Coronavirus disease (COVID-19) is a new discovered strain where WHO officially declares the disease as COVID-19 while the virus responsible for it called Severe Acute Respiratory Syndrome Coronavirus 2 or SARS-CoV-2. The incubation period of this disease is between 14 days. Ordinary clinical symptoms that reported around the world include fever, cough, fatigue, diarrhoea and vomiting as well as asymptomatic for certain people. Infection is spread mainly through broad droplets. In early March 2020, WHO again has announced that COVID-19 is a pandemic with currently no specific treatment. The potential use of SARS-COV-2 proteome as a vaccine candidate by analysing through B-cell and T-cell antigenicity by using a immunoinformatics approach as a vaccine development early stage. In this study, we used consensus sequence for SARS-COV-2 proteome that was retrieved from NCBI database. VaxiJen 2.0 was mainly used to identify the antigenic property of SARS-COV-2 proteins. IEDB then used to analyse the B-cell epitope, the presence of T cell immunogenic epitope in SARS-COV-2 proteins was obtained by using compromise method of MHC class I and II tools that accessible respectively using ProPred-1 server and MHC II Binding Prediction in IEDB database. The best epitopes of B and T-cell epitopes were predicted with high antigencity and the information is disseminated through web-based database resource (https://covid-19.omicstutorials.com/epitopes/). This study will be useful to find a new epitope-based candidate for SARS-COV-2. However, further study needs to be done for the next stages of vaccine development.

Cisplatin-based chemotherapy has long been viewed as the first-line chemotherapy for advanced and metastatic urothelial carcinoma (UC). However, many patients with UC have been classified as “cisplatin-ineligible patient”, which requires alternative chemotherapy due to their poor responses. In fact, vast majority of those who initially responded to cisplatin-based chemotherapy eventually progressed. Understanding of UC tumor immunology provided an immunopathogenic bases for immune checkpoint inhibitors, targeting PD-1 and CTLA-4, to treat cisplatin ineligible metastatic UC and patients with platinum-refractory metastatic UC. In 2020, data from the trail further showed that PD-L1 inhibitors benefit prolonged survival and progression-free survival as maintenance therapy. Besides immune-targeting therapies, manipulation of tumor microenvironment via metabolic pathways alternation, such as inhibiting tumor glycolysis, lactate accumulation and exogenous glutamine uptake, has been investigated in the past few years. In this comprehensive review, we started by introducing traditional chemotherapy of UC, and summarized current evidences supporting the use of immune checkpoint inhibitors and highlighted ongoing clinical trials. Lastly, we reviewed the tumor metabolic characteristic and the anti-tumor treatments targeting metabolic pathways.

Coronavirus disease 2019 (COVID-19) is a global pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). To contain the virus, numerous preventive measures have been taken including isolation of patients, careful infection control, social distancing, and taking vaccine. So far, new confirmed and death cases are still increasing. SARS-CoV-2 invades cells by using the angiotensin converting enzyme 2 (ACE2). ACE2 is an essential enzyme of the renin-angiotensin system (RAS) which converts angiotensin II (Ang II) to angiotensin (1-7). ACE2 is expressed in different organs, including lung, heart, and kidney. A high number of COVID-19 patients developed kidney injury has been reported. Renal impairment and acute injury are associated with mortality of COVID-19, which is 14-16 times higher than other general patients. Acute Kidney Injury has been occured in 2.9 up to 43% of intensive care unit patients. The increasing evidence show that the components of RAS can activate the complement cascade, and cytokines production. Kidney injury caused by SARS-CoV-2 is related mainly to systemic and local inflammation. Moreover, the uncontrolled immune responses mediated by SARS-CoV-2 including hypercytokinaemia, secondary hemophagocytic lymphohistiocytosis, antibody dependent enhancement, complement system, and phagocytic cells activation can contribute in the virus pathogenesis leading to associated renal dysfunction. However, the role and crosstalk between of RAS components and immune response in mediating kidney injury remain undefined. In this review, we focus on the recent studies to provide the pathogenesis of SARS-CoV-2 interacting with RAS and immune responses to mediate kidney injury.

As of July 7, 2022, the total number of confirmed cases caused by COVID-19 has reached 544,324 million, and the total number of 6.333 million deaths (WHO). Older people were globally the most vulnerable during the pandemic. This paper examined the mortality and psychological crisis of older people during the pandemic in four cities, namely Wuhan, Milan, London, and Hong Kong. The selection of cities was based on different degrees of social connectedness of older people and chronologically to cover the whole period of the outbreak from January 2020 to August 2022. Older people in Milan and Wuhan tended to rely on the close family relationship during times of crisis. Meanwhile, older people in Hong Kong and London were more dependent on social services. Both quantitative and qualitative approaches were employed to analyze the situations of older people under different government responses and the strengths and weaknesses of respective healthcare systems. Government reports and official statistics were used to illustrate the seriousness of each city's COVID-19 outbreak while stories reported by the press, NGOs, and journal articles were used to reflect the reactions of the older people. Interactions of social culture, health care provisions, and government responses to the pandemic were discussed from the perspective of health welfare regimes. On one hand, results showed that governments have not learned from the experiences of other countries. On the other hand, older people have not successfully coped with the life-threatening stress by breaking institutional boundaries and redefining cultural norms.

For Convolutional Neural Network (CNN), Depthwise Separable CNN (DSCNN) is a preferred architecture for Application Specific Integrated Circuit (ASIC) implementation on edge devices. It can benefit from a multi-mode approximate multiplier proposed in this work. The proposed approximate multiplier uses two 4-bit multiplication operations to implement a 12-bit multiplication operation by reusing the same multiplier array. With this approximate multiplier, sequential multiplication operations are pipelined in a modified DSCNN to fully utilize the PE array in the convolutional layer. This Approximate (A-DSCNN) was implemented on TSMC 40-nm CMOS process with a supply voltage of 0.9 V. At the clock frequency of 200 MHz, the design achieves 4.78 GOPs/mW while occupying 1.24 mm x 1.24 mm silicon area. Compared to conventional DSCNN implemented in a similar process node, the chip area and power consumption were reduced by 53% and 25%, while the throughput was improved by 17%.

This study was conducted to evaluate the feasibility of applying a two-step biological treatment process, solid-state anaerobic digestion (SSAD) and black soldier fly larvae (BSFL) composting, for treating dairy cattle manure. Biogas from SSAD of dairy cattle manure, and the digestate of SSAD was fed to BSFL. In turn, BSFL can be fed to animals as a protein supplement. Adjustment of pH and 30% inoculation ratio (IR₃₀) during SSAD produced the highest theoretical methane yield, 626.1±28.7 L CH₄/kg VS_des, with an ultimate methane yield of 96.81±2.0 L CH₄/kg VS_load. For BSFL composting, the groups with a feeding rate of 75 and 100 mg/day/larvae had the highest body weight change, which was 969.6±28.4 and 984.1±177.6%, respectively. The combination process of SSAD and BSFL composting increases the incentive for dairy cattle manure treatment enabled higher waste removal efficiency, and produced more valuable products.

This article aims to explore the existence and stability of solutions to differential equations involving a regularized ψ−Hilfer fractional derivative, which, compared to standard ψ−Hilfer fractional derivatives, provide a clear physical interpretation when dealing with initial conditions. We discovered that the regularized ψ−Hilfer fractional derivative can be represented as the inverse operation of the ψ−Riemann–Liouville fractional integral, and used this property to prove the existence of solutions for linear differential equations with a regularized ψ−Hilfer fractional derivative. Additionally, we applied the Mönch’s fixed-point theorem and knowledge of non-compactness measures to demonstrate the existence of solutions for nonlinear differential equations with a regularized ψ−Hilfer fractional derivative, and further discussed Ulam-Hyers-Rassias stability and semi-Ulam-Hyers-Rassias stability of these solutions. Finally, we illustrated our results through case studies.

Juvenile idiopathic arthritis (JIA) is a disease with unknown causes within all forms of arthritis in children under 16 years of age. The diagnosis is made when another joint pathology is excluded. Difficulties in early and differential diagnosis lead to the rapid disability of patients and an unfavourable life prognosis. Therefore, timely diagnosis is necessary to prevent irreversible damage to the joints and preserve their function. Due to the widespread use of new technologies, modern multimodal imaging has gained recognition, which includes X-ray, ultrasound, and MRI. The combination of methods plays a key role in confirming the diagnosis, monitoring disease activity, prognosis during the course, and outcome in children with JIA. Each method has its own advantages and disadvantages. The introduction of the method of passive microwave radiometry (MWR), in combination with other imaging methods, makes it possible to expand the possibilities of screening the disease in the preclinical and early clinical phases.

A rigid protruding surface, agitator and vortex generator often dissipate more energy than to produce a satisfied turbulence production. In contrast, a passively-oscillating flexible protruding surface has the ability in generating greater turbulence level. In the current study, a circular finite cylinder (cantilever) was used as the geometry of the rigid and protruding surface. They were varied through the aspect ratio (AR) and materials. Also, a local Reynolds number within the subcritical flow range (102<ReD<105) was considered. The results from the rigid protruding surface (finite cylinder) is served as a validation to the published results and benchmark to the improve-ment of the turbulence generated by the flexible protruding surface. It was mentioned in the pre-vious work that the increment of turbulence production by the flexible cylinder is speculated to be oscillation, this work investigates the validity of the speculation through manipulating the struc-tural stiffness of the flexible cylinder by employing different materials. The results have further demonstrated that the flexible cylinder is capable of generating a greater turbulence through the examination of turbulence intensity, turbulence production term and Reynolds stress. All the flex-ible cylinders that oscillate show increment in turbulence production but at a different percentage. The cylinders studied in this work ranged from the least structural stiffness (EVA), moderate (al-uminium) to the highest structural stiffness (carbon steel). Through studying the normalized am-plitude responses graph of the flexible cylinder, it is identified that the oscillating motion does in-deed contribute to increment. A further investigation into the results, it is found that the factor which governs the increment is the structural velocity instead of just oscillating motion alone.

A highly-integrated experimental system for plasma decomposition of fuels was built. Experiments were conducted and confirmed that macromolecular chain hydrocarbons were cracked by large-gap dielectric barrier discharge under the excitation of a microsecond-pulse power supply. Alkanes and olefins with a C atom number smaller than 10 as well as hydrogen were found in the cracked products of n-decane (n-C10H22). The combination of preheating and plasma decomposition had strong selectivity for olefins. Under strong discharge conditions, micromolecular olefins were found in the products. Moreover, there was a general tendency that micromolecular olefins gradually accounted for higher percentage of products at higher temperature and discharge frequency.

The development of a method to produce coumarins unsubstituted on the pyranic nucleus catalyzed from Wells–Dawson heteropolyacid (H₆P₂W₁₈O₆₂), phenol derivatives and ethyl 3,3-diethoxypropionate using Pechmann condensation under solvent-free conditions is described. This catalytic method was also applied successfully to synthesize various substituted coumarins, including the corresponding phenols and ethyl 3,3-diethoxypropionate. This work provides a novel, cheaper and safer way to syhthesize coumarins unsubstituted on the pyranic nucleus.

Zero-rate output (ZRO) drift induces deteriorated micro-electromechanical system (MEMS) gy-roscope performances, severely limiting its practical applications. Hence, it is vital to explore an effective method toward ZRO drift reduction. In this work, we conduct an elaborate investigation on the impacts of the internal and packaging stresses on the ZRO drift at the thermal start-up stage, and propose a temperature-induced stress release method to reduce the duration and magnitude of ZRO drift. Self-developed high-Q dual mass tuning fork gyroscopes (TFGs) are adopted to study the correlations between temperature, frequency and ZRO drift. Furthermore, a rigorous finite element simulation model is built based on the actual device and packaging structure, revealing the temperature and stresses distribution inside TFGs. Meanwhile, the relationship between temperature and stresses are deeply explored. Moreover, we introduce a temperature-induced stress release process to generate thermal stresses and reduce the temperature-related device sensitivity. By this way, the ZRO drift duration is drastically reduced from ~2000 s to ~890 s, and the drift magnitude decreases from ~0.4 °/s to ~0.23 °/s. This stress release method achieves a small bias instability (BI) of 7.903 °/h and a low angle random walk (ARW) of 0.792 °/√h, and the long-term bias performance is significantly improved.

Permeability has an important effect on drug absorption. In this study, the effect of different concentrations of sodium sulfobutyl ether-β-cyclodextrin (SBE-β-CD) on the absorption of ranitidine was investigated to examine the mechanism of permeability changes. The results of parallel artificial membrane permeability assay (PAMPA) showed that increasing the concentration of sodium sulfobutyl ether-β-cyclodextrin, 0, 0.12% (w/v), 0.36% (w/v) and 3.6% (w/v), respectively, the apparent permeability coefficient of ranitidine decreased to 4.62×10-5 , 4.5×10-5 , 3.61×10-5 and 1.08×10-5 in Caco-2 cells, respectively. The same results were obtained from oral pharmacokinetic study in rats; Further studies indicated that SBE-β-CD significantly increased the zeta potential of ranitidine. SBE-β-CD interacted with ranitidine charges to form a complex that reduced ranitidine permeability, and SBE-β-CD should be chosen with caution for drugs with poor permeability.

This paper investigates the cooperative anti-jamming distributed channel selection problem in UAV communication networks. Considering the existence of malicious jamming and co-channel interference, a location-aware cooperative anti-jamming scheme is designed for the purpose of maximizing the users' utilities. Users in the UAV group cooperate with each other via location information sharing. When the received interference energy is lower than mutual interference threshold, users conduct channel selection strategies independently. Otherwise, users take joint actions with a cooperative anti-jamming pattern under the impact of mutual interference. Aimed at the independent anti-jamming channel selection problem under no mutual interference, a Markov Decision Process framework is introduced, whereas for the cooperative anti-jamming channel selection case under the influence of co-channel mutual interference, a Markov game framework is employed. Furthermore, motivated by reinforcement learning with a ``Cooperation-Decision-Feedback-Adjustment" idea, we design a location-aware cooperative anti-jamming distributed channel selection algorithm (LCADCSA) to obtain the optimal anti-jamming channel strategies for the users with a distributed way. In addition, the channel switching cost and cooperation cost, which have great impact on the users' utilities, are introduced. Finally, simulation results show that the proposed algorithm converges to a stable solution with which the UAV group can avoid the malicious jamming as well as co-channel interference effectively.

The chemopreventive effects of various mixed cereal grain (MCG) samples on azoxymethane (AOM, 10 mg/kg) and dextran sulfate sodium (DSS, 2% w/v)-induced colorectal cancer (CRC) in C57BL/6J mice were studied. The main MCG preparation consisted of fermented brown rice (FBR), glutinous brown rice, glutinous Sorghum bicolor, glutinous Panicum miliaceum, Coix lacryma-jobi and black soybean at an appropriate mixing ratio. Other MCG preparations contained rice coated with 5% Phellinus linteus and 5% Curcuma longa (MGR-PC), or 10% Phellinus linteus (MCG-P), or 10% Curcuma longa (MCG-C). Consumption of dietary MCG-PC by CRC mice significantly increased colon length, decreased the ratio of colon weight to length, and reduced the number of colon tumors. Similar effects, although to a lower extent, were observed in CRC mice fed with MCG-P, followed by those fed with MCG-C, MCG, FBR or white rice (WR). MCG-PC significantly suppressed colonic neoplasia, and decreased the levels of various cytokines (tumor necrosis factor: Tnf, interleukin 1 beta: Il1b, interleukin 6: Il6, and interferon gamma: Ifng) in serum and colon tissue of the CRC mice. In addition, MCG-PC increased the mRNA expressions of tumor protein p53(Tp53) and cyclin-dependent kinase inhibitor 1A(Cdkn1a), activated pro-apoptotic caspase 3(Casp3), and reduced expression of both mRNA and protein of inducible inducible nitric oxide synthase 2 (Nos2), prostaglandin-endoperoxide synthase 2 (Ptgs2), and cyclin D1(Ccnd1) in colon tissue. These findings suggest that than compared with other cereal grain preparations, MCG-PC had a greater activity against AOM/DSS-induced CRC by reducing intestinal inflammation, and modulating the expression of certain carcinogenesis related factors (Nos2, Ptgs2, Tp53, Cdkn1a, Ccnd1 and Casp3) in colon tissue of CRC mice.

Objectives: The aim of this study is to understand the rationale for the lack of interest to perform regular opportunistic oral cancer screening (OCS) by primary care providers (PCPs) and the challenges they have in incorporating OCS into their annual examination protocol. Method: Sequential exploratory mixed methods were used. Both qualitative and quantitative data from PCPs working at Nebraska Medicine were obtained. One-on-one in-depth interviews were performed to identify PCP's perceptions and challenges in performing OCS. The themes identified in the qualitative study were used as a guide in the development of survey questionnaires. The survey was emailed to all the PCPs (N=100), whose information was available on the Nebraska Medicine publicly accessible website. Results: The response rate was 34%. Approximately 60% of the participants mentioned that they currently perform oral cancer screening, but only 3.8% of the providers answered that they were performing comprehensive oral cancer screening every time. Forty-eight percent of the providers identified time as the biggest challenge. Over 35.3% of the providers answered that they perform screenings for patients with a history of tobacco (i.e., smoking) or alcohol use. Conclusion: Around half of the participants identified lack of time as their primary challenge in performing OCS and lack of knowledge as their second main obstacle. Very few provided comprehensive OCS and visual examination of the oral cavity is the only step performed often.

Cold brew coffee has emerged as a new trend during the last decade. However, “cold brew” is an extraction style of ground roasted coffee with water at less than body temperature (typically 8°C or room temperature) rather than a beverage per se. Cold brew extraction poses several challenges including the need of specific optimization depending on the multivariate influences of coffee variety and processing, roast degree, grinding, dosage, water composition, turbulence, brew system (drip, immersion etc.), time and temperature. While cold brew is typically characterized by a floral sweetness, over-extraction may lead to abundant acidity and bitterness. To avoid this, an extraction degree of 70% was suggested using rather shorter times (i.e. 2 h at 15°C with 80 g/L coffee with optimized medium roast profiles). Due to the lack of sterilizing temperatures during preparation, cold brew is special in the coffee sector because hygiene and food safety aspects pose specific challenges for food industry. To avoid microbiological contamination and spoilage, cold brew should be as freshly prepared as possible and shelf-life should be minimized.

An outbreak of occupational methanol poisoning occurred in small-scale 3rd tier factories of large-scale smartphone manufacturer, in the Republic of Korea, in 2016. To investigate the working environment and the health effect of the methanol exposure among co-workers of the methanol poisoning cases, we performed a cross sectional study on 155 workers at the five aluminum CNC cutting factories. Air and urinary methanol concentration were measured by gas chromatography, and health examination included symptoms, ophthalmological examinations and neurobehavioral tests. Multiple logistic regression analyses controlled for age and sex were conducted for revealing association of employment duration with symptoms. Air concentrations of methanol in factory A and E were ranged from 228.5 to 2220.0 ppm. Mean urinary methanol concentrations of the workers in each factory were from 3.5 mg/L up to 91.2 mg/L. The odds ratios for symptom of deteriorating vision and CNS increased, according to the employment duration, after adjusting for age and sex. Four cases with injured optic nerve and two cases with decreased neurobehavioral function were founded among co-workers of the victims. This study showed that the methanol exposure under poor environmental control not only produce eye and CNS symptoms but also affect neurobehavioral function and optic nerve.

We study L_2-approximation problems in the weighted Hilbert spaces in the worst case setting. Three interesting weighted Hilbert spaces appear in this paper, whose weights are equipped with two positive parameters $\ga_j$ and $\az_j$ for $j=1,\,2,\dots,\,d$. We consider the worst case error of algorithms that use finitely many arbitrary continuous linear functionals. We discuss the exponential convergence-(t,s)-weak tractability (EC-(t,s)-WT) of these L_2-approximation problems under the absolute or normalized error criterion. In particular, we obtain the sufficient and necessary conditions for EC-(1,1)-WT and EC-(t,1)-WT with t

Although the relations between sleep and academic performance have been extensively examined, how sleep predicts future academic performance (e.g., 2 -3 years) remains to be further investigated. Using wearable smartwatches and a self-report questionnaire, we tracked sleep activities of 45 college students over a period of approximate half a month to see whether their sleep activities predicted their academic performance, which was estimated by grade point average (GPA). Results showed that both nighttime sleep awakening frequency and its consistency in the tracking period were not significantly correlated with the GPA for the courses taken in the semester during sleep tracking (current GPA). However, both nighttime sleep awakening frequency and its consistency inversely predicted the GPA for the rest of the courses taken after that semester (future GPA). Moreover, students with more difficulty staying awake throughout the day obtained lower current and future GPAs, and students with lower inconsistency of sleep quality obtained lower future GPA. Together, these findings highlight the importance of nighttime sleep awakening frequency and consistency in predicting future academic performance and emphasize the necessity of assessing the consistency of sleep measures in future studies.

Tuning fork gyroscopes (TFGs) are promising for potential high-precision applications. This work proposes and experimentally demonstrates a novel high-Q dual mass tuning fork microelectro-mechanical system (MEMS) gyroscope utilizing three-dimensional (3D) packaging techniques. Except for two symmetrically-decoupled proof masses (PM) with synchronization structures, a symmetrically-decoupled lever structure is designed to force the antiparallel, antiphase drive-mode motion and basically eliminate the low-frequency spurious modes. The thermoelastic damping (TED) and anchor loss are greatly reduced by the linearly-coupled, momentum- and torque-balanced antiphase sense mode. Besides, a novel 3D packaging technique is used to realize high Q-factors. A composite substrate encapsulation cap, fabricated by through-silicon-via (TSV) and glass-in-silicon (GIS) reflow processes, is anodically bonded to the sensing structures at wafer scales. A self-developed control circuit is adopted to realize loop control and characterize gyro-scope performances. It is shown that a high-reliability electrical connection together with a high-air-impermeability package can be fulfilled with this 3D packaging technique. Furthermore, the Q-factors of the drive and sense modes reach up to 51947 and 49249, respectively. This TFG realizes a wide measurement range of ±1800° /s and a high resolution of 0.1° /s with a scale-factor nonlinearity 720 ppm after automatic mode-matching. Besides, the long-term zero-rate output (ZRO) drift can be effectively suppressed by temperature compensation, inducing a small angle random walk (ARW) of 0.923°/√h and a low bias instability (BI) of 9.270°/h.

With the development of designing and manufacturing level for micro-electromechanical system (MEMS) gyroscopes, the control circuit system becomes a key point to determine their internal performances. Nevertheless, phase delay of electron components may result in some serious hazards. This paper describes a real-time circuit phase delay correction system for MEMS vibratory gyroscopes. A detailed theoretical analysis is provided to clarify the influences of circuit phase delay on the in-phase and quadrature (IQ) coupling characteristics and zero rate output (ZRO) utilizing force-to-rebalance (FTR) closed-loop detection and quadrature correction system. By deducing the relationship between amplitude-frequency, phase-frequency of MEMS gyroscope and the phase relationship of the whole control loop, a real-time correction system is proposed to automatically adjust the phase reference value of phase-locked loop (PLL) and thus compensate for the real-time circuit phase delay. The experimental results show that the correction system can accurately measure and compensate the circuit phase delay in real time. Furthermore, the unwanted IQ coupling can be eliminated and the ZRO is decreased by 755% to 0.095°/s. This correction system realizes a small angle random walk of 0.978°/√h, and a low bias instability of 9.458°/h together with a scale factor nonlinearity of 255 ppm at room temperature. Besides, the thermal drift of ZRO is reduced to 0.0034°/s/°C at a temperature range from -20°C to 70°C.

In aerospace, robotics, network engineering and mechanical engineering, there exist complex and urgent challenges that can be abstracted into mathematical optimization problems. Therefore, exploring solutions to these optimization problems is a crucial task. Metaheuristic algorithms have been applied across various fields.The Snake Optimization Algorithm (SO) is an innovative metaheuristic method recognized for its efficient solving capabilities.However, this algorithm encounters challenges such as diminished search efficiency in the later stages and a propensity to become ensnared in local optima. To mitigate these issues, this paper introduces an enhanced Snake Optimization Algorithm (ISO). ISO integrates the RIME Algorithm(RIME)and introduces two effective enhancement strategies to improve its capability to evade local optima.To assess the effectiveness of ISO,the population distribution state was first measured using three algorithms, including Star Discrepancy, and the exploration and exploitation performance was analyzed using the CEC2017 test functions. Subsequently, utilized 23 benchmark functions for testing.The evaluation outcomes indicate that ISO exhibits outstanding performance in terms of convergence velocity and robustness.Additionally, it was applied to engineering fields including UAV path planning,Robot path planning, Wireless sensor network node deployment and Pressure vessel design.In comparison to the SO algorithm, the ISO algorithm demonstrates superior stability, converges earlier, and improves its ability to solve for optimal .These findings highlight the significant potential of the ISO algorithm in diverse test functions and a wide range of interdisciplinary problems.

The EXO+ hip protector was developed to minimize the risk of hip fractures in seniors following falls. This study evaluated its usability in a Singapore nursing home from the perspective of staff, focusing on Learnability, Efficiency, and Satisfaction. A mixed-method design was employed, with nursing home residents wearing the EXO+ daily for 8 weeks. Quantitative data on wear time was collected alongside qualitative insights from four repeated focus group discussions with care staff. In total, 15 residents (including 8 residents with cognitive impairments) and 9 staff participated. The analysis revealed six themes and fourteen subthemes related to EXO+’s usability. Residents wore the device for an average of 1.54 hours per day, with those having cognitive impairments showing increased wear times, especially in the mornings and on weekdays. Findings indicated that the EXO+ was learnable and satisfactory for nursing home use, provided there are adequate supporting features. The efficiency of the EXO+ was not fully measured since no falls were reported during the study period. The study offers valuable insights for potential design modifications and workflow adaptations to enhance the implementation of hip protectors in healthcare settings, highlighting facilitators and barriers to support device uptake.

Sensory descriptive analysis was used to evaluate the aged Feng-flavored baijiu. The results indicated that there are notable differences in the samples of different ages. The samples with shorter storage times and fresh distilled Baijiu present bran flavor, and fresh green flavor. with the increase of storage time, the fragrance of honey, sweetness, flowers, and aging gradually increases. The samples of Feng-flavored baijiu were dected by Headspace solid-phase microextraction (HS-SPME) combined with comprehensive two-dimensional gas chromatography time-of-flight mass spectrometry (GC×GC–TOFMS) , in total, 496 sustances were identified in all samples, mainly containing 14 types of substances, such as esters, aldehydes etc., of which 42 substances were found in Feng-flavored baijiu for the first time. Chemometrics was used to analyze the key differential compounds. 143 differential compounds closely related to aging were preliminarily screened, and principal component analysis revealed that these samples were separated by year. 65 differential compounds were selected out by partial least squares discriminant analysis(PLS-DA). Furthermore, 43 key differential compounds were selected from the aged Feng-flavored baijiu combined with variable importance in projection and Pearson correlation coefficients. Partial least squares regression (PLSR) was used to research the correlation of sensory properties and key differential compounds, and the results indicated that most compounds were closely related to the aged Baijiu . This study afford theoretical basis and reference for flavor research of Feng-flavored baijiu.

Plants do need a fixed proportion of carbon (C), nitrogen (N) and phosphorus (P) elements to maintain normal metabolic activities. The P fertilizers are widely used to supplement nutrients in subtropical plantations. Stoichiometric homeostasis reflects the strategy of plants to cope with various environments (including P fertilizer supply rate). It is thus of great significance to understand C:N:P stoichiometry in the plant-litter-soil system under P addition and stoichiometric homeostasis of plant tissues for fertilization management of slash pine (Pinus elliottii Engelm) plantations. We measured the C, N and P contents in root, branch, needle, litter and soil in slash pine plantations fertilized with four treatments - P1 (25 kg P ha−1 yr−1), P2 (50 kg P ha−1 yr−1), P3 (100 kg P ha−1 yr−1), and a control (CK) in subtropical China and calculated stoichiometric homeostasis of plant tissues. Results showed that P addition increased the capacity of needle to obtain C, N and P elements and altered the C:N:P stoichiometry of plant tissues, as well promoted the accumulation of C and P elements in soil, but had no significant effect on soil stoichiometry. The nutrient contents of needle and branch were higher than those of root and litter, indicating that slash pine was more inclined to allocate nutrient to the aboveground tissues. The stoichiometric homeostasis of C, N and P among plant tissues was ranked as follows: root > branch > needle, and homeostasis of nutrient elements in the needle was C > N > P. This indicated that the C, N and P stoichiometric homeostasis was various among plant tissues and elements types under P addition. These findings suggest P addition would alleviate the P limitation of slash pine growth in subtropical regions. In the future, long-term observation experiments should be conducted and the trade-off between P addition rates and economic and ecological benefits should be considered.

Peroxydisulfate activation has garnered a lot of interest due to its benefits of broad adaptability, strong anti-interference ability, and powerful oxidation capacity. Due to their low cost and potent action, carbon materials are new green catalysts that have garnered interest. In order to effectively degrade organic contaminants in water by activating peroxydisulfate, carbon compounds are currently commonly used. Better metal ions for activating peroxydisulfate include Fe2+ and Co2+, and these metal ions can be encapsulated in carbon compounds made by calcinating metal organic framework（MOFs ）as precursors. The synthesis of carbon compounds from MOF precursors as well as their effectiveness and mechanism in reducing organic pollutants in peroxydisulfate systems. The following are the specific research contents: NH2-MIL-101 (Fe/Co) bimetallic MOFs material was synthesized by hydrothermally altering the Fe3+ to Co2+ ratio, followed by the carbonization of Fe/Co-CNs. XRD, SEM, TEM, FT-IR, and XPS were used to analyze the materials' morphology, structure, and chemical make-up. The results demonstrate that Fe/Co-CNs-2 (Co2+ doping concentration approaches 20%) has a stable three-dimensional carbon structure and effectively incorporated Co ions into the carbon material. The simultaneous encapsulation of both Fe and Co metals by the three-dimensional carbon skeleton ensures material stability and reaction activity. Tetracycline hydrochloride was reported to degrade more quickly in Fe/Co-CNs-2 than in other Co2+ doping concentrations within 30 minutes of peroxymonosulfate（PMS） activation. The degradation rate of Fe/Co-CNs-2 for 20 mg/L TC was determined to be 93.34% within 30 minutes under the following conditions: Fe/Co-CNs-2 concentration of 0.1 g/L, PMS concentration of 0.2 g/L, and pH of 7.33. The catalyst also demonstrates good stability. Last but not least, the Fe/Co-CNs-2 free radical quenching experiment revealed that singlet oxygen (1O2) is the primary active species in the reaction system, and a potential mechanism was examined by combining degradation and XPS analysis.

Pasmo is one of the most widespread diseases threatening flax production. To identify genetic regions associated with pasmo resistance (PR), a genome-wide association study was performed on 370 accessions from the flax core collection. Evaluation of pasmo severity was performed in the field from 2012 to 2016 in Morden, MB, Canada. Genotyping-by-sequencing has identified 258,873 single nucleotide polymorphisms (SNPs) distributed on all 15 flax chromosomes. Marker-trait associations were identified using ten different statistical models. A total of 692 unique quantitative trait nucleotides (QTNs) associated with 500 putative quantitative trait loci (QTL) were detected from six phenotypic PR datasets (five individual years and average across years). Different QTNs were identified with various statistical models and from individual PR datasets, indicative of the complementation between analytical methods and/or genotype × environment interactions of the QTL effects. The single-locus models tended to identify large-effect QTNs while the multi-loci models were able to detect QTNs with smaller effects. Among the putative QTL, 67 had large effects (3-23%), were stable across all datasets and explained 32-64% of the total variation for PR in the various datasets. Forty-five of these QTL spanned 85 resistance gene analogs including a large toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (TNL) type gene cluster on chromosome 8. The number of positive effect QTL (NPQTL) in accessions was significantly correlated with PR (R²=0.55), suggesting additive effects. NPQTL was also significantly associated with morphotype (R²=0.52) and major positive effect QTL were present in the fiber type accessions. The 67 large effect QTL are suited for marker-assisted selection and the 500 QTL for effective genomic prediction in PR molecular breeding.

The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.

While being a workaholic supervisor may be viewed as admirable due to their commitment to work, existing findings on its effects on subordinates are mixed. Drawing upon the principle learning perspective and activation theory, we propose a curvilinear relationship between supervisor workaholism and subordinate job performance and investigate the moderating role of subordinate social-related social media usage. Specifically, we suggest that subordinate job performance increases (decreases) as supervisor workaholism increases from low (moderate) to moderate (high) levels and that this inverted U-shaped relationship becomes flatter when subordinates have higher social-related social media usage. The results, based on a multi-source survey collected from 321 supervisor-subordinate dyads, support the predictions. Our research moves beyond linear thinking and suggests that there exists an optimal level of supervisor workaholism that maximizes subordinate job performance. We also provide insights into the ongoing debate and potential ethical concerns surrounding whether employees should use social media at work. Implications for practice and future research are discussed.

The utilization of Artificial Intelligence (AI) in biotechnology is widespread, addressing challenges such as elucidating disease pathophysiology and novel therapeutic approaches. AI plays a critical role in tasks such as drug manufacturing, chemical analysis, RNA and DNA sequencing, and enzyme studies by automating processes and expediting data collection and analysis. AI has particularly transformed the analysis of omics data for researchers, providing tools to handle complex and multifaceted datasets effectively. Through AI, integrative analysis of multi-omics data can be conducted in efficient ways. This article discusses the application of multi-omics and AI technologies in studying various diseases related to infection (COVID-19), mutation (cancer), and senescence (alopecia) to understand their pathophysiology. The applications of AI were performed as the aspect of the diagnosis, prognosis, and treatment for each disease. We introduce AI-driven analysis of pathophysiology can overcome traditional limitations in pathology, with diverse features showing potential in defining the causes of diseases, and potentially enhancing primary omics data in the distinguish the subtype of diseases. In this context, integrated approaches using multi-omics data and AI technology could provide fresh biological insights by comprehending the molecular mechanism of diseases and is instrumental in advancing precision medicine. We anticipate that the rapidly advancing AI-based multi-omics data analysis will significantly contribute to promoting healthy longevity.

Disposal and treatment of excess sludge is a huge problem in waste water treatment plants. Discharge plasma oxidation is an effective approach for sludge dewatering and digestion. In this study, the excess sludge disintegration by non-thermal discharge plasma coupled with thiosulfate (TSA) was investigated. The soluble chemical oxygen demand (SCOD) increased to 404.93 mg L-1 after 20 min of single discharge plasma treatment, and it further increased to 549.08 mg L-1 after adding 15 mmol L-1 of TSA; the water content of filter cake also further decreased in the presence of TSA. There existed an appropriate TSA dosage. In the discharge plasma coupled with TSA system, reactive oxygen species (·OH and ·O2-) were produced and played important roles in sludge disintegration. The addition of TSA promoted the production of ·OH. These reactive oxygen species destroyed the floc structures and promoted the transformation of organic substances, leading to reduction in average size of sludge flocs. The ratio of soluble extracellular polymer substances (S-EPS) was enhanced, while the ratio of tightly bound fraction was reduced after treatment. Thus, discharge plasma coupled with TSA promoted the lysis of microbial cells and released intracellular organic matter and bound water, finally improving sludge dewaterability.

Pasmo (Septoria linicola) is a fungal disease causing major losses in seed yield and quality, and stem fibre quality in flax. Pasmo resistance (PR) is quantitative and has low heritability. To improve PR breeding efficiency, the accuracy of genomic prediction (GP) was evaluated using a diverse worldwide core collection of 370 accessions. Four marker sets, including three defined by 500, 134, and 67 previously identified quantitative trait loci (QTL) and one of 52,347 PR-correlated genome-wide single nucleotide polymorphisms, were used to build ridge regression best linear unbiased prediction (RR-BLUP) models using pasmo severity (PS) data collected from field experiments performed during five consecutive years. With five-fold random cross-validation, GP accuracy as high as 0.92 was obtained from the models using the 500 QTL when the average PS was used as the training dataset. GP accuracy increased with training population size, reaching values >0.9 with training population size greater than 185. Linear regression of the observed PS with the number of positive-effect QTL in accessions provided an alternative GP approach with an accuracy of 0.86. The results demonstrate the GP models based on marker information from all identified QTL and the 5-year PS average is highly effective for PR prediction.

The vibration signal of the engine contains strong background noise and many kinds of modulating components, which is difficult to diagnose. Variational mode decomposition (VMD) is a recently introduced adaptive signal decomposition algorithm with a solid theoretical foundation and good noise robustness compared with empirical mode decomposition (EMD). VMD can effectively avoid endpoint effect and modal aliasing. However, VMD cannot effectively eliminate the random noise in the signal, so the random decrement technique is introduced to solve the problem. Based on the crankshaft bearing fault simulation experiment, the four kinds of wear state vibration signals are decomposed by VMD, and the modal components with smaller permutation entropy are selected as fault components. Then the fault component is processed by the random decrement technique, and the Hilbert envelope spectrum of the fault component is obtained. Compared with the fault feature extraction method based on EMD and EEMD, the feature extraction results of the proposed method are better than those of the above two methods. The simulation analysis and the simulation test of the crankshaft bearing fault verify the effectiveness of the proposed method.

Detecting and monitoring changes in soil salinity through remote sensing provides an opportunity for field assessment in regions where on-site measurements are limited. This investigation, carried out in Siwa Oasis, Egypt, aimed to assess the efficacy of several soil salinity indices derived from Landsat 5 and 7 satellite images. To achieve this, 56 on-site ground measurements were utilized for evaluation purposes. The study aimed to improve the correlation between EC and index values and explore the relationship between salinity and changes in land cover. Eleven spectral indices were calculated for nine scenes captured in different months from August to December. The first approach involved stacking the data to identify the index with the strongest correlation with ground EC values, without the need for complex analysis or EC value ranging. In the second approach, the ground EC measurements were classified into seven different salinity categories, and the correlation coefficient was calculated between each index and each salinity category. The third approach analyzed the data temporally, considering different salinity levels. Lastly, a spatial correlation analysis was conducted between EC and index values in the fourth scenario. The initial approach revealed a weak correlation due to substantial variation in EC values. However, the SI index demonstrated the highest correlation coefficient of 0.38. In the second scenario, the S2 index exhibited the highest correlation of 0.96 for moderate salinity samples. The third scenario showed that the S1 index achieved the highest correlation value of 0.99 for moderately saline areas. In the fourth scenario, the SI index exhibited the strongest correlation among all four ponds with correlation coefficients of 0.23, 0.23, 0.18, and 0.61. Notably, the correlations observed in the second and third scenarios demonstrated higher correlation coefficients compared to both the first and fourth scenarios. The study highlighted significant variations in EC levels related to land cover types and pond elevation. Additionally, remote sensing methods detected a 48% increase in total vegetated area over 17 years, showing the potential of remote sensing techniques in salinity monitoring for expanding agriculture and improving land management.

Outliers seriously affect the accuracy in geometric model fitting. Previous works in coping with outliers involve threshold selection and scale estimation. However most scale estimators suppose the inlier distribution as a Gaussian model, which usually poorly meets the cases in geometric model fitting. Outliers, considered as the points with big residuals to all the true models, share common items with big values in quantized residual preferences, thus making the outliers gather away from the inliers in quantized residual preference space. In this paper we make use of this outlier consensus in quantized residual preference space by extending the usage of energy minimization to combine the model error and the spatial smoothness in quantized residual preference space for outlier detection. The energy minimization based outlier detection process follows an alternate sampling and labeling framework. After the outlier detection, an ordinary energy minimization method is employed to optimize the inlier labels, which also follows the framework of alternate sampling and labeling. The experimental results in this study show that the energy minimization based outlier detection method can detect most of the outliers in the data. Furthermore, the proposed energy minimization based inlier segmentation process segments the inliers into different models quite accurately. Overall, the performance of the proposed method is better than most of the state-of-the-art methods.

A genome-wide association study (GWAS) was performed on a set of 260 lines which belong to three different bi-parental flax mapping populations. These lines were sequenced to an averaged genome coverage of 19× using the Illumina Hi-Seq platform. Phenotypic data for 11 seed yield and oil quality traits were collected in eight year/location environments. A total of 17,288 single nucleotide polymorphisms were identified, which explained more than 80% of the phenotypic variation for days to maturity (DTM), iodine value (IOD), palmitic (PAL), stearic, linoleic (LIO) and linolenic (LIN) acid contents. Twenty-three unique genomic regions associated with 33 QTL for the studied traits were detected, thereby validating four genomic regions previously identified. The 33 QTL explained 48-73% of the phenotypic variation for oil content, IOD, PAL, LIO and LIN but only 8-14% for plant height, DTM and seed yield. A genome-wide selective sweep scan for selection signatures detected 114 genomic regions that accounted for 7.82% of the flax pseudomolecule and overlapped with the 11 GWAS-detected genomic regions associated with 18 QTL for 11 traits. The results demonstrate the utility of GWAS combined with selection signatures for dissection of the genetic structure of traits and for pinpointing genomic regions for breeding improvement.

Digital technology makes energy systems more dynamic, efficient, reliable and sustainable. Promoting the digital governance of renewable energy is not only a key part of energy transformation, but also an important initiative to cope with the global energy crisis, which provides a new impetus for realizing the goal of net-zero emissions. In order to achieve the "dual-carbon" goal, China has been actively promoting energy reform and enhancing the wide application of digital technologies in the development and utilization of renewable energy. The digital governance system and governance capacity of renewable energy is an important support for the modernization of the national governance system and governance capacity. Although the digital governance of renewable energy in China has better policy support and advantages, the dilemmas it faces are still relatively prominent, including unsound laws and policies, insufficient governance capacity, and security loopholes in digital technology, etc. Therefore, this paper proposes a problem-oriented approach to the digital governance of renewable energy. Therefore, this paper puts forward problem-oriented optimization suggestions to innovate the legal system of renewable energy digital governance, promote the digital transformation of China's renewable energy industry, provide development space for renewable energy digital governance in a diversified mode, and enhance the digital governance capacity by improving the renewable energy security system.

Currently, urban renewal activities in China are booming. And promoting the renovation of public buildings is the key due to its large scale, high cost and significant impact to the nature and social environment. To reduce the ambiguity and uncertainty in evaluating the potential for renewal of existing public buildings, a renewal potential evaluation model combining game theory combination weighting method and cloud model theory is proposed. The paper constructs a comprehensive evaluation index system based on relevant standards and literature. Game theory is used to optimize the weights obtained by AHP and entropy weight methods to obtain a combined weight. MATLAB programming is used to calculate the comprehensive cloud parameters of the evaluation index for the potential renewal of existing public buildings and therefore generate cloud Graphs. Through case study in Nanjing of China, it has been demonstrated that the combination empowerment cloud model can objectively reflect the relationship between the fuzziness and randomness of evaluation indicators for public building renewal potential. The expression of cloud Graphs can intuitively reflect the magnitude of renewal and renovation potential and the degree of uncertainty in evaluation results. The research result provides useful references for the sustainable utilization of building resources in the era of building.

A simple fabrication method in the surface modification of electroosmotic silicon microchannel using thermal dry oxidation is presented. The surface modification is done by coating the silicon surface with a silicon dioxide (SiO₂) layer using thermal oxidation process. The process is aimed not only to improve the surface quality of the channel to be suitable for electroosmotic fluid transport but also to reduce the channel width using a simple technique. Initially, the parallel microchannel array with dimensions of 0.5 mm length and width ranging from 1.8 µm to 2 µm are created using plasma etching on the 2x2 cm <100> silicon substrate. The oxidation of silicon channel in a thermal chamber is then conducted to create the SiO₂ layer. The layer properties and the quality of the surface are analyzed using SEM and surface profiler, respectively. The results show that the maximum oxidation growth rate occurs in the first 4 hours of oxidation time and the rate decreases by time as the oxide layer becomes thicker. It is also found that the surface roughness is reduced with the increase of process temperature and oxide thickness. The scallop effect on the vertical wall due to plasma etching process also improved with the presence of the oxide layer. After the oxidation, the channel width is reduced by ~40%. The demonstrated method is suggested for the fabrication of a uniform channel cross section with high aspect ratio in sub-micro and nanometer scale that will be useful for the electroosmotic flow (EOF) manipulation of the biomedical fluid sample.

Pancreatitis and alcoholic pancreatitis are serious health concerns, and there is an urgent need for effective treatment strategies. Alcohol is a known etiological factor for pancreatitis, including acute pancreatitis (AP) and chronic pancreatitis (CP). Excessive alcohol consumption induces many pathological stress responses; of particular note is endoplasmic reticulum (ER) stress and adaptive unfolded protein response (UPR). ER stress results from the accumulation of unfolded/misfolded protein in the ER and is implicated in the pathogenesis of alcoholic pancreatitis. Here we summarize the possible mechanisms by which ER stress contributes to alcoholic pancreatitis. We also discuss potential approaches targeting ER stress and UPR for developing novel therapeutic strategies for the disease.

'Huangguan' pear has significant social and economic value, and phosphorus, as one of the three main mineral elements of plants, has an irreplaceable effect on the normal growth of 'Huangguan' pear trees. The objective of this study was to predict the content of phosphorus in the pulp and peel of ‘Huangguan’ pears nondestructively and conveniently by using near-infrared spectroscopy (900–1700 nm) technology. First, twelve algorithms are used to preprocess the original spectral data, and the partial least squares regression algorithm and the gradient boosting regression tree algorithm are used to build a full-band prediction model based on the original spectral data and the processed spectral data. The characteristic wavelengths were extracted using genetic algorithms, followed by establishing a characteristic wavelength prediction model. The prediction accuracy of the models was evaluated according to the coefficient of determination R² and the relative analysis error RPD. The study found that the best prediction model for predicting phosphorus content in the pulp of 'Huangguan' pear was MSC-GA-PLSR, which had R²=0.843 and RPD=1.857 in the modelling set and R²=0.989 and RPD=7.041 in the prediction set. The best prediction model for predicting phosphorus content in the peel of ‘Huangguan’ pear was SG+SNV+FD-GA-PLSR, which had R²=0.991 and RPD=7.470 in the modelling set and R²=0.974 and RPD=4.414 in the prediction set, and the effect was good and met expectations. The results demonstrated that near-infrared spectroscopy could successfully achieve nondestructive detection of phosphorus content in the pulp and peel of 'Huangguan' pears.

Effective prediction of wastewater treatment is beneficial for precise control of wastewater treatment processes. The nonlinearity of pollutant indicators such as COD and TP makes the model difficult to fit and has low prediction accuracy. The classical deep learning methods have been shown to perform nonlinear modeling. However, there are enormous numerical differences between multi-dimensional data in the prediction problem of wastewater treatment, such as COD above 3000 mg/L and TP around 30 mg/L. It will make current normalization methods challenging to handle effectively, leading to the training failing to converge and the gradient disappears or exploding. This paper proposes a multi-factor prediction model based on deep learning. The model consists of a combined normalization layer and a codec. The combined normalization layer combines the advantages of three normalization calculation methods: z-score, Interval, and Max, which can realize the adaptive processing of multi-factor data, fully retain the characteristics of the data, and finally cooperate with the codec to learn the data characteristics and output the prediction results. Experiments show that the proposed model can overcome data differences and complex nonlinearity in predicting industrial wastewater pollutant indicators and achieve better prediction accuracy than classical models.

This narrative review examines the crucial role of physical activity in managing long COVID, characterized by persistent symptoms such as fatigue, breathlessness, and cognitive impairments following SARS-CoV-2 infection. The methodology involved a comprehensive literature search across PubMed, EBSCO (EDS), and Google Scholar, selecting peer-reviewed articles from December 2019 focusing on long-term COVID physical activity interventions. The review highlights that tailored exercise programs, adjusted to individual health status and abilities, significantly alleviate symptoms and enhance psychological well-being. Key findings emphasize the importance of personalized exercise prescriptions due to the variability in patient responses and the need for a multidisciplinary approach in developing and monitoring interventions. Despite promising outcomes, the review identifies research gaps, including the need for long-term studies, randomized controlled trials, and deeper mechanistic insights. It suggests that standardized reporting, templates like CERT, and integrating digital health tools are essential for optimizing interventions. Overall, the review advocates including personalized physical activity programs in standard care for long COVID to improve patient outcomes and quality of life.

With the increasingly stringent airworthiness standards, the noise generated during the rotorcraft flight is gradually attracting people’s attention. It widely operated helicopters at low altitudes because of their maneuverability. The way to reduce the noise caused by the complex airflow of the helicopter rotor system has progressively become a hot topic for researchers. Using a hybrid acoustic analysis method, this paper investigates the improvement of the noise and thrust of the helicopter’s tail rotor through the tail rotor structural parameters. For the basic model, the turbulence simulation is performed using an incompressible detached eddy simulation (DES) method, and the Lighthill acoustic analog equation is calculated using the finite element method (FEM). We verified the accuracy of the method through wind tunnel tests. We chose a series of structural parameters for sound simulation and fluid simulation calculations. The results indicate that the modified tail rotor noise reduced by 16.5 dBA and the total thrust increased by 19.9% from the prototype model. This work can enhance the duct tail rotor design to improve aerodynamic and aeroacoustic performance.

With superior optical properties, high flexibility in engineering its material properties, and strong capability for large-scale on-chip integration, graphene oxide (GO) is an attractive solution for on-chip integration of two-dimensional (2D) materials to implement functional integrated photonic devices capable of new features. Over the past decade, integrated GO photonics, representing an innovative merging of integrated photonic devices and thin GO films, has experienced significant development, leading to a surge in many applications covering almost every field of optical sciences. This paper reviews the recent advances in this emerging field, providing an overview of the optical properties of GO as well as methods for the on-chip integration of GO. The main achievements made in GO hybrid integrated photonic devices for diverse applications are summarized. The open challenges as well as the potential for future improvement are also discussed.

Post-menopausal women are at risk of osteoporotic vertebral fractures (OVFs), which if undetected and untreated, can lead to significant pain and morbidity. However, OVFs are often not reported by radiologists on routine chest radiographs. Artificial Intelligence (AI) is increasingly used in medical applications with improvements in detection and diagnosis. This study aims to investigate the clinical value of a newly developed AI tool, Ofeye 1.0 for automated detection of OVFs on lateral chest radiographs in post-menopausal women (&gt;60 years) who were referred to undergo chest x-rays for other reasons. A total of 510 de-identified lateral chest radiographs from three clinical sites were retrieved and analysed by Ofeye1.0 tool. These images were then reviewed by a consultant radiologist to decide whether there is any fracture present or not with findings served as the reference standard for determining the diagnostic performance of the AI tool. The percentage of radiologist reports which included the OVF was analysed by comparing diagnostic reports with AI findings, while the accuracy, sensitivity, specificity, positive predictive value (PPV) and negative predictive values (NPV) of the AI tool were calculated. Out of all the original radiologist reports, missed OVFs were found in 14% images but were detected by the AI tool. The AI tool demonstrated a relatively high specificity 92.8% (95% CI: 89.6, 95.2%), moderate accuracy 80.3% (95% CI: 76,3, 80.4%), PPV 73.7% (95% CI: 65.2, 80.8%) and NPV 81.5% (95%CI: 79, 83.8%), but low sensitivity 49% (95%CI: 40.7, 57.3%). The high false negative results were mainly due to mild OVFs with &lt;20% vertebral height loss. The new AI software tool has high specificity with a low false positive rate of 5.1%, showing that it can be used as a complimentary tool to the routine diagnostic reports for reduction of missed OVF in elderly women. The low sensitivity with high false negative rates indicate the necessity of radiologist’s in identifying and reporting early OVFs.

The nuclear factor-ĸB (NF-ĸB) transcriptional system is a major effector pathway involved in inflammatory responses. Previous studies found that a Gardenia decoction (GD) inhibited the expression of NF-κB in a lipopolysaccharide (LPS)-stimulated mouse intestinal injury model. Herein, we hypothesized that geniposide (GE), a component of Gardenia jasminoides Ellis, also exerts anti-inflammatory effects and inhibits NF-ĸB activity in LPS-induced intestinal epithelial cells (IEC-6). IEC-6 cells were stimulated with LPS, following which the effects of GE on NF-ĸB signaling in the IEC-6 cells were examined by western blotting to detect IĸB phosphorylation/degradation. The expression of NF-κB was determined by immunofluorescence assay (IFA). Enzyme-linked immunosorbent assay (ELISA) was used to detect the inhibitory effect of GE on the release of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-1β (IL-1β) activated by LPS in IEC-6 cells. In addition, the migration ability of IEC-6 cells was observed by the scratch method. These results showed that GE dose-dependently downregulated levels of the proinflammatory cytokines TNF-α, IL-6 and IL-1β that had been upregulated by LPS and suppressed the phosphorylation of IĸB and NF-ĸB induced by LPS. Our findings indicated that GE could reduce LPS-induced NF-ĸB signaling and proinflammatory expression in IEC-6 cells and significantly enhance the migration of IEC-6 cells. Moreover, GE inhibited the expression of NF-κB, nuclear transfer, and transcriptional activity in IEC-6 cells. GE could block the synthesis of inflammatory factors of IEC-6 cells by inhibiting activation of the IĸB/NF-κB signaling pathway induced by LPS.

To quantify the time-varying reproduction number (Rt) for Malaysia using the COVID-19 incidence data., we used data the from the Johns Hopkins University Center for Systems Science and Engineering (JHU CCSE) Coronavirus repository. Day 1 was taken from the first assumed local transmission of COVID-19. Data was split into four intervals: a) Interval 1: from Day 1 to Day 10 MCO 1, b) Interval 2: from Day 1 to Day 10 MCO 2, c) Interval 3: from Day 1 to Day 10 MCO 3 and d) Interval 4: from Day 1 to Day 10 MCO 4. We estimated the Rt using the EpiEstim package. The means for Rt at Day 1, Day 5 and Day 10 for all MCOs ranged between 0.665 to 1.147. The average Rt gradually decreased in MCO 1 and MCO 2. However, Rt increased in MCO 3 before stabilized around 0.8 in MCO 4. MCO 1 and MCO 2 which were stricter coincide with the gradual reduction of Rt. However, the more relaxed MCO 3 and MCO 4 correspond to a slight increase in the Rt before it stabilized.

Nuclear magnetic resonance (NMR) techniques are widely used to identify pure substances and probe protein dynamics. Edible oil is a complex mixture composed of hydrocarbons, which have a wide range of molecular size distribution. In this research, low field NMR (LF-NMR) relaxation characteristic data of various sample oils were analyzed. We also suggest a new method for prediction size of edible oil molecules using LF-NMR relaxation time distributions. According to the relative molecular mass, carbon chain length, transverse relaxation time of different sample oils, combined with oil viscosity and other factors, the relationship between carbon chain length and transverse relaxation time rate was analyzed. Various oils and fats in the mixed fluid are displayed, reflecting the composition information of different oils. To study the correlation between the rotation correlation time and molecular information of oil molecules. The molecular composition of the resulting fluid determines its properties, such as viscosity and phase behavior. The results show that low-field NMR can obtain information on the composition, macromolecular aggregation, and molecular dynamics of complex fluids. Measurements of grease in the free fluid state show that the relaxation time can reflect the intrinsic properties of the fluid. It is shown that the composition characteristics and states of complex fluids can be measured by low-field nuclear magnetic resonance.

The intricate relationship between physical and social environments within organizations plays a pivotal role in shaping sustainable innovation endeavors. This paper presents a comprehensive analysis of two key dynamics that have garnered substantial scholarly attention for promoting sustainable innovation: the physical environment and the organizational climate. To elucidate the intricate interplay between these dynamics, we propose a novel three-dimensional framework that guides the modeling of the intricate processes through which the physical environment and innovation climate synergistically influence innovation outcomes. Building on this framework, we delve into an in-depth literature review concerning physical environments that exert a significant impact on innovation. Through this review, we identify and elaborate on four pivotal elements of the physical environment: communality, personalization, comfort, and healthiness. Leveraging insights gleaned from this review, we outline two promising avenues for future research in the realm of the physical environment's interaction with the innovation climate. Furthermore, we underscore the critical importance of adopting an interdisciplinary approach that seamlessly integrates insights from both the physical and social domains to comprehensively understand the sustainable innovation landscape.

Weeds that infest crops are a primary factor limiting agricultural productivity world-wide. Weedy rice, also called red rice, has experienced independent evolutionary events through gene flow from wild rice relatives and de-domestication from cultivated rice. Each evolutionary event supplied/equipped weedy rice with competitive abilities that allowed it to thrive with cultivated rice and severely reduce yields in rice fields. Under-standing how competitiveness evolves is important not only for noxious agricultural weed management but also for the transfer of weedy rice traits to cultivated rice. Molec-ular studies of weedy rice using simple sequence repeat (SSR), restriction fragment length polymorphism (RFLP) and whole genome sequence have shown great genetic variations in weedy rice population globally. These variations are evident both at whole genome and at single allele level, including Sh4 (shattering), Hd1 (heading and flower-ing), and Rc (pericarp pigmentation). The goal of this review is to describe the genetic diversity of current weedy rice germplasm and the significance of weedy rice germplasm as a novel source of disease resistance. Understanding these variations, es-pecially at an allelic level, is also crucial as individual locus that control important traits can be of great target to rice breeders.

Variational mode decomposition (VMD) is a recently introduced adaptive signal decomposition algorithm with a solid theoretical foundation and good noise robustness compared with empirical mode decomposition (EMD). There is a lot of background noise in the vibration signal of diesel engine. To solve the problem, a denoising algorithm based on VMD and Euclidean Distance is proposed. Firstly, a multi-component, non-Gauss, and noisy simulation signal is established, and decomposed into a given number K of band-limited intrinsic mode functions by VMD. Then the Euclidean distance between the probability density function of each mode and that of the simulation signal are calculated. The signal is reconstructed using the relevant modes, which are selected on the basis of noticeable similarities between the probability density function of the simulation signal and that of each mode. Finally, the vibration signals of diesel engine connecting rod bearing faults are analyzed by the proposed method. The results show that compared with other denoising algorithms, the proposed method has better denoising effect, and the fault characteristics of vibration signals of diesel engine connecting rod bearings can be effectively enhanced.

The first case of Corona Virus Disease 2019 (COVID-19) was reported in Wuhan, China in December 2019. Since then, COVID-19 has quickly spread out to all provinces in China and over 150 countries or territories in the world. With the first level response to public health emergencies (FLRPHE) launched over the country, the outbreak of COVID-19 in China is achieving under control in China. We develop a mathematical model based on epidemiology of COVID-19, incorporating the isolation of healthy people, confirmed cases and close contacts. We calculate the basic reproduction numbers 2.5 in China (excluding Hubei province) and 2.9 in Hubei province with the initial time on January 30 which show the severe infectivity of COVID-19, and verify that the current isolation method effectively contains the transmission of COVID-19. Under the isolation of healthy people, confirmed cases and close contacts, we find a noteworthy phenomenon that is the potential second epidemic of COVID-19, and estimate the peak time and value and the cumulative number of cases. Simulations show that the isolation of close contacts tracked measure can efficiently contain the transmission of the potential second epidemic of COVID-19. With isolation of all susceptible people or all infected people or both, there is no potential second epidemic of COVID-19. Furthermore, resumption of work and study can increase the transmission risk of the potential second epidemic of COVID-19.

Urban rail transit hub platform is the most important area for passenger flow distribution. In order to calculate passenger flow volume in platform and evaluate platform service level during rush hours, this paper presents a method for modeling and simulation of passenger flow distribution in platform. Passenger flow distribution model (PFDM) is proposed based on the basic analysis and the superposition principle of passenger flow. Simulation design for PFDM is proposed by Anylogic, which contains simulation process and simulation model. Experiment results show that PFDM and simulation design are effective and accordant with the reality scenario, and the simulation precision is comparatively ideal. This research could provide a beneficial reference for train scheduling and operation management under the viewpoint of traffic safety and service level.

The effect of H2S with high concentrations on catalytic dry reforming of methane (DRM) process has seldom been focused on previously. Herein, a thermodynamic analysis of the DRM reactions in the presence of H2S with the concentration varying in 0-20 vol% was conducted firstly. Several typical types of catalysts including MgO, NiO/MgO and LaNiO3 in different states were prepared for executing DRM at 800 C, 0.1 MPa in the feed of 20 vol% CO2 and 20 vol% CH4 balanced with N2. The catalytic performance of each catalyst for DRM process under conditions of absence and presence of H2S was compared. A promotion effect of increasing H2S concentration on both the conversions of CO2 and CH4 and the molar yields of CO and H2 was observed on all the catalysts especially the MgO and the pristine NiO/MgO. While a significant decline in catalytic activity of either the reduced NiO/MgO or the reduced LaNiO3 catalyst after adding H2S, moderate reactant conversions still sustained. The results of process analysis and catalyst structure characterization suggest that H2S participation can contribute to the increment in CO2 and CH4 conversion, and active S-adsorbed species may play the key role of catalysis in the reactions involving H2S.

Types of DNA recombination include homologous recombination and nonhomologous recombination. Homologous DNA recombination is a general term that includes exchange of information between chromatids: (reciprocal) crossing-over, gene conversion, and post-meiotic segregation. Gene conversion is now thought to be a type of non-Mendelian segregation of heterozygous markers near the recombination initiation site. Thus, it includes both gene conversion and post-meiotic segregation previously described. DNA non-HR including transpositional recombination and site-specific recombination. Our understanding of the molecular mechanism by which DNA recombination occurs has significantly increased in the past decades. Currently The synthesis-dependent strand annealing model is now thought to give rise to most or all noncrossovers, with the double-strand-break repair model forming mainly crossovers. The Shapiro model proposed by Dr. J. Shapiro explains the molecular mechanism of transpositional recombination. Site-specific recombination results from another distinct model. We previously proposed a novel theory which can provide a more reasonable and simpler explanation accounting for DNA HR including the 3 classes of recombinogenic events described above. In the new supplementedly molecular model, DNA meiotic recombination can be initiated by a copy choice mechanism, that is, copying part of 1 single-stranded DNA template, followed by DNA polymerase switching to another single-stranded DNA template, and then resuming the following DNA synthesis along the new template. The current review suggests that transpositional recombination and site-specific recombination should be initiated by copy choice during DNA synthesis rather than break/join mechanism. The work indicates that review of DNA nonhomologous recombination are very necessary. The novel theory would challenge earlier models accounting for transpositional recombination and site-specific recombination and would be critical to the understanding of the mechanisms. We hope copy choice initiating DNA nonhomologous recombination will be one of the concepts that are explored. Proper and specific experiments are required to reconstruct the detailed mechanism described here.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Developing clinically meaningful nanomedicines for cancer therapy requires the drugs to be effective, safe, simple, cheap, and easy to store. In the present work, we report that a simple cationic Fe(III)-rich salt of [FeIIICl(TMPPH2)][FeIIICl4]2 (Fe-TMPP) exhibits a superior anticancer performance toward a broad spectrum of cancer cell lines, including breast, colorectal cancer, liver, pancreatic, prostate, and gastric cancers, with half maximal inhibitory concentration (IC50) values in the range of 0.098−3.97 μM (0.066−2.68 μg mL−1), and comparable to the best-reported medicines. Fe-TMPP can forms stand-alone nanoparticles in water without the need for extra surface modification or organic-solvent-assisted antisolvent precipitation. Critically, Fe-TMPP is TME-responsive (TME = tumor microenvironment), and can only elicit its function in the TME with overexpressed H2O2, converting H2O2 to the cytotoxic •OH to oxidize the phospholipid of the cancer cell membrane, causing ferroptosis, a programmed cell death process of cancer cells.

Acinetobacter baumannii is a multidrug-resistant and invasive pathogen associated with the etiopathology of both an increasing number of nosocomial infections and of relevance to poultry production systems. Multidrug-resistant Acinetobacter baumannii has been reported in connection to severe challenges to clinical treatment, mostly due to an increase rate of resistance to carbapenems. Amid the possible strategies aiming to reduce the insurgence of antimicrobial resistance, phage therapy has gained particular importance for the treatment of bacterial infections. This review summarises the different phage-therapy approaches currently in use for multiple-drug resistant Acinetobacter baumannii, including single phage therapy, phage cocktails, phage -antibiotic combination therapy, phage coding Acinetobacter baumannii and the novel phage enzyme treatment. Although phage therapy represents a potential treatment solution for multidrug-resistant Acinetobacter baumannii, further research is needed to unravel some unanswered questions especially in regard to its in vivo applications, before possible routine clinical use.

Global dust events have become more frequent due to climate change and increased human activity, significantly impacting air quality and human health. Previous studies have often focused on simulating cross-regional dust transport based on atmospheric parameters; however, comprehensive monitoring of dust events remains challenging. Therefore, this study utilized Fengyun-4A (FY-4A) satellite Advanced Geostationary Radiation Imager (AGRI) imagery, Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observation (CALIPSO) lidar, and other auxiliary data to conduct three-dimensional spatiotemporal monitoring and cross-regional transport analysis of two typical dust events in the Beijing–Tianjin–Hebei (BTH) region of China using four dust intensity indices (Icsd, Dust Detection Index (DDI), Dust value (DV), and Dust Strength Index (DSI)) and the HYSPLIT model. We found that among the four indices, DDI was the most suitable for studying dust in the BTH region, with a detection accuracy (POCD) of > 88% at all times and reaching a maximum of 96.14%. Both the 2021 and 2023 dust events originated from large-scale deforestation in southern Mongolia and the border area of Inner Mongolia, with dust plumes distributed between 2 and 12 km being transported across regions to the BTH area. Further, when dust aerosols are primarily concentrated below 4 km and PM10 concentrations consistently exceed 600 µg/m³, large dust storms are more likely to occur in the BTH region. The findings of this study provide valuable insights into the sources, transport pathways, and environmental impacts of dust aerosols.

Nicotine exposure may affect NSCLC is associated with lung cancer in humans. Whether nicotine exhibits carcinogenesis promoted activities in tumor growth still unknown. Nicotine is known to have dichotomous effects on cancer biology, acting like a pro- or anti-carcinogenesis agent. There are different functions between adenocarcinoma and squamous NSCLC cancer cells. Excess generation of nicotine may inhibit mitochondrial metabolism, protein modification, and DNA cleavage. Materials and Methods: We used the H520 NSCLC line obtained from human lung epithelial cells to detected nicotine growth and toxicity using MTT assay and western blotting. The concentration of nicotine stimulated cell growth to correspond to low concentration, while high concentration was cytotoxic. Results: According to MTT assay results, at 1.0 μM nicotine has significantly enhanced the H520 cell viability (%). Nicotine induced lung cancer carcinogenesis through mechanisms of α7nAchR, EGFR, HDAC2/4/5, Cyclin D/Cyclin E, Bcl-2, p-Akt, and inflammatory proteins of NF-KappaB and COX2 increases at 1.0 μM. Apoptosis proteins were decreases at 1.0 μM nicotine by p21, p27, c-jun, and p38α using western blotting. Nicotine stimulates tumor growth is mediated through α7nicotinic-acetylcholine receptors (α7nAChR), possibly involving inflammation. On the other hand, at high nicotine concentrations (> 1.0 μM) with consistent cytotoxic effects and appeared to be due to direct cell kill. Nicotine can prevent apoptosis induced by NSCLC. Conclusion: Therefore, the effects on chemotherapeutics by NSCLC malignant cell lines, nicotine in concentrations as low as 1.0 μM decreased. These mechanisms are responsible for the genotoxic effects caused by nicotine. This leads to downstream effects on decreased apoptosis, increased cell proliferation and transformation. The malignant NSCLC cells respond to the treatment with nicotine in lung cancer, the nicotine-mediated induction of growth may provide one of its links to α7nAchR or EGFR.

In this paper, we investigate the following chemotaxis-haptotaxis model $$\left\{ \begin{array}{ll} u_{t}=\nabla\cdot (D(u) \nabla u)- \nabla\cdot (H(u)\nabla v)- \nabla\cdot (I(u)\nabla w)+ u(a-\mu u^{k-1}-\lambda w),\\ v_{t}=\triangle v-v+u^{\gamma},\\ w_{t}=-v w \end{array}\right.\eqno(*) $$ under homogenous Neumann boundary condition and for a bounded domain $ \Omega \subset \mathbb{R}^{n} (n\geq2)$, with $\lambda, \mu, \gamma >0$, $k>1$, $a \in \mathbb{R}$, and $D(u)\geq K_{D} (u+1)^{m-1}$, $0\leq H(u)\leq \chi u(u+1)^{-\alpha}$, $0\leq I(u)\leq \xi u(u+1)^{-\beta}$ for $K_{D}, \chi, \xi>0, m, \alpha, \beta\in \mathbb{R}$. It has been demonstrated that (i) For $0\gamma-k+1$ and $\beta>1-k$, problem ($*$) admits a classical solution $(u, v, w)$ which is globally bounded. (ii) For $\frac{2}{n}\gamma-k+\frac{1}{e}+1$ and $\beta>\max\{\frac{(n\gamma-2)(n\gamma+2k-2)}{2n}-k+1, \frac{(n\gamma-2)(\gamma+\frac{1}{e})}{n}-k+1\}$ or $\alpha>\gamma-k+1$ and $\beta>\max\{\frac{(n\gamma-2)(n\gamma+2k-2)}{2n}-k+1, \frac{(n\gamma-2)(\alpha+k-1)}{n}-k+1\}$, problem ($*$) admits a classical solution $(u, v, w)$ which is globally bounded.

The sexual reproduction of ascomycetes is controlled by the mating-type(MAT) locus. (Pseudo)homothallic reproduction has been hypothesized based on genetic data from Hirsutella sinensis (Genotype #1 of Ophiocordyceps sinensis). In this study, the differential occurrence of the mating-type genes in the MAT1-1 and MAT1-2 idiomorphs, which constitute the genetic control of O. sinensis reproduction, was analyzed in 237 strains and 5 genomes of H. sinensis. The mating-type genes were differentially transcribed in H. sinensis Strain L0106, and the MAT1-2-1 transcript in H. sinensis Strain 1229 was alternatively spliced, with an unspliced intron I containing stop codons; these findings constitute O. sinensis reproduction controls at the transcriptional and coupled transcriptional-translational levels. The occurrence of the mating-type genes and a-/α-pheromone receptor genes differed among the 5 H. sinensis genomes. The differential occurrence and transcription of these genes are inconsistent with self-fertilization under (pseudo)homothallism but suggest self-sterility of H. sinensis, which therefore needs a mating partner to achieve sexual outcrossing under heterothallism or hybridization. Consistent occurrence and transcription of the mating-type genes of both the MAT1-1 and MAT1-2 idiomorphs have been reported in natural and cultivated Cordyceps sinensis, but these findings are insufficient to determine the reproduction mode(s) because of the co-occurrence of >90 fungal species and multiple genomically independent genotypes of O. sinensis. The mutant MAT1-1-1 and α-pheromone receptor transcripts in natural C. sinensis result in the N-terminus or middle-truncated proteins, with changes in hydrophobicity and secondary structures of the proteins, suggesting heterogeneous fungal source(s) of the proteins and hybridization reproduction.

We research the interaction between six representative carbon-based nanoparticles (CBNs) and 20 standard amino acids through all-atom molecular dynamics simulations. The six carbon-based nanoparticles are fullerene(C60), CNT55L3, CNT1010L3, CNT1515L3, CNT2020L3, and two-dimensional-graphene(Graphene33). Their curvatures decrease sequentially, and all of CNT are single-walled carbon nanotubes. We have observed that as the curvature of CBNs decreases, the adsorption effect of 20 amino acids with them has an increasing trend. In addition, we also used multi-dimensional clustering to analyze the adsorption effects of 20 amino acids on six carbon-based nanoparticles. We observed that the π-π interaction still plays an extremely important role in the adsorption of amino acids on carbon-based nanoparticles. Individual long-chain amino acids and “Benzene-like” Pro also have a strong adsorption effect with carbon-based nanoparticles.

We report a large third-order nonlinear optical response of palladium diselenide (PdSe₂) films – a two-dimensional (2D) noble metal dichalcogenide material. Both open-aperture (OA) and closed-aperture (CA) Z-scan measurements are performed with a femtosecond pulsed laser at 800 nm to investigate the nonlinear absorption and nonlinear refraction, respectively. In the OA experiment, we observe optical limiting behaviour originating from large two photo absorption (TPA) in the PdSe₂ film of β = 3.26 ×10^-8 m/W. In the CA experiment, we measure a peak-valley response corresponding to a large and negative Kerr nonlinearity of n₂ = -1.33×10^-15 m²/W – two orders of magnitude larger than bulk silicon. We also characterize the variation of n₂ as a function of laser intensity, observing that n₂ decreases in magnitude with incident laser intensity, becoming saturated at n₂ = -9.96×10^-16 m²/W at high intensities. These results verify the large third-order nonlinear optical response of 2D PdSe₂ as well as its strong potential for high performance nonlinear photonic devices.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

A switchable and tunable terahertz (THz) metamaterial based on photosensitive silicon and Vanadium dioxide (VO2) was proposed. By using finite-difference time-domain (FDTD) method, the transmission and reflective properties of the metamaterial were investigated theoretically. The results imply that, the metamaterial can realize a dual electromagnetically induced transparency (EIT) or two narrow-band absorption depending on the temperature of the VO2. Additionally, the magnitude of the EIT and two narrow-band absorption can be tuned by varying the conductivity of photosensitive silicon (PSi) via pumping light. Correspondingly, the slow light effect accompanying the EIT can also be adjusted.

Estimating the ocean’s subsurface thermohaline information from satellite measurements is essential for understanding ocean dynamics and El Niño phenomenon. This paper proposes an improved double-output Residual Neural Network (DO-ResNet) model to concurrently estimate the ocean subsurface temperature (OST) and ocean subsurface salinity (OSS) in the tropical Western Pacific using multi-source remote sensing data, including sea surface temperature (SST), sea surface salinity (SSS), sea surface height anomaly(SSHA), sea surface wind (SSW), and geographical information (including longitude (LON) and latitude (LAT)). In the model experiment, Argo data were used to train and validate the model, and the root mean square error (RMSE), normalized root mean square error (NRMSE) and coefficient of determination (R²) were employed to evaluate the model's performance. The results showed that the sea surface parameters selected in this study have a positive effect on the estimation process, and the average RMSE and R² values for estimating OST (OSS) by the proposed model are 0.34 °C (0.05 psu) and 0.91 (0.95), respectively. Under the data conditions considered in this study, DO-ResNet demonstrates superior performance relative to the extreme gradient boosting model, random forest model, and artificial neural network model. Additionally, this study evaluates the model’s accuracy by comparing its estimations of OST and OSS across different depths with Argo-derived data, demonstrating the model's ability to effectively capture the most spatial features, and by comparing NRMSE across different depths and seasons, the model displays strong seasonal adaptability. In conclusion, this research introduces a novel artificial intelligence technique for estimating OST and OSS in the tropical Western Pacific Ocean.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

This study presented a novel and sustainable method for producing chitin nanocrystals (PA-ChNCs) using phosphoric acid hydrolysis. The produced PA-ChNCs were used as stabilizers for Pickering emulsions and their physicochemical properties as well as stabilization mechanisms were systematically investigated. The PA-ChNCs exhibited small particle sizes and high surface areas, enabling an effective adsorption at the oil/water interface, which prevented coalescence in Pickering emulsions. The particle size and surface charge PA-ChNCs were strongly pH-dependent, which were critical factors for stabilizing Pickering emulsions. The study showed that emulsions with higher O:W ratios (50%) exhibited larger droplets but greater viscosity, forming a stable gel-like matrix that was more stable than emulsions with other O:W ratios after storage for 30 days. Emulsions with higher PA-ChNCs concentrations (2.0 wt%) and higher pH values (pH 10) showed small droplets and high viscosity, leading to stable emulsions. This research contributes to the development of sustainable and effective emulsifiers for use in the food industry, making utilization of seafood waste in an eco-friendly manner possible. Overall, this study highlights the potential of using newly developed PA-ChNCs as stabilizers for Pickering emulsions in food products.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Density distribution function of classical statistical mechanics is generally generalized as a product of a general complex function and its complex Hermitian conjugate function, and the average of classical statistical mechanics is generalized as the average of the quantum mechanics. Furthermore, this paper derives three ones of the five axiom presumptions of quantum mechanics, e.g., deduces Schrȍdinger equation by two general ways, makes the three axiom presumptions into three theorems of quantum mechanics, not only solves the crisis to hard understand, but also gets new theories and new discoveries, e.g., this paper solves the crisis of the origin of the wave-particle duality, derives operators, eigenvalues and eigenstates, deduces commutation relations for coordinate and momentum as well as the time and energy, and discovers quantum mechanics is just a generalization ( mechanics ) theory of the complex square root of ( real density function of ) classical statistical mechanics. Quantum mechanics being just a generalization theory of the complex square root of classical statistical mechanics is both new physics and revolutionary discovery, which are affecting people’s deep philosophical thinking for modern physics development, solve all the crisises of quantum mechanics, quantum information and so on, and make quantum mechanics have scientific solid bases being checked and both no basic axiom presumption and no all the quantum strange incomprehensible properties, because classical statistical mechanics and the complex square root of classical statistical mechanics have the scientific solid bases being checked. In addition, this paper discovers the reason no taking the time derivative of space coordinates in Schrȍdinger equation. Therefore, this paper gives solution to the crisis of the first quantization origin, and mainly deduces quantum physics no all the quantum current strange incomprehensible properties.

(1) Background: In most cases, passive isolation control methods are commonly used for the seismic isolation design of bridge engineering. However, for passive seismic isolation devices, due to their non-adjustable performance parameters, it is challenging to achieve a good seismic isolation effect for structures under random and variable seismic loads in the wide frequency range of 0 Hz to 20 Hz; (2) Methods: the sensitivity of the design parameters of the seismic isolation bearing was analyzed using the optimization center gradient method, and an improved genetic algorithm was employed to quickly optimize and obtain the optimal design parameters; (3) Results: the effectiveness of the three-dimensional seismic isolation bearing was validated through experiments. (4) Conclusions: The multi-factor sensitivity analysis approach used in this study for designing novel isolation bearings is applicable not only to seismic design in bridges but also serves as a reference for parameter design in isolation bearings requiring medium to high precision in seismic performance.

Employing remote sensing techniques to evaluate crop residue cover (CRC) enables rapid mapping of tillage practices over large cropland areas, which has significant practical implications for monitoring the implementation of conservation tillage practices. This research utilized Sentinel-2 MSI and Landsat-8 OLI remotely sensed data, various spectral indices were calculated and the datasets were correlated with the field-measured CRC data. Selected spectral indices, highly significantly correlated, were chosen to build a correlation model between the indices and the CRC. Considering Sentinel-2 MSI and Landsat 8 OLI remotely sensed data variations in spectral and spatial scales, the accuracy of CRC models was evaluated using R2 and RMSE values. From the results, it's evident that all six spectral indices, including STI, NDTI, SRNDR, NDI5, NDI7 and NDSVI, registered correlation coefficients with the CRC exceeded 0.3 in the study area. STI and NDTI showed a stronger correlation to CRC, with coefficients of 0.810 and 0.803, respectively. For the Landsat 8 data, the lowest correlation obtained was for NDSVI with the Landsat 8 data with a correlation coefficient of 0.358. Applying the linear regression technique, STI and NDTI obtained higher accuracy compared to other indices in the Sentinel-2 MSI data. For NDTI and STI, The R2 values were 0.650 and 0.665, respectively, while their corresponding RMSE values were 3.96% and 4.03%. The highest model accuracy was obtained for the STI and NDTI constructed from the Landsat 8 OLI data (R2 values 0.41 and 0.40; RMSE values 5.25% and 5.27%, respectively). The CRC model built using partial least squares regression (PLSR) exhibited greater precision when applied to the Sentinel-2 MSI data (R2 value 0.894; RMSE value 2.18%) in comparison to the Landsat 8 OLI data (R2 value 0.695; RMSE value 3.70%). PLSR has the potential to enhance the precision of the model. In addition, the study area shows that the estimation of the CRC is better in the one-dimensional linear regression model and the PLSR model created with the Sentinel-2 MSI optical data compared to the Landsat 8 OLI optical remotely sensed data. The validation suggests that the CRC estimation in the study area is more precise when using the model relying on Sentinel-2 satellite imagery rather than the Landsat 8 OLI imagery.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Facing the charging difficulties of free-floating shared electric vehicle and the high cost of mobile charging for single demand, this article proposes a collaborative charging planning method based on the complementary advantages of fixed charging stations and mobile charging vehicles, which can charge shared electric vehicles more efficiently and reduce the charging cost at the same time. A bi-level programming model for fixed and mobile cooperative charging is constructed. The upper level of the model is the minimization model of system charging total cost, seeking the optimal charging scheme and the number of mobile charging vehicles. The lower model is a fixed and mobile cooperative charging path planning model, which calculates the optimal routes for mobile charging vehicles and the shared electric vehicles that need to be transferred to the fixed charging station. The example results show that the cost of the proposed fixed-mobile cooperative charging scheme is reduced by 12.6% compared with the pure fixed charging scheme and 14.9% compared with the pure mobile charging scheme

Manual interpretation of these huge amounts of image volumes are susceptible to inter-reader variability and human error. Thus, accurate automated CAD scheme is highly desirable in clinical pathological diagnosis. In this research, plethora of machine learning paradigms (e.g. feature extraction, dimensionality reduction and supervised classification methods) were explored, evaluated, compared and analyzed to identify the optimal pathway for brain MR images (normal vs neoplastic) binary classification task. External validation dataset was used to test the generalizability of the optimal predictive models implemented. Relevant and informative features were selected to construct cross-validated decision tree and eventually simple rule set was built based on the decision tree. The experimental results show that almost all pattern recognition paradigms achieve high accuracy with careful selection of number of attributes. LDA+ELM with 55 features are the optimal pipelines which achieve perfect classification when training and test data are of same source; and achieving (accuracy=97.5%, AUC=0.989, sensitivity=95% and specificity=100%) under balanced test dataset; (accuracy=99.5%, AUC=0.988, sensitivity=95% and specificity=100%). Cross-validated decision tree model also shows comparable performance: accuracy=98.8%, AUC=99.1%, sensitivity=99.6% and specificity=98.2%. Three highly relevant and robust attributes are visualized and selected for construction of decision tree models and finally a rule sets are read directly off the decision tree. This rule sets can potentially serve as fast and accurate classification algorithm.

The Kerr nonlinear optical performance of silicon nanowire waveguides integrated with 2D layered graphene oxide (GO) films is theoretically studied and optimized based on experimentally measured linear and nonlinear optical parameters of the GO films. The strong mode overlap between the silicon nanowires and highly nonlinear GO films yields a significantly enhanced Kerr nonlinearity for the hybrid waveguides. A detailed analysis for the influence of waveguide geometry and GO film thickness on the propagation loss, nonlinear parameter, and nonlinear figure of merit (FOM) is performed. The results show that the effective nonlinear parameter and nonlinear FOM can be increased by up to ≈52 and ≈79 times relative to bare silicon nanowires, respectively. Self-phase modulation (SPM)-induced spectral broadening of optical pulses is used as a benchmark to evaluate the nonlinear performance, examining the trade-off between enhancing Kerr nonlinearity and minimizing loss. By optimizing the device parameters to balance this, a high spectral broadening factor of 27.6 can be achieved ‒ more than 6 times that achieved in previous experiments. Finally, the influence of pulse chirp, material anisotropy, and the interplay between saturable absorption and SPM is also discussed. These results provide useful guidance for optimizing the Kerr nonlinear optical performance of silicon waveguides integrated with 2D layered GO films.

Tungsten carbide (WC) was well known as a wear-resistant material. Iron-based pow-der was suitable for remanufacturing of cast iron engine parts. To improve the wear resistance of the remanufactured iron-based cast iron engine parts, WC-Co was intro-duced into iron-based powders to prepare composite coatings for cast iron engine components. In this work, FeAlC-x(WC-Co) composite coatings were prepared by plasma transfer arc on compacted graphite cast iron. The influences of WC-Co con-tents in the Fe-AlC-x(WC-Co) composite coatings on the microstructure and properties of the composite coatings were investigated. The composite coatings contained γ-Fe, α-Fe, WC and Fe3W3C mainly. The microhardness of FeAlC-x(WC-Co) composite coatings had the highest hardness of 814 HV0.2, the-lowest coefficient of 0.5 and the lest wear mass loss of 1.3mg when the weight content of WC-Co in the composite coating was 20wt%. As compared with the FeAlC coating, FeAlC-x(WC-Co) composite coating achieved the effect of reducing friction and wear resistance simultaneously, which resulted from the self-lubricating effect of graphite and high wear-resistance of carbides in the claddings.

Most of existing fuzzy forecasting models partition historical training time series into fuzzy time series and build fuzzy-trend logical relationship groups to generate forecasting rules. The determination process of intervals is complex and uncertainty. In this paper, we present a novel fuzzy forecasting model based on high-order fuzzy-fluctuation trends and the fuzzy-fluctuation logical relationships of the training time series. Firstly, we compare each data with the data of its previous day in historical training time series to generate a new fluctuation trend time series(FTTS). Then, fuzzify the FTTS into fuzzy-fluctuation time series(FFTS) according to the up, equal or down range and orientation of the fluctuations. Since the relationship between historical FFTS and the fluctuation trend of future is nonlinear, Particle Swarm Optimization (PSO) algorithm is employed to estimate the required parameters. Finally, use the acquired parameters to forecast the future fluctuations. In order to compare the performance of the proposed model with that of the other models, we apply the proposed method to forecast the Taiwan Stock Exchange Capitalization Weighted Stock Index (TAIEX) time series datasets. The experimental results and the comparison results show that the proposed method can be successfully applied in stock market forecasting or such kinds of time series. We also apply the proposed method to forecast Shanghai Stock Exchange Composite Index (SHSECI) to verify its effectiveness and universality.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

For a comprehensive exploration of the Bimolecular Fluorescence Complementation (BiFC) approach, we critically assess whether protein pairs establish direct or indirect interactions within this context. Emphasizing the multifaceted nature of protein interactions, this review underscores the imperative of delineating macromolecular complex characteristics across five distinct levels: composition, stoichiometry, copy number, topology, and dynamics. A pivotal discussion revolves around the challenges introduced by the overexpression of target proteins and the potential artificial ramifications of fusion proteins. The significance of stoichiometry in protein interactions is illuminated, with the HOXA9/PBX1 interaction serving as a pertinent case study. The research identifies and elaborates on the inherent limitations of prevailing large-scale BiFC screenings, advocating for the incorporation of rigorous negative controls. A novel proposition is introduced in the form of a high-throughput multicolor BiFC strategy, exemplified using the HOXA9 and PBX1 proteins. The paper culminates with an insightful discourse on the implications of tags within the BiFC system, presenting the TriFC (Tripartite Fluorescence Complementation) assay as a promising alternative.

This paper, from the perspective of Mode 3 of knowledge production, takes the important carrier of knowledge, scientific research papers, as the research object. The mainstream databases (SCIE and SSCI) are chosen as the data sources. Firstly, bibliometric methods are applied to analyze the cooperation status among the main bodies of paper production, including authors and their affiliated institutions, countries, and disciplines; secondly, the Analytic Hierarchy Process (AHP) is used to construct a comprehensive evaluation model for the state of research cooperation in carbon neutrality. Based on the evaluation model, the cooperation characteristics of different disciplinary fields and the relationship between paper cooperation status and high-impact research papers are comparatively analyzed. At the same time, an analysis is conducted on the support from the government, the sponsorship from enterprises, and the participation of the public in the process of paper production. Finally, some suggestions are put forward on how to build an innovative ecosystem for carbon neutrality research from the perspective of Mode 3 of knowledge production.

To address the insufficient mechanical properties of calcined phosphogypsum, this research aims to investigate the utilization of basalt fiber and calcium carbonate whiskers as reinforcing agents. The study examines their impact on the flexural and compressive strength, toughness, water resistance, and tensile strength of calcined phosphogypsum. In the individual tests, basalt fibers with different lengths (3 mm, 6 mm, 9 mm, and 18 mm) were added at dosages of 0%, 0.5%, 1.0%, and 1.5% respectively. The findings demonstrate that basalt fiber effectively enhances the flexural and compressive strength, toughness, and tensile strength of calcined phosphogypsum, albeit potentially compromising water resistance. Among the various fiber lengths, the 6 mm fibers exhibit the most advantageous influence on the performance of calcined phosphogypsum. A subsequent test was conducted to investigate the impact of cross-scale fibers on the properties of calcined phosphogypsum by mixing 6 mm basalt fibers and calcium carbonate whiskers. The results illustrate that calcium carbonate whisker refines the pores, thereby improving the flexural strength and toughness of calcined phosphogypsum. Furthermore, it compensates for the water resistance limitations associated with the sole utilization of basalt fiber while further augmenting the tensile strength and strain capacity. However, it should be noted that increasing the dosage of both calcium carbonate whiskers and basalt fibers concurrently leads to increased porosity of phosphogypsum and reduced compressive strength.

Deep convolutional neural network (CNN) has shown their great advantages in the single image deraining task. However, most existing CNN-based single image deraining methods still suffer from residual rain streaks and details lost. In this paper, we propose a deep neural network including the Multi-scale feature extraction module and the channel attention module, which are embed in the feature extraction sub-network and the rain removal sub-network respectively. In the feature extraction sub-network, the Multi-scale feature extraction module is constructed by a Multi-layer Laplacian pyramid, and is then integrated multi-scale feature maps by a feature fusion module. In the rain removal sub-network, the channel attention module, which assigns different weights to the different channels, is introduced for preserving image details. Experimental results on visually and quantitatively comparison demonstrate that the proposed method performs favorably against other state-of-the-art approaches

Using DCC-GARCH and EGARCH model, this paper finds that since 1990, the relationship between crude oil prices and the US dollar index is time-varying, demonstrating a process of “very weak correlation—negative correlation—enhanced negative correlation—weakening negative correlation”, but the existing research does not provide enough reasonable explanation. Therefore, this paper proposed a “key mediating factors” hypothesis which points out that whether there is a common “key mediating factor” is important source of the time-varying relationship between two assets. We argue that market trend and financial market sentiment undertook the role of “key mediating factor” during the period of “2002 to the financial crisis” and “financial crisis to 2013”, while other periods lack the “key mediating factors”.

Achieving the dual development of rural revitalization and urbanization is an important strategic goal of China’s current modernization. Rural population and settlements are the main components of the countryside in traditional agricultural areas, and play an important role in the development of the countryside itself in terms of urban and rural land use and in the formation of urban and rural development patterns. This study analyzes the spatial and temporal changes in rural populations and settlements at the township level, as well as the degree and type of coupled development. A framework for urban–rural development relationships based on different types of coupled development is proposed, and a model of urban–rural forces is constructed to derive the spatial pattern of urban–rural development at the township level that may be formed in the future. Our study shows that the rural population and settlements in the study area are characterized by significant spatial and temporal dynamics, indicating that traditional rural areas are in a process of rapid development and change. The results of the township-level coupling measurements present four types of development in terms of the spatial pattern of urban–rural development: A-type is most likely to produce new cities or satellite towns in the Jixi–Harbin–Qiqihar area in the future; B-type is the fastest dying area in the future, located in the Harbin and Qitaihe clusters, with a tendency to merge into Harbin; C-type is the area to be focused on in the future to attract population and strictly control the growth of the rural settlement area to avoid it turning into B-type; D-type may develop regional township centers in the future in the combined area of Jiamusi City, Suihua City and Mudanjiang City. The results of the study provide experience in realizing rural revitalization according to local conditions. The new spatial pattern of urban–rural development provides an important reference for formulating land use policies, optimizing urban–rural land allocation and realizing integrated urban–rural development strategies.

Tulou dwellings in Southeast China have captivated global interest due to their distinctive appearance, sustainable construction materials and technologies, and their defensive and collective housing functions. Despite several recognized as World Cultural Heritage sites, the vast majority of tulou buildings are undergoing irreversible decline and destruction, necessitating a comprehensive and systematic study. Taking 83 Tulou buildings in Raoping County, Chaozhou City, Guangdong Province as the research object, this study reconstructs the historical scenes and systematically reveals the emergence, popularity, and consolidation process of tulou dwellings as integrated defensive and residential buildings for ordinary people by conducting a comprehensive analysis of historical documents and local chronicles. Based on an extensive field investigation, the study systematically analyzes the geospatial distribution and the spatial characteristics of Raoping tulou and its residential unit. The results demonstrate the adaptability and flexibility of tulou dwellings, showcasing their developmental process and revealing the inclusive nature of these traditional residences, as well as the initiative of those who reside within them. The research findings contribute to a more dynamic, comprehensive, and authentic understanding of tulou and Chinese traditional residences, providing valuable references for the preservation and sustainable development of tulou architectural heritage.

The fluid seepage in local-saturated zone of subgrade promotes the migration of fine particles in the filler, resulting in the change of pore structure and morphology of the filler and the deformation of solid skeleton, which affects the fluid seepage characteristics. Repeatedly, the muddy interlayer, mud pumping and other diseases are finally formed. Based on the theory of two-phase seepage, the theory of porous media seepage, and the principle of effective stress in porous media, a two-phase fluid-solid coupling mathematical model in local-saturated zone of subgrade considering the effect of fine particles migration is established. The mathematical model is numerically calculated with the software COMSOL Multiphysics○R, the two-phase seepage characteristics and the deformation characteristics of the solid skeleton in local-saturated zone of the subgrade are studied. The research results show that due to the continuous erosion and migration of fine particles in local-saturated zone of the subgrade, the volume fraction of fine particles first increases then decreases and finally becomes stable with the increase of time. And the volume fraction of fine particles for the upper part of the subgrade is larger than that for the lower part of the subgrade. The porosity, the velocity of fluid, the velocity of fine particles, and the permeability show a trend of increasing first and then stabilizing with time; the pore water pressure has no significant changes with time. The vertical displacement increase first and then decrease slightly with the increase of time, and finally tend to be stable. For a filler with a larger initial volume fraction of fine particles, the maximum value of the volume fraction of fine particles caused by fluid seepage is larger, and the time required to reach the maximum value is shorter. It can be concluded that in actual engineering, the volume fraction of fine particles in the subgrade filler should be minimized on the premise that the filler gradation meets the requirements of the specification.

In this paper, we propose a partial differential equation model based on phase-field for sentiment analysis in the field of hotel comment texts. The comment texts are converted into word vectors using the Word2Vec tool, and then we utilize the multifractal detrended fluctuation analysis (MF-DFA) model to extract the generalized Hurst exponent of the word vector time series to achieve dimensionality reduction of the word vector data. The dimensionality reduced data is represented in a two-dimensional computational domain, and the modified Allen-Cahn (AC) function is used to evolve the phase values of the data to obtain a stable nonlinear boundary, thereby achieving automatic classification of hotel comment texts. The experimental results show that the proposed method can effectively classify positive and negative samples and achieve excellent results in classification indicators. We compared our proposed classifier with traditional machine learning models and the results indicate that our method possesses a better performance.

We investigate \texorpdfstring{$L_2$}{}-approximation problems in the worst case setting in the weighted Hilbert spaces \texorpdfstring{$H(K_{R_{d,\a,\g}})$}{} with weights \texorpdfstring{$R_{d,\a,{\bm \ga}}$}{} under parameters \texorpdfstring{$1\ge \ga_1\ge \ga_2\ge \cdots\ge 0$ and $1<\az_1\le \az_2\le \cdots$}{}. Several interesting weighted Hilbert spaces \texorpdfstring{$H(K_{R_{d,\a,\g}})$}{} appear in this paper. We consider the worst case error of algorithms that use finitely many arbitrary continuous linear functionals. Multivariate approximation; information complexity; tractability; weighted Hilbert spacesWe discuss tractability of \texorpdfstring{$L_2$}{}-approximation problems for the involved Hilbert spaces, which describes how the information complexity depends on \texorpdfstring{$d$}{} and \texorpdfstring{$\va^{-1}$}{}. As a consequence we study the strongly polynomial tractability (SPT), polynomial tractability (PT), weak tractability (WT), and \texorpdfstring{$(t_1,t_2)$}{}-weak tractability (\texorpdfstring{$(t_1,t_2)$}{}-WT) for all \texorpdfstring{$t_1>1$}{} and \texorpdfstring{$t_2>0$}{} in terms of the introduced weights under the absolute error criterion or the normalized error criterion.

The poor conductivity and instability of layered dihydroxides (LDHs) limit their widespread application in oxygen evolution reaction (OER). In this study, the composite electrode of NiMn-LDHs, reduced graphene oxide (rGO) and nickel foam (NF), i.e., NiMn-LDHs/rGO/NF, was prepared by a hydrothermal method. When subjected to oxygen evolution reaction (OER) catalytic performance in a solution of 1 M KOH, the NiMn-LDHs/rGO/NF composite catalyst exhibited an overpotential of only 140 mV at a current density of 10 mA cm-2 and a Tafel slope of 49 mV dec-1, which is not only better than the comparing RuO2/NF catalyst, but also better than most of the Mn-based and the Ni–Fe containing bimetallic OER catalysts reported in the literature. The excellent electrocatalytic performance is ascribed to the efficient integration of ultrathin NiMn-LDHs sheets, thin-layered rGO and NF, contributing a lot to the decrease in charge transfer resistance and the increase in electrochemically active surface area. Moreover, NF plays a role of current collector and a role of rigid support for the NiMn-LDHs/rGO composite, contributing extra conductivity and stability to the NiMn-LDHs/rGO/NF composite electrode.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.