Evaluating soil quality across various altitudinal gradients, both with and without vegetative cover, is crucial for the proper functioning of soil and optimal crop growth, thereby contributing to the sustainability of agroecosystems. Although the altitudinal gradient significantly influences soil quality, the ability to predict this quality, expressed through an index, in soils with and without vegetative cover, is still insufficiently explored. This study aimed to assess soil quality in the Jun Jun micro-watershed, located in the Tungurahua region, Ecuador. To achieve this objective, three categories of altitudinal gradients were selected: less than 2800 meters above sea level (masl), between 2800 and 2900 masl, and greater than 2900 masl. A total of 24 soil samples were collected in the mentioned gradients, considering both areas with and without vegetative cover. The indicators used included chemical and biological parameters such as soil organic carbon (OC), earthworm density (WD), earthworm biomass (WB), organic matter (OM), pH, total nitrogen (TN), and organic carbon (OC). The results revealed that in areas with altitudinal gradients below 2800 masl, soil quality index values were higher compared to other altitudes. In vegetated areas, a decrease in index values was observed as the altitudinal gradient increased, indicating a deterioration in soil quality with altitude. These findings are significant in providing a quantitative assessment of the effects of altitudinal gradient and vegetative cover influence on soil quality.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

Determining accurate PM2.5 pollution concentrations and understanding their dynamic patterns is crucial for scientifically informed air pollution control strategies. Traditional reliance on linear correlation coefficients for ascertaining PM2.5 related factors only uncovers superficial relationships. Moreover, the invariance of conventional prediction models restricts their accuracy. To enhance the precision of PM2.5 concentration prediction, this study introduces a novel integrated model that leverages feature selection and a clustering algorithm. Comprising three components - feature selection, clustering, and integrated prediction, the model first employs the non-dominated sorting Genetic Algorithm (NSGA-III) to identify the most impactful features affecting PM2.5 concentration within air pollutants and meteorological factors. This step offers more valuable feature data for subsequent modules. The model then adopts a two-layer clustering method (SOM+K-means) to analyze the multifaceted irregularity within the dataset. Finally, the model establishes the Extreme Learning Machine (ELM) weak learner for each classification, integrating multiple weak learners using the Adaboost algorithm to obtain a comprehensive prediction model. Through feature correlation enhancement, data irregularity exploration, and model adaptability improvement, the proposed model significantly enhances the overall prediction performance. Data sourced from 12 Beijing-based monitoring sites in 2016 were utilized for an empirical study, and the model's results compared with five other predictive models. The outcomes demonstrate that the proposed model significantly heightens prediction accuracy, offering useful insights and potential for broadened application to multifactor correlation concentration prediction methodologies for other pollutants.

The model proposed in this study was based on the assumption that the biomass attached to the anode served as biocatalysts for MFC exoelectrogenesis, and this catalytic effect was quantified by the exchange current density of anode. By modifying the Freter model and combining it with the Butler-Volmer equation, this model could adequately describe the processes of electricity generation, substrate utilization, and the suspended and attached biomass concentrations, at both batch and continuous operating modes. MFC performance is affected by the operating variables such as initial substrate concentration, external resistor, influent substrate concentration, and dilution rate, and these variables were revealed to have complex interactions by data simulation. The external power generation and energy efficiency were considered as indices for MFC performance. The simulated results explained that an intermediate initial substrate concentration (about 100 mg/L under this reactor configuration) needed to be chosen to achieve maximum overall energy efficiency from substrate in the batch mode. An external resistor with the value about that of the internal resistance boosted the power generation, and a resistor with several times of that of the internal resistance achieved better overall energy efficiency. At continuous mode, dilution rate significantly impacted the steady-state substrate concentration level (thus substrate removal efficiency and rate), and attached biomass could be fully developed when the influent substrate concentration was equal to or higher than 100 mg/L at any dilution rate of the tested range. Overall, this relatively simple model provided a convenient way for evaluating and optimizing the performance of MFC reactors by regulating operating parameters.

The controllability and consistency in the fabrication of micro-textures on large-scale remains a challenge for existing production processes. Mask electrolyte jet machining (MEJM) is an alternative to Jet-ECM for controllable and high-throughput surface microfabrication with more consistency of dimensional tolerances. This hybrid configuration combines the high-throughput of masked-ECM and the adjustable flow-field of jet-ECM. In this work, a duckbill jet nozzle was introduced to make MEJM more capable of batch micro-structuring. A multiphysics model was built to simulate the distribution of electrochemical reaction ions, the cur- rent density distribution and the evolution of the shape of the machined cavity. Experimental investigations are presented showing the influence of the machining voltage and nozzle moving speed on the micro cavity. Several 35 ×35 micro cavity arrays with a diameter of 24.92 − 11.73 µm and depth of 15.86 − 7.24 µm are generated on 304 stainless steel.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

Nereis as a mudflat organism has a variety of uses, in the history of China as a Chinese herbal record, because of its body contains rich amino acids, fatty acids and other nutrients, it can be used for therapeutic treatment and treatment can also be used as health care products. acids, fatty acids and other nutrients, it can be used for therapeutic treatment and treatment can also be used as health care products. In modern times, more and more researchers have studied the protease extract of Nereis as a mudflat organism. In modern times, more and more researchers have studied the protease extracted from the body of nereis and found that there are a variety of functional proteins in nereis, including superoxide dismutase, superoxide dismutase, superoxide dismutase and superoxide dismutase. More and more researchers have studied the proteases extracted from the body of nereis and found that there are a variety of functional proteins in nereis, including superoxide dismutase, adenylate cyclase, glycosidase, and plasminase. In this paper, the functional proteases in the extracts of nereis were summarized, and the functions and characteristics of proteases in nereis were discussed from the perspective of molecular structure.

The effects of various drawing parameters and annealing processes on the structure and properties of Cu-Ag wires, containing 1 wt% silver, were investigated using specialized equipment including fine wire drawing machines, very fine wire drawing machines, heat treatment equipment, tensile testing machines, microcomputer-controlled electronic universal testers, resistance testers, and scanning electron microscopes. The results revealed that continuous drawing of Cu-1%Ag alloy wires led to elongation of the grains, resulting in a uniform and tightly fibrous microstructure. Moreover, the tensile strength of the alloy wire increased from 670 MPa to 783.9 MPa after a single-pass with a deformation of 14%. Subsequently, when the wire was drawn at a speed of 500 m/min, the tensile strength further increased to 820.1 MPa. After annealing the Փ0.08 mm Cu-1% Ag alloy wire, an increase in annealing temperature up to 500°C resulted in the wire's tensile strength decreasing from 820.1 MPa to 377.5 MPa. Simultaneously, the elongation increased from 1.94% to 15.21%, and the resistivity decreased from 1.931×10-8Ω·m to 1.723×10-8Ω·m. Additionally, when annealing was conducted at a rate of 80 m/min, the wire resistivity dropped to 1.635×10-8Ω·m.

Mesozoic-Palaeozoic marine carbonate rocks are important hydrocarbon reservoirs in the Central Uplift area of the South Yellow Sea Basin (SYSB). Due to the lack of boreholes and the great heterogeneity of carbonate reservoirs, the distribution of porous carbonate reservoirs and their related key controlling factors remain unclear. Based on seismic inversion and isotope analysis, this study explores the factors affecting the distribution of porous Carboniferous-Early Permian carbonate reservoirs in the SYSB. In this study, the log-seismic characteristics of porous carbonate reservoirs, sensitive lithology parameters, and physical property parameters are extracted and analyzed. The pre-stack simultaneous inversion technique is applied to predict the lithology properties and physical properties of the porous carbonate reservoirs. Moreover, the sedimentary of carbonate is analyzed using isotopes of carbon, oxygen, and strontium. The results indicate that porous carbonate reservoirs with porosities of 3%~5% mainly occur at the paleo-highland (Huanglong Formation and Chuanshan Formation) and the slope of paleo-highland (Hezhou Formation). The porous carbonate reservoirs of the Qixia Formation are only locally developed. In addition, the study area was dominated by a warm and humid tropical climate from the Carboniferous to Early Permian, with four sea-level eustatic fluctuation indicated by the negative and positive δ13C excursions. When the sea level fell, the study area was exposed and denuded, and the supply of terrigenous detrital was dominated, which significantly influenced the carbonate deposit and diagenesis. This study highlights that sedimentation was a key factor in controlling the quality of Carboniferous-Early Permian carbonate reservoirs. The methods proposed in this study can be used in other carbonate-dominated strata worldwide.

Water and nutrients shortage threatens agricultural sustainability in many arid and semiarid areas of the world. It is unknown whether improved water and nutrient conservation practices can be developed to alleviate this issue while increasing crop productivity. In this study, experimental work included the application of straw, biochar and N fertilizer. The straw and biochar were applied alone or combined with N fertilizer (0 and 100 kg N ha-1). Application of biochar and straw in combination with N fertilizer caused a reduction in mean soil temperature by an average of 20.05% and 18.10% relative to soils without carbon. Biochar and straw– amended soils significantly (P < 0.05) increased soil moisture content by 11.04% and 13.68% compared to no carbon treatments. Statistically comparable temperatures and moisture were recorded for both straw and biochar treated plots. Both biochar and straw treated soils produced the lowest bulk density (0–5 cm) at 1.15 g cm–3, and no carbon soils the highest at 1.20 g cm–3. The improved soil quality translated into higher biomass in the biochar (1906 kg ha–1) and biomass (1643 kg ha–1) and soils without carbon the lowest at 1553 kg ha–1. The improvement of soil moisture and the optimization of soil temperature for the two residue treated soils allow us to conclude that combined application of biochar and straw at the rate used in this study can be used as an effective farming model in alleviating water and nutrient shortage in semiarid environments.

An undescribed diterpene, stellerterpenoid A (1) and two undescribed sesquiterpenoids, stellerterpenoids B and C (2-3), together with six known compounds, were isolated from the roots of Stellera chamaejasme L. Their structures were elucidated by extensive spectroscopic data (1D, 2D NMR, IR, UV and HR-ESI-MS). The absolute configuration of 1-3 were elucidated based on ECD calculation. Among of them, stellerterpenoid A was a rare 13, 14 - seco nortigliane diterpenoid and stellerterpenoid B was a guaiacane type sesquiterpenoid with an unusual 1, 2-diketone moiety. The known stelleraguaianone B (5) exhibited moderate activity to suppress NO production in LPS - simulated macrophages with an IC50 value of 24.76 ± 0.4 μM. None of the compounds showed inhibitory influenza virus and tumor activity.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

Transient receptor potential melastatin-8 (TRPM8) is a cation channel that is activated by cold and “cooling agents” such as menthol and icilin, which induce a cold sensation. Stimulation of TRPM8 activates an intracellular signaling cascade that ultimately leads to a change in the gene expression pattern of the cells. Here, we investigated the TRPM8-induced signaling pathway that links TRPM8 channel activation to gene transcription. Using a pharmacological approach, we show that inhibition of phosphatidylinositol 4-phosphate 5 kinase alpha (PIP5K), an enzyme essential for the biosynthesis of phosphatidylinositol 4,5-bisphosphate, attenuated TRPM8-induced gene transcription. Analyzing the link between TRPM8 and Gq proteins, we show that pharmacological inhibition of the beta gamma subunits impairs TRPM8 signaling. In addition, genetic studies showed that TRPM8 requires an activated Galpha subunit for signaling. In the nucleus, the TRPM8-induced signaling cascade triggers an activation of the transcription factor AP-1, a complex consisting of a dimer of basic region leucine zipper (bZIP) transcription factors. Here, we identified the bZIP protein c-Jun as an essential component of AP-1 within the TRPM8-induced signling cscade. In summary, with PIP5K, Gq subunits and c-Jun we have identified key molecules in the TRPM8-induced signaling from the plasma membrane to the nucleus.

The impact of the agriculture net carbon effect is crucial for climate change mitigation, yet research on this topic in China is currently insufficient. In this study, the carbon balance ratio (CBR) is used to characterise the net carbon effect of agriculture, and the spatial Durbin model and threshold regression model were used to empirically analyse the CBR with a sample of 30 provincial-level regions in China from 2004 to 2019. The aim was to investigate the mechanism of the influence of the land management scale (SCALE) of farming on the CBR. The results of the study indicate that national farming generally has a net sink effect, with large changes in interannual fluctuations; the expansion of SCALE has an obvious role in increasing sinks and reducing emissions, and has a positive spatial spillover effect on CBR, with significant spatial heterogeneity. Furthermore, as the SCALE expands, the direction of the influence of rural residents’ income and education level on CBR changes in the opposite direction, showing a significant non-linear relationship characteristic. However, in most areas, the SCALE threshold has not yet been reached, suggesting that the improvement in education levels can still offset the negative impact of economic income growth in the short term. The study recommends paying attention to the role of farmers’ human capital, changing production methods, and implementing carbon peaking and carbon neutrality goals to enhance the net sink effect of the farming industry, which would be achieved by increasing land management scale.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The nutrient absorption and utilization efficiency in the roots of seedlings are beneficial for increasing crop yield. Creating marker assisted selection for wheat root traits can assist wheat breeders in choosing robust roots to maximize nutrient uptake. Exploring and identifying the effect of different nitrogen applications on RSA is of great significance for breeding nitrogen efficient wheat varieties. In this study, A total of 243 wheat varieties native to the Yellow and Huai Valley regions of China were utilized for genome-wide association studies (GWAS). Furthermore, a recombinant inbred line (RIL) population of 123 lines derived from the cross between Avocet and Chilero was utilized for linkage examination and confirmation of the hereditary loci distinguished by GWAS. Five RSA traits include the relative number of root tips (RNRT); relative total root length (RTRL); relative total root surface area (RTRS); relative total root volume (RTRV) and relative average root diameter (RARD) where evaluated under two N conditions—normal N (NN) supply and low N (LN)—to characterize the NUE of each accession. GWAS and linkage analysis were performed by integrating data from the wheat 660k single nucleotide polymorphism (SNP) chip and diversity arrays technology (DArT) to identify genetic loci associated with RSA. The results showed that based on the ratio of RSA related traits under two N supply conditions, a total of 598 SNP markers, which are significantly associated with RSA related traits, were detected at 160 genetic loci by GWAS. A total of 10 QTL loci related to RSA were dis-covered and identified by linkage mapping. In which, three significant RSA related Quantitative Trait Locus (QTL) were identified, namely qRtrl-3D, qRnrt-3D, and qRtrl-7D. The study has the potential to enhance the effectiveness of selecting root traits in wheat breeding programs, offering valuable insights into the genetic underpinnings of nitro-gen use efficiency (NUE) in wheat. This could lead to the creation of NUE wheat varieties by implementing focused breeding strategies.

This paper proposes a solution for the problem of mobile robot navigation and trajectory interpolation in dynamic environments with large scenes. The solution combines a semantic laser SLAM system that utilizes deep learning and a trajectory interpolation algorithm. The paper first introduces some open-source laser SLAM algorithms and then elaborates in detail on the general framework of the SLAM system used in this paper. Secondly, the concept of voxel is introduced into the occupation probability map to enhance the ability of local voxel maps to represent dynamic objects. Then, in this paper, we propose a PointNet++ point cloud semantic segmentation network combined with deep learning algorithms to extract deep features of dynamic point clouds in large scenes and output semantic information of points on static objects. A descriptor of the global environment is generated based on its semantic information. Closed-loop completion of global map optimization is performed to reduce cumulative error. Finally, T-trajectory interpolation is utilized to ensure the motion performance of the robot and improve the smooth stability of the robot trajectory. The experimental results indicate that the combination of the semantic laser SLAM system with deep learning and the trajectory interpolation algorithm proposed in this paper yields better graph building and loop closure effects in large scenes at SIASUN large scene campus. The use of T-trajectory interpolation ensures vibration-free and stable transitions between target points.

A 'little brother' of pain, itch is an unpleasant sensation that creates a specific urge to scratch. To date, various machine-learning based image classifiers (MBICs) have been proposed for quantitative analysis of itch-induced scratch behaviour of laboratory animals in an automated, non-invasive, inexpensive and real-time manner. In spite of MBICs' advantages, the overall performances (accuracy, sensitivity and specificity) of current MBIC approaches remains inconsistent, with their values varying from ~50% to ~99%, for which the reasons underlying have yet to be investigated further, both computationally and experimentally. To look into the variation of the performance of MBICs in automated detection of itch-induced scratch, this article focuses on the experimental data recording step, and reports here for the first time that MBICs' overall performance is inextricably linked to the sharpness of experimentally recorded video of laboratory animal scratch behaviour. This article furthermore demonstrates for the first time that a linearly correlated relationship exists between video sharpness and overall performance (accuracy and specificity, but not sensitivity) of MBICs, and highlight the primary role of experimental data recording in rapid, accurate and consistent quantitative assessment of laboratory animal itch.

Based on a modified dice-and-fill technique, a PIN-PMN-PT single crystal 1-3 composite with the kerf of 12 μm and pitch of 50 μm was prepared. The as-made piezoelectric composite material behaved with high piezoelectric constant (d33 = 1500 pC/N), high electromechanical coefficient (kt = 0.81), and low acoustic impedance (16.2 Mrayls). Using lithography and flexible circuit method, a 48-element phased array was successfully fabricated from such a piezoelectric composite. The array element was measured to have a central frequency of 20 MHz and a fractional bandwidth of approximately 77% at −6 dB. Of particular significance was that this PIN-PMN-PT single crystal 1-3 composite-based phased array exhibits a superior insertion loss compared with PMN-PT single crystal and PZT-5H-based 20 MHz phased arrays. The focusing and steering capabilities of the obtained phased array were demonstrated theoretically and experimentally. These promising results indicate that the PIN-PMN-PT single crystal 1-3 composite-based high frequency phased array is a good candidate for ultrasound imaging applications.

The four-way reversing valve is a key component determining whether a heat pump air conditioning system can work. Studying the four-way reversing valve is of great significance for improving the performance of the heat pump air conditioning system. In this paper, the control equation of the sliding block movement process is constructed to simulate the reversing process of the four-way reversing valve in fluid mechanics, and a detailed study is carried out from the sliding block speed, sliding block acceleration, sliding block force, refrigerant leakage, and other aspects. Research has shown that optimizing the structure of the slider can greatly improve the working performance of the four-way reversing valve. Increasing the height of the slider not only improves the pressure relief ability of the four-way reversing valve and prevents the slider from being damaged by high-pressure gas impact, but also reduces the leakage of refrigerant during the directional process; When reducing the length of the slider, although it will improve the pressure relief capacity of the four-way reversing valve, it also increases the amount of refrigerant leakage. The research results provide a theoretical basis and improvement direction for designers to improve the performance of four-way reversing valves.

Different inlet structures have a significant impact on the internal flow characteristics of a solid-magnesium powder water ramjet engine. Based on the magnesium-water reaction model, a computational fluid dynamics (CFD) method is applied to establish a numerical simulation method for the internal flow field of the engine, and the internal flow characteristics of the engine under different inlet structure conditions are studied. The simulation results show that high-temperature gas can effectively promote the ignition of magnesium powder at the top of the combustion chamber, while accelerating the evaporation of the first inlet water and increasing the combustion rate of magnesium powder. The secondary inlet has the most significant effect on the temperature inside the combustion chamber. When the secondary inlet flow rate increases towards the top of the combustion chamber, it increases the amount of heat absorbed by the evaporating water at the top of the chamber, thereby reducing the temperature at the top of the combustion chamber. However, when the flow rate is low, it results in insufficient oxidizer at the top of the combustion chamber, which is unfavorable for the combustion of magnesium powder.

The low-altitude quasi-periodic (LQP) E-region echoes observed with the upgraded HCOPAR located in Hainan Island of China (19.5°N, 109.1°E) are presented. With the interferometry technique, the interferometry equations can be developed to investigate the structures of the irregularities. The results show that the plasma structures of the LQP echoes with negative slope mainly drift southwestward almost horizontally, but they also drifted southeastward in some striations. According to the movement of the plasma structures, we find strong wind shear in the region where the LQP echoes are produced. Meanwhile, The periodicity of the LQP echoes may be related to the strength of the wind shear. It is proposed that the plasma structures are most likely produced by the Kelvin-Helmholtz instability.

In the current natural environment, due to the complexity of the background and the high similarity of the color between immature green tomato and plant, the occlusion of the key organs (flower and fruit) by the leaves and stems will lead to low recognition rate and poor generalization of the detection model. Therefore, an improved tomato organ detection method based on convolutional neural network has been proposed in this paper. Based on the original Faster R-CNN algorithm, Resnet-50 with residual blocks was used to replace the traditional vgg16 feature extraction network, and K-means clustering method was used to adjust more appropriate anchor size than manual setting to improve detection accuracy. A variety of data augmentation techniques were used to train the network. The test results showed that compared with the traditional Faster R-CNN model, the mean average precision (mAP) of the optimal model was improved from 85.2% to 90.7%, the memory requirement decreased from 546.9MB to 115.9 MB, and the average detection time was shortened to 0.073S/sheet. As the performance greatly improved, the training model can be transplanted to the embedded system, which lays a theoretical foundation for the development of precise targeting pesticide application system and automatic picking device.

The connected vertex cover (CVC) problem is a variant of the vertex cover problem, which has many important applications, such as wireless network design, routing and wavelength assignment problem, etc. A good algorithm for the problem can help us improve engineering efficiency, cost savings and resources in industrial applications. In this work, we present an efficient algorithm GRASP-CVC (Greedy Randomized Adaptive Search Procedure for Connected Vertex Cover) for CVC in general graphs. The algorithm has two main phases, i.e., construction phase and local search phase. To construct a high quality feasible initial solution, we design a greedy function and a restricted candidate list in the construction phase. The configuration checking strategy is adopted to decrease the cycling problem in the local search phase. The experimental results demonstrate that GRASP-CVC is competitive with the other competitive algorithm, which validate the effectivity and efficiency of our GRASP-CVC solver.

In recent years, a large-scale afforestation campaign has taken place in Inner Mongolia, China, to control desertification and soil erosion. However, the water consumption associated with large-scale afforestation significantly impacts the water resources in Inner Mongolia, resulting in a substantial ecological risk. This study aimed to evaluate the ecological risk of water resources caused by afforestation in the region. In this study, based on land cover data, Normalized Difference Vegetation Index (NDVI) data, and meteorological data, used trend analysis, water balance equation, and Water resources Security Index (WSI) index to analyze the ecological risks of water resources caused by afforestation in Inner Mongolia from 2000 to 2020. The results show that:(1) The afforestation area in Inner Mongolia was 5.37×104 km2 in 2000-2020; (2) Afforestation in arid and semi-arid areas leads to the reduction of water resources. (3) Afforestation reduces water resources in the study area by 0.76×108m3/year; (4) ~76% of afforestation regions face ecological risks of water resources.

The greatly diversified flowering plants (angiosperms) are the dominating and defining group in the current earth ecosystem. However, from which group by what way the flowers, especially their gynoecia (key characteristics of angiosperms), are derived have been the questions in botany unanswered over centuries. Such an embarrassing situation can be attributed to the lack of plants with partially enclosed ovules, which are supposed to be a post between gymnosperms and angi-osperms. Here we report a fossil plant that has an apparent coniferous vegetative and reproduc-tive morphologies but has a single seed partially wrapped by the subtending bract. Such a mor-phology suggests that the carpels in angiosperms may be equivalent to bracts enclosing their axil-lary seed(s). Such a non-traditional interpretation of the homology of angiosperm carpels is com-patible with various new progresses made in botany and is in line with Tomlinson’s recent hy-pothesis. Together with other fossil evidence reported recently, it appears that gynoecia in angio-sperms are derived in multiple ways.

Accurate measurements of tree height and diameter at breast height (DBH) in forests to evaluate the growth rate of cultivars is still a significant challenge, even when using LiDAR and 3-D modeling. We propose an integrated pipeline methodology to measure the biomass of different tree cultivars in plantation forests with high crown density which that combines unmanned aerial vehicles (UAVs), hyperspectral image sensors, and data processing algorithms using machine learning. Using a planation of Cunninghamia lanceolate, commonly known as Chinese fir, in Fujian, China, images were collected using a hyperspectral camera and orthorectified in HiSpectral Stitcher. Vegetation indices and modeling were processed in Python using decision trees, random forests, support vector machine, and eXtreme Gradient Boosting (XGBoost) third-party libraries. Tree height and DBH of 2880 samples were measured manually and clustering into three groups: “fast growth,” “median,” growth and “normal” growth group, and 19 vegetation indices from 12,000 pixels were abstracted as the input of features for the modeling. After modeling and cross-validation, the classifier generated by random forests had the best prediction accuracy compare to other algorisms (75%). This framework can be applied to other tree species to make management and business decisions.

Lipid nanoparticles (LNPs) have attracted extensive attention in tumor immunotherapy in recent years. The strategy of targeting immune cells in cancer therapy has become a research area of great interest. mRNA vaccines are a potential choice for tumor immunotherapy due to their ability to directly encode antigen proteins and stimulate a strong immune response. However, the mode of delivery and lack of stability of mRNA are key issues limiting its application. LNPs are an excellent mRNA delivery vector, and their structural stability and biocompatibility make them an effective means to deliver mRNA to specific targets. This study summarizes the research progress in LNP delivery vector-assisted targeted controlled release mRNA vaccines in tumor immunity. The role of LNPs in improving mRNA stability, immunogenicity and targeting is discussed. In addition, combined with the cutting-edge research results, the potential mechanisms and application prospects of LNP-mRNA vaccines in tumor immunotherapy were further analyzed. This review aims to systematically summarize the latest research progress in LNP delivery carrier-assisted targeted controlled-release mRNA vaccines in tumor immunity to provide new ideas and strategies for tumor immunotherapy and provide more effective treatment plans for patients.

As the lifespan of porous asphalt pavement extends, it invariably experiences performance degradation and an increase in tire/pavement noise compared with the original surface when it is newly built. To understand the medium-term performance of porous asphalt pavement during service and reveal the influence of different pavement performance indicators on tire/pavement noise generation, a seven-year continuous observation and data analysis study was conducted. Porous asphalt with different designed material parameters was taken into account, including thin-layer porous asphalt overlay with a maximum nominal aggregate size of 10mm (PUC-10), porous asphalt with a maximum nominal aggregate size of 13mm (PAC-13), and a two-layer porous asphalt incorporating both PUC-10 and PAC-13 (PUC-10+PAC-13). Using automated pavement technology testing equipment, key performance indexes, including damage rate (DR), rut depth (RD), international roughness index (IRI), and sideway force coefficient (SFC), were measured and calculated. The on-board sound intensity (OBSI) method was used to test noise levels in three types of porous asphalt pavement structures and on a dense graded easy compact asphalt concrete (ECA) for comparison. The progressions of the medium-term performances were analyzed according to the measured results. The correlations between tire/pavement noise levels and testing speed, testing lane, pavement structure, and road condition indicators were investigated by regression. The research results revealed that the DR and SFC of the three types of porous asphalt pavement displayed more significant attenuation in the service period, while the IRI and RD showed small changes. Among them, the SFC demonstrated significant attenuation over the first 4 years, decreasing between 13.8% and 17.0%. From the 3-7 years of operation, the transverse crack disease in porous asphalt pavement progressed rapidly. The three porous asphalt pavement structures tested exhibited commendable noise reduction capabilities. Compared to ECA, the OBSI noise levels of these structures were lower by 2.09 dB, 1.53 dB, and 2.88 dB, respectively. Compared to other pavement condition indicators, RD had a more significant impact on the OBSI value of the PUC-10 porous asphalt pavement. For the PUC-10+PAC-13 porous asphalt pavement, there was a significant linear relationship between the OBSI value and SFC, mainly due to polishing of the coarse aggregate surface. It leads to a decrease of the micro-texture, which lies in increasing tire/pavement noise at high-frequency ranges and decreasing SFC. This study will have guiding significance for the research of the attenuated law and durability improvement of porous asphalt tire/pavement noise.

[Objective] To investigate the expression of ALDH2 in hepatocellular carcinoma and its correlation with macrophage infiltration and with the activation of specific subtypes of macrophages. [Methods] Transcriptome and clinical data from patients with hepatocellular carcinoma were downloaded from The Cancer Genome Atlas (TCGA) and the International Cancer Genome Consortium (ICGC) databases and analyzed and collated using R and Perl software. In the TCGA hepatocellular carcinoma dataset, the Wilcoxon test was used to identify macrophage activation-related gene sets that show differential expression between hepatocellular carcinoma and normal tissues. Single-cell sequencing combined with bulk data was used to analyze macrophage infiltration of hepatocellular carcinoma immune cells and the activation and recruitment of different subtypes of macrophages. Single-factor Cox regression and minimum absolute convergence and selection operator (Lasso) were used to identify survival-related genes and construct prognostic models of HCC. The patients were divided into two groups based on their model scores. The Wilcoxon test was used to identify differentially expressed genes (DEGs) between the two groups, and gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) functional enrichment analyses of the DEGs were performed. Single-sample gene set enrichment analysis (ssGSEA) was performed to explore the possible mechanism underlying the differences in prognosis. The reliability of the model was verified using the ICGC hepatocellular carcinoma dataset. A Kaplan‒Meier curve was constructed and used to analyze the influence of macrophage activation-related gene expression on survival and prognosis in patients with hepatocellular carcinoma. The log-rank test and the independent t test were used to analyze survival time data and to compare immune cell infiltration in the two groups. [Results] In a comparison of hepatocellular carcinoma and paracancerous tissues, the expression of six of 137 macrophage activation-related genes (ALDH2, CCNB2, CYP2C9, CYP3A4, F9 and KLKB1) was found to be significantly correlated with overall survival time (OS) in patients with hepatocellular carcinoma. Based on this finding, a prognosis assessment model for hepatocellular carcinoma was constructed. The OS of the patients in the high-scoring group was significantly shorter than the OS of the patients in the low-scoring group (P<0.05), and the model predicted the prognosis of patients with hepatocellular carcinoma independently of sex, age, tumor grade and stage. The area under the receiver operating characteristic (ROC) curve of the model used to predict 1-, 2-, and 3-year survival was greater than 0.7 in both the test set and the validation set. GO enrichment of DEGs between the high- and low-scoring groups of the model suggested that the DEGs are mainly related to immune function. GSEA suggested that the tumor-infiltrating immune cells in the high-scoring group were macrophages, Th2 cells and Treg cells and showed that the number of tumor-infiltrating immune cells, including NK cells, was lower in the high-scoring group than in the low-scoring group. With respect to immune function, the immune checkpoint of the high-scoring group was higher than that of the low-scoring group. Single-cell sequencing data indicated the recruitment of B cells, M0 cells, M1 cells and M2 cells to the hepatocellular carcinoma microenvironment and suggested that ALDH2 regulates related signaling pathways in a way that promotes the differentiation of macrophages into M2-type macrophages. [Conclusion] M2-type macrophages are the dominant type of macrophages associated with immune infiltration in hepatocellular carcinoma. The macrophage-associated activation gene ALDH2 activates the macrophage polarization signaling pathway and negatively regulates the differentiation of macrophages into M2-type macrophages.

Amidst the escalating demands for efficient Intelligent Transportation Systems (ITS) management, the significance of accurate Origin-Destination (OD) data prediction has emerged as a paramount concern, given its indispensable role in the ITS domain. This paper introduces a groundbreaking integrated model, creatively fusing the unique strengths of Graph Convolutional Network (GCN), Residual Neural Network (ResNet), and Long Short-Term Memory Network (LSTM) into a single architecture, which we name GraphResLSTM, to exploit road segment average speed data for OD prediction. Compared with conventional road segment traffic volume data, average speed data is more readily available, significantly reducing the data accessibility barrier for OD prediction. We underscore the critical role of selection of key road segments and employs a combination of Entropy Weight Method and Technique for Order Preference by Similarity to Ideal Solution (TOPSIS) to identify 41 representative road segments from the experimental road network. In the experimental phase, we simulate 86400000 seconds of traffic conditions, generating a total of 1440000 data records. Utilizing these simulated data, we design and conduct comparative experiments between models as well as data types. The results demonstrate that both the GraphResLSTM model and road segment average speed data outperform other models and data types notably in OD prediction tasks.

System-of-systems (SoS) evolution is a complex and unpredictable process. Although various principles to facilitate collaborative SoS evolution have been proposed, there is a lack of experimental data validating their effectiveness. To address these issues, we present an Agent-Based Model (ABM) for SoS evolution in the Internet of Vehicles (IoV) , serving as a quantitative analysis tool for SoS research. By integrating multiple complex and rational behaviors of individuals, we aim to simulate real-world scenarios as accurately as possible. To simulate the SoS evolution process, our model employs multiple agents with autonomous interactions and incorporates external environmental variables. Furthermore, we propose three evaluation metrics: evolutionary time, degree of variation, and evolutionary cost, to assess the performance of SoS evolution. Our study demonstrates that enhanced information transparency significantly improves the evolutionary performance of distributed SoS. Conversely, the adoption of uniform standards only brings limited performance enhancement to distributed SoSs. Although our proposed model has limitations, it stands out from other approaches that utilize Agent-Based Modeling to analyze SoS theories. Our model focuses on realistic problem contexts and simulates realistic interaction behaviors. This study enhances the comprehension of SoS evolution processes and provides valuable insights for the formulation of effective evolutionary strategies.

Cadmium(Cd) is a highly toxic and cumulative environmental pollutant. Siderophores are heavy metal chelators with high tolerance to heavy metals such as Cd. Furthermore, ryegrass (Lolium perenne L.) has potential remediation capacity for soils contaminated by heavy metals. Consequently, using ryegrass alongside beneficial soil microorganisms that produce siderophores may be an effective means to remediate soils contaminated with Cd. In this study, Bacillus strains WL1210 and CD303 that were previously isolated from the rhizospheres of Nitraria tangutorum in Wulan and Peganum harmala L in Dachaidan, respectively, both arid sandy environments, were evaluated for heavy metal pollution mitigation. The results indicate that both strains of Bacillus exhibit favorable biological characteristics and stress resistance, and they are both producers of siderophores, which promote the growth of ryegrass under Cd stress.

(1) Background: Proximal humerus fractures can be a debilitating condition if not properly treated. These fracture patterns are varied and differ in every patient. Functional outcomes may be determined by the integrity of the shoulder girdle involving the rotator cuff insertion. The post-operative resorption or malreduction of the greater tuberosity is an important factor contributing to the poor functional outcome of a patient. (2) Methods: A single-center retrospective comparative study was performed to evaluate the functional outcomes of patients undergoing operative fixation for this injury. A total of 387 consecutive cases treated operatively from 2019-2021 were included for analysis. (3) Results: 94 cases fulfilled our criteria for analysis. A matched-group comparison of 19 patients each was performed to compare demographics, post-operative fracture characteristics and functional outcomes. (4) Conclusions: The resorption or malreduction of the greater tuberosity contributes greatly to the prognostic outcome in patients treated with ORIF surgery. In our demographic study, obesity is another contributing factor affecting the parameters of post-operative reduction in proximal humerus fractures. Appropriate surgical planning and post-operative multidisciplinary care must be taken into consideration to attain a satisfactory prognostic outcome.

One new cassane diterpene possessing an unusual N bridge between C-19 and C-20 named caesalsappanin R (1), as well as another new diterpene caesalsappanin S (2), were isolated from the seeds of Caesalpinia sappan with methanol extract. Their structures were determined by spectroscopic analysis and examined alongside existing data from prior studies. Their biological activities were profiled by their antiplasmodial activity.

To accurately and non-destructively monitor the growth of spring wheat in the Hetao Irrigation Area, UAV remote sensing was employed during various fertility stages. Digital image indices from diverse fertilization treatments were calculated and compared with physiological indices to identify the most sensitive digital image indices corresponding to these indices. The study underscored the critical importance of the flowering stage in the growth of spring wheat, thus highlighting the necessity of focusing on this stage. This finding reiterated that the flowering stage was pivotal for spring wheat development in the Hetao Irrigation Area. Several digital image indices, such as GLA, R, G, INT, g, GRVI, MGRVI, RGBVI, EXG, and GRRI, exhibited a high frequency of significant correlations with physiological indices during the four primary reproductive stages of wheat. Consequently, these sensitive digital image indices during the flowering stage can more effectively characterize the physiological indices of spring wheat.

Gas flaring is commonly used by industrial plants for processing oil and natural gases in the atmosphere, and hence is an important anthropogenic source for various pollutants including CO₂, CO, and aerosols. This study evaluates the feasibility of using satellite data to characterize gas flaring form space by focusing on the Khanty Mansiysk Autonomous Okrug in Russia, a region that is well known for its dominatingly gas flaring activities. Multiple satellite-based thermal anomaly data products at night are inter-compared and analyzed, including MODIS (Moderate Resolution Imaging Spectroradiometer) Terra level-2 Thermal Anomalies product (MOD14), MODIS Aqua level-2 Thermal Anomalies product (MYD14), VIIRS (Visible Infrared Imaging Radiometer Suite) Active Fires Applications Related Product (VAFP), and VIIRS level-2 data based Nightfire product (VNF). The analysis compares and contrasts the efficacy of these sensor products in detecting small, hot sources like flares on the ground in extremely cold environments such as Russia. We found that the VNF algorithm recently launched by NOAA has the unprecedented accuracy and efficiency in characterizing gas flares in the region owing primarily to the use of Shortwave Infrared (SWIR) bands. Reconciliation of VNF’s differences and similarities with other nighttime fire products is also conducted, indicating that MOD14/MYD14 and VAFP data are only effective in detecting those gas flaring pixels that are among the hottest in the region. Validation of VNF product of gas flaring location with Google Earth images are made. It is shown that that VNF’s estimates of gas flaring area (the area of gas flaming) agree well the counterparts from Google images with a linear correlation of 0.91, highlighting its potential use for routinely monitoring emissions of gas flaring from space.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

MultiCal is an affordable, high-precision measuring device designed for the on-site calibration of industrial robots. Its design features a long measuring rod with a spherical tip that is attached to the robot. By restricting the rod’s tip to multiple fixed points under different rod orientations, the relative positions of these points are accurately measured beforehand. A common issue with MultiCal is the gravity deformation of the long measuring rod, which introduces measurement errors into the system. This problem becomes especially serious when calibrating large robots, as the length of the measuring rod needs to be increased to enable the robot to move in a sufficient space. To address this issue, we propose two improvements in this paper. Firstly, we suggest the use of a new design of the measuring rod that is lightweight yet has high rigidity. Secondly, we propose a deformation compensation algorithm. Experimental results have shown that the new measuring rod improves calibration accuracy by 20% to 39%, while by using the deformation compensation algorithm, the accuracy increases by 6% to 16%. In the best configuration, the calibration accuracy is similar to that of a measuring arm with a laser scanner, producing an average positioning error of 0.274 mm and a maximum positioning error of 0.838 mm. The improved design is cost-affordable, robust, and has sufficient accuracy, making MultiCal a more reliable tool for industrial robot calibration.

Interface solar steam generation (ISSG) are charming for its applications in desalination and wastewater treatment. Biomass is an attractive substrate for utilizing solar vapor evaporators because of its natural pore structure and water transportability. Polymers like polydopamine (PDA) and polypyrrole (PPy) with broadband spectrum absorption are fascinating in photothermal materials (PTMs). Herein, PDA coated daikon-based (PDA-DK) and PPy coated daikon-based (PPy-DK) PTMs have been exploited for solar steam generation. When polyethylene foam (PEF) was used as an insulating layer to limit heat loss from the PTMs to bulk water, the evaporation rate of PDA-DK and PPy-DK was raised from 0.82 kg m–2 h–1 and 0.96 kg m–2 h–1 to 1.50 kg m–2 h–1 and 1.60 kg m–2 h–1, respectively. Meanwhile, the corresponding photothermal conversion efficiency was increased to 89.01% and 98.97%, which was increased by nearly 40% under 1-sun irradiation. In addition, PDA-DK and PPy-DK exhibited remarkable stability for the solar steam generation without significant change through 15 cycles. Furthermore, PDA-DK and PPy-DK could effectively desalt seawater and purify dyeing wastewater. All the results indicate that PDA-DK and PPy-DK have great potential in real-world applications for solar steam generation.

Water pollution, intensified by the release of hard-to-degrade pollutants, poses severe threats to ecosystems, human health, and economic development. The existing advanced oxidation processes often involve high operational costs and may result in secondary pollution, highlighting the necessity for innovative and more sustainable solutions. To address these challenges, our study introduces a cost-effective and eco-friendly corona discharge barrier plasma discharger for wastewater treatment. Through the central composite design/response surface methodology, a high decolorization rate of 98% of methylene blue (MB) within 10 minutes was achieved by optimizing parameters such as pH and voltage. Furthermore, the mechanisms of the generation of reactive oxygen species via this device was discussed in detail and the degradation pathways of MB were described. Moreover, this device is also very energy-efficient, with a low energy density and electrical energy per order of 0.15 watt/mL and 5.79 kWh/m³/order, respectively. In conclusion, the plasma discharger developed in this study provides a cost-effective and environmentally sustainable solution for dye wastewater treatment. This research contributes significantly to the advancement of sustainable dye wastewater management practices, offering an innovative method that meets both environmental and economic objectives.

Findings from studies of prenatal exposure to pesticides and adverse birth outcomes have been equivocal so far. We examined prenatal exposure to agricultural pesticides in relation to preterm birth and term low birthweight, respectively, in children born between 1998 and 2010 randomly selected from California birth records. We estimated residential exposures to agriculturally applied pesticides within 2 km of residential addresses at birth by pregnancy trimester for 17 individual pesticides and 3 chemical classes (organophosphates, pyrethroids, and carbamates). Among maternal addresses located within 2 km of any agricultural pesticide application, we identified 24,693 preterm and 220,297 term births, and 4,412 term low birthweight and 194,732 term normal birthweight infants. First or second trimester exposures to individual pesticides (e.g., glyphosates, paraquat, imidacloprid) or exposures to 2+ pesticides in the three chemical classes were associated with small increases (3-7%) in risk for preterm birth; associations were stronger for female offspring. We did not find associations between term low birthweight and exposures to pesticides other than for myclobutanil (OR: 1.11; 95% CI: 1.04-1.20) and possibly pyrethroids as a class. Our improved exposure assessment revealed that first and second trimester exposures to pesticides were associated with preterm delivery but few affected term low birthweight.

With the rapid development of tumor immunotherapy, nanoparticle vaccines have attracted much attention as a potential therapeutic strategy. The potential role of the mannose-modified lipid calcium phosphate nanoparticle vaccine in enhancing the anti-tumor immune response was investigated. The aim of this study was to investigate the effect of mannose modification on the immune response of nanoparticles in regulating the tumor microenvironment through systematic review and analysis and to explore its potential clinical application in tumor therapy. Currently, despite the potential advantages of nanoparticle vaccines in immunotherapy, achieving an effective immune response in the tumor microenvironment remains a challenge. Tumor immune escape and overexpression of immunosuppressive factors limit its clinical application. Therefore, this study will explore how to intervene in the immunosuppressive mechanism in the tumor microenvironment through mannose-modified lipid calcium phosphate nanoparticle vaccines so as to improve the immunotherapy effect of tumor patients and provide new ideas and strategies for the field of tumor therapy.

To achieve a micro-destructive and rapid measurement of the wood density of standing trees, this study investigated the feasibility of using the micro-drilling resistance method, formulated a mathematical model, explored the potential for a unified model across multiple tree species, and analyzed the influence of moisture content on measurement accuracy. First, 231 tree cores and drill resistance data were sampled from Pinus massoniana, Cunninghamia lanceolate, and Cryptomeria fortunei. The basic density and moisture content of each core were measured, and the average value of each resistance data record was calculated. Second, the average drill resistance, the natural logarithm of average drill resistance, and absolute moisture content were used as independent variables, while the wood basic density was used as the dependent variable. Third, the total model of the three tree species and sub-model for each tree species were established through a stepwise regression method. Finally, the accuracy of each model was compared and analyzed with that of using the average basic density of each tree species as an estimated density. The results revealed that the estimation accuracy of the sub-model for each tree species was 1.670 percentage points higher than the average value of each tree species used as the density estimation value for these tree species. Additionally, except for Cryptomeria fortunei, the natural logarithm of drill resistance significantly influenced the wood density model at a significance level of 0.05. Moreover, moisture content significantly affected the total model and sub-models of Pinus massoniana at a significance level of 0.05. The estimation accuracy of the total mathematical model was 2.125 percentage points lower than that achieved using the average basic density of each tree species to predict their density. The results indicated the feasibility of using the micro-drilling resistance method to measure the wood density of standing trees. Moreover, the relationship between wood density and drill resistance did not follow a linear pattern, and moisture content slightly influenced the drill needle resistance. Furthermore, the establishment of a mathematical model for each tree species was deemed essential. This study provides valuable guidance for measuring the wood density of standing trees through the micro-drilling resistance method.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

In recent years, green and healthy foods have attracted much attention. Plant-based foods have become a new trend to replace animal-derived foods. In this study, we used walnut and purple rice as the primary raw materials to produce yogurt. The process included boiling, mixing, grinding, inoculation, fermentation, and sterilization. We then analyzed the similarities and differences between the resulting walnut purple rice yogurt and unfermented walnut purple rice milk, as well as dairy-based yogurt, in terms of physical chemistry, flavor, and sensory characteristics. We also examined the similarities and differences between fermented walnut purple rice milk and conventional warm yogurt. The study results revealed that walnut purple rice yogurt exhibited greater viscosity than walnut purple rice milk and conventional dairy-based yogurt. Additionally, the former displayed enhanced stability and recovery ability. Notably, distinguishable differences were observed between the three types of yogurts in terms of the presence of unknown volatiles and the umami signal as indicated by electronic nose/tongue and GC-IMS analyses. The umami flavour of walnut purple rice yogurt surpasses that of traditional dairy-based yogurt, whilst its salty taste is lower than that of walnut purple rice milk. Despite possessing a weaker aroma than dairy-based yogurt, it is more potent than walnut purple rice milk. Additionally, its relative abundance of olefins, ketones, and alcohols enhances its unique flavour profile, surpassing both other options. Based on sensory analysis, it can be deduced that walnut purple rice yogurt has the highest overall acceptance rate.

Background and Objectives: The site types of Eucalyptus urophylla × Eucalyptus grandis clonal plantations in southern Yunnan were compared, aiming to provide basis for site selection and scientific plantations management. Materials and Methods: In this study, 80 standard plots were set up in the 6−9-year-old Eucalypts plantations in Pu'er City and Lincang City. Furthermore, the quantitative theory I model and canonical correlation analysis were used to analyze the relationship between dominant tree growth traits and site factors, and evaluate the growth potential of E. urophylla × E. grandis plantation. Results: The multiple correlation coefficient between 8 site factors (altitude, slope, slope level, soil thickness, slope direction, texture, soil bulk density, and litter thickness) and the quantitative growth of the dominant wood was 0.825 (P < 0.05). According to the correlation coefficient of the quantitative regression model, slope, altitude, and soil thickness were the main factors for the classification of E. urophylla × E. grandis plantations in southern Yunnan. In addition, E. urophylla × E. grandis plantations grew best downhill and mid uphill at relatively low altitude, where the soil layer was thick and composed of weathered red soil. Contrastingly, E. urophylla × E. grandis plantation growth was extremely poor in uphill sites at higher altitude, where the soil layer was thin and composed of semi-weathered purple soil. Furthermore, total N, and available B, Cu, and Zn content, as well as soil organic matter content in the soil had a great influence on the growth of E. urophylla × E. grandis. Conclusions: Nitrogen and phosphate fertilizer as well as trace elements such as B, Zn, and Cu can be properly applied in middle- and low-yield forests to promote the growth and development of E. urophylla × E. grandis plantations.

Ocean surface waves have been utilized as fundamental information in various fields of oceanic research. In this paper, we suggest a simulation and modelling technique for generating an ocean surface wave using an inverse Fast Fourier Transform (iFFT), and we subsequently verify the wave’s accuracy. The conventional method, linear superposition, requires recursive calculation because of the double summation and the time variable; to circumvent this issue, the new algorithm is presented. The Joint North Sea Wave Project (JONSWAP) spectrum is utilized for the ocean surface wave simulation example, and the parameters are the significant wave height (HS) and the zero-crossing wave period (TZ). A coordinate transform for the wavenumber domain was used to apply the inverse FFT algorithm. To verify the accuracy of the simulation result, the relative error between the input condition and the analysis result was calculated. The result for TZ is below 4% relative error, and the maximum relative error for HS is 7%. To avoid the Nyquist frequency for wave-field analysis and simulation, the minimum grid size was calculated by twice applying the maximum wavenumber.

With the rapid evolution of SARS-CoV-2, the emergence of new strains is an intriguing question. This paper presents an evolutionary theory to analyze the mutations of the virus and identify the conditions that lead to the generation of new strains. We represent the virus variants using a 4-letter sequence based on amino acid mutations on the spike protein and employ an n-distance algorithm to derive a variant phylogenetic tree. We show that the theoretically-derived tree aligns with experimental data on virus evolution. Additionally, we propose an A-X model, utilizing the set of existing mutation sites (A) and a set of randomly generated sites (X), to calculate the emergence of new strains. Our findings demonstrate that a sufficient number of random iterations can predict the generation of new macro-lineages when the number of sites in X is large enough. These results provide a crucial theoretical basis for understanding the evolution of SARS-CoV-2.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

A robust guaranteed cost preview repetitive controller is proposed for a class of polytopic uncertain discrete-time systems. In order to improve the tracking performance, the repetitive controller combined with preview compensator is inserted in the forward channel. By using the L-order forward difference operator, an augmented dynamic system is constructed. Then, the guaranteed cost preview repetitive control problem is transformed into the guaranteed cost control problem for the augmented dynamic system. For given performance index, the sufficient condition of asymptotic stability for the closed-loop system is derived by combining parameter-dependent Lyapunov function method with linear matrix inequality (LMI) techniques. By incorporating the controller obtained into the original system, the guaranteed-cost preview repetitive controller is derived. A numerical example is also included to show the effectiveness of the proposed method.

Resection of malignant lesions in the oral and maxillofacial area causes functional and morphological defects. To recover from these defects, reconstruction surgery is needed such as a primary closure or a flap. There are advantages and disadvantages to the method of using the primary closure and the flap, and the choice of procedure is entirely up to a surgeon. The purpose of this study is to evaluate availability of primary closure in patients. For 10 years from January 2010 to May 2020, patients who recovered using flaps after removing malignant lesions from the oral cavity and those who closed the lesion using primary closure were investigated. The investigation was conducted by searching the database of the hospital. There were 85 patients who removed malignant lesions in the oral and maxillofacial area, and among them 16 patients closed the soft tissue defects using primary closure. Operation time, histologic types, stages, wound status, and period of hospitalization according to the patients' medical records were investigated retrospectively. Between the staging and the primary closure, statistically significant differences were observed between stage I and stage II patients in 13 patients using the primary closure. (P=0.046). Statistically significant differences were identified between operation time and primary closure, with an average of 4.02 hours (P=0.015). The average period of hospitality for patients who underwent primary closure was 13.4 days, compared to 26.7 days for those who underwent flap surgery. This difference was statistically significant (P=0.0003). This study evaluated the use of primary closure in patients who underwent resection of malignant lesions in the oral and maxillofacial area. Although the majority of patients underwent reconstruction with flaps, our results showed that primary closure can be a viable option for certain patients with early-stage lesions. Therefore, oral and maxillofacial surgeons should carefully consider various evaluation criteria and select appropriate reconstruction methods to optimize functional and aesthetic outcomes for each patient.

In order to explore more spectrum resources to support sensors and its related applications, cognitive wireless sensor networks (CWSNs) have emerged to identify available channels being underutilized by the primary user (PU). To improve the detection accuracy of the PU signal, cooperative spectrum sensing (CSS) among sensors paradigm is proposed to make a global decision about the PU status for CWSNs. However, CSS is susceptible to Byzantine attack from malicious sensor nodes due to its open nature, resulting in wastage of spectrum resources or causing harmful interference to PUs. To suppress the negative impact of Byzantine attack, this paper proposes a beta distribution function (BDF) for CSS among multiple sensors, which includes a sequential process, beta reputation model, and weight evaluation. Based on sequential probability ratio test (SPRT), we integrate the proposed beta reputation model into SPRT, while improving and reducing the positive and negative impacts of reliable and unreliable sensor nodes on the global decision, respectively. Finally, the numerical simulation results demonstrate that compared to SPRT and weighted sequential probability ratio test (WSPRT), the proposed BDF has outstanding effects in terms of the error probability, and average number of samples under various attack ratios and probabilities.

The regulation of hepatic very-low-density lipoprotein (VLDL) secretion plays an important role in the pathogenesis of dyslipidemia and fatty liver diseases. VLDL is controlled by hepatic microsomal triglyceride transfer protein (MTTP). Mttp is regulated by carbohydrate response element binding protein (ChREBP) and small heterodimer partner (SHP). However, it is unclear whether both coordinately regulate Mttp expression and VLDL secretion. Here, adenoviral overexpression of ChREBP and SHP in rat primary hepatocytes induced and suppressed Mttp mRNA, respectively. However, Mttp induction by ChREBP was much more potent than suppression by SHP. Promoter assays of Mttp and the liver type pyruvate kinase gene revealed that SHP and ChREBP did not affect the transactivity of each other. Mttp mRNA and protein levels of Shp^/– mice were similar to those of wild-type; however, those of Chrebp^–/–Shp^–/– and Chrebp^–/– mice were much lower. Consistent with this, the VLDL particle number and VLDL secretion rates in Shp^–/–- mice were similar to wild-type, but were much lower in Chrebp^–/– and Chrebp^–/–Shp^–/–- mice. These findings suggested that ChREBP rather than SHP regulates VLDL secretion and that ChREBP and SHP do not affect the transactivities of each other.

Tack is one of the most important factors affecting the operability of prepregs, but it is still very difficult to obtain the change of prepreg tack with time at different temperatures. In this paper, a newly designed T-peel device is used to test the tack decay rate of prepregs at different temperatures. The obtained decay rate deviates less than 8.9% from the manufacturer's data. The maximum deviation of the ratio of tack decay speeds calculated by the Arrhenius equation from the experiments is not higher than -9.7%. It is proved that the present method can obtain the decay rate of tack of prepregs at different temperatures. This method is also applicable to the other two types of prepregs. The article proposes the handling life unit, an operational life measurement unit for prepregs, and establishes that the relationship between tack and remaining shelf life reduces prepreg management costs.

Saikosaponin (SS) a is a compound with various pharmacological properties and easily degraded into SSb1 and SSg in acid condition. In present work another two new degradation products of SSa formed under acid hydrolytic condition were detected and isolated by analytical and semi-preparative liquid chromatography technology, furthermore their structures were characterized as hydroxyl-saikosaponin a and SSb2 by spectral analysis, which is not only essential in stability-indicating method development and validation but also could be used as a worst case to assess the analytical method performance of SSa. Moreover their structural transformation pathways were also proposed.

In large-capacity energy storage systems, instructions are decomposed typically using an equalized power distribution strategy, where clusters/modules operate at the same power and durations. When dispatching shifts from stable single conditions to intricate coupled conditions, this distribution strategy inevitably results in increased inconsistency and hastened system aging. This paper presents a novel differentiated power distribution strategy comprising three control variables: the rotation status, the operating boundaries for both Depth of Discharge (DOD) and C-rates (C) within a control period. The proposed strategy integrates an aging cost prediction model developed to express the mapping relationship between these control variables and aging costs. Additionally, it incorporates the multi-colony particle swarm optimization (Mc-PSO) algorithm into the optimization model to minimize aging costs. The aging cost prediction model consists of three functions: predicting health features (HFs) based on the cumulative charge/discharge throughput quantity and operating boundaries, characterizing HFs as comprehensive scores, and calculating aging costs using both comprehensive scores and residual equipment value. Further, we elaborated on the engineering application process for the proposed control strategy. In the simulation scenarios, this strategy prolonged the service life by 14.62%, reduced the overall aging cost by 6.61%, and improved module consistency by 21.98%, compared with the traditional equalized distribution strategy. In summary, the proposed strategy proves effective in elongating service life, reducing overall aging costs, and increasing the benefit of energy storage systems in particular application scenarios.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

Blood image intensity has been used to detect erythrocyte sedimentation rate (ESR). However, it does not give an information on biophysical properties of blood sample under continuous ESR. In this study, three physical properties, including, τ₀, ESR_τ, and AI_I, are suggested to quantify mechanical variations of blood under continuous ESR. To demonstrate the proposed method, blood sample is loaded into a driving syringe. The blood flow rate is set in a periodic on–off pattern. Blood sample is then supplied into a capillary chip, and microscopic blood images are captured at specific intervals. Blood shear stress is quantified from the interface of blood stream in the coflowing channel. Both τ₀ and ESR_τ are then obtained by analyzing the blood shear stress. Simultaneously, the AI_I is evaluated by analyzing the image intensity of blood flow. According to the experimental results, the τ₀ exhibits consistent trends with respect to hematocrit as well as diluent. The ESR_τ and AI_I showed a reciprocal relationship each other. Three suggested properties represented substantial differences for suspended blood samples (i.e., hardened red blood cells, different concentration of dextran solution and fibrinogen). In conclusion, the present method can detect variations of blood sample under continuous ESR effectively.

Establishing an effective evaluation model to analyze the actual environmental level of the multi-indicator systems is an urgent challenge. However, due to the complexity of the environmental system, the factors that determine the practical system are usually interrelated. To solve this problem, many methods have been proposed and verified. However, the disadvantage of unreasonable weight determination and only single-indicator assessment limits the practical application of these analysis methods. Here, we established an optimized entropy weight model and integrate it with the fuzzy comprehensive evaluation (FCE) method to quantify the complex environmental system. By introducing the linear programming method into the entropy weight solution, we can obtain high accuracy weight values and strong resistance to extreme data. Theoretical and simulation results demonstrate that our method can enhance the precision of weight calculation and evaluation results for multi-factor systems. Our work develops an effective method to quantify the complex environment system comprehensively and is significant to real applications of evaluation method.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Searching over a sorted list is a classical problem in computer science. Binary Search takes at most log2n+1 tries to find an item in a sorted list of size n. Interpolation Search achieves an average time complexity of Ο(loglogn) for uniformly distributed data. Hybrids of Binary Search and Interpolation Search are also available to handle data with unknown distributions. This paper analyzes the computation cost of these methods and shows that interpolation can significantly affect their performance — accordingly, a new method, Interpolation Once Binary Search (IOBS), is proposed. The experimental results show that IOBS outperforms the hybrids of Binary Search and Interpolation Search for nonuniformly distributed data.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

Innovations and improvements in hydraulic fracturing and horizontal well technologies have contributed to the success of the shale gas industry; however, the industry is also challenged by freshwater use and environmental health issues. Increasing water impact makes precise quantification of water consumption important. The objective in this study was to better understand water sustainability and availability of the projected shale gas from 2018 to 2030 in the Weiyuan play, China. The water footprint framework was used to quantify the potential water use and environmental impacts on different time scales. The results showed that the water use per well ranged from 11351.3 to 60664.73 m3, with a median of 36013.94 m3, totaling ~3.44 Mm3 for 97 wells. Yearly evaluation results showed that the gray water footprint was the main contributor and accounted for 83.82% to 96.76%, which was dependent on different scenarios of treatment percentages. The monthly environmental impact results indicated that the annual streamflow statistics were more likely to prevent water withdrawal. Water quality issues may be alleviated through recycling and retreatment measures that improve current waste water management strategies. Resource regulators should manage their water resources by matching water demand to water availability or replenishment.

The multidrug resistance transporter NorM is an important drug resistance pump and plays a critical role in multidrug resistance in bacteria and mammals. In this study we carried out molecular dynamics simulation to study the mechanism of Na+ binding and dynamical structures of two long loops in the substrate-releasing process in substrate binding NorM. Our simulation study identified several key residues (D41, E261 D377) along the Na+ binding pathway and a multi-state ion-binding mechanism is proposed based on the simulation study. In this proposed model, the transport of Na+ is a multi-stage process with D41 being the first station for binding to Na+, followed by Na+ binding to the second station E262 and finally to the cation-binding site of E262 and D377. During the transport of Na+, the transmembrane components TM1, TM7 and TM2 are rearranged to facilitate the ion transport as well conformational changes of NorM to a closed state. Further, substrate-bound simulation revealed that Loop3-4 and Loop9-10 control the substrate-releasing process.

This paper systematically discusses the application of reinforcement learning in automatic driving system. Reinforcement learning frameworks show significant advantages in optimizing decision making, predictive perception, path planning, and controller design, exceeding the limitations of traditional supervised learning methods. The paper highlights the critical role of components such as scene understanding, positioning, and map making in autonomous driving systems, which provide reliable environmental awareness through deep learning and sensor fusion technologies to support intelligent decision-making in complex urban environments. In addition, the paper discusses innovative approaches to safety reinforcement learning to reduce risk in autonomous driving and ensure that systems adhere strictly to safety constraints while maximizing expected rewards. These findings provide an important theoretical and practical basis for further improving algorithm robustness, managing multi-agent interactions, and integrating ethical considerations in the future.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Flexible implementations of Monte Carlo Tree Search (MCTS), combined with domain specific knowledge and hybridization with other search algorithms, can be a very powerful for the solution of problems in complex planning. We introduce mctreesearch4j, a standard MCTS implementation written as a standard JVM library following key design principles of object oriented programming. We define key class abstractions allowing the MCTS library to flexibly adapt to any well defined Markov Decision Process or turn-based adversarial game. Furthermore, our library is designed to be modular and extensible, utilizing class inheritance and generic typing to standardize custom algorithm definitions. We demon- strate that the design of the MCTS implementation provides ease of adaptation for unique heuristics and customization across varying Markov Decision Process (MDP) domains. In addition, the implementation is reasonably performant and accurate for standard MDP’s. In addition, via the implementation of mctreesearch4j, the nuances of different types of MCTS algorithms are discussed.

The surface velocity of the Amery Ice Shelf (AIS) is vital to assessing its stability and mass balance. Previous studies have shown that the AIS basin has a stable multi-year average surface velocity. However, spatiotemporal variations in the surface velocity of the AIS and the underlying physical mechanism remain poorly understood. This study combined offset tracking and DInSAR methods to extract the monthly average surface velocity of the AIS and obtained the inter-annual surface velocity from the ITS_LIVE product. An uneven spatial distribution in inter-annual variation of the surface velocity was observed between 2000–2022, although the magnitude of variation was small at less than 20.5 m/yr. The increase and decrease in surface velocity on the eastern and western-central sides of the AIS, respectively, could be attributed to the change in the thickness of the AIS. There was clear seasonal variation in monthly average surface velocity at the eastern side of the AIS between 2017–2021, which could be attributed to variations in the area and thickness of fast-ice and also to variations in ocean temperature. This study suggested that changes in fast-ice and ocean temperature are the main factors driving spatiotemporal variation in the surface velocity of the AIS.

In February 2004, the Food and Drug Administration (FDA) was the first to approve the combination of cisplatin (CDDP) and pemetrexed (PEM) as standard first-line chemotherapy for untreated, unresectable malignant pleural mesothelioma (MPM). However, after that approval, no progress was made in the standard first-line treatment of MPM for almost 15 years. Positive results from a phase 3 study (Mesothelioma Avastin Cisplatin Pemetrexed Study: MAPS) verifying the effect of bevacizumab, an anti-angiogenesis agent added to CDDP/PEM for unresectable MPM, were published in The Lancet in December 2015; however, this did not lead to approval by national drug regulatory agencies. Furthermore, no second-line treatment was established for cases refractory to CDDP/PEM. In August 2018, the Pharmaceuticals and Medical Devices Agency of Japan was the first in the world to approve monotherapy with nivolumab, an immune checkpoint inhibitor (ICI), for previously unresectable, advanced, or recurrent MPM. Following Japan, in October 2020, the FDA approved the combination of nivolumab and ipilimumab for the treatment of previously untreated, unresectable MPM. In this article, we review the transition of drug treatment for MPM, in light of the historical background, focusing on the benefits of ICIs.

Oleuropein, glycosylated secoiridoid present in olive leaves is known to be an important antioxidant phenolic compound. We studied the antioxidant effect of low doses of oleuropein aglycone (3,4-DHPEA-EA) and oleuropein aglycone peracetylated (3,4-DHPEA-EA(P)) in murine C2C12 myocytes treated with hydrogen peroxide (H2O2). Both compounds were used at a concentration of 10 μM and were able to inhibit cell death induced by the H2O2 treatment, with 3,4-DHPEA-EA(P) being more. Under our experimental conditions, H2O2 efficiently induced the phosphorylated-active form of JNK and of its downstream target c-Jun. We demonstrated, by Western blot analysis, that 3,4-DHPEA-EA(P) was efficient in inhibiting the phospho-active form of JNK. This data suggests that the growth arrest and cell death of C2C12 proceeds via the JNK/c-Jun pathway. Moreover, we demonstrated that 3,4-DHPEA-EA(P) affects the myogenesis of C2C12 cells; because MyoD mRNA levels and the differentiation process are restored with 3,4-DHPEA-EA(P) after treatment. Overall, the results indicate that 3,4-DHPEA-EA(P) prevents ROS-mediated degenerative process in a genomic and epigenomic manner by functioning as an efficient antioxidant.

Oleuropein, glycosylated secoiridoid present in olive leaves is known to be an important antioxidant phenolic compound. We studied the antioxidant effect of low doses of oleuropein aglycone (3,4-DHPEA-EA) and oleuropein aglycone peracetylated (3,4-DHPEA-EA(P)) in murine C2C12 myocytes treated with hydrogen peroxide (H2O2). Both compounds were used at a concentration of 10 μM and were able to inhibit cell death induced by the H2O2 treatment, with 3,4-DHPEA-EA(P) being more. Under our experimental conditions, H2O2 efficiently induced the phosphorylated-active form of JNK and of its downstream target c-Jun. We demonstrated, by Western blot analysis, that 3,4-DHPEA-EA(P) was efficient in inhibiting the phospho-active form of JNK. This data suggests that the growth arrest and cell death of C2C12 proceeds via the JNK/c-Jun pathway. Moreover, we demonstrated that 3,4-DHPEA-EA(P) affects the myogenesis of C2C12 cells; because MyoD mRNA levels and the differentiation process are restored with 3,4-DHPEA-EA(P) after treatment. Overall, the results indicate that 3,4-DHPEA-EA(P) prevents ROS-mediated degenerative process in a genomic and epigenomic manner by functioning as an efficient antioxidant.

Flap surgery is a common method used to cover defects following tumor ablation, trauma, or infection. However, insufficient vascularity in the transferred flap can lead to flap necrosis and failure. Proper postoperative monitoring is essential to prevent these complications. Recently, research has explored the use of infrared thermal imaging in plastic surgery, leading to its clinical application. This study investigates the use of a forward-looking infrared (FLIR) camera to monitor blood flow in flaps. In the study, 28 rats underwent reverse McFarlane flap surgery, and their flaps were analyzed using a FLIR thermal imaging camera seven days post-surgery. Additionally, thermal images of flaps were taken on postoperative days 0, 1, 2, 3, and 7 in 22 patients. The study focused on temperature differences between normal skin and the perforator compared to the average flap temperature. Results showed that the temperature difference was higher in the necrosis group and increased over time in cases of total necrosis. A lower perforator temperature compared to the flap's average indicated vascular compromise, potentially leading to flap failure. The FLIR camera, being contact-free and convenient, shows promise for understanding and inferring the clinical progression of flaps in postoperative monitoring.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

In order to better realize rural revitalization, this paper analyzes the spatial and temporal char-acteristics and influencing factors of agricultural surface source pollution in the Yangtze River Economic Belt from the three perspectives of government, enterprise and agriculture by using the spatial Durbin model and the dynamic GMM method in the period of 2006-2021, and further re-searches the threshold characteristics of the distortion of the factor market on the agricultural surface source pollution under the different strengths of environmental regulation. The results show that there is a positive spatial correlation between agricultural surface pollution in the Yangtze River Economic Belt, and government environmental regulation, input factor market distortion and labor force transfer all have a significant impact on agricultural surface pollution. Among them, factor market distortion has a significant spatial spillover effect on agricultural surface pollution in the Yangtze River Economic Zone, and has a significant single-threshold ef-fect on environmental regulation. Accordingly, the government should strengthen environmental regulation, continuously improve the agricultural factor market mechanism, and pay attention to the construction of talents to provide support for rural revitalization.

As an important organelle in eukaryotic cells, Golgi apparatus is responsible for processing and transporting proteins and lipids in cells. Precise monitoring the status of Golgi apparatus by targeting fluorescence imaging technology is of enormous importance but remains an attractive yet dramatically challenging task. In this study, we report the construction of the first Golgi apparatus targeted sensor with bright near-infrared fluorescence, termed as Golgi-Pdots. As a start point of our investigation, hydrophobic CDs with bright NIR fluorescence at 674 nm (fluorescence quantum yield : 12.18%), narrow emission band of 23 nm, and excellent stability were facilely prepared from Magnolia Denudata flowers through an ultrasonic method. Incorporating the CDs into a polymer matrix modified with Golgi-targeting molecules can produce the water-soluble Golgi-Pdots, which showed high colloidal stability and similar optical properties as compared to CDs. Further studies revealed that the Golgi-Pdots showed good biocompatibility and Golgi-targeting ability. Based on these fascinating properties, Golgi-Pdots have been successfully used for long term bioimaging of Golgi apparatus inside live cells.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Pleione is a genus of Orchidaceae and is one of the major sources of Pseudobulbus Cremastrae seu Pleiones (PCsP). It contains many constituents, such as phenanthrene, bibenzyl, glycoside, flavonoid and so on, which have plenty of bioactivities, including anti-tumor, anti-oxidation, anti-inflammatory, lowering glycemic levels and other pharma cological activities. In order to further utilize the edible and medicinal functions of Pleione, and clarify its medicinal active ingredients, this review systematically summarizes the constituents and pharmacological effects of Pleione, which will provide a theoretical foundation for the clinical application and new drug development．

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

The purpose of this study is to examine the relationship between the institutional investors which can affect financial performance for corporate sustainability on the income smoothing. Therefore, this study focus on the connection between the nature of stock rights and income smoothing in China. For this study, hypotheses were established on the relationship each state-controlled companies, income smoothing, and information equilibrium of individual investors, and empirical analysis was conducted through related variables. The analysis results are summarized in three categories as follows. First, this research finds that state-controlled firms (CONTs) prefer income smoothing activities compared to non-state-controlled firms for the long-term sustainable development of firms using data from 2011 to 2019. Second, this study found out that Institutional investors support the behavior of CONTs to smooth their earnings because this behavior is seen as an attempt by CONTs to convey valuable private information to other investors. Third, we was able to discover that institutional investors' monitoring effect is predominantly driven by pressure-resistant institutional investors. This research complements the lack of empirical research on income smoothing and enable to give a guideline that the type of stock rights is a critical key determinant of participation in income smoothing activities for stable growth and sustainability in the future.

Oleuropein, glycosylated secoiridoid present in the olive leaves, is known as an important antioxidant phenolic compound. We studied the antioxidant effect of low dose of oleuropein aglycone (3,4-DHPEA-EA) and oleuropein aglycone peracetylated (3,4-DHPEA-EA(P)) in murine C2C12 myocytes treated with hydrogen peroxide (H2O2). Both compounds were used at a concentration of 10 μM and were able to inhibit cell death induced by H2O2 treatment, with 3,4-DHPEA-EA(P) being more. Under our experimental conditions H2O2 efficiently induced the phosphorylated-active form of JNK and of its downstream target c-Jun. We demonstrated, by Western blot analysis, that 3,4-DHPEA-EA(P) was efficient in inhibiting the phospho-active form of JNK. This data suggest that growth arrest and cell dead of C2C12 proceeds via the JNK/c-Jun pathway. Moreover, we demonstrated that 3,4-DHPEA-EA(P) affects myogenesis of C2C12 cells; because the MyoD mRNA levels and the differentiation process are restored after treatment with 3,4-DHPEA-EA(P). Overall, the results indicate that 3,4-DHPEA-EA(P) prevents ROS-mediated degenerative process by functioning as an efficient antioxidant.

Abstract：Objective: To compare the effects of fermentation on the chemical composition of Gastrodia Tuder Halimasch Powder, and to provide a basis for the processing, processing and clinical application of this medicinal material. Methods: UHPLC-Q-Orbitrap HRMS was used to identify compound structure by comparing excimer ions, characteristic fragment ions and reference substances, and referring to relevant literature and database search. The main differential components were screened by orthogonal partial least squares-discriminant analysis (OPLS-DA), and the differential components were quantitatively studied by high performance liquid chromatography, and the differences in the types and contents of chemical components before and after fermentation were compared. Results: A total of 77 compounds were identified or preliminarily derived after fermentation, including 21 terpenes, 18 organic acids, 9 flavonoids, 7 nucleosides, 6 amides, 4 amino acids, 2 pyrrolidone derivatives, 2 sterols, 2 alkaloids and 6 others.Through high performance liquid chromatography, it was found that the content of daidzein genistein and ergosterol was significantly increased after fermentation, and a new component ergosterol was produced. Compared with Gastrodia Tuder Halimasch Powder before fermentation, the content of genistin and other components was significantly reduced, and there may be a process of genistin conversion to genistein.Conclusion: The fermentation process will have a certain influence on the types and contents of the chemical components of Gastrodia Tuder Halimasch Powder, and ergosterol, genistein and .daidzein may be the main pharmacodynamic components, which can provide a useful reference for the clinical rational application, quality control and mechanism of action of Gastrodia Tuder Halimasch Powder.

In this paper we study a class of impulsive delayed neural networks with parameter uncertainties and reaction-diffusion terms. Using the properties of M-matrices and some inequality techniques, some sufficient conditions are derived to guarantee the global exponential stability of the given system. The results obtained are presented by simple algebraic inequalities, which are certainly more concise than previous methods. Finally, the validity and usefulness of our results are illustrated by arithmetic examples.

Insulated Gate Bipolar Transistor (IGBT) may convey high current and sustain high breakdown voltages; it may provide high power control. In a sense, how IGBT demonstrates the capability of power control was not specifically described, and the equivalent bipolar junction transistors (BJT) activated by an applied bias to the insulated gate is intriguing. As seen in Figure 1, IGBT shows an equivalent circuit structure containing two types of BJT, (NPN-type Bipolar transistor and PNP-type Bipolar transistor), which can be modeled as diode-associated transistor. Apparently, as a bias applies to the controlling gate, the channel beneath the gate oxide gets strongly inversed and turns out to be conductive just like what happens on metal-oxide-silicon field effect transistor (MOSFET), which provides necessary igniting currents to both BJTs and thus causes high current gain flowing through them-selves from the bottom. A proposed and renewed formula provides addressing the above scenario and successfully fitting the measured data that forms the characteristic curves. Some parameters in the proposed formula, which includes size and mobility associated constant, threshold voltage, and Early-Voltage-related lambda for MOSFET, explain and explore the underlying physics. IGBT thus enjoy high input impedance and high current gain due to MOSFET (Insulated Gate) and BJT, respectively. This formula combines both merits of MOSFET and BJT in order to fit the measured data. Indeed, the formula intimately fits IGBT electrical characteristic curves, and thus may be qualified and served as a model. The new model is then advisable for designing power integrated circuit to exactly achieve power saving, power control, and power efficiency.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

The dilatometer curves of continuous cooling transformation of 12Mn steel were measured with Formastor-FⅡthermal mechanical simulator．The steel's undercooled austenite phase continuous cooling transformation curves ( CCT curves) were established by means of the dilatometer method and the metallographic-hardness measurement method． The effect of cooling rate on microstructure and hardness of the steel was studied． CCT curve of test steel was simulated by JMatPro. The results show that the Ac1 and Ac3 of the experimental steel are 692 ℃ and 855 ℃ ; the microstructure obtained is made of ferrite，pearlite and bainite．The ferrite transformation and pearlite transformation occur at a slower cooling rate，in which the ferrite is dominant. When the cooling rate is greater than 4.25 ℃ / s bainite transformation happens．As the cooling rate increases，microstructure or grains become finer．The hardness of the tested steel with increasing cooling rate shows a trend of first fast increase and soon decrease．The simulation results are consistent with the measured CCT law. The high temperature mechanical properties of 12mn steel round billet were tested by gleeble-1500d thermal / mechanical simulator. The tensile strength, reduction of area and stress-strain curves of the billet were obtained in the range of 600-1300 ℃.

Our understanding of pull-apart basins and their fault systems has been enhanced by analog experiments and simulations. However, there has been no opportunity to compare the faults that constitute pull-apart basins with surface ruptures during earthquakes. In this study, we investigated the effects of a 2018 earthquake (Mw 7.5) on a pull-apart basin in the Palu-Koro fault system, Sulawesi Island, Indonesia, using geomorphic observations in digital elevation models, optical correlation with pre- and post-earthquake satellite images. A comparison of active fault traces determined by geomorphology with the locations of surface ruptures from the 2018 earthquake shows that some of the boundary faults of the basin are inactive and that active faulting has shifted to basin-shortcut faults and relay ramps. We also report evidence of lateral spreading, in which alluvial fan materials moved around the end of the alluvial fan. These phenomena may provide insights for anticipating the location of future surface ruptures in pull-apart basins.

The high prevalence of human papillomavirus (HPV) infection in oropharyngeal squamous cell carcinoma (OPSCC) is well-established, with p16 expression being a strong predictor. HPV-related tumors exhibit unique mechanisms targeting p16 and p53 proteins. However, re-search on HPV prevalence and the combined predictive value of p16 and p53 expression in head and neck cutaneous squamous cell carcinomas (HNCSCC), especially in Asian populations, is limited. This retrospective study surveyed 62 HNCSCC patients (2011–2020), excluding those with facial warts or other skin cancers. All patients underwent wide excision and biopsy. Immuno-histochemical staining for HPV, p16, and p53 yielded both positive and negative results. The relevance of each marker was investigated by categorizing the tumor locations into high-risk (Area H) and mid-risk (Area M) zones based on recurrence frequency. Of the 62 patients, 20 (32.26%) were male, with an average age of 82.27 years (26–103). Area H included 19 cases (30.65%), with the eyelid and lip being the most common sites (five cases, 8.06%). Area M in-cluded 43 cases (69.35%), with the cheek being the most common site (29 cases, 46.77%). p16 ex-pression was positive in 24 patients (38.71%), p53 expression in 42 patients (72.58%), and HPV in five patients (8.06%). No significant association was found between p16 expression and HPV presence (p > 0.99), with a positive predictive value of 8.33%. This indicates that p16, a surrogate marker of HPV in OPSCC, is not a reliable marker for HPV in HNCSCC. This study enhances our understanding of the relationship between HPV, p53, and p16 in HNCSCC in Asian populations and offers valuable insights for further research.

Although promoting healthy eating is a policy objective, the controllability of dietary habits remains uncertain. The personal dietary patterns reflect many factors, of which some are relatively controllable for individual, and others are not. In this article, assuming that some sort of information about controllability of dietary habits is contained in the observed pattern of food consumptions, we focused on dietary pattern on its own. We introduced a statistical descriptive model for data on food frequency questionnaire, estimated strength of pairwise linkage between foodstuffs, and grouped foodstuffs by applying community detection to the networks of the estimated inter-food linkages. Those linkages represent co-movement of pairs of foods consumption. Furthermore, we demonstrated an analysis on the relationship between health of mind and dietary habits considering the aspect of controllability of dietary habits. Using an observational study in Japan, we obtained the following results: 115 foodstuffs were divided into 3 groups for both of genders, but the compositions were different by gender; in the analysis of mental health, some stress response items were associated with the dependence on some of those food groupings. As the grouping of foodstuffs based on our estimation depicted the internal structure of dietary habit that a healthy eating policy should regard as constraint, it follows that we should design the policy along the line with that grouping.

Building Information Modeling (BIM) has been one of the overwhelming trends in the worldwide. In Korea, from 2012, BIM application to the public construction projects worth more than $40 million was mandated. However, despite the policy, many public owners have hesitated to apply BIM to their projects. They generally view BIM very complex to manage and difficult to understand. While there have been diverse BIM guides as a reference, most of them have developed from BIM suppliers’ perspective involving certain deficiency in meeting the public owners’ taste. The public owners have addressed the necessity for developing an owner-oriented BIM guide on which they can understand the overall BIM procurement process thereby efficiently preparing their BIM service contracts. The main objective of this study is to develop the structure and contents guidance of the new guide to be developed that follows the public business process and mitigates the deficiency. To meet the research objective, a number of domestic and international BIM guides were analyzed and workshops were operated twice with the 12 BIM experts from the Korean construction industry. As a result of the study, a four-staged guide structure was developed consisting of the BIM service Scoping, Tendering, Executing, and Wrapping-up (STEW) guides.

Recommender Systems (RecSys) are crucial in managing information overload and enhancing user satisfaction across various digital platforms, including e-commerce and entertainment. Evolving from traditional models to Deep Neural Networks (DNNs) and, more recently, Large Language Models (LLMs), these systems leverage sophisticated algorithms to analyze user behaviors and preferences. LLMs, such as GPT-4, are trained on extensive datasets to comprehend and generate natural language, significantly advancing their ability to deliver personalized recommendations. This tutorial explores the transformative impact of LLMs on RecSys, discussing their development, application in handling complex datasets, and the integration of contextual insights. Real-world examples illustrate how LLMs enhance recommendation accuracy and user experience, highlighting challenges and future directions in the field.