/v), and sulfuric acid concentrations of 0–0.7% (w/v) were investigated, with the reaction time and liquid-to-solid ratio kept constant at 60 min and 10, respectively. The fractionation conditions for the efficient separation into the three components of rice husk were determined to be 180 °C, 60% (v/v) of ethanol, and 0.25% (w/v) of sulfuric acid. Under these fractionation conditions, 86.8% of the xylan and 77.5% of the lignin were removed from the rice husk, and xylose and lignin were obtained from the liquid in 67.6% and 49.8% yields, respectively. The glucan digestibility of the fractionated rice husk was 85.2% with an enzyme loading of 15 FPU (filter paper unit) of cellulase per g-glucan.

Cisplatin-based chemotherapy has long been viewed as the first-line chemotherapy for advanced and metastatic urothelial carcinoma (UC). However, many patients with UC have been classified as “cisplatin-ineligible patient”, which requires alternative chemotherapy due to their poor responses. In fact, vast majority of those who initially responded to cisplatin-based chemotherapy eventually progressed. Understanding of UC tumor immunology provided an immunopathogenic bases for immune checkpoint inhibitors, targeting PD-1 and CTLA-4, to treat cisplatin ineligible metastatic UC and patients with platinum-refractory metastatic UC. In 2020, data from the trail further showed that PD-L1 inhibitors benefit prolonged survival and progression-free survival as maintenance therapy. Besides immune-targeting therapies, manipulation of tumor microenvironment via metabolic pathways alternation, such as inhibiting tumor glycolysis, lactate accumulation and exogenous glutamine uptake, has been investigated in the past few years. In this comprehensive review, we started by introducing traditional chemotherapy of UC, and summarized current evidences supporting the use of immune checkpoint inhibitors and highlighted ongoing clinical trials. Lastly, we reviewed the tumor metabolic characteristic and the anti-tumor treatments targeting metabolic pathways.

Objective: The purpose of this study was to determine if Porphyra tenera extract (PTE) has immune-enhancing effects and is safe in healthy adults. Methods: Subjects (3x10³ ≤ peripheral blood leukocyte levels < 8x10³ cells/μl) who met the inclusion criteria were recruited for this study. Enrolled subjects (n=120) were randomly assigned to either the PTE group (n=60) who were given 2.5 g/day of PTE (as Porphyra tenera extract) in capsule form or the placebo group (n=60) who were given crystal cellulose capsules with the identical appearance, weight, and flavor as the PTE capsules for 8 weeks. Outcomes were assessed by measuring natural killer cell (NK-cell) activity, cytokines, and upper respiratory infection (URI), and safety parameters were assessed at baseline and 8 weeks. Results: Compared to baseline, NK cell activity (%) increased for all effector cell to target cell ratios in the PTE group after 8 weeks, but there were no changes in the placebo group (p<0.1). Subgroup analysis of 101 subjects without an URI revealed that NK-cell activity in the PTE group tended to be increased for all E:T ratios (E:T=12.5:1 p=0.068; E:T=25:1 p=0.036; E:T=50:1 p=0.081) compared to the placebo group. There was a significant difference between these two groups for the E:T=25:1 ratio, which increased from 20.3±12.0% at baseline to 23.2±12.4% after 8 weeks in the PTE group (p=0.036). There was no significant difference in levels of cytokines between these two groups. Conclusions: PTE supplementation appears to enhance immune function by improving NK-cell activity without adverse effects in healthy adults.

Cardiovascular disease is the leading cause of death worldwide. A key factor in assessing the risk of cardiovascular disease is left ventricular functional evaluation. Left ventricular (LV) systolic function is evaluated by measuring the left ventricular ejection fraction (LVEF) using echocardiography data. Therefore, quick and accurate left ventricle segmentation is important for estimating the LVEF. However, it is difficult to accurately segment the left ventricle due to changes in the shape and area of the left ventricle during cardiac cycles. In this study, we proposed a framework that considers changes in the shape and area of the left ventricle during the cardiac cycle by applying the convolutional long short-term memory (CLSTM) approach. In addition, we evaluated the left ventricular segmentation and multidimensional quantification of the proposed system in comparison to manual and automated segmentation methods. In addition, to assess the validity of CLSTM, the values of multi-dimensional quantification metrics were compared and analyzed using graphs and Bland–Altman plots on a frame-by-frame basis. We demonstrated that the CLSTM method effectively segments the left ventricle by considering the LV activity. In conclusion, we demonstrated that LV segmentation based on our framework may be utilized to accurately estimate LVEF values.

As argued by ‘Declaration of Concrete Environment (2010)’ of Korea and ‘Declaration of Asian Concrete Environment (2011)’ of six Asian countries, concrete as a single material has lately shown extremely large impact on environmental issues such as climate change. Assessment of environmental impact from concrete material and production has considerable importance. Concrete is a major material used in the construction industry that emits a large amount of substances with environmental impacts during its life cycle. Accordingly, technologies for the reduction in and assessment of the environmental impact of concrete from the perspective of Life Cycle Assessment must be developed. At present, the studies in relation to greenhouse gas emission from concrete are being carried out globally as a countermeasure against climate change. In this study, a sustainable concrete mix design algorithm was designed using correlation analyses, and its carbon emission and cost reduction performances were assessed. Using correlation analyses, the concrete strength, w/b and s/a ratios, and CO₂ emissions were identified as major variables of concrete mix design that influenced other variables. Also, this study aims to evaluate the CO₂ emission reduction performance of the algorithm-deduced sustainable concrete mix design, and therefore, the CO₂ emissions of the sustainable concrete mix design are compared with those of the actual concrete mix design applied to the construction of the office building A in South Korea.

While the container crane is an important part of daily port operations, it has received little attention compared with other infrastructures, such as buildings and bridges. Crane collapse due to earthquake affects the operation of the port, and indirectly impacts the economy. This study proposes fragility analyses for various damage levels of the container crane that allow the port owner and partners to better understand the seismic vulnerability presented by container cranes. A large quantity of nonlinear time history analyses was applied for a three-dimensional (3D) finite element model to quantify the vulnerability of the container crane in considering the uplift and derailment behavior. The uncertainty of demand and capacity of the crane structures were also considered through random variables, i.e. elastic modulus of members, ground motion profile, and intensity. The results analyzed in the case of a Korean container crane showed that the probability of exceeding the first uplift with or without derailment is shown before the crane reaches the structure’s limit states. This means that under low seismic excitation, the crane might be derailed without any structural damage. But when the crane reaches the minor damage state, it is always coupled with a certain probability of uplift with or without derailment. This study also proposes the fragility curves developed for different structural periods to enable port stakeholders to assess the risk of their container crane.

Background/Aim: microRNAs (miRNAs) are key regulators of both physiological and pathophysiological mechanisms in diabetes and gastrointestinal (GI) dysmotility. Our previous studies have demonstrated the therapeutic potential of miR-10a-5p mimic and miR-10b-5p mimic (miR-10a/b mimics) in rescuing diabetes and GI dysmotility in murine models of diabetes. In this study, we elucidated the safety profile of a long-term treatment with miR-10a/b mimics in diabetic mice. Methods: Male C57BL6 mice were fed a high-fat, high-sucrose diet (HFHSD) to induce diabetes and treated by five subcutaneous injections of miR-10a/b mimics for a 5-month period. We examined the long-term effect of the miRNA mimics on diabetes and GI dysmotility, including an assessment of cancer risk as well as liver and colon inflammation using cancer and inflammatory biomarkers. Results: HFHSD-induced diabetic mice subcutaneously injected with miR-10a/b mimics monthly for 5 months exhibited a marked reduction in fasting blood glucose levels with restoration of insulin and significant weight loss, improved glucose and insulin intolerance, and restored GI transit time. In addition, the miR-10a/b mimic treated diabetic mice showed no indication of risk for cancer development and inflammation induction in the liver, colon, and blood for the 5 months post injections. Conclusion: This longitudinal study demonstrates that miR-10a/b mimics, when subcutaneously administered in diabetic mice, effectively alleviate diabetes and GI dysmotility for 5 months with no discernible risk for cancer or inflammation in the liver and colon. The sustained efficacy and favorable safety profiles position miR-10a/b mimics as promising candidates in miRNA-based therapeutics for diabetes and GI dysmotility.

The association between the choice of general anesthetic agents and the risk of acute kidney injury (AKI) and long-term renal function after nephrectomy has not yet been evaluated. We reviewed 1087 cases of partial or radical nephrectomy. The incidence of postoperative AKI, new-onset chronic kidney disease (CKD) stage 3a and CKD upstaging were compared between different general anesthetic agent groups: propofol, sevoflurane, and desflurane. Four different propensity score analyses were performed to minimize confounding for each pair of comparison (propofol vs sevoflurane; propofol vs desflurane; sevoflurane vs desflurane; propofol vs volatile agents). Study outcomes were compared before and after matching. Kaplan-Meier survival curve analysis was performed to compare renal survival determined by the development of CKD stage 3a between groups up to 36 months after nephrectomy before and after matching. Propofol was associated with a lower incidence of AKI, CKD upstaging and a higher three-year renal survival after nephrectomy compared to sevoflurane or desflurane group after matching (AKI: propofol 23.2% vs. sevoflurane 39.5%, P=0.004, vs. desflurane 34.3%, P=0.031; CKD upstaging: propofol 27.2% vs. sevoflurane 58.4%, P<0.001, vs. desflurane 48.6%, P=0.017; Log-rank test propofol vs. sevoflurane P<0.001, vs. desflurane P=0.015). Propofol was also associated with a lower incidence of new-onset CKD after nephrectomy compared to sevoflurane after matching (P<0.001). However, there were no significant differences between sevoflurane and desflurane. In conclusion, propofol, compared to volatile agents, may be the reasonable choice of general anesthetic agent for nephrectomy to attenuate postoperative renal dysfunction. Randomized prospective trials are warranted to test this hypothesis.

Background Telomere shortening is related to aging and unfavourable health outcomes. Obesity and metabolic diseases are important factors for accelerating aging. This study aimed to find out the association between obesity, metabolic disease, and telomere length in metabolically healthy adults. Methods 237 adults were enrolled with written consents at a health promotion centre of a tertiary hospital from February 2014 to March 2015. After excluding 99 subjects who met the exclusion criterion, a total of 130 metabolically healthy subjects were selected for final analysis. The subjects were divided into quartile groups according to the telomere lengths of their oral mucosal cells. Results The subjects consisted of 66 (50.8%) males with a mean age of 58.59 years. The body mass index (BMI, kg/m2) increased significantly along with the quartile groups (Q1, 23.00; Q2, 23.96; Q3, 23.70; Q4, 25.20; P-for trend=0.008). Waist circumference (WC, P-for trend=0.022), waist-to-hip ratio (WHR, P-for trend=0.005), and waist-to-height ratio (WHtR, P=0.001) also increased along with the quartile groups. Obesity prevalence (BMI ≥25 kg/m2), abdominal obesity (WC ≥90 cm for men, ≥85 cm for women), WHR 〉1.0 for men or 〉0.85 for women, and WHtR ≥0.5 increased significantly as the telomere length increased (P-for trend <0.05). After adjusting for covariates, the ORs for each obesity markers increased as the telomere length increased (P-for trend <0.05); and the ORs of WHtR were especially meaningful (Q1, 1.00; Q2, 2.53; Q3, 2.97; Q4, 7.81; P-for trend = 0.001). There were no significant trends for metabolic syndrome and its components along with the prevalence of fatty liver disease. Conclusion Obesity markers and telomere length had significant positive correlation despite the established theory. The obesity paradox may exist in metabolically healthy adults with regard to telomere length, However, further studies with larger sample sizes for the association between obesity and telomere length are needed.

The rhizome of Drynaria fortunei (Kunze ex Mett.) J. Sm., which is known as “Golsebo” in Korea, has been traditionally used to treat various inflammatory conditions, including bone metabolism disorders. It relieves blood extravasation, stops bleeding, repairs broken bone tissue, treats bone fractures, and kills bacteria. Recently, D. fortunei-derived polysaccharides (DFP) have been identified as bioactive compounds that act against numerous human diseases. However, the molecular mechanism underlying the bone metabolism-improving effect of DFP has not been elucidated. In this study, we evaluated the modulatory effects of DFP on the differentiation of bone marrow-derived macrophages into osteoclasts. We performed tartrate-resistant acid phosphatase assays using DFP (different concentrations and molecular weights) to evaluate the degree of bone resorption in the receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclastogenesis of bone marrow-derived macrophages. DFP significantly inhibited RANKL-induced osteoclastogenesis and suppressed RANKL-mediated overexpression of c-Fos and nuclear factor of activated T cells 1, thereby downregulating osteoclast-specific gene (Atp6v0d2, DC-STAMP, and cathepsin K) expression. DFP has potential as a nutraceutical candidate for treating bone loss diseases, including osteoporosis in postmenopausal women.

Skin photoaging is caused by prolonged exposure to ultraviolet (UV) radiation from sunlight. UV-exposed skin appears rough, thick, dry, loose, and shows deep wrinkles, and thickening. Our previous research showed that a Phaseolus angularis seed extract (PASE) effectively inhibits photoaging through UVB protection in HaCaT cells. However, its efficacy has not been evaluated in clinical trials so far. In this single-centered, randomized, double-blind study, we investigated the anti-aging effect of PASE in eye wrinkle areas. To these 21 healthy adult women aged 30 to 65, a PASE cream was applied to the right eye wrinkle area and a placebo to the left eye wrinkle area twice a day (morning and evening) for 12 weeks. The change in thick, deep crease wrinkles around the eyes was confirmed by visual evaluation, skin measurements, and a questionnaire. As a result, the R1 (surface roughness), R2 (maximum roughness), R3 (average roughness), R4 (smoothness depth), and R5 (arithmetic mean roughness) values in the group using the PASE cream all decreased. Particularly, R1, R4, and R5 significantly decreased by 18.1%, 18.6%, and 25.0%. In addition, no participants reported side effects. Our study showed that PASE led to clinically significant levels of wrinkle improvement. In conclusion, as PASE is a natural food, safe, and with few side effects, it can be a good resource for natural anti-wrinkle cosmetics in the future.

We fabricated the nano-aperture plasmonic platforms for single molecule detection and other various applications such as infrared thermal emission device. The nano-apertures including the nanopores on the pyramid, and the nano-slits on the Au flat membrane were fabricated using a Ga ion focused ion beam drilling technique, followed by high energy electron beam irradiations dependent upon the electron beam current density. The nanopores with a few nanometer size and the nanoslit array with order of ~ 100 nm width were fabricated. Optical characteristics for the various nanoslits were examined dependent upon the slit opening width and sample thickness. The broad emission spectra from the (7x 7) slit array are obtained from spp-mediated emission in the visible and infrared region. A sharp strong infrared emission peak is also obtained due to Au nanoparticle. The fabricated Au platform can be utilized as single molecule sensor and infrared thermal emission device.

Background: Inflammasomes recognize cytosolic danger signals, including pathogens, and subsequently induce the secretion of pro-inflammatory cytokines, such as interleukin (IL)-1β. Studying inflammasomes in the red fox (Vulpes vulpes) is crucial from a wildlife veterinary and public health perspective, as it can be used to help control and prevent the transmission of zoonotic pathogens. The understanding of how diversity in inflammasomes across species affects pathogen carriage in the red fox is still limited. Methods: We investigated the activation and intracellular mechanisms of three inflammasomes (NLRP3, AIM2, and NLRC4) in fox peripheral blood mononuclear cells (PBMCs), using established triggers and inhibitors derived from humans and mice. Results: Fox PBMCs exhibited normal activation and induction of IL-1β secretion in response to representative inflammasome triggers (ATP and nigericin for NLRP3, dsDNA for AIM2, flagellin for NLRC4). However, in inhibitor studies, MCC950, a selective NLRP3 inhibitor, suppressed IL-1β secretion mediated by the fox AIM2 and NLRC4 inflammasomes. Conclusions: These findings suggest that NLRP3 may have a common role in dsDNA- and flagellin-mediated inflammasome activation in the red fox. In conclusion, this fox inflammasome biology can be applied to the control of zoonotic infections and the treatment of inflammasome-mediated diseases in the red fox.

Background and Objectives: Light therapy (LT) is used as an adjunctive treatment for sleep problems. This study evaluates the impact of LT on sleep quality and sleep-related parameters in patients with sleep disorders. Materials and Methods: We performed a pilot randomized, open-label clinical trial. Fourteen patients aged 20–60 years with sleep disorders for more than three months were randomized into the control and LT groups (1:1 ratio). The LT group was instructed to use a device that provides bright LT (6000 K, 380 lux, wavelength 480 nm) for at least 25 minutes before 09:00 am for two weeks. A self-reported questionnaire was used to evaluate circadian preference, mood, and sleep-related parameters. We analyzed serum cortisol levels and clock genes expression. Results: The Epworth Sleepiness Scale (ESS), insomnia severity index, and Pittsburgh Sleep Quality index were significantly improved within the LT group only after the two-week period. When comparing the two groups, only the change in ESS significant was significant (mean difference; control: -0.14 vs LT: -1.43, p=0.021) after adjusting for baseline characteristics. There were no significant differences in serum cortisol or clock genes expression. Conclusions: LT can improve daytime sleepiness in patients with sleep disorders; however, further well-designed studies are warranted to confirm its efficacy.

Age-related hearing loss (ARHL) is the most common sensory disorder in the elderly. It is associated with aging and hair cell death due to oxidative stress-induced mitochondrial dysfunction. Although transgenic mice and long-term cultures for induction of aging have been used to study ARHL, there are presently no ARHL animal models stimulated by intermittent environmental change for aging. In this study, an ARHL animal model was established by inducing continuous oxidative stress to promote short-term aging of cells, determined based on the expression of the hearing loss-induced phenotype and aging related factors in the short term. The incidence of hearing loss was significantly different among the groups subjected to intermittent hypoxic environment, high-fat diet (HFD), and injection with D-galactose. Continuous oxidative stress and HFD were factors that accelerated cellular aging. Increase in UCP2 affected oxidative stress and mitochondrial dysfunction. CDH23, SLC26A4, KCNQ4, Myo7a, and Myo6, which are ARHL-related factors, were modified by oxidative stress in cells of the hearing organ. We found that intermittent hypoxic, HFD, and galactose injection accelerated cellular aging in the short term. Thus, we anticipate that the development of this hearing loss animal model, which reflects intermittent environmental changes, will benefit future research on ARHL.

Lichens are a life form in which algae and fungi have a symbiotic relationship. A lichen has various biological activities, including anti-inflammatory and anti-proliferative activities. Inflammation is a response caused by various factors, such as infection by pathogens or tissue damage; excessive reactions can contribute to the etiology of chronic diseases, such as asthma, brain damage, and serious tissue damage. This study demonstrates the anti-inflammatory effect of ethyl acetate extract from Phlebia sp. on NF-κB and AP-1 pathways in the lipopolysaccharide-treated RAW 264.7 cell. Especially, Phlebia sp. extract inhibits the phosphorylation of AP-1 signaling (c-Fos and c-Jun) and its upstream MKK/MAPKs (MKK4, MKK7 and JNK), which induced a decrease in the production of the inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-1β (IL-1β), and granulocyte-macrophage colony-stimulating factor (GM-CSF) in downstream of AP-1 signaling. Furthermore, Phlebia sp. extract inhibited the production of final inflammatory effector molecules involved in AP-1 signaling, including nitric oxide (NO) and prostaglandin E2 (PGE2). Here, we report that Phlebia sp. extract has the potential to be developed as an anti-inflammatory agent.

This study investigated the impact of boron and copper on the microstructure and mechanical properties of Spheroidal graphite Cast Iron (SCI). The addition of boron increased the ferrite content, while copper increased the stability of pearlite. The interaction between boron and copper significantly increased the ferrite content. Differential Scanning Calorimetry (DSC) revealed that boron decreased the enthalpy change of the α + Fe3C -> γ transformation and increased the enthalpy change of the α -> γ transformation. The addition of boron and copper reduced the tensile and yield strength but increased elongation and impact energy. The findings provide valuable insights into the effect of boron and copper on SCI, facilitating the design and development of high-performance SCI materials.

Background: Animal-assisted therapy has positive effects on cognitive function, depression, performance ability, and social functioning in elderly patients. The aim of this study was to evaluate the effects of rearing pet insects on the cognitive function of healthy elderly participants, with fMRI (functional magnetic resonance imaging) being used for this purpose. Methods: Community-dwelling elderly women (≥60 years) with normal cognitive function were enrolled during April 2015. They were randomized at a 1:1 ratio into two groups: insect-rearing and control (n=16) groups, with the insect-rearing group being further classified into two groups for analysis according to the subjects’ scores in the Wisconsin Card Sorting Test, WCST) at the first fMRI: insect-rearing group I with a relatively high score (n=13), and insect-rearing group II with a relatively low score (n=6). All subjects were educated on a healthy lifestyle for better cognitive function at every visit, and the insect-rearing groups received and reared crickets as pet insects. The fMRI was performed at baseline and after 8 weeks using the WCST as a stimulus. The WCST consisted of two variations, a high level baseline (HLB) and semi-WCST version. Results: There were no significant differences in the baseline characteristics among the three groups. There was a significant difference accuracy of the HLB–semi-WCST (p<0.05) in insect-rearing group II after 8 weeks from the baseline test. In the fMRI analysis involving the WCST reaction test, increased activation was observed in the right dorsal lateral prefrontal cortex and parietal cortex in insect-rearing group II when the semi-WCST, rather than the HLB, was performed. There were no significant differences in the other groups. Conclusion: The rearing of pet insects as an animal-assisted therapy is cost-effective, easy, and occupies little space. In this study, it showed positive effects on executive functions and performance improvement in elderly women. Further larger studies on the effects of pet insects on cognitive function are warranted.

Coronary artery disease (CAD) is a prevalent cardiovascular condition characterized by the accumulation of plaque within coronary arteries. This plaque accumulation obstructs blood flow to the heart, resulting in a heart attack. While distinct features of CAD have been identified, its causes remain largely unclear, with the exception of environmental and nutritional factors. This study aimed to investigate the connection between genetic factors and CAD, focusing on the thymidylate synthase (TS) gene, a gene involved in one-carbon metabolism. Therefore, our research targeted single nucleotide polymorphisms that could potentially impact TS gene expression and lead to dysfunction. Our findings strongly associate the TS 1100T&gt;C and 1170A&gt;G genotypes with CAD susceptibility. We observed that TS 1100T&gt;C polymorphisms increased disease susceptibility in several groups, while the TS 1170A&gt;G polymorphism displayed a decreasing trend for disease risk when interacting with clinical factors. Furthermore, our results demonstrate the potential contribution of the TS 1100/1170 haplotypes to disease susceptibility, indicating a synergistic interaction with clinical factors in disease occurrence. Based on these findings, we propose that polymorphisms in the 3'-UTR miRNA binding site of the TS gene could serve as clinically useful biomarkers for the prevention, prognosis, and management of CAD.

At present, magnetic selection of genetically modified cells is mainly performed with surface markers naturally expressed by cells such as LNGFR, CD4 and H-2Kk. The disadvantage of such markers is the possibility of their undesired and poorly predictable expression by unmodified cells before or after cell manipulation, which makes it essential to develop new surface markers that would not have such a drawback. Earlier, modified CD52 surface protein variants with embedded HA and FLAG epitope tags (CD52/FLAG and CD52/HA) were developed by the group of Dr. Mazurov for selection of CRISPR-modified cells using FACS. In the current study, we tested whether these markers can be used for magnetic selection of transduced cells. For this purpose, appropriate constructs were created in MigR1-based bicistronic retroviral vectors containing EGFP and DsRedExpress2 as fluorescent reporters. Cytometric analysis of the transduced NIH 3T3 cell populations after magnetic selection evaluated the efficiency of isolation and purity of the obtained populations, as well as the change in the median fluorescence intensity (MFI). The results of this study demonstrate that the surface markers CD52/FLAG and CD52/HA can be effectively used for magnetic cell selection, and their efficiencies are comparable to that of the commonly used LNGFR marker. At the same time, the significant advantage of these markers is the absence of HA and FLAG epitope sequences in cellular proteins, which rules out spurious co-isolation of negative cells.

The science‐policy interface in climate change adaptation became better managed over the past decades. However, the scientists and other knowledge producers, as well as policy makers still need to take bolder steps to more effectively engage with others to apply science and shape up policies. This paper aims to provide practical recommendations, intended to promote conversations between science and policy sectors to address climate change issues. Here, I used two different approaches to synthesize experiences and identify recommendations: a literature review and a case study. The paper stress main findings: (1) The linear communication model is still commonly involved in the science - policy dialogue and proved to be useful to increase the relevance of science and data products to decision makers. (2) When a gap between knowledge producer and knowledge user or decision maker exists, the need for a third party to specialize in bridging the gap become essential. (3) Indigenous people and knowledge must be involved in adaptation policy making based on legitimation local and traditional knowledge, designing the consultation process to broadly engage local and indigenous people, facilitating meaningful dialogues between traditional knowledge and science, and developing initiatives to strengthen skills and capacity of indigenous communities.

Background: The advances of genomics have greatly improved the survival rate cancer patients. However, due to genetic heterogeneity, pancreatic ductal adenocarcinoma (PDAC) is still difficult to diagnose early and the survival rate is extremely low. Therefore, we identified biomarkers that predict the prognosis of PDAC patients by using independent cohort data. Methods: To develop a novel prognostic biomarker, we used gene expression and clinical data from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO). In Kaplan-Meier survival curve using median values of genes as cut off, the only statistically significant gene in the three cohorts was EIF4G1. We analyzed prognostic significance of EIF4G1 using the time-dependent area under the curve (AUC) of the Uno's C-index, the AUC value of the receiver operating characteristics (ROC) at 3 years, and multivariate cox analysis. Also, we compare EIF4G1 levels between tumor and matched non-tumor. Results: EIF4G1 is the only prognostic gene patients with PDAC which was selected by Kaplan-Meier survival analysis. Kaplan-Meier survival analysis showed that high expression of EIF4G1 was associated with poor prognosis of PDAC with good discriminative ability in 3 independent cohorts. Risk stratifying ability of EIF4G1 was demonstrated by analyzing C-indices and AUC values. Multivariate cox regression analysis confirmed its prognostic significance. EIF4G1 expression was significantly higher in the PDAC tissues than in the matched normal tissues. Conclusions: Herein, the novel prognostic biomarker EIF4G1 could be used as prognostic maker for PDAC and determining suitable treatment options.

Hizikia fusiformis is a common, edible marine alga found in Asia. Although the anticancer activity of its extracts has previously been investigated, its active compounds have not been identified. In this study, saringosterol acetate (SA) was isolated from H. fusiformis extracts by centrifugal partition chromatography (CPC) system (two phase solvents condition: n-hexane:ethyl acetate/methanol:water = 5:3:7:1, v/v), exhibited anticancer effects in the human lung adenocarcinoma epithelial cell line, A549, by inducing apoptosis and sub-G1 phase cell cycle arrest. In addition, SA increased the expression of the pro-apoptotic proteins, Bax and cleaved caspase 3, and decreased that of the anti-apoptotic protein Bcl-xL. Although, SA did not affect the expression of p53, induces expression of Bid and caspase 8. In conclusion, we suggested that SA induces apoptosis against A549 cells via Bid and caspase 8 dependent pathway.

Field cricket (Gryllus bimaculatus) is newly emerged as an edible insect in several countries. Anti-inflammatory effect of glycosaminoglycan derived this cricket was not fully investigated on chronic disease animal model such as diabetic mouse. For potential therapeutic agents, anti-diabetic activities of field cricket glycosaminoglycan (GbG) was evaluated in diabetic mice based on their abilities to reduce glucose, ALT, AST, LDL-cholesterol, and BUN levels, compared with dung beetle (Catharsius molossus) glycosaminoglycan (CaG) as a positive control glycosaminoglycan. Db mice were orally administered for one month according to their groups: Db Hetero (normal), Db Homo (type-2 diabetic), CaG (5 mg/kg), GbG (5 mg/kg), and metformin (10 mg/kg). Blood glucose level was decreased after 1^st week treatment with GbG. It also inhibited LDL-cholesterol and alkaline phosphatase levels. Regarding oxidative damage of diabetic state, levels of hepatocellular biomarkers levels and protein carbonyl content were reduced in db mice treated with GbG. Especially anti-oxidative activities of catalase, superoxide dismutase, and glutathione peroxidase were significantly increased in GbG treated group compared to those in the control. GbG was composed of heparin disaccharides and main N-glycan was identified as Hex₉GlcNAc₂ (m/z 1905.7) of with neutral mono-sugar mainly comprising of hexose, L (+) rhamnose by mass spectroscopy. These results from sero-biochemical, hepatocellular anti-oxidant assay in db mice data suggest cricket (G. bimaculatus) glycosaminoglycan might play a role in its anti-diabetic action.

We report the development of an extrinsic self-healing coating system that shows no fluorescence from the intact coating, yellowish fluorescence in cracked regions, and greenish fluorescence in healed regions, thus allowing the separate monitoring of cracking and healing of coatings. This fluorescence monitoring self-healing system consisted of a top coating, an epoxy matrix resin containing mixed dye-loaded in single microcapsule. The dye-loaded microcapsules consisted of a poly(urea-formaldehyde) shell encapsulating a healing agent containing MAT-PDMS and styrene, a photo-initiator and a mixture of two dyes, one that fluoresces only in the solid state (DCM) and a second that fluoresces dramatically increased in the solid than solution state (4-TPAE). A mixture of the healing agent, photo-initiator and the two dyes was yellow due to fluorescence from DCM. On UV curing of this mixture, however, the color changed from yellow to green and the fluorescence intensity increased due to fluorescence from 4-TPAE in the solid state. When a self-healing coating embedded with microcapsules containing the DCM/4-TPAE dye mixture was scratched, the damaged region exhibited a yellowish color that changed to green after healing. Thus, the self-healing system reported here allows the separate monitoring of cracking and healing based on changes in fluorescence color.

The chemopreventive effects of various mixed cereal grain (MCG) samples on azoxymethane (AOM, 10 mg/kg) and dextran sulfate sodium (DSS, 2% w/v)-induced colorectal cancer (CRC) in C57BL/6J mice were studied. The main MCG preparation consisted of fermented brown rice (FBR), glutinous brown rice, glutinous Sorghum bicolor, glutinous Panicum miliaceum, Coix lacryma-jobi and black soybean at an appropriate mixing ratio. Other MCG preparations contained rice coated with 5% Phellinus linteus and 5% Curcuma longa (MGR-PC), or 10% Phellinus linteus (MCG-P), or 10% Curcuma longa (MCG-C). Consumption of dietary MCG-PC by CRC mice significantly increased colon length, decreased the ratio of colon weight to length, and reduced the number of colon tumors. Similar effects, although to a lower extent, were observed in CRC mice fed with MCG-P, followed by those fed with MCG-C, MCG, FBR or white rice (WR). MCG-PC significantly suppressed colonic neoplasia, and decreased the levels of various cytokines (tumor necrosis factor: Tnf, interleukin 1 beta: Il1b, interleukin 6: Il6, and interferon gamma: Ifng) in serum and colon tissue of the CRC mice. In addition, MCG-PC increased the mRNA expressions of tumor protein p53(Tp53) and cyclin-dependent kinase inhibitor 1A(Cdkn1a), activated pro-apoptotic caspase 3(Casp3), and reduced expression of both mRNA and protein of inducible inducible nitric oxide synthase 2 (Nos2), prostaglandin-endoperoxide synthase 2 (Ptgs2), and cyclin D1(Ccnd1) in colon tissue. These findings suggest that than compared with other cereal grain preparations, MCG-PC had a greater activity against AOM/DSS-induced CRC by reducing intestinal inflammation, and modulating the expression of certain carcinogenesis related factors (Nos2, Ptgs2, Tp53, Cdkn1a, Ccnd1 and Casp3) in colon tissue of CRC mice.

This paper will present the torque control design of an AFPMSM, one stator, and one rotor, using an FLC and ANFIS in-wheels fed by a three-level T-type inverter. The Surgeon ambiguous inference file of the FLC controller is built by two input vectors, the stator current error and the derivative of the stator error. These input variables include five membership functions, Negative big (NB), Negative small (NS), Equal zero (ZE), Positive small (PS), and Positive big (PB). The FLC controller is implemented with a 5x5 matrix so that the output stator voltage of the controller is required. The ANFIS controller for the neural network-based feature set and the fuzzy system. The neural network develops the dataset on the stator current error (e) and error integral (∆e). Then, the generated dataset is fed to the fuzzy logic method, and the control rules are developed. This ANFIS controller is caused by the training and testing phases. Finally, the FLC and ANFIS torque controllers are compared with the PI controller. The correctness of the proposed control structured solution is demonstrated by the simulation results of MATLAB/SIMULINK.

Due to advances in power electronics technology and the evolution of automation devices, the number of electrical devices that are sensitive to power quality is rapidly increasing, and for this reason, users are increasing their demand for high quality. To meet power quality demands, many power conversion devices are used, including dynamic voltage restorers (DVRs). DVRs are rec-ognized as devices that can effectively manage problems such as voltage segment, swells, and harmonics. DVR control requires many samples for harmonic compensation, which has the dis-advantage of being complicated to implement due to fast digital signal processing computation and the application of the cyclic discrete Fourier transform. In this paper, a high-precision DVR system configuration is proposed that compensates for harmonics using a periodically equivalent time-interval sampling technique and a novel circular structured memory filter. The proposed circular structured multi-pointer memory filter is an effective filter algorithm for high-precision input voltage measurement because it can remove noise and compensate for the delay of the phase angle of the filter in voltage measurement. A simulation and DVR prototype system was built, and the feasibility and effectiveness of the phase angle multi-filter voltage detection method and the compensation method were verified by experiments.

We report the use of four-layer graphene (4LG) as a highly reliable transparent conductive electrode (TCE) for polymer-dispersed liquid crystal (PDLC)-based smart window devices. The adhesion between 4LG and the substrate was successfully improved through a water-induced interface-cleaning (WIIC) process. We compared the performance of a device with a WIIC-processed 4LG electrode with that of devices with a conventional Indium tin oxide (ITO) electrode and a 4LG electrode without a WIIC. With the application of the WIIC process, the PDLC smart window with a 4LG electrode exhibited reduced turn-on voltage and haze compared to 4LG without the WIIC process and characteristics comparable to those of the ITO electrode. Based on our observations, we conclude that 4LG with WIIC is a promising TCE for flexible smart windows.

Levels of synthetic musk fragrances (SMFs) and various personal care products (PCPs) were measured in the Han River and its tributaries in Seoul, Korea. The most abundant SMF in all river and PCP samples was 4,6,6,7,8,8-hexamethyl-1,3,4,7-tetrahydrocyclopenta[g]isochromene (HHCB), followed by 1-(3,5,5,6,8,8-hexamethyl-6,7-dihydronaphthalen-2-yl)ethanone (AHTN), musk ketone (MK), and 1,1,2,3,3-pentamethyl-2,5,6,7-tetrahydroinden-4-one (DPMI). There was a significant correlation between the SMF concentration in the PCPs and the Han River samples. Moving from upstream to downstream in the Han River, the median SMF concentration was 6.756, 2.945, 0.304, and 0.141 μg/L in the sewage treatment plant (STP) influent, effluent, tributaries, and mainstream, respectively, implying that effective SMF removal was achieved during the sewage treatment process, followed by dilution in the receiving water. Four STPs using advanced biological treatment processes had removal efficiencies of 55.8%, 50.6%, 43.3% for HHCB, AHTN, and MK, respectively. The highest SMF concentrations in the tributaries were observed at locations close to the STPs. Our study confirmed that the main source of SMFs in the receiving water were sewage effluent containing untreated SMFs, which are largely originated from household PCPs, especially hair care products (e.g., shampoo) and perfumes.

An outbreak of occupational methanol poisoning occurred in small-scale 3rd tier factories of large-scale smartphone manufacturer, in the Republic of Korea, in 2016. To investigate the working environment and the health effect of the methanol exposure among co-workers of the methanol poisoning cases, we performed a cross sectional study on 155 workers at the five aluminum CNC cutting factories. Air and urinary methanol concentration were measured by gas chromatography, and health examination included symptoms, ophthalmological examinations and neurobehavioral tests. Multiple logistic regression analyses controlled for age and sex were conducted for revealing association of employment duration with symptoms. Air concentrations of methanol in factory A and E were ranged from 228.5 to 2220.0 ppm. Mean urinary methanol concentrations of the workers in each factory were from 3.5 mg/L up to 91.2 mg/L. The odds ratios for symptom of deteriorating vision and CNS increased, according to the employment duration, after adjusting for age and sex. Four cases with injured optic nerve and two cases with decreased neurobehavioral function were founded among co-workers of the victims. This study showed that the methanol exposure under poor environmental control not only produce eye and CNS symptoms but also affect neurobehavioral function and optic nerve.

Regulated autophagy is involved in the repair of renal ischemia-reperfusion injury (IRI). ω3-Polyunsaturated fatty acids (ω3-PUFAs) show protective effects against various renal injuries. It was recently reported that ω3-PUFAs regulate autophagy. We assessed whether ω3-PUFAs attenuated IR-induced acute kidney injury (AKI) and evaluated associated mechanisms. C57Bl/6 background fat-1 mice and wild-type mice (wt) were divided into four groups: wt sham (n = 10), fat-1 sham (n = 10), wt IRI (reperfusion 35 min after clamping both the renal artery and vein; n = 15), and fat-1 IRI (n = 15). Kidneys and blood were harvested 24 h after IRI. Renal histological and molecular data were collected. The kidneys of fat-1 mice showed better renal cell survival, renal function, and pathological damage than those of wt mice after IRI. In addition, fat-1 mice showed less oxidative stress and autophagy impairment; greater amounts of LC3, Beclin-1, and Atg7; lower amounts of p62; and higher levels of renal cathepsin D and ATP6E than wt kidneys. They also showed more AMPK activation, which resulted in the inhibition of phosphorylation of the mammalian target of rapamycin (mTOR). Collectively, ω3-PUFAs in fat-1 mice contributed to AMPK mediated autophagy activation, leading to a renoprotective response.

Stereotactic radiosurgery (SRS) is considered the initial treatment for lung cancer patients with small-sized and limited number of brain metastases. The objective of this study was to assess clinical outcomes of SRS treatment using CyberKnife (CK) for recursive partitioning analysis (RPA) class II/III patients with one to three brain metastases from lung cancer and identify which patients in the high RPA class could benefit from SRS. A total of 48 lung cancer patients who received CK-based SRS for their metastatic brain lesions from 2010 to 2017 were retrospectively analyzed. Radiographic response was evaluated during follow-up period. Overall survival (OS) and intracranial progression-free survival (IPFS) were calculated and prognostic variables associated with OS and IPFS were evaluated. Median follow-up time was 6.6 months. Local control rates at 6 months and 1-year following SRS were 98% and 92%, respectively. The median OS of all patients was 8 months. One-year and 2-year OS rates were 40.8% and 20.9%, respectively. In multivariate analysis, uncontrolled primary disease (p = 0.008) and ECOG performance status of 2 or 3 (p = 0.001) were independent prognostic factors for inferior OS. These two factors were also significantly associated with inferior IPFS. In subgroup analysis according to RPA class, primary disease status was the only prognostic factor, showing statistically significant OS differences in both RPA class II and III (controlled vs. uncontrolled: 41.1 vs. 12.3 months in RPA class II, p = 0.031; 26.9 vs. 4.1 months in RPA class III, p = 0.011). Our results indicated that SRS could be an effective treatment option for RPA class II/III patients with brain metastases from lung cancer in the modern treatment era. SRS might be particularly considered for patients with controlled primary disease.

The contact materials in high-voltage vacuum interrupter require properties such as high conductivity, high density, and high hardness to minimize arc heat damage. In this study, copper–molybdenum-chromium alloys contact materials are examined for a high voltage contact material. Ball milling process was carried out after analyzing the raw materials of copper, chromium, and molybdenum powders. A green compact was produced using a high press with the mixed powder. Afterwards, composite was produced by sintering method according to temperature and infiltration method according to Cu content in green compact. The composite of sintering method showed a density of 8.55 g/cm3 (relative density 93%) a hardness of 217 HV, and an electrical conductivity of 40.7 IACS% at 1200 °C. The composite of 10 wt.% Cu produced by the Cu infiltration method showed a density of 8.7 g/cm3 (relative density 94%), Hardness of 274HV and electrical conductivity of 39 IACS% at 1300 °C. The measurements of physical properties showed the new possibility of using the Cu–Cr–Mo alloy as a contact material for high-voltage vacuum interrupters.

Ral-interacting protein 76 (RLIP76) is a potential factor with vascular endothelial growth factor (VEGF) in the corpus luteum and tumor angiogenesis. RLIP76, VEGF, and hypoxia-inducible factor-1 (HIF-1) are proteins that activate angiogenic functions in tumor and endothelial cells. RLIP76 is a main factor in tumor growth, and VEGF is a major endothelial cell protein for angiogenesis. Also, RLIP76 regulates a small GTPase (R-Ras, oncogene) in cell survival, spreading, and migration. HIF-1 is important in the corpus luteum, tumor angiogenesis, and tumor growth. VEGF and HIF-1 regulate the angiogenic function of RLIP76, and RLIP76 controls vascular growth in endothelial and tumor cells. RLIP76, R-Ras, VEGF, and HIF-1 may be useful in the research of corpus luteum and cancer therapy and the study of mechanisms of tumor angiogenesis. This review will help to elucidate the roles of RLIP76/R-Ras and VEGF via HIF-1 in corpus luteum and tumor angiogenesis, tumorigenesis, and the specific regulation of RLIP76 in luteal, tumor, and endothelial cells. Thus, we reviewed the angiogenesis of the corpus luteum and tumor in the ovarian and tumor microenvironment.

This paper expressed three regression models that predict the lithium-ion battery life for electric cars based on a supervised machine-learning regression algorithm. The Linear Regression, Bagging Regressor, and Random Forest Regressor models will be compared for capacity prediction of lithium-ion batteries based on voltage-dependent per-cell modeling. When sufficient test data is available, three linear regression learning algorithms will train this model to give a promising battery capacity prediction result. The effectiveness of the three linear regression models will be demonstrated experimentally. The experiment table system is built with an NVIDIA Jetson Nano 4GB Developer Kit B01, a battery, an Arduino, and a voltage sensor. The Random Forest Regressor model has evaluated the model's accuracy based on the average of the square of the difference between the initial value and the predicted value in the data set (MSE (Mean Square Error)), and RMSE (Root Mean Squared Error) is smaller than the Linear Regression model, Bagging Regressor model (MSE is 516.332762; RMSE is= 22.722957). The Linear Regression model with MSE and RMSE is the biggest (MSE is 22060.500669; RMSE is= 148.527777). This result allows the Random Forest Regressor model to remain a helpful life prediction of lithium-ion batteries. Moreover, this result allows rapid identification of battery manufacturing processes and will enable users to decide to replace defective batteries when deterioration in battery performance and lifespan are identified.

The H7 subtype of avian influenza viruses (AIV) stands out among other AIV. The H7 viruses cir-culate in ducks, poultry, equine and have repeatedly caused outbreaks of disease in humans. In or-der to study the pathogenicity factors of H7N1 viruses, several variants were obtained, starting with laboratory strain, with a history of 12 passages through chicken embryos. This strain, A/chicken/Rostock/R0p/1934(H7N1) (R0p) had only 3 substitution in HA relatively A/Chicken/Rostock/45/34(H7N1), substitution Arg140Gly among them. 10 variants of this strain was obtained and studied to ascertain its biological property, genome stability and factors of patho-genicity. Strain R0p had decreased virulence for chicken, comparing with described in literature virulence of A/FPV Rostock/34 and A/chicken/Rostock/34 viruses. After 10 passages through the chicken lungs variant was obtained much more pathogenic than the starting R0p. The study of in-termediate passages through the chicken lungs showed that the jump in pathogenicity had occurred sharply between the fifth and sixth passage. By cloning these variants, a pair of strains (R5p and R6p) were obtained, and the complete genomes of these strains were sequenced. Single amino acid substitution was revealed, namely reversion Gly140Arg in HA1. This amino acid is located at the head part of the hemagglutinin, adjacent to the receptor-binding site. In addition to the increased pathogenicity for chicken and mice, R6p differs from R5p in the pattern of foci in cell culture and an increased affinity for a negatively charged receptor analogue, while maintaining a pattern of recep-tor binding specificity and the pH optimum of the HA conformational change.

As a growing public interest in social health of elderly, studies focusing on social networks and interpersonal relationships of the elderly are needed. The present study was conducted to de-velop a structured interview to evaluate the interpersonal schema based on Self-Defining Memory of elderly. First, the word cues that the elderly often report on interpersonal events were con-firmed. Next, the indices and scoring rules were prepared, including Relationship frequency (RF), Conflict frequency (CF), Dominance mean (Dm), and Warmth mean (Wm). Healthy elderly peo-ple living alone (mean age = 71.81, SD = 3.95) were interviewed. Finally, the correlation between each index and Short form of Korean Inventory of Interpersonal Problems Circumplex Scales (KIIP-SC) was analyzed for criterion validity. The inter-rater reliability was substantial (Kappa = .61 ~ .66). Based on the analysis of criterion validity, the indices of CF, Dm, and Wm indices showed an appropriate level of criterion validity. This study developed a structural interview based on a novel system of reporting autobiographical memory and established indices with appropriate validity to evaluate interpersonal relationships. The interview is expected to identify the characteristics of interpersonal relationships of the elderly and contribute to the establishment of the elderly community, accordingly.

We developed a transparent and flexible electrochemical sensor using a platform based on a network of single-walled carbon nanotubes (SWCNTs) for the non-enzymatic detection of hydrogen peroxide (H2O2) released from living cells. We decorated the SWCNT network on a poly(ethylene terephthalate) (PET) substrate with platinum nanoparticles (PtNPs) using a potentiodynamic method. The PtNP/SWCNT/PET sensor synergized the advantages of a flexible PET substrate, a conducting SWCNT network, and a catalytic PtNP, and demonstrated good biocompatibility and flexibility, enabling cell adhesion. The PtNP/SWCNT/PET-based sensor demonstrated enhanced electrocatalytic activity towards H2O2 as well as excellent selectivity, stability, and reproducibility. The sensor exhibited a wide dynamic range of 500 nM to 1 M, with a low detection limit of 228 nM. In addition, Furthermore, the PtNP/SWCNT/PET sensor remained operationally stable even after bending at various angles (15°, 30°, 60°, and 90°) with no noticeable loss of current signal. These outstanding characteristics enabled the PtNP/SWCNT/PET sensor to be practically applied for the direct culture of HeLa cells and the real-time monitoring of H2O2 release by the HeLa cells under drug stimulation.

As symbionts of fungi and algae, lichens produce a variety of secondary products which pharmacological activities. This study aimed to investigate the anti-inflammatory activities of Heterodermia hypoleuca and its main compound, atraric acid. The results confirmed that atraric acid could regulating induced pro-inflammatory cytokine, nitric oxide, induced nitric oxide synthase and cyclooxygenase-2 expression by lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Means while, atraric acid down-regulated expression of phosphorylated IκB, ERK and nuclear factor kappa B (NFκB) signaling pathway to exhibit anti-inflammatory effects in LPS-stimulated RAW264.7 cells. Based on these results, the anti-inflammatory effect of atraric acid during LPS-induced endotoxin shock in a mouse model was confirmed. In the atraric acid treated-group, cytokine production was decreased in the peritoneum and serum, and each organ damaged by LPS-stimulation was recovered. These results show that atraric acid has an anti-inflammatory effect and its molecular mechanism may be involved in the inactivation of the ERK/NFκB signaling pathway, demonstrating its value as a potential therapeutic for inflammatory diseases.

Objectives: This study aimed to investigate and compare sleep quality between patients with chronic temporomandibular disorder and healthy controls, and to analyze the association of sleep quality with disease characteristics, obstructive sleep apnea risk factors, and excessive daytime sleepiness. Methods: Chronic temporomandibular disorder patients (n=503) and 180 age- and sex-matched healthy controls were included, who completed well-organized clinical report and answered questions on sleep quality (Pittsburgh Sleep Quality Index), sleep apnea risk factors (STOP-Bang questionnaire), and excessive daytime sleepiness (Epworth sleepiness scale). Results: Mean global Pittsburgh Sleep Quality Index scores were significantly higher in the patients (6.25±2.77) than in healthy controls (6.25±2.77) (p&lt;0.001). Poor sleep was significantly more prevalent in the patient group (56.9%) than in healthy controls (22.2%) (p&lt;0.001). Compared with healthy controls, chronic temporomandibular disorder patients had a higher likelihood of obstructive sleep apnea. (STOP-Bang total score ≥3; 7.2% vs. 16.1%; p&lt;0.01) and higher excessive daytime sleepiness (Epworth sleepiness scale score ≥10; 12.8% vs. 19.7%; p&lt;0.05). Age (odds ratio=2.551; p&lt;0.001), female sex (odds ratio=1.885; p=0.007), total Epworth sleepiness scale score (odds ratio=1.839; p=0.014), and headache attributed to temporomandibular disorder (odds ratio=1.519; p=0.049) were the most powerful predictors of poor sleep (global Pittsburgh Sleep Quality Index score ≥5) in chronic temporomandibular disorder patients. Conclusion: Chronic temporomandibular disorder patients had sleep quality impairment. Various factors, including peripheral and central factors, affect the patient's sleep quality. Therefore, in addition to sleep quality and sleep-related problems, the underlying central mechanism for poor sleep quality should be assessed when treating chronic temporomandibular disorder patients.

We introduce the lower chaos grade of a real-valued function F defined on the Markov triple (E,μ,Γ), where μ is a probability measure and Γ is the carré du champ operator. As an application of this concept, we obtain the better estimate of the four moments theorem for Markov diffusion generators worked by Bourguin et al (2019). For our purpose, we need to find the largest number except zero in the set of eigenvalues corresponding to its eigenfunction in the case where the square of a random variable F, coming from a Markov triple structure, can be expressed as a sum of eigenfunctions, We give some examples of eigenfunctions of the diffusion generators such as Ornstein-Uhlenbeck, Jacobi and Romanovski-Routh. In particular, two bounds, called the four moments theorem and fourth moment theorem respectively, will be provided for the normal approximation of the case where a random variable F comes from eigenfunctions of a Jacobi generator.

Apigenin (API) possesses excellent antitumor properties, but its limited water solubility and low bioavailability restrict its therapeutic impact. Thus, a suitable delivery systems is needed to overcome these limitations and improve the therapeutic efficiency. Poly (lactic-co-glycolic acid) (PLGA) is a copolymer extensively utilized in drug delivery. Hyaluronic acid (HA) is a major extracellular matrix and can specifically bind with CD44 on colon cancer cells. Chitosan (CS) can serve as an intermediate binding with HA and PLGA. Herein, we aimed to perpare receptor-selective HA-coated PLGA nanoparticles (NPs) for colon cancer with high expression of CD44. Firstly, API was encapsulated in PLGA to obtain PLGA-API-NPs, which were then sequentially combined with CS and HA to form HA-coated PLGA NPs. HA coated PLGA NPs had a stronger sustained-release capability. Cellular uptake of HA coated PLGA NPs was enhanced in HT-29 cells with high expression of CD44. HA-PLGA-DiR-NPs can target specificity towards the HT-29 ectopic tumor model. Overall, HA coated PLGA NPs was an effectively drug deliver platform for API in treatment of colon cancer with high expression of CD44.

The H7 subtype of avian influenza viruses (AIV) stands out among other AIV. H7 viruses circulate in ducks, poultry, equine and have repeatedly caused outbreaks of disease in humans. In order to study the pathogenicity factors of H7N1 viruses, several laboratory variants of the A/FPV/Rostock/34 (H7N1) strain were obtained by passages in the chicken lungs. After 10 such passages, a variant was obtained that differed from the parent virus by amino acid substitutions Val109Phe in PB2, Gln621Lys in PB1, Thr32Ala and Leu586Phe in PA Gly140Arg in HA1 and Ala101Thr in HA2 (numbering by H3), Ser82Arg in M2, Arg118Lys and Met124Arg in NS1. No differences were found in proteins NA, NP, M1 and NS2. The resulting variant was hundreds of times more pathogenic for chickens than the original laboratory variant of the virus. The study of intermediate passages showed that the jump in pathogenicity occurs sharply between the fifth and sixth passage through the chicken lungs. By cloning these variants, a pair of strains (R5p and R6p) were obtained, and the complete genomes of these strains were sequenced. Single amino acid substitution was revealed, namely Gly140Arg in HA1. It is important to emphasize that this substitution is a reversion, since Arg is located in position 140 HA1 of original the A/FPV/Rostock/34 (H7N1) virus (GenBank). This amino acid is located at the head part of the hemagglutinin, adjacent to the receptor-binding site. In addition to the increased pathogenicity, R6p differs from R5p by an increased affinity for a negatively charged receptor analogue, an increased affinity for MDCK cells, while maintaining a receptor specificity profile.

In this work, we report the electric energy storage properties of (1-x)Bi0.5(Na0.8K0.2)0.5TiO3-xBi0.2Sr0.7TiO3 (BNKT-BST; x = 0.15-0.50) relaxor ferroelectric ceramics enhanced via a domain engineering method. A rhombohedral–tetragonal phase, the formation of highly dynamic PNRs, and a dense microstructure are confirmed from XRD, Raman vibrational spectra, and microscopic investigations. The relative dielectric permittivity (2664 at 1 kHz) and loss factor (0.058) were gradually improved with BST (x=0.45). The incorporation of BST into BNKT can disturb the long-range ferroelectric order, lowering the dielectric maximum temperature Tm and inducing the formation of highly dynamic polar nano-regions. In addition, the Tm shifts toward high temperature with frequency and a diffuse phase transition, indicating relaxor ferroelectric characteristics of BNKT-BST ceramics, which is confirmed by the modified Curie Weiss law (γ=1.83). The rhombohedral–tetragonal phase, fine grain size, and lowered Tm with relaxor properties synergistically contribute to a high recoverable energy density Wrec of 0.81 J/cm3 and a high energy efficiency η of 86.95% at 90 kV/cm for x = 0.45.

Measuring Marginal Reflex Distance-1 (MRD-1) is a crucial clinical tool used to evaluate the position of the eyelid margin in relation to the cornea. Traditionally, this assessment has been conducted manually by plastic surgeons, ophthalmologists, or trained technicians. However, with the advancements in Artificial Intelligence (AI) technology, there is a growing interest in the development of automated systems capable of accurately measuring MRD-1.In this context, we introduce novel MRD-1 measurement methods based on deep learning algorithms that can simultaneously capture images and compute the results. This prospective observational study involved 154 eyes of 77 patients aged over 18 years who visited Chungnam National University Hospital between September 1, 2023, and July 29, 2023. We collected four different MRD1 da-tasets from patients using three distinct measurement methods, each tailored to the individual patient. The mean MRD1 values, measured through the manual method using a penlight, the deep learning method, ImageJ analysis from RGB eye images, and ImageJ analysis from IR eye images in 56 eyes of 28 patients, were 2.64 ± 1.04 mm, 2.85 ± 1.07 mm, 2.78 ± 1.08 mm, and 3.07 ± 0.95 mm, respectively. Notably, the strongest agreement was observed between MRD1_deep learning (DL) and MRD1_IR (0.822, p < 0.01). In the Bland-Altman plot, the smallest difference was observed between MRD1_DL and MRD1_IR ImageJ, with a mean difference of 0.0611 and △LOA (limits of agreement) of 2.5162, which is the smallest among the other groups. In conclusion, this novel MRD1 measurement method, based on an IR camera and deep learning, demon-strates statistical significance and can be readily applied in clinical settings.

This paper presents experimental results of static and dynamic obstacle avoidance methods for a two-wheel mobile robot with independent control using a deep Q-learning (DQL) reinforcement learning algorithm. This is an alternative method that combines the Q-learning (QL) algorithm with a neural network. Neural networks in the DQL algorithm act as Q matrix table approximators for each pair (State - Action). The effectiveness of the proposed solution was verified through simulations, programming, and experimentation. This DQL algorithm is compared to the QL algorithm. First, the mobile robot communicated with the control script using the robot operating system (ROS). The mobile robot is code programmed using a Python in the ROS operating system combined with the DQL controller in Gazebo software. The mobile robot then performed experiments in a workshop with many different experimental scenarios. This DQL controller is improved in term of the computation time, convergence time, planning trajectory accuracy, and obstacles avoidance. Therefore, the DQL controller solved the path optimization problems for mobile robots better than the Q-learning controller.

Preproenkephalin (PPE) is a precursor molecule for multiple endogenous opioid peptides Leu-enkephalin (ENK) and Met-ENK, which are involved in a wide variety of modulatory functions in the nervous system. Despite the functional importance of ENK in the brain, the effect of brain-derived factor(s) on PPE expression is unknown. We report the dual effect of neural epidermal growth factor (EGF)-like-like 2 (NELL2) on PPE gene expression. In cultured NIH3T3 cells, transfection of NELL2 expression vectors induced an inhibition of PPE transcription intracellularly, in parallel with downregulation of protein kinase C signaling pathways and extracellular signal-regulated kinase. Interestingly, these phenomena were reversed when synthetic NELL2 was administered extracellularly. The in vivo disruption of NELL2 synthesis resulted in an increase in PPE mRNA level in the rat brain, suggesting that the inhibitory action of intracellular NELL2 predominates the activation effect of extracellular NELL2 on PPE gene expression in the brain. Biochemical and molecular studies with mutant NELL2 structures further demonstrated the critical role of EGF-like repeat domains in NELL2 for regulation of PPE transcription. These are the first results to reveal the spatio-specific role of NELL2 in the homeostatic regulation of PPE gene expression.

The accurate assessment of wound size is a critical step in advanced wound care management. This study aims to introduce and validate a Light Detection and Ranging (LiDAR) technique for measuring wound size. Twenty-eight wounds treated from December 2022 to April 2023 at the Chunganam National University Hospital were analyzed. All wounds were measured using three techniques; conventional ruler methods, the LiDAR technique, and ImageJ analysis. Correlation analysis, linear regression, and Bland-Altman plot analysis were conducted to validate the accuracy of the newly introduced method. The measurement results (Mean ± Standard deviation) obtained using the Ruler method, LiDAR technique, and ImageJ analysis were 112.99 ± 110.07 cm², 73.59 ± 72.97 cm², and 74.29 ± 72.15 cm², respectively. The Pearson correlation coefficient was higher in the LiDAR application (0.995) than the conventional ruler methods (Mean difference; -5.0000 cm2), as was the degree of agreement (Mean difference; 38.6933 cm2). Wound size measurement using LiDAR is a simple and reliable method that allows practitioners to conveniently assess wounds with a flattened and irregular shape. However, non-flattened wounds cannot be assessed owing to the technical limitations of LiDAR.

Fluorescent bioprobes are invaluable tools for visualizing live cells and deciphering complex biological processes by targeting intracellular biomarkers without disrupting cellular functions. In addition to protein-binding concepts, fluorescent probes utilize various mechanisms, including membrane, metabolism, and gating-oriented strategies. This study introduces a novel fluorescent mechanism distinct from existing ways. Here, we developed a B-cell selective probe, CDrB, with unique transport mechanisms. Through SLC-CRISPRa screening, we identified two transporters, SLCO1B3 and SLC25A41, by sorting out populations exhibiting higher and lower fluorescence intensities, respectively, demonstrating contrasting activities. We confirmed that SLCO1B3, with comparable expression levels in T and B cells, facilitates the transport of CDrB into cells, while SLC25A41, overexpressed in T lymphocytes, actively exports CDrB. The observation suggests that SLC25A41 plays a crucial role in discriminating between T and B lymphocytes. Furthermore, it reveals the potential for reversible localization of SLC25A41 to demonstrate its distinct activity. This study is the first report to unveil a novel strategy of SLC by exporting the probe. We anticipate that this research will open up new avenues for developing fluorescent probes.

Background and Objectives: The Temperament Evaluation of Memphis, Pisa, Paris and San Diego Autoquestionnaire (TEMPS-A) is designed to assess affective temperaments. The short version of TEMPS-A (TEMPS-A-SV) was translated into diverse languages for its broad application in research and clinical settings. However, no study was conducted to validate the Korean version of TEMPS-A-SV among patients with mood disorders. The purpose of this study is to examine the reliability and validity of the TEMPS-A-SV in mood disorder patients of the Korean population. Materials and Methods: In this cross-sectional retrospective study, a total of 715 patients (267 patients with major depressive disorder, 94 patients with bipolar disorder I, and 354 patients with bipolar disorder II) completed the Korean TEMPS-A-SV. Cronbach's alpha and McDonald’s omega was used to assess reliability. Exploratory factor analysis (EFA) was also performed. Spearman's correlation coefficient was used to examine associations between five temperaments. The difference in five temperament scores between gender or diagnosis groups were analyzed, and the correlation between five temperament scores and age were tested. Results: The Korean TEMPS-A-SV displayed good internal consistency (α = 0.65–0.88, ω = 0.66–0.9) and significant correlations between the subscales except one (correlation between hyperthymic and anxious). Using EFA, a two-factor structure was produced: Factor I (cyclothymic, depressive, irritable, and anxious) and Factor II (hyperthymic). The cyclothymic temperament score differed by gender and the anxious temperament score was significantly correlated with age. All the temperaments, except for irritable temperament, showed significant differences between diagnosis groups. Conclusions: Overall, our findings indicate that TEMPS-A-SV is a valid and reliable measure of estimating affective temperaments among Koreans. Our results confirm validity of TEMPS-A-SV among Korean patients with mood disorders. However, more study is required on affective temperaments and associated characteristics in people with mood disorders.

This study examined the relationships between attitude, subjective norms, perceived behavioral control, and behavioral intention through the perceived value of Pilates participants. The participants of this study were 301 Pilates students using Pilates studios located in Busan, Ulsan, and Gyeongbuk Province. The participants were selected by convenient sampling, a non-probability sampling method. The collected data were analyzed using descriptive analysis, reliability analysis, correlation analysis, confirmatory factor analysis, and structural equation modeling analysis using SPSS 22.0 and AMOS 24.0. The results can be summarized as follows. First, among the three subfactors of perceived value, functional and social values had a positive effect on attitude. Second, attitude, subjective norms, and perceived behavioral control, which are three main components of the Theory of Planned Behavior, had a positive effect on the behavioral intention for Pilates. These results suggest that Pilates instructors require meticulous planning and efforts to develop an environment for promoting spontaneous interest and participation to attract students and engage their attention and interest in the field.

This study was conducted to investigate the prevalence of Coxiella burnetii infection according to cattle breeds and growth types. A total of 491 cattle [cattle breed: 216 dairy cattle and 275 beef cattle; according to growth type: indoor housing (n = 294) and grazing (n = 197)] were tested for the presence of C. burnetii DNA and antibodies against C. burnetii using a commercial enzyme-linked immunosorbent assay (ELISA). Overall, 10.8% and 8.8% of the cattle were positive by PCR and for C. burnetii antibodies, respectively. The prevalence of C. burnetii was significantly higher in beef cattle than in dairy cattle using PCR (13.6% vs 7.4%; P = 0.032) and ELISA (14.6% vs 1.4%; P = 0.000), respectively. The overall infection rate of C. burnetii was significantly high in grazing cattle (PCR: 24.9%, ELSIA: 21.3%; P = 0.000) compared with housing cattle (PCR: 1.4%, ELISA: 0.3%). The results indicate that beef cattle have a significantly higher risk of contracting C. burnetii infection compared with dairy cattle (21.5% vs. 7.9%, χ2 = 5.82, P = 0.000, odds ratio = 3.197, 95% CI: 1.80-5.67). In addition, the infection of C. burnetii was significantly associated with grazing (P = 0.000). Moreover, a risk of contracting C. burnetii infection in grazing cattle was increased by 32.57-fold (95% CI: 12.84-82.60, P = 0.000) compared with indoor housed cattle. The phylogenetic analysis based on the IS111 gene revealed that our isolates were grouped together with humans, ticks, goats, and cattle isolates found in several countries. C. burnetii isolates circulating in the Republic of Korea exhibit genetic variations. Consequently, our results suggest that cattle are potential reservoirs for C. burnetii infection and most importantly, grazing acts as a high risk factor for the occurrence and transmission of this infection.

A new study for CH4 reforming to hydrogen and hydrogen storage was performed using magnesium-based alloy. MgH2-12Ni (with the composition of 88 wt% MgH2 + 12 wt% Ni) was prepared in a planetary ball mill by milling in hydrogen atmosphere (reaction-involved milling). X-ray diffraction (XRD) analyses were performed for the samples after reaction-involved milling and after reactions with CH4. The variation of adsorbed or desorbed gas with time was measured by a Sieverts’ type high-pressure apparatus at 773 K. The microstructures of the powders were observed using scanning transmission microscope (STEM) with energy-dispersive X-ray spectroscopy (EDS). The synthesized samples were also characterized using Fourier Transform Infrared (FT-IR) spectroscopy. XRD pattern of MgH2-12Ni after reaction with CH4 of 12 bar at 773 K and decomposition under 1.0 bar at 773 K exhibited phases of MgH2 and Mg2NiH4. This shows that reforming of CH4 was occurred, hydrogen produced after reforming of CH4 was then adsorbed on the particles, and hydrides were formed during cooling to room temperature. Ni and Mg2Ni formed during heating up to 773 K are believed to have brought about catalytic effects for reforming CH4. MgH2-12Ni adsorbed 0.8 wt% reformed CH4 within 1 min in a reaction with CH4 of 12 bar at 773 K and then desorbed 0.8 wt% reformed CH4 (hydrogen-containing mixture) within 1 min under 1 bar at 773 K. Attenuated total reflectance FT-IR spectroscopy (ATR-FTIR) spectra of MgH2-12Ni after reactions under 12 bar CH4 at 723 K and 773 K showed peaks of C-H bending, C=C stretching, O-H stretching, O-H bending, and C-O stretching.

Venous thromboembolism (VTE) is a prevalent medical condition with high morbidity, mortality, and associated cost. Anticoagulation remains the main treatment for VTE, though the decision on when, how, and for how long to administer anticoagulants is increasingly complex. This review highlights the different phases of VTE management, special circumstances for consideration such as antiphospholipid syndrome, coronary artery disease, cancer associated thrombus and COVID, and future anticoagulation options. Anticoagulation management will continue to be a complex decision, applying evidence-based medicine to individual patients with the hope to maximize effectiveness while minimizing risks.

This research analyzed the impact of quality of service as perceived by Hapkido students on their exercise continuation and recommendation intentions. It also identified the measures to reduce the rate of student dropout, strengthen competitiveness, and create more efficient marketing strategies for consumer patterns that are rapidly diversifying Hapkido. A questionnaire survey method was conducted with 300 middle and high school students aged 14–19 years having Hapkido training of three months to two years in Incheon and Bucheon during March–April 2019. Frequency, factor, reliability, correlation, and standard multiple regression analyses were conducted on the surveyed data. The conclusions are as follows. First, considering the impact of service quality on exercise continuation intention, service quality positively affects reliability, personification, and perceptual openness; in terms of possibility, it positively affects typicality, personification, and perceptual openness; and in terms of reinforcement, it positively affects reliability and perceptual openness. Second, examining the impact of service quality on recommendation intention positively affects reliability, personification, and perceptual openness. Third, exercise continuation intention positively affects recommendation intention.

Human sepsis is one of the leading cause of death worldwide and is known to be a harmful damaging host inflammatory condition, primarily caused by endotoxin released by gram-negative bacteria. Despite antibiotics administration being widely used to treat disease, effective targeted therapeutic strategies for the sepsis are still lacking. Here, we demonstrate that CM1, a derivative of natural polyphenol chrysin, exerts anti-inflammatory activity by inducing the ubiquitin-editing protein TNFAIP3 and NAD-dependent deacetylase sirtuin 1 (SIRT1). We found that CM1 attenuated Toll-like receptor 4 (TLR4)-induced the generation of inflammatory cytokines by inhibiting the extracellular-signal-regulated kinase (ERK)/MAPK and nuclear factor kappa B (NF-κB) signaling pathway. In addition, the treatment of macrophages with CM1 induced the expression of TNFAIP3 and SIRT1 in TLR4-stimulated primary macrophages, however the anti-inflammatory properties of CM1 was disappeared by siRNA silencing of TNFAPI3 or by the genetic and pharmacologic inhibition of SIRT1. Importantly, intravenously administration of CM1 resulted in the decreased susceptibility to endotoxin-induced sepsis, leading to inhibition of the generation of proinflammatory cytokines and neutrophils infiltration into lung than control mice. Collectively, these findings suggest that CM1 has the potential to be a treatment candidate for diverse inflammatory diseases including sepsis.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Mitochondria are highly dynamic organelles that continuously change their shape. Their main function is ATP production; however, they are additionally involved in a variety of cellular phenomena, such as apoptosis, cell cycle, proliferation, differentiation, reprogramming, and aging. The change in mitochondrial morphology is closely related to the functionality of mitochondria. Normal mitochondrial dynamics are critical for cellular function, embryonic development, and tissue formation. Thus, defect in proteins involved in mitochondrial dynamics that control mitochondrial fusion and fission can affect cellular differentiation, proliferation, cellular reprogramming, and aging. Here we review the processes and proteins involved in mitochondrial dynamics and its various associated cellular phenomena.

In federated learning (FL), clients train models locally without sharing raw data, ensuring data privacy. In particular, federated distillation transfers knowledge to clients regardless of the model architecture. However, when groups of clients with different data distributions exist, sharing the same knowledge among all clients becomes impractical. To address this issue, this paper presents an approach that clusters clients based on the output of a client model trained using their own data. The clients are clustered based on the predictions of their models for each label on a public dataset. Prior knowledge of the number of groups is not required. Evaluations on the MNIST dataset showed that our method accurately identified these group structures and improved accuracy by 15–75% compared with traditional federated distillation algorithms when distinct group structures were present. Additionally, we observed significant performance improvements in smaller client groups, bringing us closer to fair FL.

Since the controllers of the variable speed seawater pump and the 3-way valve of a ship central cooling system receive the feedback signal from the same output, the two controllers may interfere and operate inefficiently under certain conditions. Therefore, studying an efficient control tuning method for the central cooling water system is necessary. The central cooling water system was modeled in this study using MATLAB Simulink, utilizing actual operation data, and unknown parameters are estimated to fine-tune. The model is then verified using another operating data set. Additionally, transfer functions are developed for freshwater output temperature against 3-way valve openness input and seawater pump motor electric power frequency input. Then, the two PI controllers are tuned through the Internal Model Control guide, supposing the two systems are decoupled. Moreover, the modified IMC tuning method is suggested for the seawater pump system, which has larger time constants because of a heat exchanger. This method simplifies combining the two PI controller tuning, enhancing the seawater pump's overall efficiency and 3-way valve operation. This study determined that the proposed tuning methods through the IMC guide confirmed the efficiency of controlling the seawater pump speed and 3-way valve with reasonable control of freshwater outlet temperature.

At the LHC, the process of a Higgs boson decaying into bottom or charm quarks produced in association with a pair of top quarks, tt¯H, allows for an empirical exploration of the heavy-flavor quark Yukawa couplings to the Higgs boson. Accordingly, the cross sections for the tt¯ + heavy-flavor production without the appearance of the Higgs boson have been measured at the LHC in various phase spaces using data samples collected in pp collisions at s = 7, 8 and 13 TeV with the ATLAS and CMS experiments. Flavor ratios of cross sections of tt¯ + additional jets processes with different flavors are also measured. In this paper, the measured cross sections and ratios are reviewed and the prospects with more data are presented.

Corresponding to the principles of biological synapses, an essential prerequisite for hardware neural networks using electronics devices is continuous regulation of conductance. We implemented artificial synaptic characteristics in a (GeTe/Sb2Te3)16 iPCM with a superlattice structure under optimized identical pulse trains. Based on atomically controlling the Ge switch in the phase transition that appears in the GeTe/Sb2Te3 superlattice structure, multiple conductance states were implemented by applying the appropriate electrical pulses. Furthermore, we found that the bidirectional switching behavior of a (GeTe/Sb2Te3)16 iPCM can achieve a desired resistance level using the pulse width. Therefore, we also fabricated a Ge2Sb2Te5 PCM and designed a pulse scheme based on the phase transition mechanism to compare to the (GeTe/Sb2Te3)16 iPCM. We designed an identical pulse scheme that implements linear and symmetrical LTP and LTD based on the iPCM mechanism. As a result, the (GeTe/Sb2Te3)16 iPCM showed relatively excellent synaptic characteristics by implementing gradual conductance modulation, a nonlinearity value of 0.32, and LTP/LTD 40 conductance states using identical pulses trains. Our results demonstrate the general applicability of the artificial synaptic device for potential use in neuro-inspired computing and next generation non-volatile memory.

Erlotinib inhibits epithelial growth factor receptor (EGFR) kinase activity and is used to treat non-small cell lung cancer (NSCLC). Despite its high efficacy, recurrence can occur in patients who become resistant to the drug. To address the underlying mechanism of Erlotinib resistance, we investigated additional mechanisms related to mode-of-drug-action, by multiple protein-binding interactions, besides EGFR by using drug affinity responsive target stability (DARTS) and liquid chromatography-mass spectrometry (LC-MS/MS) methods with non-labeled Erlotinib. DNA polymerase alpha subunit B (POLA2) was identified as a new Erlotinib binding protein that was validated by the DARTS platform, complemented with cellular thermal shift assays. Genetic knock-down of POLA2 promoted the anti-proliferative effect of the drug in the Erlotinib-resistant cell line H1299 with high POLA2 expression, whereas overexpression of POLA2 restored anti-proliferative effects in the Erlotinib-sensitive cell line HCC827 with low POLA2 expression. Importantly, POLA2 expression levels in four NSCLC cell lines were positively correlated with anti-proliferative Erlotinib efficacy, verified by bio-statistical analysis (Pearson correlation coefficient, R=0.9886). These results suggest that POLA2 is a novel complementary target protein of Erlotinib, and could clinically provide validity as a surrogate marker for drug resistance in patients with NSCLC.

Inflammation is known to be risk factors for metabolic diseases. The purpose of this study was to develop a Food-based Index of Dietary Inflammatory Potential (FBDI) and conduct its validation assessment. This study analyzed raw data from Korean Genome and Epidemiology Study 2012–2014 data of 17,771 people. We carried out the correlation analysis between 51 food groups and hs-CRP. The FBDI was developed by multiple regression method with hs-CRP and selected 17 food group. For the validation of FBDI, 7795 people in the 6th Korea National Health and Nutrition Examination Survey (KNHAES) was used. Binary logistic regression analysis was used for risk analysis of metabolic syndrome and FBDI. The FBDI model included that 7 were composed of anti-inflammatory food groups and 3 of inflammatory food groups. The FBDI was calculated by multiplying the intake of food group by β coefficients. KNHAES were included in the validation of FBDI. The risk of metabolic syndrome was found to be 2.152 times higher in the group with the highest FBDI than in the group with the lowest one (95% Cl:1.458–3.178, p for trend = 0.000). This study developed FBDI reflecting food intake for Koreans, which showed a significant relationship with the risk of metabolic syndrome.

(1) Background: The CEO message of hospital homepage contain various contents such as the hospital's future vision, promises with customers, upgraded services and public activities. The CEO’s message of the homepage includes non-financial information as well as financial information of corporates. Also, it provides useful information for not only company's goals and vision but also firm performance and strategies for the future. This study aims to investigate associations between CEO’s message of hospitals homepages and financial status. We used the balanced scorecard frame to analyze what content on the hospital's homepage is related to the hospital's various financial ratios. (2) Methods: We adopt a text mining method to extract significantly repeated keywords from the CEO’s message of hospital website. And we classify these keywords by a balanced scorecard frame. To examine the relationship between keywords of CEO’s message of the hospital homepage and hospital’s financial ratio, T-test is conducted for the difference in the TF-IDF (Term Frequency is Divided by Inverse Document Frequency) mean of the home page contents and its relationship with the views of the balanced scorecard framework. (3) Results: According to empirical results on 65 samples collected from local hospitals, there are some significant relationship between the qualitative content of the hospital's homepage and the quantitative financial ratio that indicates profitability, activity, leverage, liquidity, and transfer to essential business fund (EBF) income. (4) Conclusions: The introduction section of a homepage is most accessible to customers, containing the aims and ideals of hospitals and reflecting their values and visions [1]. In addition, in view of financial status, they can either emphasize financial strength or focus on other areas to mask weakness of financial information. This study reminds us of the importance of hospital website’s disclosure, and it can be inferred from the financial status of the hospital. It also highlights the need for harmonization between quantitative data, financial statements, and qualitative data, CEO’s messages. (5) Implications: To our best knowledge, this paper is the first research attempting to investigate the relation between text of hospital homepage and financial ratio of hospital through text mining technique and balanced scorecard frame. Hospitals take a crucial part in a country’s welfare and healthcare backbone industry. Nevertheless, in many countries, hospital organization sectors tend to remain a source of critical fiscal deficits due to its ineffective and sloppy management. We expect that the result of this paper can provide hospital managers to useful information.

This study was to investigate and assess salivary biomarkers as a means of diagnosing periodontitis. A total of 121 subjects were included: 28 periodontally healthy subjects, 24 with stage I, 24 with stage II, 23 with stage III, and 22 with stage IV periodontitis. Salivary proteins including active matrix metalloproteinase-8 (MMP-8), pro-MMP-8, total MMP-8, C-reactive protein, secretory immunoglobulin A and planktonic bacteria including Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola, Fusobacterium nucleatum, Prevotella intermedia, Porphyromonas nigrescens, Parvimonas micra, Campylobacter rectus, Eubacterium nodatum, Eikenella corrodens, Streptococcus mitis, Streptococcus mutans, Staphylococcus aureus, Enterococcus faecalis, and Actinomyces viscosus were measured from salivary samples. The performance of the diagnostic models was assessed by receiver operating characteristics (ROC) and area under the ROC curve (AUC) analysis. The diagnostic models were constructed based on the subjects’ proteins and/or microbial profiles, resulting in two potential diagnosis models, which achieved better diagnostic powers with an AUC value &gt; 0.750 for the diagnosis of stage II, III, and IV periodontitis (Model PC-I; AUC: 0.796, sensitivity: 0.754, specificity: 0.712) and for the diagnosis of stage III and IV periodontitis (Model PC-II; AUC: 0.796, sensitivity: 0.756, specificity: 0.868). This study can contribute to screening for periodontitis based on salivary biomarkers.

Spectral image analysis has the potential to replace traditional approaches for assessing plant responses to different types of stress including herbicide, through non-destructive and high-throughput screening (HTS). Therefore, this study was conducted to develop a rapid bioassay method using a multi-well plate and spectral image analysis for diagnosis of herbicide activity and mode of action. Crabgrass (Digitaria ciliaris) as a model weed was cultivated in multi-well plates and subsequently treated with 6 herbicides with different modes of action when they reached the 1-leaf stage, using only a quarter of the recommended dose. To detect plant response to herbicides, plant spectral images were acquired after herbicide treatment using RGB, infrared (IR) thermal, and chlorophyll fluorescence (CF) sensors and analyzed for diagnosing herbicide efficacy and mode of action. Principal Component Analysis (PCA) using all spectral data successfully distinguished herbicides and clustered depending on their modes of action. The performed experiments have shown that the multi-well plate assay combined with spectral image analysis can be successfully applied for herbicide bioassay. In addition, the use of spectral image sensors, especially in CF image, would facilitate HTS by enabling rapid observation of herbicide response, as early as 3 hours after herbicide treatment.

Background: Little information exists regarding the differences in the clinical and laboratory characteristics of Kikuchi-Fujimoto disease (KFD) according to age. Objective: To evaluate the clinical and laboratory characteristics of KFD according to age. Methods: We retrospectively evaluated patients diagnosed with KFD at Pusan National University Hospital between 2010 and 2020. Results: Eighty patients (46 children and 34 adults) with a mean age of 21.5 ± 11.8 years (range, 3–49 years) were included in the study. Among children, the male sex ratio was higher, in adults, the female sex ratio was higher. Fever, tenderness in the lymph node, and skin rashes were more common in children, while myalgia and weight loss were more common in adults. In children, the recurrence rate was significantly higher among boys than among girls (15.8% vs 0.0%, P=0.001). EBV and ANA positivity rates were higher in boys than in girls. In adults, the recurrence rate was significantly higher in women than in men (18.2% vs 0.0%, P=0.005). ANA positivity rates were higher in women than in men. Conclusion: The clinical features, laboratory findings, and recurrence of KFD may differ depending on age and sex. Clinicians should be aware of this.

Corrosive burns lead to progressive esophageal stricture and dysphagia. There are many trials to prevent Esophageal stricture formation after corrosive burn. This study aimed to access the effects of EW-7197 on prevention for esophageal stricture formation after corrosive esophageal burn. animal study were classified divided into three groups: a healthy group, a control group (corrosive burn without EW-7197), and a treatment group (corrosive burn with EW-7197). Corrosive esophageal burns were produced using 30% NaOH on the lower esophagus. For 3 weeks, the control group received vehicle and the treatment group received 20 mg/kg/day EW-7197. Treatment efficacy was assessed by measuring the stenosis ratio by esophagogram with contrast media on day 21. histologic staining was performed to evaluate the fibrosis area ratio, and western blotting was performed to evaluate fibrotic markers. Among 20 rats that underwent surgery, 14 survived. Three in the treatment group died because of esophageal perforation, and three in the control group died due to their debilitating status. The esophageal stenosis ratio was significantly lower in the treatment group than in the control group (12.1 ± 9.5% and 42.2 ± 8.3%, respectively; p = 0.001). The histologic fibrosis area ratio was also significantly lower in the treatment group (12.5 ± 3.0% and 21.6 ± 2.1%, respectively; p = 0.001). The treatment group showed lower expressions of profibrogenic proteins such as TGF-β1, pSmad3, and α-SMA. EW-7197 may be a good alternative for the prevention esophageal stricture formation after corrosive burn.

Liver cirrhosis is one of the most prevalent chronic liver diseases worldwide. In addition to viral hepatitis, genetic conditions such as steatohepatitis, autoimmune hepatitis, sclerosing cholangitis, and Wilson’s disease can also lead to cirrhosis. Moreover, alcohol can cause cirrhosis on its own and exacerbate chronic liver disease from other causes. The treatment of cirrhosis can be divided into addressing the cause of cirrhosis and reversing liver fibrosis. To this date, there is still no clear consensus on the treatment of cirrhosis. Recently, there has been a lot of interest in potential treatments that modulate the gut microbiota and gut-liver axis for the treatment of cirrhosis. According to recent studies, modulation of the gut microbiome by probiotics ameliorates the progression of liver disease. The precise mechanism for relieving cirrhosis via gut microbial modulation has not been identified. This paper summarizes the role and effects of the gut microbiome in cirrhosis based on experimental and clinical studies on absorbable antibiotics, probiotics, prebiotics, and synbiotics. Moreover, it provides evidence of a relationship between the gut microbiome and liver cirrhosis.

In the context of the Korean building structure standard KDS2022, wind loads can be readily calculated in terms of the along-wind, across-wind, and torsional components, based on a single wind direction. However, this approach falls short in accurately and safely evaluating the impact of winds from various directions. Therefore, in this study, we developed a Wind Load Calculation Program (WCP) capable of predicting wind loads with relative precision during the preliminary design phase. First, wind tunnel tests were conducted to identify the essential factors necessary for calculating wind loads and the variables influencing these factors. The building shape considered was a square, and the wind force coefficients and power spectral density were measured by combining 4 ground roughness values, 11 side ratios (), 4 aspect ratios (), and wind directions ranging from 0° to 90°. Subsequently, a generalized formulation was devised to facilitate wind load calculations across diverse conditions and a method for calculating load combination coefficients, considering response correlation and load simultaneity, was presented. Finally, the wind loads obtained from the wind tunnel tests were compared with those predicted by the WCP using an actual project model.

The purpose of this study was to identify subgroups of quality of life (QOL) changes in breast cancer survivors (BCS) and to determine factors associated with subgroups of consistently low or deteriorated QOL. We enrolled 101 women recently diagnosed with breast cancer in South Korea and asked them to complete a questionnaire at baseline (within 1 month of diagnosis), 1 year later (Year 1), 2 years later (Year 2), and 3 years later (Year 3). We assessed QOL using the global QOL subscale from the EORTC QLQ-C30. We defined low QOL as a global QOL score 10 points below the mean score of the general population. Based on low QOL as defined in this study, we identified subgroups of QOL changes over 3 years. We identified four subgroups of QOL changes: improved (47.4%), stable (30%), continuously low (8.8%), and deteriorated (13.8%) and considered the last two categories (22.6%) as poor QOL. Logistic regression analyses demonstrated that significant determinants of poor QOL were insomnia at Year 1, fatigue and anxiety at Year 2, and fatigue, depression, and comorbidity at Year 3. In conclusion, persistent symptoms of insomnia, fatigue, anxiety, depression, and comorbidity are potential risk factors for poor QOL in BCS.

Developing low-cost and stable materials for converting solar energy into electricity is vital in meeting the world's energy demand. Metal-organic frameworks (MOFs) have gained attention for solar cells due to their natural porous architectures and tunable chemical structures. This review commences with an exploration of the synthetic methods of MOFs. Moreover, we discuss the various roles of MOFs, including photoanodes and counter electrodes in dye-sensitized solar cells and interfacial layers and charge carriers in perovskite solar cells. Ultimately, burdensome tasks and possible directions for advancing MOFs-based nanomaterials are provided for solar cells.

In this work, alkylammonium-functionalized hollow mesoporous silica as nonocarrier of drugs was synthesized to realize enhanced cancer therapy by pH stimuli for sustained drug release. First, functionalized hollow mesoporous silica nanoparticles (Hollow MSNs) were synthesized using dodecyl dimethyl(3-sulfopropyl)ammonium hydroxide (DDAPS), sodium dodecyl sulfate (SDS), and triethanolamine as structure-directing agents, and tetraethyl orthosilicate (TEOS) and N-trimethoxysilypropyl-N,N,N-trimethylammonium chloride (TMAPS) as silica sources under basic condition via the sol-gel process. The structure and morphology of the alkylammonium-functionalized hollow mesoporous silica nanoparticles (Hollow MSN-N+CH3) were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), N2 adsorption-desorption analysis, and Fourier-transform infrared (FT-IR) spectroscopy. The functionalized hollow MSNs had a particle size of about 450 nm and a shell thickness of about 60 nm with uniform size. The nanoparticle had a surface area of 408 m2g-1, pore volume of 0.8 cm3g-1 and a uniform pore diameter of 45.9 Å. In the cancer cell viability test with MCF-7 cell, fludarabine-incorporated and alkylammonium-functionalized hollow mesoporous silica nanoparticles (Flu/Hollow MSN-N+CH3) showed excellent cancer cell death comparable with pure fludarabine drug with the controlled drug release by pH stimuli. It is considered that our current materials have the potential applicability as pH-responsive nanocarriers in the field of cancer therapy.

Enhancing the effectiveness of search and rescue operation at sea is always a duty of utmost importance of the coastal states. The search area for distressed objects can be determined by using Monte Carlo simulation, combined with the Median-Filter. Once the search area has been identified, the success of search and rescue operations depends on the sweeping ability of search and rescue vessel at the probability area of the distress object with the minimum time. This is the important element to the success of the search and rescue operation as it minimizes the risk and cost for Search and rescue team. In this article, the authors study and propose the use of Bacterial Foraging Optimization Algorithm (BFOA) to calculate the optimal search and co-ordination route for many search and rescue vessels in Vietnam sea. The simulation results show that it is quite consistent with reality and BFOA can be effectively applied to determine a quick search.

Medical institutions, where several patients are treated and medical workers engaged, are always exposed to secondary viral and bacterial infections. It is critical to prevent infection transmission by indirect as well as direct contact through air or splash. The infections of most diseases can be transmitted through the air. HEPA filters installed in air conditioning equipment are used to prevent infection transmission through air in medical institutions, but air circulation takes a long time in a large space. Virus and bacteria smaller than 0.3 μm cannot be removed by the HEPA filter; hence, those microbes remain alive throughout the air ventilation. A plasma sterilizer has the capability to provide environmental friendly sterilization by employing reactive oxide species and reactive nitrogen species at a low cost. We developed an excellent plasma sterilizer by using a non-thermal atmospheric-pressure biocompatible plasma (NBP). Ozone concentration in plasma sources has been derived by Kuhn et al. [1]. The diffusion coefficients inside (D₀) and outside (D₁) the plasma sterilizer have been calculated to be 0.0641 m² s^-1 and 0.717 m² s^-1, respectively. To sustain high O₃ concentrations over 121 ppm inside the plasma source and low O₃ concentrations below 0.05 ppm outside the sterilizer, it is necessary to keep O₃ concentrations at the exit of plasma sterilizer below 0.28 ppm. so that diffusion coefficient D₁ has been designed to be as large as 11 times of D₀.

Public restrooms are often a hub of microbial contamination, and the examination of bacterial contamination in these facilities can serve as an important indicator of the transmission of infectious diseases. This study was conducted to determine the prevalence of bacterial contamination in public restrooms based on the economic class of the building. Samples were collected from various spots in 32 restrooms found in 10 shopping malls, classifying them into two categories: upper-end restrooms and lower-end restrooms. The findings showed that the level of contamination was higher in the lower-end restrooms, with the seat being the most contaminated area. The most dominant Gram-positive bacteria were coagulase-negative staphylococci species, making up 86% of the identified Gram-positive isolates. The most dominant Gram-negative bacteria identified were Klebsiella pneumoniae and Pseudomonas aeruginosa. The antibiotic sensitivity test results revealed the presence of multi-drug resistant bacteria among the Gram-positive and negative isolates, including Staphylococcus haemolyticus, Staphylococcus kloosi, Acinetobacter baumanii, and Pseudomonas aeruginosa. In conclusion, the study underscores the significance of monitoring bacterial contamination in public restrooms and the need for measures to reduce the spread of infectious diseases. Further research is crucial to gain a complete understanding of the bacterial contamination in public restrooms and their resistance patterns, to ensure the safety and health of the public. The implementation of improved cleaning practices and hands-free designs in restrooms can help reduce the risk of cross-contamination and prevent the spread of diseases.

Landslides impact on human activities and socio-economic development especially in mountainous areas. This study focuses on the comparison of the prediction capability of advanced machine learning techniques for rainfall-induced shallow landslide susceptibility of Deokjeokri catchment and Karisanri catchment in South Korea. The influencing factors for landslides i.e. topographic, hydrologic, soil, forest, and geologic factors are prepared from various sources based on availability and a multicollinearity test is also performed to select relevant causative factors. The landslide inventory maps of both catchments are obtained from historical information, aerial photographs and performing field survey. In this study, Deokjeokri catchment is considered as a training area and Karisanri catchment as a testing area. The landslide inventories content 748 landslide points in training and 219 points in testing areas. Three landslide susceptibility maps using machine learning models i.e. Random Forest (RF), Extreme Gradient Boosting (XGBoost) and Deep Neural Network (DNN) are prepared and compared. The outcomes of the analyses are validated using the landslide inventory data. A receiver operating characteristic curve (ROC) method is used to verify the results of the models. The results of this study show that the training accuracy of RF is 0.757 and the testing accuracy is 0.74. Similarly, training accuracy of XGBoost is 0.756 and testing accuracy is 0.703. The prediction of DNN revealed acceptable agreement between susceptibility map and the existing landslides with training and testing accuracy of 0.855 and 0.802, respectively. The results showed that, the DNN model achieved lower prediction error and higher accuracy results than other models for shallow landslide modeling in the study area

The selectin of a demand forecasting method is critical for companies aiming to avoid manufacturing overproduction or shortages in pursuit of sustainable development. Various qualitative and quantitative criteria with different weights must be considered during the evaluation of a forecasting method. The qualitative criteria and criteria weights are usually assessed in linguistic terms. Aggregating these various criteria and linguistic weights for evaluating and selecting demand forecasting methods in sustainable manufacturing is a major challenge. This paper proposes an extension of fuzzy Elimination and Choice Translating Reality (ELECTRE) I to resolve this problem. In the proposed method, fuzzy weighted ratings are defuzzified with the signed distance to develop a crisp ELECTRE I model. Moreover, an extension to ELECTRE I is developed by suggesting an extended modified discordance matrix and a closeness coefficient for ranking alternatives. The proposed extension can overcome the problem of information loss which can lead to incorrect ranking result when using the Hadamard product to combine concordance and modified discordance matrices. A comparison is conducted to show the advantage of the proposed extension. Finally, a numerical example is used to demonstrate the feasibility of the proposed method; furthermore, a numerical comparison is made to display the advantage of the proposed method.

Ixodes scapularis is a blood-feeding obligate ectoparasite responsible for transmitting the Lyme disease (LD) agent, Borrelia burgdorferi. During the feeding process, I. scapularis injects B. burgdorferi into the host along with its saliva, facilitating the transmission and colonization of the LD agent. Tick calreticulin (CRT) is one of the earliest tick saliva proteins identified and is currently utilized as a biomarker for tick bites. Our recent findings revealed elevated levels of CRT in the saliva proteome of B. burgdorferi-infected I. scapularis nymphs compared to uninfected ticks. Differential precipitation of proteins (DiffPOP) and LC-MS/MS analyses were used to identify the interactions between Ixs (I. scapularis) CRT and human plasma proteins and further exploring its potential role in shielding B. burgdorferi from complement killing. We observed that although yeast expressed recombinant (r) IxsCRT binds to the C1 complex (C1q, C1r, and C1s), the activator of complement via the classical cascade, it did not inhibit deposition of the membrane attack complex (MAC) via the classical pathway. Intriguingly, rIxsCRT binds intermediate complement proteins (C3, C5, and C9) and reduces MAC deposition through the lectin pathway. Despite inhibition of MAC deposition in the lectin pathway, rIxsCRT did not protect a serum sensitive B. burgdorferi strain (B314/pBBE22Luc) from complement-induced killing. As B. burgdorferi establishes a local dermal infection before disseminating to secondary organs, it is noteworthy that rIxsCRT promotes the replication of B. burgdorferi in culture. We hypothesize that rIxsCRT may contribute to the transmission and/or host colonization of B. burgdorferi by acting as a decoy activator of complement and by fostering B. burgdorferi replication at the transmission site.

In this study, an optimized multi-material system was designed and developed to print samples in various applications, including biomedical fields (e.g., mandibular bone loss). To improve the mechanical and biological properties of scaffolds utilized for dental bone loss applications, a multi-material setup was devised, which employs digital light processing technology. This setup consists of a linear system comprising two resin vats and one ultrasonic cleaning tank, enabling the integration of diverse materials and structures to optimize the composition of the scaffold. This approach was used to print multi-material PLLA scaffolds containing 20 wt.%. HA on the interior side, and PLLA containing 1 wt.% GO on the exterior surface of the scaffold, which were evaluated mechanically and biologically after printing. The scaffold was designed using a triply periodic minimal surface (TPMS) lattice structure, which is known to possess favorable mechanical and biological properties. Various multi-material samples were successfully printed and evaluated to illustrate the multiple-material setup's potential for ensuring proper function, cleaning, and adequate interface bonding. By numerically evaluating several TMPS structures, a novel Gyroid TPMS scaffold with a nominal porosity of 50% was developed and validated experimentally. The biological properties of the scaffolds were also evaluated, including surface morphology, (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) MTT assay, and cell adhesion. Based on the results, multi-material components with the least contaminations with suitable mechanical and biological properties were successfully printed. By combining PLLA-HA and PLLA-GO, this innovative technique holds tremendous potential for enhancing the effectiveness of regenerative procedures in the field of dentistry.

This study presents structural analysis and optimization for the lightweight design of a buoyant rotor-type permanent magnet (BRPM) generator, which was first presented in Bang (2010), and compares its structural performances to a conventional generator with a spoke arm-type rotor and stator. The main benefit of a BRPM is that it can be realized as a bearing-less drive system, free from the mechanical failure of rotor bearings, by using a buoyant rotor. Also, the deformation of a generator by blade vibration can be effectively suppressed using joint couplings between the blades and the rotor. For the design optimization, the objective is set as the mass of the rotor and the stator, and the maximum deformation of the airgap clearance between the rotor and the stator by external forces is constrained below 10% of the gap width. The commercial software Optistruct is used for the analysis and optimization. In this investigation, the analysis and optimization are conducted for a 10 MW wind turbine generator. However, the proposed methods can be extended to larger generator designs without requiring considerable modification. The mass of the opti-mized 10MW BRPM generator is 160.7 tons (19.3 tons for the rotor and 141.4 tons for the stator) while that of an optimized conventional spoke arm-type generator is obtained as 325.6 tons.

The study examines the behavior of the Mechanically Stabilized Earth (MSE) wall using available reinforcement materials in Danang, Vietnam. The MSE was reinforced by the self-fabricated galvanized steel grids using CB300V steel with 3 cm ribs. The backfill soil is a sandy clay soil from the local area with a low cohesion. A full-scale model with full instrumentation was installed to investigate the distribution of tensile forces along the reinforcement layers. The highest load that caused the wall to collapse due to internal instability (reinforcement rupture) was 302 kN/m2, which is 15 times the design load of 20 kN/m2. The failure surface within the reinforced soil had a parabolic sliding shape which is similar to the theoretical studies. At the failure load level, the maximum lateral displacement at the top of the wall facing was small (3.9 mm) which is significantly lower than the allowable displacements for the retaining wall. Furthermore, a numerical model using FLAC software was applied to simulate the performance of the MSE wall. The modeling results are in good agreement with the physical model. Thus, the self-fabricated galvanized steel grids could be confidentially used in combination with the local backfill soil for the MSE walls.

Introduction: This study explored the structural relationship between peer relations, exercise participation satisfaction, exercise commitment, and adherence to intention to exercise among Korean sports club participants. The objective was to offer insights that can enhance intentions for continuous exercise participation. Methods: To fulfill this objective, data were gathered using snowball sampling from teenagers at middle schools in Seoul and Gyeonggi, South Korea, who either currently participate in school sports clubs or have participated in the past. A total of 261 responses were analyzed using frequency, technical statistics, and confirmatory factor, reliability, correlation, and structural equation model analyses. Results: Through these analyses, this study found that peer relationships, exercise participation satisfaction, and exercise commitment were significant as both direct and indirect influences on exercise adherence intentions. Discussion: Intervention strategies should focus on fostering the positive emotions that stem from peer relationships.

It is unavoidable that the characteristics of the robot system alter inexactly or cannot be correctly determined during movement and are impacted by external disturbances. There are many adaptive control methods, such as sliding control or neural control, to improve the quality of trajectory tracking for robot motion systems. Still, those methods require a large amount of computation related to solving the problem of constrained nonlinear optimization problem. The article presents some techniques for determining an intelligent controller's online learning function parameters, including two circuits: the inner circuit is a state feedback linearized controller, and the outer course is an Interactive learning controller and does not use the robot's mathematical mode with function parameters online optimal learning and intelligent online learning closely following the joint model to stabilize the robot system. Finally, the 2-DOF planar robot simulation is performed on Matlab software R2022b. The findings indicate that outstanding tracking performance is achievable.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Bioethanol has been considered as an excellent alternative to fossil fuels since it importantly contributes to the reduced consumption of the crude oil and to the alleviation of environmental pollution [1]. Up to now, the baker yeast Saccharomyces cerevisiae is the most common eukaryotic microorganism used in ethanol production. The inability of S. cerevisiae to grow on pentoses, however, hinders its effective growth on plant biomass hydrolysates, which contain large amounts of C5 and C12 sugars. The industrial-scale bioprocessing requires high temperature bioreactors, diverse carbon sources, and the high titer production of volatile compounds [2]. These criteria indicate that the search for alternative microbes possessing useful traits that meet the required standards of bioethanol production is necessary. Compared to other yeasts, Kluyveromyces marxianus has several advantages over the others, e.g. it could grow on a broad spectrum of substrates (C5, C6 and C12 sugars) [3], tolerate to high temperature, toxin [4,5] and a wide range of pH values [6], and produce volatile short-chain ester [2]. K. marxianus also shows a high ethanol production rate at high temperature and is a Crabtree-negative species [7]. These attributes make K. marxianus a promise as an industrial host for the biosynthesis of biofuels and other valuable chemicals.

Robot-assisted gait training (RAGT) is a promising treatment for stroke rehabilitation. Although the coordination between the upper and lower limbs is important for locomotor training, commercially available robotics for gait training mainly focus on the restoration of lower limb function. We aimed to evaluate the feasibility and usability of complex upper and lower limb RAGT in stroke patients using the GTR-A®, end effector-type robotic device. Patients with subacute stroke (N=9) received 30-minute RAGT thrice a week for two weeks (six sessions). Functionally, the hand grip strength (HGS), Functional Ambulatory Categories, modified Barthel Index, muscle strength test sum score, Berg Balance Scale, Timed Up and Go test, and Short Physical Performance Battery were used. The heart rate and a structured questionnaire were used to evaluate cardiorespiratory fitness and the usability of RAGT. Among the nine patients, all functional parameters between the baseline and post-training were significantly improved after RAGT, except for HGS and the muscle strength test. The questionnaire’s mean scores for each domain were as follows: safety 4.40±0.35, effects 4.23±0.31, efficiency 4.22±0.77, and satisfaction 4.41±0.25. The GTR-A® is a feasible and safe robotic device for patients with gait impairment after stroke. It showed functional improvement with endurance training effects.

This study aimed to investigate the effect of potassium poly-γ-glutamate (PGA-K) on mice fed a high-fat diet consisting of 60% of total calories for a duration of 12 weeks. PGA-K administration reduced the increase in body weight, epididymal fat, and liver weight caused by a high-fat diet compared to the obese group. The triglyceride, low-density lipoprotein cholesterol and high-density lipoprotein cholesterol levels, which are blood lipid indicators, were significantly increased in the obese group but were significantly decreased in the PGA-K-treated group. The administration of PGA-K resulted in a significant inhibition of pro-inflammatory cytokines, including tumor necrosis factor α and interleukin 6. Moreover, the levels of leptin and insulin, which are insulin resistance indicators, significantly increased in the obese group but were significantly decreased in the PGA-K-treated group. These results suggest that PGA-K exhibits a protective effect against obesity induced by a high-fat diet, underscoring its potential as a candidate for obesity treatment.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.