Heat dissipation from Li-ion batteries is a potential safety issue for large-scale energy storage applications. Maintaining low and uniform temperature distribution, and low energy consumption of the battery storage is very important. We studied the fluid dynamics and heat transfer phenomena of a single cell, 16-cell modules, battery packs, and cabinet through computer simulations and experimental measurements. The results show that the temperature distribution of single cell is relatively uniform when the cell is facing the air flow. In a module, very high air flow rate and large gap between the cells can reduce the cell temperature. A pack with a good thermally conductive case is very important to ensure good heat dissipation of the battery module. Due to limited space in the cabinet, additional air inlets and outlets can be opened outside of the cabinet to slightly lower the pack temperature. Installing fins outside the cabinet can also slightly reduce the temperature inside the cabinet. Liquid cooling medium, such as water, is much better than the air-cooling medium.

Neuronal cell death in the central nervous system has always been a challenging process to decipher. In physiological condition, neuronal cell death is restricted in the adult brain even as people ages. However, in pathological conditions of various neurodegenerative diseases, the cell death and shrinkage of a specific brain region represent a fundamental pathological feature across different neurodegenerative diseases. In this review, we will briefly go through the general pathways of cell death and describe the evidence of the cell deaths in the context of common neurodegenerative diseases individually, discussing our current understandings of cell death in connecting with the renowned pathogenic proteins, including tau, amyloid-beta, alpha-synuclein, huntingtin, and TDP-43.

With the development of sensor and communication technologies, Internet of Things (IoT) subsystem is gradually becoming a crucial part in vehicles. It can effectively enhance functionalities of vehicles. However, new attack types are also emerged. For example, a driver with the smart key in the pocket can push the start button to start a car when. At the same time, security issues in the push-to-start scenario are alerted, such as smart key forgery. In this paper, we propose a vehicle Passive Entry Passive Start (PEPS) system that uses deep learning algorithms to recognize the driver by the Electrocardiogram (ECG) signals measured by his or her smart watch. ECG signals are used for verification. Smart watches, as a new smart key of PEPS system, can replace traditional smart keys to improve security. Experiment results show that Long Short-Term Memory (LSTM) models have achieved the best accuracy score for identity recognition (91%) when single ECG cycle is used. However, it takes at least 30 minutes for training. The training time of Auto Encoder successfully reduces to 5 minutes. When 15 continuous ECG cycles are used, it can achieve 100% identity accuracy.

Luminescent properties of epitaxial Cu2O thin films were studied in 10-300 K temperature range and compared with luminescent properties of Cu2O single crystals. Cu2O thin films were deposited epitaxially by the electrodeposition method on either Cu or Ag substrates at different processing parameters, which determined the epitaxial orientation relationships and encapsulated surface. Cu2O (100) and (111) single crystal samples were cut from a crystal rod grown by the floating zone method. Luminescence spectra of thin films contain the same emission bands as single crystals around 720, 810 and 910 nm, characterizing VO2+, VO+ and VCu defects, correspondingly. Additional emission bands, whose origin is under discussion, are observed around 650-680 nm, while the exciton features are negligibly small. The relative mutual contribution of the emission bands varies depending on the particular thin film sample. Existence of the domains of crystallites with different orientation determines the polarization of luminescence. PL of both Cu2O thin films and single crystals is characterized with negative thermal quenching in the low temperature region, the reason of this phenomenon is discussed.

The increased consumption of high fat-containing foods has been linked to the prevalence of obesity and abnormal metabolic syndromes. Rhizopus oligosporus, a fungus in the family Mucoraceae, is widely used as a starter for homemade tempeh. Although R. oligosporus can prevent the growth of other microorganisms, it grows well with lactic acid bacteria (LAB). Lactobacillus plantarum can produce β-glucosidase, which catalyzes the hydrolysis of glucoside isoflavones into aglycones (with greater bioavailability). Therefore, the development of a soybean-based functional food by the co-inoculation of R. oligosporus and L. plantarum is a promising approach to increase the bioactivity of tempeh. In this study, the ameliorative effect of L. plantarum in soy tempeh on abnormal carbohydrate metabolism in high-fat diet (HFD)-induced hyperglycemic rats was evaluated. The co-incubation of L. plantarum with R. oligosporus during soy tempeh fermentation reduced the homeostatic model assessment of insulin resistance, HbA1c, serum glucose, total cholesterol, triglyceride, free fatty acid, insulin, and low-density lipoprotein contents and significantly increased the high-density lipoprotein content in HFD rats. It also increased the LAB counts as well as the bile acid, cholesterol, triglyceride, and short-chain fatty acid contents in the feces of HFD rats. Our results suggested that the modulation of serum glucose and lipid levels by LAB occurs via alterations in the internal microbiota, leading to the inhibition of cholesterol synthesis and promotion of lipolysis. Tempeh, produced with both L. plantarum and R. oligosporus, may be a beneficial dietary supplement for individuals with abnormal carbohydrate metabolism.

This study investigated the inhibitory effect of Siegesbeckia orientalis ethanolic extract (SOE) on growth and metastasis of hepatic tumors in C57BL/6JNarl mice, which is the model of tumor-igenesis induced by subcutaneous injection of Hepa1-6 murine hepatoma cells on the back of mice. Feeding 25 mg SOE/kg BW daily for 14 days effectively reduced the hepatoma weight in tu-mor-bearing mice by 59.7%. SOE intervention reduced the expression of anti-apoptotic Bcl-2 gene in tumor tissue by 48.5% and down-regulated the antioxidant system, by reducing the gene ex-pression of catalase (48.0%), glutathione peroxidase (46.3%), and superoxide dismutase (32.0%). In addition, SOE intervention increased the production of ROS by 21.4%, and the gene expression of pro-inflammatory cytokines TNF-α, IL-1β, and IL-6 by 135.3%, 179.3% and 91.7%, respectively, indicating that SOE intervention promoted the acute inflammatory response. Results of H&E staining analysis showed that SOE had the ability to inhibit angiogenesis in tumor tissue. Fur-thermore, SOE treatment inhibited the expression of migration-related genes, such as MMP-2, MMP-7, MMP-9 and β-catenin, and the inhibition rates were 24.8%, 27.4%, 10.4% and 21.9%, respectively. These results imply that SOE had the ability to suppress tumor metastasis. On the other hand, SOE intervention decreased the serum contents of inflammatory cytokines, such as TNF-α, IL-1β and IL-6 by 27.4%, 30.4%, and 30.7%, respectively, indicating that SOE intervention has an anti-inflammatory effect on normal tissues of mice. Since SOE intervention had no signif-icant effect on liver and kidney weights, and no mice died throughout the experiment, it shows that it is safe to feed SOE under this experimental condition. Based on the above results, SOE has a great potential to be used in the treatment of hepatoma.

Our study explores the role of cancer-derived extracellular exosomes (EXs), particularly focusing on collagen alpha-3 (VI; COL6A3), in facilitating tumor dissemination and metastasis in epithelial ovarian cancer (EOC). We found that COL6A3 is expressed in aggressive ES2 derivatives, SKOV3 overexpressing COL6A3 (SKOV3/COL6A3), and mesenchymal-type ovarian carcinoma stromal progenitor cells (MSC-OCSPCs), as well as their EXs, but not in less aggressive SKOV3 cells or ES2 cells with COL6A3 knockdown (ES2/shCOL6A3). High COL6A3 expression correlates with worse overall survival in EOC patients, as evidenced by TCGA and GEO data analysis. In vitro experiments showed that EXs from MSC-OCSPCs or SKOV3/COL6A3 cells significantly enhance invasion ability in ES2 or SKOV3/COL6A3 cells, respectively (both, P <0.001). In contrast, ES2 cells with ES2/shCOL6A3 EXs exhibit reduced invasion ability (p<0.001). In vivo, the average disseminated tumor numbers in the peritoneal cavity were significantly greater in mice receiving intraperitoneally injected SKOV3/COL6A3 cells than in SKOV3 cells (p<0.001). Furthermore, mice intravenously (IV) injected with SKOV3/COL6A3 cells and SKOV3/COL6A3-EXs showed increased lung colonization compared to mice injected with SKOV3 cells and PBS (p=0.007) or SKOV3/COL6A3 cells and PBS (p=0.039). Knockdown of COL6A3 or treatment with EXs inhibitor GW4869 or rapamycin-abolished COL6A3-EXs may suppress the aggressiveness in EOC.

Taiwan developing offshore wind power to promote green energy and self-electricity production. In this study, a Light Detection and Ranging (Lidar) was set up at Chang-Hua development zone one on the sea and 10km away from the seashore. At Lidar location, WRF (3.33km & 2km grid lengths) model and WAsP were used to simulate the wind speed at various elevations. Three days mean wind speed of simulated results were compared with Lidar data. From the four wind data sets, developed five different comparisons to find an error% and R-Squared values. Comparison between WAsP and Floating Lidar was shown good consistency. Lukang meteorological station 10 years wind observations at 5m height were used for wind farm energy predictions. The yearly variation of energy predictions of traditional and TGC wind farm layouts are compared under purely neutral and stable condition. The one-year cycle average surface heat flux over the Taiwan Strait is negative (-72.5 (W/m2) and 157.13 STD), which represents stable condition. At stable condition TGC (92.39%) and 600(92.44%), wind farms were shown higher efficiency. The Fuhai met mast wind data was used to estimate roughness length and power law exponent. The average roughness lengths are very small and unstable atmosphere.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

In this paper, the overall performance of Cu-(In,Ga)-Se₂ (CIGSe) solar cells was improved in the ultraviolet (UV)–visible wavelength region by two-segment process. In which, adjusting DC sputtering powers (20–40 W) for absorbers (segment I), and metal-alloy compositions (CdS, ZnO/CdS, ZnMgO/CdS and ZnMgO) for buffers (segment II) were explored and characterized. Upon choosing the optimal-30-W CIGSe-absorber (with 0.95-CGI ratio) sputtered by the segment-I process, the Cu-rich film can distinctly boost grain growth, thus reducing the trap state density. After segment-II process as the toxic-CdS alternative, the optimal Zn_0.9Mg_0.1O-alloy buffer can reach the best conversion efficiency (η = 8.70%) was attained for the environmental protection. Meanwhile, and the overall internal/external quantum efficiencies (IQE/EQE) were improved by 13.15%, respectively for the 2.48–3.62-eV bandgap (short wavelength) range. The developed photovoltaic (PV) module (with 9 optimum-CIGSe cells) exhibits acceptable stability with a variance within ±5% over the 60-day experiment. This discovery in PV-device research contributes to a new scientific understanding of renewable energy. Furthermore, this study undeniably enhances the progress of practical applications for PV-modules in alignment with sustainable development goals. It also actively supports the development of eco-friendly communities.

Background: Gastric cancer (GC) is one of the leading malignancy diseases worldwide, especially in Asian. CAST is a potential oncogene in GC carcinogenesis process. The character of macrophage infiltration in GC microenvironment was also unaddressed. Methods: We first applied machine searching in gene candidate evaluation of GC. CAST expression was analyzed via the Human Protein Atlas (HPA) and Gene Expression Profiling Interactive Analysis 2 (GEPIA2) database. Protein-protein interaction (PPI) network was downloaded from STRING. We investigated the impact of CAST on clinical prognosis using Kaplan-Meier plotter. The correlations between CAST and Lgr5 and macrophage infiltration in GC was surveyed via TIMER 2.0. Finally, GeneMANIA was also used to evaluate the possible functional linkage between genes. Results: After machine-assisted searching, CAST expression was found signicant difference in the overall survival of GC patients. STRING revealed CAST related proteomics and transcriptomics associations, mainly about CAPN family. Moreover, CAST significantly impacts the prognosis of GC from other datasets validation. Notably, high CAST expression was correlated with worse overall survival in GC patients (hazard ratio = 1.59; logrank P = 9.4 x 10-8). CAST and Lgr5 expressions were both positively correlated with WNT 2 and WNT 2B. Among GC patients in several datasets, CAST and macrophage infiltration evaluated together showed no obvious trend toward poor clinical overall survival. Conclusion: CAST plays an important role in GC clinical prognosis and is associated with WNT 2/WNT 2B/Lgr5. Our study denmostrated that CAST in GC overall survival is regulated by macrophage infiltration.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

Keywords: mHealth; peritoneal dialysis; functionality; usability

Excessive body fat is a major contributor to obesity, which is related to high blood, total cholesterol and triglycerides. Lemons (Citrus limon) are renowned for their antioxidant and lipid-lowering properties. First, Sugar-free fermentation demonstrated better results lower sugar content and was identified as the preferred fermentation method. Next, the effect of two doses of sugar-free fermented lemon peel juice (SF-FLPJ) on obesity was investigated. Sprague Dawley (male rats) were randomly divided into 4 groups and fed a standard feed or high-fat diet (HFD) to induce fatness for eight weeks. The two groups of rats fed an HFD were administered SF-FLPJ at 0.45 or 0.9 g/kg body weight daily for eight weeks. The obese rats administered 0.9 g/kg (body weight/day) of SF-FLPJ exhibited significant reductions in body fat mass and percentage; they also had lower blood cholesterol and triglyceride levels than the other groups. Additionally, the rats displayed diminished liver fat accumulation. The results suggest that SF-FLPJ can be a supplement in managing body fat, contributing positively to addressing obesity within the context of health management, and reduce obesity-associated issues.

Aging and obesity make humans more prone to cardiovascular and metabolic syndrome diseases, leading to several serious health conditions, including dyslipidemia, high blood pressure, and sleep disturbance. Hyperlipidemia means elevated blood lipid levels, including cholesterol and triglycerides. This study aimed to explore the hypolipidemic effect of fermented citrus lemon juice using a hyperlipidemic hamster model. Sugar-free lemon juice’s fermentation was optimized, and the characteristics of fresh and fermented lemon juice (FLJ) were evaluated and compared. In addition, tests were conducted to determine the appropriate hamster feed for the functional animal tests. Then, experiments were conducted to evaluate the hypolipidemic effect of the FLJ, which contained polyphenols and superoxide dismutase-like activity, on a hyperlipidemic hamster model. This study’s pre-fermentation efficiency evaluation found that 21–30 days of bacterial DMS32004 and DMS32005 fermentation of fresh lemon juice provided the best fermentation benefits. In addition, the fermentation evaluation showed that a sugar-free fermentation method provided FLJ with the best benefits. Results showed that the absorption and utilization efficiency of FLJ was higher compared with the unfermented lemon juice. After six weeks of feeding, the total cholesterol and triglyceride values in the blood and liver of the FLJ treatment groups were de-creased compared with the high-fat diet (HFD) group. In addition, the blood low-density lipoprotein cholesterol levels were significantly reduced in the FLJ treatment groups compared with the HFD group. In contrast, the blood high-density lipoprotein to low-density lipoprotein cholesterol ratio increased considerably in the FLJ treatment groups, and the total to high-density lipoprotein ratio was significantly lower than in the HFD group. Compared with the HFD group, the total cholesterol content in the FLJ treatment groups’ feces increased significantly. This study demonstrated that the sugar-free fermentation method and fermentation cycle management provided FLJ with the potential to regulate blood lipids. Further research and verification will be carried out to isolate specific substances from the FLJ and identify their mechanisms of action.

A method of direction-of-arrival (DoA) estimation for FMCW radars is presented. In addition to MUSIC and ESPRIT, which are well-known high-resolution DoA estimation algorithms, deep learning has recently emerged as a very promising alternative. It is proposed in this paper to use a 3D convolutional neural network (CNN) for DoA estimation. The 3D-CNN extracts from the radar data cube spectrum features of the region of interest (RoI) centered on the potential positions of the targets, thereby capturing the spectrum phase shift information, which corresponds to DoA, along the antenna axis. Finally, the results of simulations and field experiments are provided to demonstrate the superior performance, as well as the limitations, of the proposed 3D-CNN.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

Dysregulation of cartilage homeostasis and the changes in the density and the architecture of the subchondral bone were postulated as a potent mechanically pathological activity contributing to osteoarthritis (OA) pathogenesis. Extracorporeal shockwave therapy (ESWT) is a new, none invasive and effective method in the treatment of animal OA model. In the current study, we demonstrated that shockwave induced the expression of protein-disulfide isomerase-associated 3 (Pdia-3) which is a multifunctional protein hypothesized to be a significant mediator for 1α,25-Dihydroxyvitamin D3 (1α,25(OH)₂D₃) signaling pathway using two-dimensional electrophoresis. Histological analysis and quantitative polymerase chain reaction (qPCR) were verified and observed that the expression of Pdia-3 at 2 weeks was significantly higher than that of any other group at 4 weeks, 8 weeks, and 12 weeks post-shockwave treatment in early OA knee of rat. The other factors of the 1α,25(OH)₂D₃ rapid membrane signaling pathway including extracellular signal-regulated protein kinases 1 (ERK1), osteopontin (OPG), alkaline phosphatase (ALP), and matrix metallopeptidase 13 (MMP13) were measured and significantly increased by qPCR at 2 weeks post-shockwave treatment in early OA knee. Our proteomic data revealed significant Pdia-3 expression in microenvironments of joint tissue that could be actively responded to ESWT, which may potentially regulate biological function of chondrocytes and osteoblasts in the treatment of OA knee.

Background: Cancer patients require cross-professional care during the diagnosis and treatment periods. Therefore, methods for effectively carrying out case management are essential to tumor care. Purpose: To investigate the effects of using the community software LINE Official Ac-count on oral cancer case management. Methods: An experimental design was used; 100 patients were randomly divided into two groups by using a computer-generated random number table. The experimental group used LINE Official Account, which gave them self-care information, timely messages, and one-on-one health-care consultations. The control group followed standard healthcare practices. Results: The experimental group was satisfied with the self-care information provided by LINE Official Account (86.9%), patients regularly checked the self-care information (89.4%) and would check the information when receiving a push notification (54.3%). Ten patients used the one-on-one consultation(20.0%). LINE Official Account had a significant effect on the rate of participation in support groups. Generalized estimating equations indicated a significant difference between the two groups regarding the overall quality of life over 7 days (P = 0.023). Conclusion: Community software applications used in oncological case management can improve self-management and empower, also enable tracking of long-term follow-up effectiveness and reinforce the case manager’s role as a family therapist. Therefore, this study recommends that case manager systems be incorporated into mobile applications to increase the sustainable management, accessibility, effectiveness, and satisfaction of oncological management systems. This study also provides the value of Sustainable Development Goals (SDGs) with Good Health and Well-being, and decreased social withdrawal among patients with oral cancer.

Mechanical ventilation (MV), used in patients with acute lung injury (ALI), induces diaphragmatic myofiber atrophy and contractile inactivity, termed ventilator-induced diaphragm dysfunction. Phosphoinositide 3-kinase- (PI3K-) is crucial in modulating fibrogenesis during the reparative phase of ALI; however, the mechanisms regulating the interactions among MV, myofiber fibrosis, and PI3K- remain unclear. We hypothesized MV with or without bleomycin treatment would increase diaphragm muscle fibrosis through the PI3K- pathway. Five days after receiving a single bolus of 0.075 units bleomycin intratracheally, C57BL/6 mice were exposed to 6 or 10 mL/kg MV for 8 h after receiving 5 mg/kg of AS605240 intraperitoneally. In wild-type mice, bleomycin exposure followed by MV 10 mL/kg prompted significant increases in disruptions of diaphragmatic myofibrillar organization, transforming growth factor-1, oxidative loads, Masson’s trichrome staining, extracellular collagen levels, positive staining of -smooth muscle actin, PI3K- expression, and myonuclear apoptosis (P < 0.05). Decreased diaphragm contractility and peroxisome proliferator activated receptor- coactivator-1 levels were also observed (P < 0.05). MV-augmented bleomycin-induced diaphragm fibrosis and myonuclear apoptosis were attenuated in PI3K-γ-deficient mice and through AS605240-induced inhibition of PI3K- activity (P < 0.05). MV-augmented diaphragm fibrosis after bleomycin-induced ALI is partially mediated through PI3K-γ. Therapy targeting PI3K-γ may ameliorate MV-associated diaphragm fibrosis.

Regulatory T cells are key immune cells to initiate tolerable immune responses. TGFβ is the key cytokine of regulatory T cells. TGFβ is also the master cytokine to stimulate tissue fibrosis. Systemic sclerosis is an autoimmune disease related to overt organ fibrosis. Thus, systemic sclerosis is a disease related to regulatory T cell over-representation. Besides, many end stage organ failures including heart failure, liver cirrhosis, uremia, and pulmonary fibrosis also related to tissue fibrosis. Thus, TGFβ producing regulatory T cells are also involved in the pathogenesis of these end stage organ failure. Once we know the significance of TGFβ and it induced tolerable immune reactions in the pathophysiology of end organ failure, we can develop better prevention or therapeutic strategies to combat these detrimental disorders.

Gastric inflammation-related disorders are commonly observed digestive system illnesses char-acterized by the activation of proinflammatory cytokines, particularly tumor necrosis factor-α (TNF-α). This results in the induction of cyclooxygenase-2 (COX-2)/prostaglandin E2 (PEG2) and matrix metallopeptidase-9 (MMP-9). These factors contribute to the pathogenesis of gastric in-flammation disorders. We examined the preventive effects of Lonicera japonica Thunb. ethanol ex-tract (Lj-EtOH) on gastric inflammation induced by TNF-α in normal GES-1 cells. The GES-1 cell line was used to establish a model that simulated the overexpression of COX-2/PGE2 and MMP-9 proteins induced by TNF-α, to examine the anti-inflammatory properties of Lj extracts. The re-sults indicated that Lj-EtOH exhibits significant inhibitory effects on COX-2/PEG2 and MMP-9 ac-tivity, attenuates cell migration, and provides protection against TNF-α-induced gastric inflam-mation. The protective effects of Lj-EtOH are associated with the modulation of COX-2/PEG2 and MMP-9 through activation of TNFR–ERK 1/2 signaling pathways as well as the involvement of c-Fos and nuclear factor kappa B (NF-κB) signaling pathways. Based on our findings, Lj-EtOH ex-hibits a preventive effect on human gastric epithelial cells. Consequently, it may represent a novel treatment for the management of gastric inflammation.

Non-intrusive load monitoring (NILM) is a core technology for demand response (DR) and energy conservation services. Traditional NILM methods are rarely combined with practical applications, and most studies aim to decompose the whole loads in a household, which leads to low identification accuracy. In this paper, an NILM approach based on multi-feature integrated classification (MFIC) is explored, which combines some non-electrical features such as ON/OFF duration, usage frequency of appliances, and usage period to improve load differentiability. The implementation of MFIC algorithm is consistent with traditional event-based method. The uniqueness of our algorithm is that it designs an event detector based on steady-state segmentation and a linear discriminant classifier group based on multi-feature global similarity. Simulation results using an open-access dataset demonstrate the effectiveness and high accuracy of MFIC algorithm, with the state-of-the-art NILM methods as benchmarks.

The mechanism of immune activation and de-activation is very important. Host should trigger effective immunity against pathogen infection. And, host cannot trigger immunity against self-antigens that will lead to detrimental autoimmune disorders. Spleen and liver have opposite roles in mediating immune responses. Spleen is the organ involving in immune activation, and liver is the organ involving in immune de-activation. Sympathetic nerve system and parasympathetic nerve system have opposite roles in mediating immune responses. Sympathetic nerve system is involving in pro-inflammatory, and parasympathetic nerve system is involving in anti-inflammatory. ACTH and glucocorticosteroid have opposite roles in mediating immune responses. ACTH is involving in activating adaptive immunity with inhibiting innate immunity, and glucocorticosteroid is involving in activating innate immunity with inhibiting adaptive immunity. The molecular chaperons, heat shock proteins, which are induced by fever, have the vital roles in immune activation. On the contrary, IgD B cells and gamma-delta T cells are causing immune de-activation via the mechanism of clonal anergy. These mechanism can help us the know the work of immunological pathways better for better control of infectious diseases and autoimmune disorders.

In this paper, the performance of Cu-(In,Ga)-S2 (CIGS2) solar cells with adjusting composite CGI-ratio absorber is explored and compared through an improved three-stage co-evaporation technique. For co-evaporating CIGS2 absorber as a less toxic alternative to Cd-containing film, we analyse the effect of the CGI-ratio stoichiometry and crystallinity, and explore its opto-electric sensing characteristic of individual solar cell. The results of this research signify the potential of high-performance CIGS2-absorption solar cells for photovoltaic (PV)-module industrial applications. For the optimal CIGS2-absorption film (CGI=0.95), the Raman main-phase signal (A1) falls at 291 cm-1, which is excited by the 532-nm line of Ar+-laser. Using photo-luminescence (PL) spectroscopy, the corresponding main-peak bandgaps measured is 1.59 eV at the same CGI-ratio film. Meanwhile, the best conversion efficiency (=3.212%) and the average external quantum efficiency (EQE=51.1% in the visible-wavelength region) of photo-electric properties were achieved for the developed CIGS2-solar cells (CGI=0.95). The discoveries of this CIGS2-absorption PV research provide a new scientific understanding of solar cells. Moreover, this research undeniably contributes to a major advancement towards practical PV-module applications and can help more to build an eco-friendly community.

In this study, the preparation of the composite 3% Au/graphite-C3N4 (3% Au/g-C3N4) sensing material was prepared by doping 3% Au onto the surface of graphitic carbonitride (C3N4) for detection pimobendan. By the way of sensing materials characterization, the X-ray diffraction analysis (XRD) and transmission electron Microscope (TEM) were performed. The cyclic voltammetry (CV) was used to measure the concentration and redox properties of pimobendan. It can be seen that when the voltage value is 0.05 V, and a reduction peak was appeared and the pimobendan concentration (0 to 55 μM) has a relationship with the reduction current value. At low concentrations of pimobendan concentration from 0.0 to 0.8 μM, the linearity R2 = 0.9642 with a detection limit of 0.28 μM. A possible pimobendan sensing mechanism on 3% Au/g-C3N4 was proposed.

Building information modeling (BIM) is the digital representation of physical and functional characteristics (such as geometry, spatial relationship, and geographic information) of a facility to support decisions during its life cycle. BIM has been extended beyond 3D geometrical representations in recent years, and now includes time as a fourth dimension and cost as a fifth dimension, as well as such other applications as virtual reality and augmented reality. The Internet of Things (IoT) has been increasingly applied in various products (smart homes, wearables) to enhance work productivity, living comfort, and entertainment. However, research addressing the integration of these two technologies (BIM and IoT) is still very limited, and has focused exclusively on the automatic transmission of sensor information to BIM models. This paper describes an attempt to represent and visualize sensor data in BIM with multiple perspectives in order to support complex decisions requiring interdisciplinary information. The study uses a university campus as an example and includes several scenarios, such as an auditorium with a dispersed audience and energy saving options for rooms with different functions (mechanical/electric equipment, classrooms, and laboratory). This paper also discusses the design of a common platform allowing communication among sensors with different protocols (Arduino, Raspberry Pi), the use of Dynamo to accept sensor data as input and automatically redraw visualized information in BIM, and how visualization may help in making energy-saving management decisions.

Despite huge effort has been devoted to the design of the initiators and reaction conditions, it remains challenging to synthesize high molecular weight polypeptides with conventional solution phase synthesis. In this work, surface-initiated vapor deposition polymerization (SI-VDP) was utilized to graft synthetic polypeptides poly (γ-benzyl L-glutamate) (PBLG) from polystyrene (PS) resin beads by ring-opening polymerization of N-carboxyanhydrides (NCAs). It was demonstrated for the first time that high molecular weight bulk PBLG (> 500,000) could be readily obtained within one hour via solvent-free synthetic method which paves the way for the synthesis of copolypeptides with high molecular weight.

Systemic lupus erythematosus (SLE) is a prevalent autoimmune condition, yet its alignment with a specific host immunological pathway remains unclear. The THαβ host immunological pathway, recognized for its defense against viruses and prions, has recently emerged as a response to DNA, RNA, and protein pathogens. SLE patients often produce anti-double strand DNA antibodies and anti-nuclear antibodies, suggesting a potential association with the THαβ host immune reaction. Throughout the course of SLE, elevated levels of type 1 interferons, type 3 interferons, interleukin-10, IgG1, and IgA1 are commonly observed. These cytokines and antibody isotypes are indicative of the THαβ host immunological pathway. Similarly, Myasthenia gravis, Grave’s disease, Graft versus host disease, autoimmune hemolytic anemia, immune thrombocytopenia, dermatomyositis, and Sjogren’s syndrome are also linked to THαβ-related type 2 hypersensitivities. Considering the potential association of these diseases with dysregulated THαβ immune responses, therapeutic strategies such as anti-interleukin-10 or anti-interferons α/β could be explored to manage these disorders effectively.

Sustainable urban design or planning is not a LEGO-like assembly of prefabricated elements, but an embryo-like growth with persistent differentiation and adaptation towards a coherent whole. The coherent whole has a striking character – called living structure – that consists of far more small substructures than large ones. To detect the living structure, natural streets or axial lines have been previously adopted to be topologically represent an urban environment as a coherent whole. This paper develops a new approach to detecting the underlying living structure of urban environments. The approach takes an urban environment as a whole and recursively decomposes it into meaningful subwholes at different levels of hierarchy or scale ranging from the largest to the smallest. We compared the new approach to natural street and axial line approaches and demonstrated, through four case studies, that the new approach is better and more powerful. Based on the study, we further discuss how the new approach can be used not only for understanding, but also for effectively designing or planning the living structure of an urban environment to be more living or more livable.

Gesture recognition technology has been quickly developed in the field of human-computer interaction. The multiple-input multiple-output (MIMO) radar has been widely adopted in gesture recognition because of its notable spatial resolution. In this work, a highly accurate MIMO radar-based hand gesture recognition algorithm with very low complexity is proposed. To make the proposed system applicable in the industry and work well even when the size of the training data is limited, we applied several low-complexity adaptive signal processing methods to extract features and reduce the noise effect. First, spectrum analysis is applied to range-Doppler maps (RDMs) and a cell-averaging constant false alarm rate (CA-CFAR) with mirror filters is applied to improve the robustness to noise. Afterward, the features related to the distance, speed, direction, and the elevation angle of the moving object are determined by the proposed adaptive signal analysis techniques and the random forest is applied for classification. The proposed system has the capability to precisely distinguish and identify eight motions, including waving, moving to the left or right, patting, pushing, pulling, and rotating clockwise or anticlockwise, with an accuracy of 95%. Experiments demonstrate the capability of the proposed hand gesture recognition system to classify different movements precisely.

Field-effect transistor (FET)-based biosensors stand as powerful analytical tools for detecting trace-specific biomolecules in diverse sample matrices, especially in the realms of pandemics and infectious diseases. The primary concern in applying these biosensors is their stability, a factor directly impacting the accuracy and reliability of sensing over extended durations. The risk of biosensor degradation is substantial, potentially jeopardizing sensitivity and selectivity and leading to inaccurate readings, including the possibility of false positives or negatives. This paper delves into the documented degradation of silicon nanobelt FET (NBFET) biosensors induced by buffer solutions. The results highlight a positive correlation between immersion time and the threshold voltage of NBFET devices. Secondary ion mass spectrometry analysis demonstrates a gradual increase in sodium and potassium ion concentrations within the silicon as immersion days progress. This outcome is ascribed to the nanobelt's exposure to the buffer solution during the biosensing period, enabling ion penetration from the buffer into the silicon. The study emphasizes the critical need to address buffer solution-induced degradation to ensure the long-term stability and performance of FET-based biosensors in practical applications.

Abstract: Background: The optimal strategy for the microelimination of HCV within community settings remains ambiguous. We evaluated the percentage of participants who achieved linkage to care (LTC) following the conclusion of the screening campaign, and examined the diverse factors influencing LTC among these individuals. The effectiveness of recall intervention for the non-LTC population and its barriers were analyzed. Methods: We initiated an HCV patients recall program to identify the HCV participants who might not be treated after the HCV screening campaign. A program staff recalled HCV participants who lost to follow-up through the telephone from March 2019 to June 2019. They were informed of HCV treatment's importance, efficacy, availability, and safety. Result: Among 185 HCV-infected participants, 109 (58.9%) HCV-infected participants had obtained LTC. Compared with those who had LTC, those without LTC were older, lower education levels, were less aware of their HCV infection, less frequently lived in urban areas, and had less health insurance. At the end of the recall program, 125 (67.6 %) persons had liked to care. The proportion of LTC increased by 8.7 %. 119 persons had an HCV RNA test, and 82 (68.9%) had viremia. Of 82 patients with viremia, 78 (95.1%) received antiviral therapy. 76 (97.4 %) of them achieved a sustained virological response. Conclusion: After a community screening campaign, 59 % of participants with anti-HCV positive had LTC. The recall program can increase by 9 %. However, there were still 32% of HCV participants who couldn't be linked to care. Outreach care for non-LTC patients is a way worth trying to achieve micro-elimination of HCV in the rural community.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

Background and Aims: The impact of antibody response after direct-acting antiviral (DAA) therapy in hepatitis C virus (HCV)-infected recipients before and after liver transplantation (LT) is still undetermined. Methods: In this observational cohort study, we aimed to explore the association of changes in anti-HCV antibody titers after pre-LT DAA therapy with allograft injury, including biliary complications (BCs) and acute cellular rejection (ACR). Results: A total of 153 cases were enrolled from January 2015 to February 2021. Serum anti-HCV antibody titers were assessed before and after (day 30) LT. Among all recipients, 31/153 (20.3%) had pre-LT DAA therapy (DAA group) and 122/153 (79.7%) did not undergo pre-LT DAA therapy (DAA-naïve group). Higher incidence of post-LT BCs was observed in the DAA group (P = 0.028). Compared with the DAA-naïve group, the DAA group had a significantly higher mean level of anti-HCV titer upregulation (P = 0.0024); furthermore, among the recipients with BCs (n = 28) and ACR (n = 41), those in the DAA group exhibited significantly higher mean levels of anti-HCV antibody titer upregulation (P < 0.005). Conclusion: In conclusion, we speculated that anti-HCV antibody titer upregulation, which might have been induced by restoration of HCV-specific immune responses with pre-LT DAA therapy, were associated with post-LT allograft injury.

Various vaccines have been developed in response to the SARS-CoV-2 pandemic, and the safety of vaccines has become an important issue. COVID-19 vaccines-related central nervous system inflammatory demyelinating diseases (CNS IDDs) have been reported recently. We present one case of AstraZeneca vaccine-related myelin oligodendrocyte glycoprotein (MOG) antibody-associated disease and literature review another 78 patients published from January 2020 to October 2022. Patients were divided into three vaccine groups (viral vector, mRNA and inactivated vaccines) for further analyses. Among 79 patients with COVID-19 vaccines-related CNS IDDs, 49 (62%) cases received viral vector vaccines, 20 (25.3%) received mRNA vaccines and 10 (12.7%) received inactivated vaccines. Twenty-seven cases (34.2%) were confirmed with autoantibodies, including 15 patients (19%) with anti-MOG, 11 (13.9%) with anti-aquaporin 4 (AQP4), and one (1.3%) with both antibodies. Significantly, more males developed CNS IDDs post viral vector vaccines compared to mRNA and inactivated vaccines. Patients receiving mRNA vaccines were older than other groups. Furthermore, mRNA and inactivated vaccines correlated more with anti-AQP4 antibodies, while viral vector vaccines showed higher MOG positivity. The research suggests potential associations between COVID-19 vaccines-related CNS IDDs and gender, age, and autoantibodies, contingent on vaccine types. Protein sequence analysis implies similarities between the S protein and AQP4/MOG. Further studies may elucidate the mechanisms of CNS IDDs, aiding vaccine selection for specific groups.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

This study proposed a spatially and temporally improving methodology adopting the Regional Frequency Analysis with L-moments approach to estimate rainfall quantiles from 22787 grids of radar rainfall in Taiwan for a 24-hour duration. Due to limited radar coverage in the eastern region, significant discordant grids were found in the coastal area of the eastern region. A K-means cluster analysis using scaled at-site characteristics was used to group the QPESUMS grids in Taiwan into 22 clusters/sub-regions based on their characteristics. Spatially, homogeneous subregions with QPESUMS data produce more detailed homogeneous subregions with clear and continuous boundaries, especially in the mountain range area where the number of rain stations is still very limited. According to the results of z-values and L-moment ratio diagrams, the Wakeby (WAK), Generalized Extreme Value (GEV), and Generalized Pareto (GPA) distributions of rainfall extremes fitted well for the majority of subregions. The Wakeby distribution was the dominant best-fitted distribution, especially in the central and eastern regions. The east of the northern part and southern part of Taiwan had the highest extreme rainfall for each return period. Both areas were frequently struck by typhoons. By using grid-based (at-site) as the basis for assessing regional frequency analysis, the results show that the regional approach in determining extreme rainfall is very suitable for large-scale applications and even better for smaller scales such as watershed areas. The spatial investigation was performed by establishing regions of interest in small subregions across the northern part. It showed that regionalization was correct and consistent.

Background: LncRNA and pyroptosis play important roles in cancer development and tumor immune microenviroment. However, pyroptosis-related lncRNAs (PRLs) in ovarian cancer have not been identified and its impact on prognosis and immune response are not fully understood. Methods: Using pearson correlation analysis, PRLs were screened. Subsequently, we constructed a prognosis signature by using LASSO cox regression. In addition, the association between risk score and cancer immune environment was analyzed. Results: In TCGA-RNA-seq cohort (n=377), 32 prognostic PRLs were selected and a 7-gene signature were developed and had high accuracy in predicting the OS of ovarian cancer patients. Stratification analysis suggested that it might serve as an independent prognostic indicator. Except to clinical outcome, the signature was significantly associated with tumor immune microenvironment. Patients with high risk score exhibited lower infiltration abundance of MHC class Ⅰ cells, Type Ⅰ IFN response and immunotherapy response. In ovarian cancer, TYMSOS was highly expressed and its high expression was associated with worse OS. TYMSOS deletion in ovarian cancer cell lines inhibited the cell proliferation, invasion and migration, indicating that it might serve as a novel biomarker in ovarian cancer. Conclusions: The prognostic PRLs signature constructed in this work is available for prognostic prediction and immune microenvironment infiltration in ovarian cancer.

Accurate and reliable mid-long runoff prediction (MLTRP) is of great importance in water re-sources management. However the MLTRP is not suitable in each basin and how to evaluate the applicability of MLTRP is still a question. Therefore, the total mutual information (TMI) index is developed in this study based on the predictor selection method using mutual information (MI) and partial MI (PMI). The relationship between the TMI and the predictive performance of five models is analyzed by applying five models in 222 forecasting scenarios in Australia. The results over 222 forecasting scenarios demonstrate that, compared with the MI, the developed TMI index can better represent the available information in the predictors, and has more significant negative correlation with the RRMSE with the correlation coefficient between -0.62 and -0.85. This means the model's predictive performance will become better along with the increase of TMI, and there-fore the developed TMI index can be used to evaluate the applicability of MLTRP. When TMI is more than 0.1, the available information in the predictors can support the construction of MLTRP models. In addition, the TMI is used to partly explain the difference of predictive performance among five models. In general, the complex models, which can better utilize the contained infor-mation, are more sensitive to the TMI, and have more significant improvement in terms of predic-tive performance along with the increase of TMI. This research can provide support for the study of MLTRP.

Light sources tend to affect images captured in any automatic optical inspection (AOI) system. In this study, the effectiveness of metal-halide lamps, quartz-halogen lamps, and LEDs as the light sources in AOI systems for the detection of the 3rd and 4th layers electrodes of thin-film-transistor liquid crystal displays (TFT-LCDs) is examined experimentally. The results show that the performance of LEDs is generally comparable or better than that of metal-halide and quartz-halogen lamps. The best optical performance is by the blue LED due to its spectrum compatibility with the time-delay-integration charged-coupled device (TDI CCD) sensor and its better spatial resolution. The images revealed by the blue LED are sharper and more distinctive. Since current LEDs are more energy efficient and environmentally friendly, using LEDs as the light source for AOI is very beneficial. As the blue LED performs the best, it should be adopted for AOI using TDI CCD sensors.

Among colours, the green has the most sensitivity in human vision so that green defects on displays can be effortlessly perceived by a photopic eye with the most intensity in the wavelength 555 nm of the spectrum. With the market moving forward to high resolution, displays can have resolutions of 10 million pixels. Therefore, the task detects the appearance the panel using ultra-high resolutions in TFT-LCD. The machine vision associated with reflective chromaticity spectrometer quantises the defects are explored, such as blackening and whitening. The result shows the significant phenomena to recognize the non-uniformity film-related chromatic tendency. In contrast, the quantitative assessment illuminates that the chromaticity CIE xyY at 0.001 is a just noticeable difference (JND) and detects even more sensitivity. Moreover, an optical device associated with a 198 Hg discharge lamp calibrates the spectrometer accuracy.

The aim of this case-series report article is to provide a new topical view of the styletubation (video intubating stylet technique) in obese patients undergoing bariatric surgeries. In contrast to various conventional direct laryngoscopes (DLs), videolaryngoscopes (VLs) have been applied in such obese population with potentially difficult airway populations. The safety and effectiveness of VLs have been repeatedly studied and the superiority of VLs then has been observed and is advocated as a routine use. In this article, among our vast use experiences of the styletubation (more than 54,998 patients since 2016) for routine tracheal intubation, we present such unique experience to apply such intubating technique in obese patient undergoing bariatric surgery. Consistent with the experiences applied in other patient populations, we found the styletubation technique to be swift (the time to intubate from 5 s to 24 s), smooth (first-attempt success rate: 100%), safe (no airway complications), and easy (high subjective satisfaction). The learning curve can be steep but is easily overcome if technical pitfalls are avoided. We, therefore, propose that the styletubation technique can be feasibly applied for tracheal intubation in obese patients undergoing bariatric surgery.

Multi-wire saw machining (MWSM) used for slicing hard-brittle materials in semiconductor, is an important material removal process that uses free abrasives. Cutting model of single-wire saw machining (SWSM) is the basis of MWSM, and the material removal mechanism of SWSM can better understand than MWSM. Mathematical model (includes brittle fracture and plastic deformation) is presented in this paper for SWSM ceramic with abrasives. This paper determines the effect of various machining parameters on the removal of hard-brittle materials. For brittle fracture of SWSM ceramics, the minimum of the strain energy density is used as a fracture criterion. The material removed of SWSM ceramics due to plastic deformation is calculated using the equations of motion. Actual wire-sawing experiments are conducted to verify the results from the developed mathematical model. Theoretical results agree with experimental data and practical experience. The developed mathematical model shows that brittle fracture plays a major concern role in material removed of SWSM ceramics. Wire speed and working load have positively correlated with material removed of SWSM ceramics. The coefficient of friction is low, a lateral crack, which propagates almost parallel to the working surface, leads to more brittle fracture and material removed is increased on SWSM ceramics.

Taiwan’s auditors have suffered from processing excessive audit data, including drawing audit evidence. This study advances sampling techniques by integrating machine learning with sampling. This machine learning integration helps avoid sampling bias, keep randomness and variability, and target the risker samples. We first apply a Naive Bayes classifier to classify data into some classes. Next, a user-based, item-based, or hybrid approach is employed to draw audit evidence. The representativeness index is the primary metric for measuring the representativeness of audit evidence. The user-based approach denotes the selection of samples between two percentiles in a class as audit evidence. It may be equivalent to a combination of monetary and variable sampling methods. The item-based approach represents the choice of risky samples as audit evidence. It may be identical to a combination of non-statistical and monetary sampling methods. Auditors can hybridize those user-based and item-based approaches to balance representativeness and riskiness in selecting audit evidence. Three experiments show that sampling using machine learning integration has the benefits of drawing unbiased samples, handling complex patterns, correlations, and unstructured data, and improving efficiency in sampling big data. However, the limitations are the classification accuracy output by machine learning algorithms and the range of prior probabilities.

The purposes of this study are based upon the theory of planned behavior (TPB) to examine the impact of past experiences of contract farming on selecting a specific type of contract farming in the future and then compare different psychological factors in the TPB for different potential contract farmer statuses. These statuses include homesteaders, farmers from cooperative farms, farmers from production and sales teams, professional farmers, and brokers. The impact of factors in the TPB for a particular contract type on potential contract farmers is further to compute. To this end, data are collected in three major sweet potato production areas in Taiwan. The results show that the farmers’ past contract farming experience does not influence the selection of the contract in the future. As for the selection of contract type, strengthening the perception and motivating the behavioral intention of contract farming for cooperative farms will increase the probability of selecting an unclassified sweet potato size contract. On the other hand, enhancing perceived behavioral control factors and behavioral intention factors for professional farmers and brokers is apt to have a relatively high probability of selecting those types involving the highest amount or the best price to obtain the best deal.

Protrusive defects on the color filter of thin-film transistor (TFT) liquid crystal displays (LCDs) frequently damage the valuable photomask. An fast method using side-view illuminations associated with digital charge-couple devices (CCDs) to detect the protrusive defect in the four substrates, which are the black matrix (BM), red, green, and blue. Between the photomask and substrate, the depth of field (DOF) is normally 300 μm for the proximity-type aligner; we select the four substrates to evaluate the detectability in the task. The experiment is capable of detecting measurements of 300 μm and even lower than 100 μm can be assessed successfully. The maximum error of the measurement is within 6% among the four samples. Furthermore, the uncertainty analysis of three standard deviations is conducted. Thus, the method is cost-effective to prevent damage for valuable photomasks in the flat panel display industry.

In hepatocellular carcinoma (HCC), recurrence usually occurs after curative surgical resection. Currently, no approved adjuvant therapy has been shown to reduce recurrence rates. In this report, the in vivo mouse effect of sequential combination treatment with recombinant mouse interferon-alpha (rmIFN-α) and an anti-mouse-PD1 antibody on hepatitis B virus (HBV) clearance was evaluated. A phase I clinical trial was then conducted to assess the safety, tolerability, and inhibitory activity of sequential therapy with ropeginterferon alfa-2b and nivolumab in HCC recurrence in patients who have undergone curative surgery for HBV-related HCC. In animal modeling, HBV suppression was significantly greater with rmIFN-α and anti-PD1 sequential combination treatment than with their treatment alone. In the Phase I study, eleven patients completed the sequential therapy with ropeginterferon alfa-2b every two weeks at the dose of 450 µg for six doses, followed by three doses of nivolumab every two weeks up to 0.75 mg/kg. A notable decrease or clearance of HBV surface antigen was observed in two patients. Dose-limiting toxicity of grade 3 alanine transaminase and aspartate aminotransferase increases was observed in one patient. The maximum tolerated dose was determined. Currently no HCC recurrence has been observed. The treatment modality was well tolerated. The data support further clinical development of sequential combination therapy as a post-surgery prophylactic measure against the recurrence of HBV-related HCC.

We aimed to investigate the mechanism underlying social stress (SS)-induced erectile dysfunction (ED) and evaluate the effects of a single sub-anesthetic dose of ketamine on SS-related ED. Male FVB mice were exposed to retired male C57BL/6 mice for 60 minutes daily over a 4-week period. In the third week, SS mice received intraperitoneal injections of either saline (SSS group) or ketamine (SSK group). Erectile function was assessed by measuring intra-cavernosal pressure (ICP) during electrical stimulation at the major pelvic ganglia. Corpus cavernosum (CC) strips were utilized for wire myography to assess their reactivity. Both SSS and SSK mice exhibited significantly lower ICP in response to electrical stimulation than control. SS mice showed increased contractility of CC induced by phenylephrine. Acetylcholine-induced relaxation was significantly reduced in SSS and SSK mice. Sodium nitroprusside-induced relaxation was higher in SSS mice compared to control and SSK mice. Nicotine-induced neurogenic and nitric oxide (NO)-dependent relaxation was significantly impaired in both SSS and SSK mice. Immunohistochemically analysis revealed co-localization of tyrosine hydroxylase and neuronal nitric oxide synthase (nNOS)-immunoreactive fibers in the CC. These findings highlight the complex nature of SS-related ED and suggest the limited efficacy of ketamine as a therapeutic intervention in this condition.

This study proposes and validates a novel combustion control system for Oil-Fired Boilers aimed at reducing air pollutant emissions through flame image prediction. The proposed system is easily applicable to existing ships. Traditional proportional combustion control systems supply fuel and air at fixed ratios according to the set steam load, without considering the emission of air pollutants. To address this, a stable and immediate control system is proposed, which adjusts the air supply to modify the combustion state. The combustion control system utilizes oxygen concentration predictions from flame images via SEF+SVM as control inputs, and applies Internal Model Control (IMC)-based Proportional-Integral (PI) control for real-time combustion control. Due to the complexity of modeling the image-based system, IMC parameter tuning through experimentation is essential for achieving effective control performance. Experiments conducted on a 3000 kg/h marine oil-fired boiler in actual operation optimized the controller parameters for stability and responsiveness, and validated their effectiveness. The results demonstrate the potential of the proposed system to improve combustion efficiency and reduce emissions of air pollutants. This study provides a feasible and effective solution for enhancing the environmental performance of marine oil-fired boilers. Given its ease of application to existing ships, it is expected to contribute to sustainable air pollution reduction across the maritime environment.

Previous investigations have illuminated the significant association between the gut microbiome and a broad spectrum of health conditions, including obesity, diabetes, cardiovascular diseases, and psychiatric disorders. Evidence from certain studies suggests that dysbiosis of the gut microbiota may play a role in the etiology of obesity and diabetes. Moreover, it is acknowledged that dietary habits, pharmacological interventions, psychological stress, and other exogenous factors can substantially influence the gut microbial composition. For instance, a diet rich in fiber has been demonstrated to increase the population of beneficial bacteria, whereas the consumption of antibiotics can reduce these advantageous microbial communities. In light of the established correlation between the gut microbiome and various pathologies, strategically altering the gut microbial profile represents an emerging therapeutic approach. This can be accomplished through the administration of probiotics or prebiotics, which aim to refine the gut microbiota and, consequently, mitigate the manifestations of associated diseases. The present manuscript evaluates recent literature on the relationship between gut microbiota and metabolic syndrome published over the past three years and anticipates future directions in this evolving field.

Water quality monitoring was an important objective in the surroundings. In this study, we investigated the sensing characteristics of the arrayed flexible chloride sensor with XBee wireless sensing system. The sensitivity and linearity of the wireless chloride sensing devices were 91.6 mV/pCl and 0.988, respectively. The hysteresis voltages were 50.14 mV and 36.71 mV during the cycles of 1 M → 10⁻¹ M → 1 M → 10⁻³ M → 1 M and 1 M → 10⁻³ M → 1 M → 10⁻¹ M → 1 M, respectively. The selectivity coefficients of the ClO⁻ ion, ClO₄⁻ ion, NO₃⁻ ion and I⁻ ion for Cl⁻ ion were 5.0 × 10⁻², 1.0 × 10⁻¹, 5.9 × 10⁻³ and 5.6×10⁻¹, respectively. The sensing characteristics of real time measurement were investigated for dynamic microfluidic. The arrayed flexible chloride sensor was integrated with the microfluidic device, syringe pump and wireless sensing system. The sensitivity and linearity were 273.1 mV/pCl and 0.978 at 35 μL/min, respectively.

Diastolic dysfunction, a prevalent condition characterized by impaired relaxation and filling of the left ventricle, significantly contributes to heart failure with preserved ejection fraction (HFpEF). Galectin-3, a β-galactoside-binding lectin, has garnered attention as a potential biomarker and mediator of fibrosis and inflammation in cardiovascular diseases. This comprehensive review investigates the impact of galectin-3 on diastolic dysfunction. We explore its molecular mechanisms, including its involvement in cellular signaling pathways and interaction with components of the extracellular matrix. Evidence from both animal models and clinical studies elucidates galectin-3's role in cardiac remodeling, inflammation, and fibrosis, shedding light on the underlying pathophysiology of diastolic dysfunction. Additionally, we examine the diagnostic and therapeutic implications of galectin-3 in diastolic dysfunction, emphasizing its potential as both a biomarker and a therapeutic target. This review underscores the significance of comprehending galectin-3's role in diastolic dysfunction and its promise in enhancing diagnosis and treatment approaches for HFpEF patients.

Dust storms originating from Central Australia and western New South Wales frequently cause high particles concentration at many sites across New South Wales, both inland and along the coast. This study focussed on a dust storm event in February 2019 which affect air quality across the state as detected at many ambient monitoring stations in the Department of Planning, Industry and Environment (DPIE) air quality monitoring network. The WRF-Chem (Weather Research and Forecast Model – Chemistry) model is used to study the formation, dispersion and transport of dust across the state of New South Wales (NSW, Australia). Wildfires also happened in northern NSW at the same time of the dust storm in February 2019, and their emissions are taken into account in WRF-Chem model by using Fire Inventory from NCAR (FINN) as emission input. The model performance is evaluated and is shown to predict fairly accurate the PM2.5 and PM10 concentration as compared to observation. The predicted PM2.5 concentration over New South Wales during 5 days from 11 to 15 February 2019 is then used to estimate the impact of the February 2019 dust storm event on three health endpoints namely mortality, respiratory and cardiac diseases hospitalisation rates. The results show that even though as the daily average of PM2.5 over some parts of the state, especially in western and north western NSW near the centre of the dust storm and wild fires, are very high (over 900 µg/m3), the population exposure is low due to the sparse population. The top five Statistical Area Level 4 regions with the most impact in term of mortality, respiratory diseases hospitalisation and cardiac disease hospitalisation are Far West and Orana, Newcastle and Lake Macquarie, New England and North West, Sydney – Inner South West and either Central Coast (mortality) or Sydney – Parramatta (respiratory diseases hospitalisation) or Sydney – Inner West (cardiac diseases hospitalisation). Generally, the health impact is similar in order of magnitude to that caused by biomass burnings events from wildfires or from hazardous reduction burnings (HRBs) near populous centres such as in Sydney in May 2016. One notable difference is the higher respiratory diseases hospitalisation for this dust event (161) compared to fire event (24).

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

GaN ultraviolet photodetector with metal-semiconductor-metal structure is achieved by growing on a periodic trapezoid column-shape patterned sapphire substrate using metalorganic chemical vapor deposition. Under 5-V reverse bias, the photodetector fabricated on such patterned sapphire substrate exhibits a lower dark current, a higher photocurrent, and a 476 % enhancement in the maximum responsivity as compare with those of the photodetector fabricated on conventional flat sapphire substrate. It is also found that the much larger UV-to-visible rejection ratio and the fact that responsivity drops in a smaller cut-off region are observed from photodetector fabricated by using a periodic trapezoid column-shape patterned sapphire substrate. These phenomena may all be attributed to the reduction of threading dislocation density and the improved quality of GaN film, as well as the internal reflection and/or scattering effect on the interface between GaN film and the periodic trapezoid column-shape pattern of the substrate.

Antibiotic beads were used to treat surgical infections. In this study, polylactide–polyglycolide (PLGA) was mixed with vancomycin, osteogenic enhancer lithium chloride (LiCl), and hot com-pressing to form PLGA-vancomycin-LiCl delivery beads to treat bone infection. An elution method was employed to characterize the in vitro release characteristics of the vancomycin and the Li over a 42-day period. The released profiles lasted for more than 42 days for vancomycin and 28 days for Li. The concentration of vancomycin in each sample was well above the breakpoint sensitivity. Lithium co-treatment enhanced the bactericidal effect of vancomycin. Released Li and vancomycin increased mRNA or protein expressions of osteogenic markers of mesenchymal stem cells (MSCs). In vivo, the PLGA delivery systems were implanted into the rabbit distal femoral cavities and the cavity fluid content was aspirated and analyzed at each time point. The released Li and vancomycin lasted more than 6 weeks, and vancomycin concentrations were much above the breakpoint sensitivity. Four rabbits in each group were killed at 8 weeks for histologic observation. More mature bone tissue was shown in the Li treatment group. This study provides a PLGA drug delivery system to meet the requirements of patients with bone infections.

According to many research groups, high glucose induces over production of superoxide anions, and reactive oxygen species (ROS) in general is the link between high glucose levels and the toxicities seen at cellular levels. Respiratory complex anomalies could lead to the production of ROS. Calcium [Ca2+], at physiological levels serves as a second messenger in many physiological functions. Accordingly, mitochondrial calcium [Ca2+]m overload leads to ROS production which could be lethal to the mitochondria through various mechanisms. The F1F0-ATPase (ATP syn-thase or complex V) is the enzyme that is responsible for catalyzing the final step of oxidative phosphorylation. It does so by coupling the translocation of protons in the mitochondrial in-termembrane space and shuttling them to the mitochondrial matrix for ATP synthesis to take place. Mitochondrial complex V T8993G mutation specifically blocks the translocation of protons across the intermembrane space thereby blocking ATP synthesis leading to Neuropathy, Ataxia and Retinitis Pigmentosa Syndromes (NARP). This study seeks to explore the possibility of [Ca2+]m overload mediating the pathological roles of high glucose in defective respiratory chain mediated mitochondrial stress. The NARP cybrids are the in vitro experimental models for the cells with F1FO-ATPase defects, these cells harbor 98% of mtDNA T8993G mutation. Their coun-terparts 143B osteosarcoma cell lines are the parental cell lines used for comparisons. We uncov-ered that, NARP cells mediated and enhanced the death of the cells (apoptosis) when incubated with hydrogen peroxide (H2O2) and high glucose respectively as depicted by the MTT assay of cell viability. Furthermore, using the fluorescence probe-coupled laser scanning confocal imag-ing microscopy, NARP cells significantly enabled mitochondrial reactive oxygen species (mROS) formation and enhanced the depolarization of the mitochondrial membrane potential (ΔΨm). Elucidating the mechanisms of sugar enhanced toxicity on mitochondria would help in the fu-ture to alleviate the symptoms of patients associated with (NARP) syndromes.

Neuronal cells are believed to rely on autophagy to maintain cellular homeostasis. Nevertheless, autophagy may be a therapeutic target for neurodegenerative diseases because of the role it plays in neuronal cell death. Despite Beclin 1 association with autophagy and apoptosis, the molecular mechanisms that underlie Tau-induced vesicular pathology and Tau protein aggregates in humans remain poorly understood. Here, we set out to examine the role of three genes-ATG14L, Beclin 1 and VPS34- in autophagy nucleation failure-associated Tau disorders in fruit fly models. We found that either reduced ATG14L levels improve neuronal outcomes, or transgenic expression of ATG6/Beclin 1 greatly reduced age-dependent neurodegeneration and Tau pathology; whereas, the loss of Beclin 1 exacerbated these effects. Prior to p-Tau accumulation, the neuronal Beclin 1 network is critical for reducing p-Tau accumulation, indicating that the loss of Beclin 1 causes Tau pathology and neurodegeneration. As neurodegeneration progressed, glial cells showed an upregulation of vesicular Beclin 1 immunoreactivities. The reduced VPS34 also resulted in p-Tau accumulation, suggesting that neurons require both Beclin 1 and VPS34 to reduce p-Tau accumulation. Our results provide mechanistic insight into the molecular pathways that cause age-dependent Tau pathology and neurodegeneration due to an excess of autophagy nucleation processes and autophagy activity, and we derive novel inferences on the therapeutic possibilities of rebalanced Beclin 1 network by reducing autophagic specific nucleation component of ATG14L.

This study investigated the roles of low-molecular-weight fucoidan (LMWF) in enhancing the anti-cancer effects of fluoropyrimidine-based chemotherapy. HCT116 and Caco-2 cells were treated with LMWF and 5-FU. Cell viability, cell cycle, apoptosis, and migration were analyzed in both cell types. Potential mechanisms underlying how LMWF enhances the anti-cancer effects of fluoropyrimidine-based chemotherapy were also explored. The cell viability of HCT116 and Caco-2 cells was significantly reduced after treatment with a LMWF-5-FU combination. In HCT116 cells, LMWF enhanced the suppressive effects of 5-FU on cell viability through the 1) induction of cell cycle arrest in the S phase and 2) late apoptosis mediated by the Jun-N-terminal kinase (JNK) signaling pathway. In Caco-2 cells, LMWF enhanced the suppressive effects of 5-FU on cell viability through both c-mesenchymal–epithelial transition (MET)/ Kirsten Rat Sarcoma virus (KRAS)/ extracellular signal-regulated kinase (ERK) and c-MET/ phosphatidyl-inositol 3-kinases (PI3K)/ protein kinase B (AKT) signaling pathways. Moreover, LMWF enhanced the suppressive effects of 5-FU on tumor cell migration through the c-MET/ matrix metalloproteinase (MMP)-2 signaling pathway in both HCT116 and Caco-2 cells. Our results demonstrated that LMWF is a potential complementary therapy for enhancing the efficacies of fluoropyrimidine-based chemotherapy in colorectal cancers (CRCs) with the wild-type or mutated KRAS gene through different mechanisms. However, in vivo studies and in clinical trials are required to validate the results of the present study.

Huntington's disease (HD) is a progressive and fatal neurodegenerative disease caused by CAG repeat expansion in the coding region of huntingtin (HTT) protein. The accumulation of mutant HTT (mHTT) contributes to neurotoxicity by causing autophagy defects and oxidative stress that ultimately lead to neuronal death. Interestingly, epidemiologic studies have demonstrated that the prevalence of type-2 diabetes, a metabolic disease mainly caused by defective insulin signaling, is higher in patients with HD than in healthy controls. Although the precise mechanisms of mHTT-mediated toxicity remain unclear, the blockade of brain insulin signaling may initiate or exacerbate mHTT-induced neurodegeneration. In this study, we used an in vitro HD model to investigate whether neuronal insulin signaling is involved in mHTT-mediated neurotoxicity. Our results demonstrated that mHTT overexpression significantly impairs insulin signaling and causes apoptosis in neuronal cells. However, treatment with liraglutide, a GLP-1 analogue, markedly restores insulin sensitivity and enhances cell viability. This neuroprotective effect may be attributed to the contribution of the upregulated expression of genes associated with endogenous antioxidant pathways to oxidative stress reduction. In addition, liraglutide stimulates autophagy through AMPK activation, which attenuates the accumulation of HTT aggregates within neuronal cells. Our findings collectively suggest that liraglutide can rescue impaired insulin signaling caused by mHTT and that GLP-1 may potentially reduce mHTT-induced neurotoxicity in the pathogenesis of HD.

Background Successful treatment for patients with metastatic colorectal cancer who failed to response to first-line treatment has been a challenge due to their low response rate for later-line treatment and poor progression free survival and overall survival. The application of dendritic cell-cytokine-induced killer cells (DC-CIK) immunotherapy combined with conventional treat-ment, either surgical resection or chemotherapy, showed improvement in survivals in first-line treatment for metastatic colorectal cancer. In this retrospective study, we aimed to evaluate the benefit of dendritic cell-cytokine-induced killer cells (DC-CIK) immunotherapy for patient with refractory metastatic colorectal cancer. Methods A total of 20 patients with refractory metastatic colorectal cancer receiving cell-cytokine-induced killer cells (DC-CIK) immunotherapy were enrolled to this study. Among these patients, 11 patients responded to the treatment and the remaining 9 patients did not. All patients were followed for at least one years and the determination of treatment response was mainly based on image study at 6 months after the completion of treatment. Data were analyzed with Kaplan-Meier method and log-rank test. Results The treatment response rate of the study group is 55% (11/20). The median progression free sur-vival (PFS) and median overall survival (OS) of responsive patients was 7 months and 12 months, respectively. The median overall survival of irresponsive patients was 9.5 months. Four responsive patients received subsequent metastectomy or cytoreduction plus hyperthermic in-traperitoneal chemotherapy surgery (CRS + HIPEC). Conclusion DC-CIK cell-based immunotherapy may provide benefits for patients with refractory mCRC with improved response rate and progression free survival.

General Linear Modelling (GLM) has been widely employed to estimate the hemodynamic changes evoked by cognitive processing, which are more likely to be nonlinear than linear. First, this study re-analyzed the fNIRS data (N = 38, Mage = 5.0 years, SD = 0.69 years, 17 girls) collected in the Mixed-Order Design Dimensional Change Card Sort (DCCS) task. The results indicated that the quadratic equation was better than GLM to model HbO changes in this task. Second, analysis of a new set of data indicated that the Habit-DisHabit design of DCCS was more effective in identifying the neural correlates of cognitive shifting than the Mixed-Order Design. Third, this study found that the Non-users were more attentive and engaged than the Heavy-users, with a slower but more steady increase of brain activation in BA8 and BA9.

This study aims to examine the impact of tablet use on preschoolers’ executive function during the Dimensional Change Card Sort Task (DCCS) task using the functional near-infrared spectroscopy (fNIRS). Altogether 38 Chinese preschoolers (Mage = 5.0 years, SD = 0.69 years, 17 girls) completed the tasks before the COVID-19 lockdown. Eight children never used tablets, while 16 children were diagnosed as the ‘heavy-user'. The results indicated that: (1) the 'Non-user' outperformed the 'Heavy-user' with a significantly higher correct rate in the DCCS task; (2) the two groups differed significantly in the activation of the prefrontal cortex (BA 9): the 'Non-user' pattern is normal and healthy, whereas the 'Heavy-user' pattern is not normal and needs further exploration.

This study proposes an image recognition method to assist swine farm managers in collecting health data related to pig feeding and excretion. Analyzing the correlation between sow health data and indoor air quality in the pigsties revealed significant influences of air quality indicators on sow health. Increased levels of TVOC, CO2, and temperature were found to negatively affect feeding health, while increased temperature, humidity, and PM10 were found to negatively impact excretion health. These findings provide a basis for evaluating variables when constructing future sow disease prediction models. Analyzing the correlation between pig health status and air quality can help swine farm managers improve sow production environments, reduce disease risks, enhance production efficiency, and provide valuable insights for future research on disease prediction models.

Performance of the overhead squat may affect golf swing mechanics associated with golf-related low back pain. This study investigates the difference in lumbar kinematics and joint loads during the golf downswing between golfers with different overhead squat abilities. Based on the per-formance of the overhead squat test, 21 golfers aged 18 to 30 years were divided into the highest-scoring group (HS, N=10, 1.61 ± 0.05 cm, and 68.06 ± 13.67 kg) and lowest-scoring group (LS, N=11, 1.68 ± 0.10 cm, and 75.00 ± 14.37 kg). Data collection used a motion analysis system, two force plates, and TrackMan. OpenSim software was used to simulate the joint loads for each lum-bar joint. An independent t-test was used for statistical analysis. Compared to golfers demonstrat-ing limitations in the overhead squat test, golfers with better performance in the overhead squat test demonstrated significantly greater angular extension displacement on the sagittal plane, smaller lumbar extension angular velocity, and smaller L4-S1 joint shear force. Consequently, the overhead squat test is found to be a useful index to reflect lumbar kinematics and joint loading patterns during the downswing, and provides a good training guide reference for reducing the risk of a golf-related low back injury

(1) Background: This study aimed to explore how prolonged mask use during the COVID-19 pandemic affected appearance anxiety; (2) Methods: It implemented a quantitative–qualitative mixed-research approach based on a convenience sample of young people in Taiwan; (3) Results: A total of 1,118 participants completed the online questionnaire. A total of 49 participants reached the 55-point threshold of Appearance Anxiety Scale. Higher score of appearance anxiety was correlated to higher state anxiety statistically (r = 0.4, p < 0.001). Ten participants were interviewed and qualitative content analysis revealed 5 main themes and 16 subthemes. Three of the main themes were related to the positive effects of wearing masks for pandemic prevention and reducing appearance anxiety: “Wearing masks indicates compliance with the epidemic prevention requirement,” “Wearing masks functions as protection against lack of confidence in appearance,” and “Wearing masks helps mitigate the fear of being judged by others.” The remaining two “Wearing masks shifts attention from appearance to figure” and “Prolonged mask wearing exacerbates the anxiety about taking it off” were related to the impacts of long-term mask use; (4) Conclusions: results enhance understanding of negative emotional experiences and anxiety related to physical appearance.

Xinjiang, as a climate-sensitive region in northwest China, holds significant importance in studying extreme weather events for agricultural production and socioeconomic development. Based on data from 52 meteorological stations and 23 extreme climate indicators in Xinjiang from 1960 to 2021, the 5a moving average, linear trend estimation, climate tendency rate, and GIS spatial analysis methods are used to analyze the distribution and change characteristics of extreme climate. The results revealed that from 1960 to 2021, TXx, TNx, TXn, TNn, FD, ID, TN10p, TX10p, and WSDI showed a significant upward trend, while SU, TR, TN90p, TX90p, and CSDI showed a significant downward trend. What is more, the range of changes in the extreme temperature indexes from 1990 to 2021 is higher than that of 1960 to 1989. The high-value areas of extreme indexes are primarily concentrated in the northern part, while the high-value areas of cold event indexes are mainly distributed in the southern part. The upward/downward trends all accounting for over 80.00% of the entire region. The Rx1day, Rx5day, PRCPTOT, R95p, R99p, R10, R20, and R25 showed a significant growth trend from 1960 to 2021, and the range of change in the extreme precipitation indexes from 1990 to 2021 was lower than that from 1960 to 1989. Moreover, their high-value areas and high climate tendency areas are mainly concentrated in the northern and western parts of Xinjiang, with upward trends all accounting for over 71.00% of the entire region. The research results provide theoretical foundations for formulating climate risk strategies in the northwest region of China.

Chronic obstructive pulmonary disease (COPD) patients are particularly susceptible to respiratory infections like influenza, which exacerbate symptoms and increase healthcare utilization. While smoking cessation and influenza vaccination are recommended preventive measures, their combined impact on healthcare resource utilization is underexplored. The Charlson Comorbidity Index (CCI) assesses comorbidity burden in COPD patients and may influence healthcare outcomes. We conducted a retrospective analysis of 357 COPD patients, evaluating smoking cessation success over one year and influenza vaccination receipt, stratifying patients by CCI scores. Healthcare utilization outcomes included emergency room visits, hospitalizations, and medical expenses. Results showed that 51.82% of patients quit smoking and 59.66% received influenza vaccination, with higher comorbidity prevalence in advanced COPD stages (p=0.002). Both smoking cessation and influenza vaccination independently correlated with decreased emergency room visits, hospital admissions, days, and costs. Patients who both quit smoking and received influenza vaccination exhibited the lowest healthcare utilization rates. In conclusion, smoking cessation and influenza vaccination significantly reduce healthcare resource utilization in COPD patients, with the combination yielding synergistic benefits, particularly in those with lower CCI scores. Integrating these interventions and comorbidity management in COPD strategies is essential for optimizing patient outcomes and healthcare efficiency.

A fast and effective determination method of different species of vegetable seeds oil is vital in the plant oil industry. The near-infrared reflectance spectroscopy (NIRS) method was developed in this study to massively analyze the oil and moisture contents of Camellia gauchowensis Chang and C. semiserrata Chi seeds kernels. In the prediction models of NIRS, the levels of accuracy obtained were sufficient for C. gauchowensis Chang and C. semiserrata Chi, the correlation coefficient of which oil were 0.983 and 0.962, respectively, while which of moisture were 0.937 and 0.907, respectively. The near infrared spectrum of crush seeds kernels was more precise compared to intact kernels. Based on the calibration models of the two Camellia species, the NIRS predictive oil contents of C. gauchowensis Chang and C. semiserrata Chi seeds kernels were 48.71 ± 8.94% and 31.71 ± 7.39%, respectively, and the NIRS predictive moisture contents were 4.39 ± 1.08% and 3.49 ± 0.71%, respectively. Compared with the traditional chemical measurement, the rapid, precise measurement of oil and moisture of C. gauchowensis Chang and C. semiserrata Chi seeds kernels can be actualized by NIRS method.

Antibiotic-loaded bone cement (ALBC) plays a pivotal role in infection prevention and treatment related to musculoskeletal surgery. The release efficacy of antibiotics from ALBC is closely tied to its surface area, yet little is known about the effective release depth. To investigate the relationship between surface area, volume, and antibiotic elution, spheric ALBC specimens with consistent outer diameters but different internal metal sphere diameters were prepared. Two vancomycin doses were utilized in ALBC specimens with an outer diameter of 35 mm: high (4 g) and low (1 g). Each dosage group included five specimens containing embedded metal spheres with diameters of 15, 25, 29, 32, or 33 mm. The resulting shell-like ALBC specimens had thicknesses of 10 mm, 5 mm, 3 mm, 1.5 mm, or 1 mm, respectively. The specimens were immersed in sterile phosphate buffer solution, and antibiotic elution was measured at designated sampling times (1, 3, 6, 10, 24, 48, 72, and 168 hours). Methylene blue was employed to visualize penetration depth. Vancomycin elution did not display statistically significant differences between high- and low-dose groups. In both groups, specimens with 1 mm thickness exhibited a higher vancomycin release efficiency (high-dose group: 18560±5474 μg, 6.7%; low-dose group: 2017±419 μg, 2.6%), decreasing sharply in thicker ALBC specimens. Methylene blue penetration depth showed no apparent difference between high-dose and low-dose groups. ALBC thickness does not significantly impact antibiotic elution, while surface area and antibiotic dose exert notable effects. These in vitro findings offer potential applications in clinical treatments for musculoskeletal infections.

This study reports rapid hydrolysis, acylation, and lipolysis with lipase B from Candida antarctica (CalB) and nanofructosome encapsulated CalB (CalB@NF) enzymes immobilized on silica-coated magnetic nanoparticles (Si-MNPs). Enzymatic hydrolysis was confirmed for conversion to p-nitrophenol (p-NP, λex=400 nm) from p-nitrophenyl butyrate (p-NPB, λex=270 nm), and various catalytic parameters such as Km, Vmax, and Kcat were calculated from Michaelis-Menten and Lineweaver-Burk plot. Efficiency of enzymatic hydrolysis was in the order of CalB > Si-MNPs@CalB > CalB@NF > Si-MNPs@CalB@NF, and reusability was much better with the enzyme immobilized on Si-MNPs than with the native enzyme. Enzymatic acylation was confirmed by the formation of benzyl benzoate (λex=229 nm) from benzoic anhydride (λex=240 nm), and efficiency exceeded 99% in all samples. Finally, enzymatic lipolysis was confirmed by the decomposition of olive oil to fatty acid such as oleic acid (λex=230 nm) using thin-layer chromatography (TLC), column chromatography, and proton nuclear magnetic resonance (1H -NMR). The lipases immobilized on Si-MNPs have the advantage of good thermal stability and reusability and are thus applicable to a wide range of industries.

The log interpretation and evaluation of Chang 8 tight sandstone reservoir in Longdong West area, Ordos Basin, is facing great challenges due to the existence of low resistivity contrast oil pays. To better guide the exploration of oil resources in this area, the characteristics and control mechanism of low resistivity contrast oil pays were studied in this research. Firstly, according to the relative value of apparent resistivity increase rate of the target formation, the reservoir was divided into two types: low resistivity contrast oil pay (LRCP) and high resistivity oil pay (HRP). Then, the reservoir characteristics were studied by comparing and analyzing the experimental data, formation water data and logging data collected from the two reservoir types. On this basis, the control mechanism of LRCP was studied and summarized into reservoir micro factors and regional macro factors, respectively. It is found that the reservoir rock composition between LRCP and HRP is basically the same. Compared with HRP reservoir, the average porosity and permeability of LRCP reservoir are relatively better, but the pore structure is relatively poorer because of the high content of micro pores. When the filling pressure of crude oil is sufficient enough, the high oil saturation can be formed in LRCP reservoir. The high irreducible water saturation and high formation water salinity are the main micro factors reduced the reservoir resistivity. Besides, the difference of hydrocarbon expulsion capacity of source rock and the regional difference of formation water salinity are the macro factors influenced the distribution of LRCP and HRP from vertical and horizontal of the region. The formation of LRCP is controlled by the comprehensive influence of reservoir micro factors and regional macro factors. And the comprehensive consideration of the influence of micro factors and macro factors on LRCP is suggested during the log interpretation and evaluation.

In this paper, we consider a reconfigurable intelligent surface (RIS)-assisted integrated satellite-high altitude platform-terrestrial networks (IS-HAP-TNs) that can improve network performance by exploiting HAP's stability and RIS's reflection. Specifically, the reflector RIS is installed on the side of HAP to reflect signals from the multiple ground user equipments (UEs) to the satellite. To aim at maximising system sum rate, we jointly optimize the transmit beamforming matrix at the ground UEs and RIS phase shift matrix. Due to the limitation of the unit modulus of the RIS reflective elements constraint, the combinatorial optimization problem is difficult to tackle it effectively by traditional solving methods. Based on this, this paper studies deep reinforcement learning (DRL) algorithm to achieve online decision making for this joint optimization problem. In addition, it is verified through simulation experiments that the proposed DRL algorithm outperforms the standard scheme in terms of system performance and execution time, and higher computing speed, making real-time decision making truly feasible。

In Taiwan, mountainous areas account for approximately two-thirds of the total area. The steep terrain and concentrated rainfall during typhoons cause landslides, which pose a considerable threat to mountain settlements. Therefore, models for analyzing rainfall-induced landslide hazards are urgently required to ensure adequate land use in mountainous areas. In this study, focusing on Pingtung County in southern Taiwan, we developed a landslide hazard index (IRL) to land use. Using FORMOSA-2 and SPOT-5 satellite images, data were collected before and after four typhoons (one in 2009 and three in 2013). The ArcGIS random tree classifier was used for interpreting satellite images to explore surface changes and disasters, which were used to analyze slope disturbances. The product of the maximum 3-h rolling rainfall intensity and effective accumulated rainfall was used as a rainfall trigger index (IRT). Considering environmental and slope disturbance factors, an index of slope environmental strength potential (ISESP) was developed through logistic regression (LR). Landslide hazard to land use was estimated using IRT and ISESP. The average coefficient of agreement (Kappa) was approximately 0.71 (medium to high accuracy); the overall accuracy of slope environmental strength potential analysis was approximately 80.4%. At a constant ISESP, IRT increased with the increasing hazard potential of rainfall-induced landslides. Furthermore, IRT and ISESP were positively correlated with landslide occurrence. When large ISESP values occur (e.g., fragile environment and high land development intensity), small IRT values may induce landslides.

Bat feces were reported in ancient Chinese medicine books to have the effect of reducing heat and improving eyesight, but the mechanism of vision improvement still needs further research. To this end, we used 2,2-diphenyl-1-picrylhydrazyl (DPPH) and liquid chromatography/tandem mass spectrometry (LC/MS/MS) to analyze the antioxidant capacity of and the types of vitamins in bat feces. We hoped to screen the pharmacological components of bat feces, and to explain the role that these components may play in the treatment of visual deterioration. Our results found that bat feces had a good antioxidant capacity and mainly contain vitamins B1 (thiamine), B2 (riboflavin), B3 (nicotinamide), B3 (nicotinic acid), and B5 (pantothenic acid). Although these vitamins may help maintain the health of the optic nerve and cornea, the vitamin content of bat feces is low, but the heavy metal content is high, as shown using inductively coupled plasma mass spectrometry (ICP-MS) analysis. Therefore, we suggest that the use of bat feces as traditional Chinese medicine to improve vision should be strictly restricted.

Zinc cobalt oxide-zinc hydroxide (ZnCo2O4-Zn(OH)2) microspheres were successfully fabricated on carbon cloth via a sample hydrothermal method. The surface morphology of these microspheres and their efficacy in degrading methyl violet were further modulated by varying the thermal annealing temperatures. The manipulation of thermal annealing temperatures was pivotal in adjusting the porosity of ZnCo2O4-Zn(OH)2 microspheres to amplify their photocatalytic performance. Various analytical techniques were utilized to evaluate the physical and chemical properties of the ZnCo2O4-Zn(OH)2 microspheres, including field-emission scanning electron microscopy, energy-dispersive spectroscopy, X-ray diffraction, field-emission transmission electron microscopy, X-ray photoelectron spectroscopy, and UV-vis spectroscopy. Compared to untreated ZnCo2O4-Zn(OH)2 microspheres, those subjected to thermal annealing exhibited increased specific surface area and light absorption capacity, rendering them highly effective photocatalysts under UVC light exposure. Subsequent studies have confirmed the superior performance of ZnCo2O4-Zn(OH)2 microspheres as a reusable photocatalyst for degrading methyl violet and tetracycline. Additionally, trapping experiments during the photodegradation process involving ZnCo2O4-Zn(OH)2 microspheres have identified hydroxyl radicals (·OH) and superoxide radicals (·O2–) as the primary reactive species.

Cadmium(Cd) is a highly toxic and cumulative environmental pollutant. Siderophores are heavy metal chelators with high tolerance to heavy metals such as Cd. Furthermore, ryegrass (Lolium perenne L.) has potential remediation capacity for soils contaminated by heavy metals. Consequently, using ryegrass alongside beneficial soil microorganisms that produce siderophores may be an effective means to remediate soils contaminated with Cd. In this study, Bacillus strains WL1210 and CD303 that were previously isolated from the rhizospheres of Nitraria tangutorum in Wulan and Peganum harmala L in Dachaidan, respectively, both arid sandy environments, were evaluated for heavy metal pollution mitigation. The results indicate that both strains of Bacillus exhibit favorable biological characteristics and stress resistance, and they are both producers of siderophores, which promote the growth of ryegrass under Cd stress.

Our image recognition system mainly judges whether the left upper limb in the image is the left upper limb or the right upper limb through our deep learning model in the image. The doctor then could give the correct surgical position. From the experimental results, it could be found that the precision rate and recall rate of the intelligent image recognition system proposed in this paper for preventing the upper limb dislocation surgery could reach 98% and 93%, respectively. It proved that our artificial intelligent image recognition system, AIIRS, could indeed assist orthopedic surgeons to prevent the occurrence of left and right dislocation in upper limb surgery. At the same time, this paper also completes the IRB application approval through the prototype experimental results and will conduct the second phase of human trials in the future. It showed that the research results of this paper will be of great benefit and research value to upper limb orthopedic surgery.

Our image recognition system mainly judges whether the left upper limb in the image is the left upper limb or the right upper limb through our deep learning model in the image. The doctor then could give the correct surgical position. From the experimental results, it could be found that the precision rate and recall rate of the intelligent image recognition system proposed in this paper for preventing the upper limb dislocation surgery could reach 98% and 93%, respectively. It proved that our intelligent image recognition system could indeed assist orthopedic surgeons to prevent the occurrence of left and right dislocation in upper limb surgery. At the same time, this paper also completes the IRB application approval through the prototype experimental results and will conduct the second phase of human trials in the future. It showed that the research results of this paper will be of great benefit and research value to upper limb orthopedic surgery.

(1) Background: Proximal humerus fractures can be a debilitating condition if not properly treated. These fracture patterns are varied and differ in every patient. Functional outcomes may be determined by the integrity of the shoulder girdle involving the rotator cuff insertion. The post-operative resorption or malreduction of the greater tuberosity is an important factor contributing to the poor functional outcome of a patient. (2) Methods: A single-center retrospective comparative study was performed to evaluate the functional outcomes of patients undergoing operative fixation for this injury. A total of 387 consecutive cases treated operatively from 2019-2021 were included for analysis. (3) Results: 94 cases fulfilled our criteria for analysis. A matched-group comparison of 19 patients each was performed to compare demographics, post-operative fracture characteristics and functional outcomes. (4) Conclusions: The resorption or malreduction of the greater tuberosity contributes greatly to the prognostic outcome in patients treated with ORIF surgery. In our demographic study, obesity is another contributing factor affecting the parameters of post-operative reduction in proximal humerus fractures. Appropriate surgical planning and post-operative multidisciplinary care must be taken into consideration to attain a satisfactory prognostic outcome.

Background: Hypoalbuminemia is known to be associated with adverse outcome in critical illness. In this study, we attempted to identify if hypoalbuminemia on emergency department (ED) arrival a reliable predictor for in-hospital mortality in necrotizing fasciitis (NF). patients. Method: A retrospective cohort study of hospitalized patients with NF was conducted in a tertiary teaching hospital in Taiwan between March 2010 and March 2018. Blood samples were collected in the ED upon arrival, and serum albumin levels were determined. we evaluated the predictive value of serum albumin level at ED presentation for in-hospital mortality. All collected data were statistically analyzed. Result: Of the 707 NF patients, 40 (5.66%) died in the hospital. The mean serum albumin level was 3.1 ± 0.9 g/dL and serum albumin levels were significantly lower in the non-survivor group than in the survivor group (2.8± 0.7 g/dL vs. 3.5 ± 0.8 g/dL). In the multivariable logistic regression model, albumin was associated with in-hospital mortality significantly (odds ratio[OR] 0.92, 95% confidential interval (CI) 0.88–0.96, P <0.001). The area under-the-receiver-operating-characteristic curve (AUC) for in-hospital survival was 0.77 (95% CI 0.72–0.82) and corresponding sensitivity, specificity, positive predictive value, negative predictive value, positive and negative likelihood ratio were 66%, 74%, 33%, 88%, 2.25 and 0.48, respectively. High sensitivity (96%) was shown at albumin level of 4.0 g/dL and high specificity (91%) was shown at level of 2.5 g/dL. Conclusion: Initial serum albumin levels were independently associated with in-hospital mortality among adult patients with necrotizing fasciitis and demonstrated fair discriminative performance in the prediction of in-hospital mortality. NF patients with hypoalbuminemia on ED arrival should be closely monitored for signs of deterioration and consider early and aggressive intervention to prevent mortality.

Heterosis plays a significant role in enhancing variety, boosting yield, and raising economic value, but the molecular mechanism is still unclear. We analyzed the transcriptomes and 3D genomes of hybrid (F1) and its parents (w30 and 082). Analysis of the expression revealed a total of 485 specially expressed genes (SEGs), 173 differentially expressed genes (DEGs) above parental expression level, more actively expressed genes and up-regulated DEGs in F1. Further study revealed that the DEGs detected in F1 and its parents were mainly involved in response to auxin, plant hormone signal transduction, DNA metabolic process, Purine metabolism, starch and sucrose metabolism, which suggested that these biological processes may play a crucial role in the heterosis of B. rapa. The analysis of 3D genome data revealed that hybrid F1 tend to contain more transcriptionally active A compartments after hybridization. Additionally, F1 had a smaller TAD (topologically associated domain) genome length, but the number was the highest, and the expression change of activated TAD was higher than repressed TAD. More specific TAD boundaries were detected between parents and F1. Subsequently, 140 DEGs with genomic structural variants were selected as potential candidate genes. Among them, we found two DEGs with consistent expression changes in A/B compartments and TADs. Our findings suggest that genomic structural variants, such as TADs and A/B compartments, may affect gene expression and contribute to heterosis in B. rapa. This study provides further insight into the molecular mechanism of heterosis in B. rapa.

In kidney, epithelial barrier has diverse functions in body fluid and electrolyte homeostasis, and urine production. Maintaining epithelial integrity fundamentally builds up physiological functionality of the renal epithelial barrier (REB). Specially, the REB) states regularly in osmotic dynamics. The osmotic dynamics gives rise of osmotic pressure that is a physical force. Overloading of osmotic pressure can crack epithelial integrity and damage REB. How REB endures the osmotic pressure force yet remains enigmatic. LMO7 (LIM domain only 7) is a protein associated with cell-cell junctional complex and cortical F-actin. LMO7 upregulation was observed in cells cultured in hypertonic condition. In kidney, LMO7 predominantly distributes in epithelial cells in renal tubules. Hypertonic stimulation leads to assembly of LMO7 and F-actin in cortical stress fibers in renal epithelial cells. Hypertonic-isotonic alternation as pressure force pushing plasma membrane inward/outward was set as osmotic disturbance and was applied to test FAK signaling and LMO7 functioning in maintaining junctional integrity. Along with junctional integrity, LMO7 depleted cells resulted in loss of junctional integrity in the epithelial sheet cultured hypertonic medium or hypertonic-isotonic alternation. On the other hand, FAK inhibited by PF-573228 leads to failure in robust cortical F-actin assembly and association of LMO7 with cortical F-actin in epithelial cells responding upon hypertonic stress. Epithelial integrity in context of osmotic stress, LMO7 and FAK signaling both involves in assembling robust cortical F-actin and maintaining junctional integrity. The LMO7 elaborately manages FAK activation in renal epithelial cells, which was evidently demonstrated in NRK-52E cells who have excessive FAK activation and lost epithelial integrity when cells with LMO7 depletion exposed to hypertonic environment. Our data suggests that LOM7 manages FAK activation and is responsible for maintaining REB under osmotic disturbance.

In early 2020 from April to early June, the metropolitan area of Sydney as well as the rest of New South Wales (NSW, Australia) experienced a period of lockdown to prevent the spread of Covid-19 virus in the community. The effect of reducing anthropogenic activities including transportation had an impact on the urban environment in term of air quality which is shown to have improved for a number of pollutants, such as nitrogen dioxides (NO2) and carbon monoxide (CO), based on monitoring data on ground and from satellite. Besides primary pollutants CO and NOx emitted from mobile sources, PM2.5 (primary and secondary) and secondary ozone (O3) during the lockdown period will also be analysed using both air quality data and modelling method. The results show that NO2, CO and PM2.5 levels decreased during the lockdown, but O3 instead increased. The change in the concentration levels however are small considering the large reduction in traffic volume of ~30%. By estimate the decrease in traffic volume in Sydney region, the corresponding decrease in emission input to the WRF-CMAQ (Weather Research and Forecasting - Community Multiscale Air Quality Modeling System) air quality model is then used to estimate the effect of lockdown on the air quality especially CO, NO2, O3 and PM2.5 in the Greater Metropolitan Region (GMR) of Sydney. COVID-19 lockdown period is an ideal case to study the effect of motor vehicle and mobile source contribution to air pollutants such as those listed above in the GMR.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Globally increasing antibiotic resistance has been connected to the use of antibiotics in medical, veterinary, and agricultural medicine, contributing to the burden of antibiotic resistance in Asia and Europe. The main objective of this study was to correlations of antimicrobial-resistant of various pathogens in three compartments: humans, animals and the environment in India and Germany. A systematic search was carried out in Medline via PubMed, Google Scholar, and science direct, including studies published in 2022. Out of 532 papers, 24 were considered for meta-analysis. This study reveals that in India, β-lactam is highly resistant in animals. Quinolone, on the other hand, was highly resistant in humans. Furthermore, in the environment and integrated studies, aminoglycosides and β-lactams is resistant. While in Germany, a high rate of AMR resistance in all three sectors was reported in β-lactam. However, E. coli was the most frequent pathogen in both countries and is highly resistant to β-lactam, followed by cephalosporin in all the compartments. Monitoring and evaluating antibiotic-sensitivity patterns and developing proper antibiotic regimens may lead to improved outcomes for inhibiting and controlling E. coli infections in various parts of the world.

The objective of this work is to analyze the improvement of heat transfer in trapezoidal fin heat exchangers using numerical simulation. Heat exchangers are essential components frequently used in contemporary electronic gadgets to effectively disperse heat produced by high-power components. Nevertheless, as electronic devices continue to advance and become more powerful, the heat transfer capacity of heat exchangers is facing more requirements, therefore requiring enhanced heat dissipation efficiency. Afterwards, various fin angles were adjusted, and the heat transmission efficiency was compared. Modifying the angles can significantly improve the effi-ciency of convective heat dissipation. Moreover, it has been found that employing an optimized trapezoidal fin structure can further enhance the efficiency of heat transfer. The results indicate that trapezoidal fin heat exchangers provide superior heat dissipation efficiency compared to conventional heat exchangers. This is important for enhancing the thermal dissipation capabili-ties of electrical gadgets, hence guaranteeing steady functionality and extending their longevity. Subsequent study might explore supplementary methods to boost heat transmission in different heat exchanger configurations in order to meet the growing requirements for heat dissipation.

In response to the increasing energy demand in Taiwan and the global trend of renewable energy development, Kuroshio energy is a potential energy source. How to extract this invaluable natural resource has then become an intriguing and important question in engineering practices. This study conducted a study for a nozzle-diffuser duct (NDD) as the Kuroshio currents energy harvester. The computational fluid dynamics (CFD) software ANSYS Fluent was employed to calculate the drag and added mass coefficients of the duct anchored to the seabed. Those coefficients were further imported into Orcaflex to simulate the motion of the duct under normal and storm wave conditions. Results showed that the duct was stable 25 m below the sea surface under normal wave condition. When the wave condition changed to storm waves, the duct needed to dive into at least 90 m below the sea surface to regain its stability and obtain high power take-off (PTO). An optimal design nozzle-diffuser-duct was reported and a PTO peak of 15 kW was expectable in the Kuroshio currents. Once a suitable offshore platform can be developed with sixty-six NDDs, a Megawatt Kuroshio ocean current power generation system is feasible in the near future.

The allocation of funding for higher education typically focuses on competition in neoliberal mechanisms. Surprisingly, much less attention has been paid to considering the effect of fund locations for sustainable development through public goods purposes in neoliberal contexts. This study aims to examine specific funding schemes and determine the influential factors impacting funding for teaching, research, and public goods transformation. Taking Taiwan's Higher Education Sprout Project (HESP) as an example, we explored the effect of policy initiatives on public goods transformation towards sustainable development. The data were collected from the Ministry of Education and Scopus databases. First, a regression analysis was conducted to determine which factors influence the effect of funding allocations in academic institutes. Second, we used logistic regression to detect the effects of the system and the sector. Third, we used partial least square structural equation modeling (PLS-SEM) to explore the causal effects among the selected impact variables on expected outcomes. Finally, we used the bootstrap method to demonstrate the model’s robustness. Our study found that only diversity was shown in private technology groups receiving less HESP funding. At the same time, it did not widen the differences in the sector and system in the transformation process. Our findings suggest that funding allocations will not affect teaching and research based on sectors and systems. In contrast, this study demonstrates that transforming public goods through special funding can play a critical role in leading sustainable development in higher education.

Ginkgolic acids (GA) have been reported to exhibit anticancer properties, however, the mechanisms remain unclear. This study aims to investigate the mechanisms of GA C13:0 that was isolated from Ginkgo biloba exocarp (GBE) for anti-proliferation, pro-apoptosis and anti-migration effects in human MCF-7 and mouse 4T-1 breast cancer cells. The cytotoxic effect, apoptosis induction and migration inhibition were measured using MTT, TUNEL and Wound healing assays. The expression of mRNA and protein were determined using qPCR and Western blot. Our results showed that no cytotoxicity was found at concentrations of C13:0 below 100µM. The effects of GA C13:0 was further demonstrated by up-regulation of the Bax/Bcl-2 apoptosis pathway and the expression of Apaf-1 protein in the mitochondria. In addition, GA C13:0 also suppressed cell migration and epithelial to mesenchymal transition (EMT) with the increase of E-cadherin expression accompanied by the decrease of Snail, MMP-2, MMP-9 and Vimentin expression. Moreover, GA C13:0 induced cytochrome P450 (CYP) 1B1 expression in aryl hydrocarbon receptor (AhR) pathway. Notably, the up-regulation of CYP1B1 also might play a pivotal regulatory role in mitochondrial and EMT pathways in MCF-7 and 4T-1 cells. Our results may have implications for the development of anticancer agents containing GA as functional additives.

This article provides a thorough overview of biomarkers, pathophysiology, and molecular pathways involved in the transition from acute kidney injury (AKI), acute kidney disease (AKD) to chronic kidney disease (CKD). It categorizes the biomarkers of AKI into stress, damage, and functional markers, highlighting their importance in early detection, prognosis, and clinical application. The pathophysiological mechanisms underlying AKI, AKD, including renal hypoperfusion, sepsis, nephrotoxicity, and immune responses, with the impact on renal injury. In addition, various molecules play pivotal roles in inflammation and hypoxia, triggering maladaptive repair, mitochondrial dysfunction, immune system reactions, and cellular senescence of renal cell. Key signaling pathways, such as Wnt/β-Catenin, TGF-β/SMAD, and Hippo/YAP/TAZ, promote fibrosis and impact renal function. The Renin-Angiotensin-Aldosterone System (RAAS) triggers a cascade leading to renal fibrosis, with aldosterone exacerbating oxidative stress and cellular changes that promote fibrosis. Clinical evidence suggests RAS inhibitors may protect against CKD progression, especially post-AKI, though more extensive trials are needed to confirm their full impact.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

Abstract. Graphene family (GF)-Calcium phosphate (CaP) composites, holds great potential as components of bone regeneration materials. GF nanomaterials can be modified physically as well as chemically, which are to be biomimetic, mechanically to be hard due to their capability to support exceptional mechanical, thermal and electronic properties. These biocompatible GF composites coated on the calcium phosphate can enhance and tolerate stem cell growth and differentiation, proliferation into various lineages or interact with bioorganisms. The development in CF-CaP materials and their physicochemical/biointeractions and strategies towards osteoblasts is a great concern to promote faster healing and reconstructions of large bone imperfections or defects. In this review, we explain the influence of the CF-CaP and summarize recent developments on designing CF-CaP architectures as multifunctional bone regeneration platforms. We have also explored the typical biological applications concerning these CF-CaP based bioactive nanocomposites. Furthermore, the future viewpoints and evolving challenges will also be emphasized. Due to the shortage of full-length reviews in this emerging research field, this review would be caught great attention and encourage various new chances across a wider range of disciplines.

In Southeast Asia, the Malayan Pit Viper (Calloselasma rhodostoma) is a venomous snake species of medical importance and bioprospecting potential. To unveil the diversity of its toxin genes, this study assembled and analyzed the de novo venom gland transcriptome of C. rhodostoma from Malaysia. The expression of toxin genes dominates the gland transcriptome by 53.78% of total transcript abundance (based on overall FPKM), in which 92 non-redundant transcripts belonging to 16 toxin families were identified. Snake venom metalloproteinase (SVMP, PI&gt;PII&gt;PIII) is the most dominant family (37.84% of all toxin FPKM), followed by phospholipase A2 (29.02%), bradykinin/angiotensinogen-converting enzyme inhibitor-C-type natriuretic peptide (16.30%), C-type lectin (CTL, 10.01%), snake venom serine protease (SVSP, 2.81%), L-amino acid oxidase (2.25%) and others (1.78%). The expressions of SVMP, CTL and SVSP correlate with hemorrhagic, anti-platelet and coagulopathic effects in envenoming. The SVMP metalloproteinase domains encode hemorrhagins (kistomin and rhodostoxin), while disintegrin (rhodostomin from P-II) is platelet-inhibitory. CTL gene homologues uncovered include rhodocytin (platelet aggregators) and rhodocetin (platelet inhibitor), which contribute to thrombocytopenia and platelet dysfunction. The major SVSP is a thrombin-like enzyme (ancrod homolog) responsible for defibrination in consumptive coagulopathy. The findings provide insight into the venom complexity of C. rhodostoma and the pathophysiology of envenoming.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

Entrepreneurship has been viewed as an opportunity for economic development and changing economic scenarios in global markets. Women are viewed as a reservoir of entrepreneurial talent, so they can be growth engines in novel markets. Previous studies have considered entrepreneurship as the most effective way towards the economic empowerment of women. Female students engaged in entrepreneurial education have been addressed persistently, while what transforms them in an education process is still unclear. Considering the transforming global economy and its influence on higher education, this study aims to detect female students transforming entrepreneurial competency, mindset, and intention into sustainable entrepreneurship. Using a self-compiled survey, we targeted 752 female students to investigate their entrepreneurial competency, mindset, and intention. SPSS and AMOS were used to transform the data for interpretation. We assumed that the impact of female students’ entrepreneurial competency could be modified by an entrepreneurial mindset and result in entrepreneurial intention. To detect this causal relationship, this study employed reliability, factor, structural equation modeling (SEM), and bootstrap-ping analyses to verify the evidence. The result of the SEM confirms that female students’ entrepreneurial competency will, through their entrepreneurial mindset, impact entrepreneurial intention. With bootstrapping, 5000 samples were collected, and it was demonstrated that the measure constructs were still reliable in the model. This study found that there is a mediation effect between entrepreneurial competency and entrepreneurial intention. The entrepreneurial mindset plays a crucial role in the transformation process. Without an entrepreneurial mindset, entrepreneurial competency cannot exert a significant effect on entrepreneurial intention. The findings can help reinvent related entrepreneurial education in higher education.

This study examined the relationship among the three domains of executive function (EF; cognitive shifting, inhibitory control, and working memory) to test the applicability of the unity-diversity model in preschoolers using both behavioral and fNIRS approaches. Altogether 58 Chinese preschoolers (34 boys, 24 girls, Mage = 5.86 years, SD = 0.53, Age range = 4.83-6.67 years) were administered the Dimensional Card Change Sort (DCCS), go/no-go, and missing scan task. Their brain activations in the prefrontal cortex during the tasks were examined using fNIRS. First, the behavioral results indicated that the missing scan task scores (working memory) correlated with the DCCS (cognitive shifting) and go/no-go tasks (inhibitory control). But the latter two did not correlate with each other. Second, the fNIRS results demonstrated that the prefrontal activations during the working memory task correlated with those in the same regions during the cognitive shifting and inhibitory control tasks. Still, the latter two did not correlate. The behavioral and neuroimaging evidence jointly indicates that the unity-diversity model of EF does apply to Chinese preschoolers.

We investigated whether post-exercise capsinoids (CSN) supplementation could enhance muscle glycogen resynthesis via GLUT4/Akt expressions in human skeletal muscle. Nine male college students (aged 21.4±0.2 years, BMI 21.9±1.3 kg/m2, VO2max 47.1±1.8 ml/kg/min) participated in this crossover designed study, and completed a 60-min cycling exercise at 70% VO2max. Immediately after exercise, participants consumed high-carbohydrate diet (2 g carb/kg bodyweight) with CSN (12 mg, single dosage) or placebo. Biopsied muscle samples (vastus lateralis) were obtained immediately (0h) and 3h after exercise. Blood and expired gas samples were collected before and after exercise. We found oral CSN supplementation immediately after exercise was unable to enhance glycogen resynthesis in exercised human skeletal muscle. Despite, CSN could alter the energy reliance on fat oxidation during post-exercise recovery, based on gaseous exchange measurement (NEFA and glycerol). We further identified no significant differences in postprandial glucose/insulin area under curve in both trials. Western blot data showed no significant response of p-Akt/Akt ratio with CSN during post-exercise recovery. Inconsistent with glycogen levels, muscle GLUT4 expression was significantly elevated at 3h in CSN trial. Our findings emphasize the necessity of further evidences to confirm the ergogenic properties of CSN in connection with glycogen recovery in exercised human skeletal muscle.