Vibrotactile displays have been reported effective in enhancing awareness of flight attitude for pilots and releasing other heavily loaded sensory channels. Although some work have been done on vibrotactile coding of flight altitude, there is lack of a systematic investigation into coding methods with combination of multiple coding parameters. In this paper, seven coding methods with combinations of multiple coding parameters (location, rhythm, intensity, and mode) were systematically studied to cue flight attitude for pilots with a vibrotactile vest. We conducted two psychophysical experiments in a static tactile sensory environment in which the attitude commands in the form of vibrotactile feedback are presented randomly, and quantitatively evaluated the effectiveness of the vest according to the users’ recognition accuracy, reaction time and information transfer rate. The results show that vibrotactile vest is effective to cue attitude information. The preferred coding method with combinations of location, rhythm and mode allowed users to perform with lowest reaction time and highest recognition accuracy and yield about 255 bits/min of information transfer rate. Overall, the presented work provides valuable insights and guidance for the design of haptic displays for vibrotactile aids for the pilots.

Large aluminum alloy ring forgings are the core components of heavy-duty rocket fuel storage tanks, and the large residual stress inside the rings leads to poor shape accuracy of large thin-walled parts. The initial stress of the 2219 aluminum alloy ring blank was tested using the drilling method, and the creep constitutive coefficient of the 2219 aluminum alloy was determined through stress relaxation tests. The numerical simulation processes of thermal stress relief (TSR), vibration stress relief (VSR), and thermal-vibration stress relief (TVSR) were compared and established. Through the correlation analysis between the actual measurement results of residual stress and the simulation results, it can be seen that the strong correlation in three directions at each measurement point accounts for over 37.5%, and the moderate correlation accounts for over 62.5%. This indicates that the numerical simulation model of 2219 aluminum alloy ring containing initial residual stress can accurately reflect the size and distribution of residual stress inside the actual ring. The simulation results show that the derived constitutive model can describe the stress relaxation process of TVSR by combining a single thermal time effect stress relaxation constitutive theory with a VSR plastic deformation material model. The simulation models established above were used to calculate the residual stress homogenization ability of three types of aging. The results showed that VSR, TSR, and TVSR can homogenize and reduce the residual stress field inside the ring, improve the distribution of residual stress inside the ring, and have a better overall homogenization ability of TVSR. The VSR control has a certain effect on reducing and homogenizing residual stress, but compared with TSR and TVSR, the reduction and homogenization ability of residual stress control is limited. The homogenization control effect TVSR>TSR>VSR, and the maximum equivalent stress homogenization rates of VSR, TSR, and TVSR are 52.8%, 80.6%, and 82.2%, respectively. Then, numerical simulation technology is used to study how the initial residual stress in the blank will cause the deformation of the ring during the thin-walled machining process. The roundness error theory of the minimum containment area method is applied to evaluate the deformation degree during the thin-walled numerical machining process, and the TVSR method is used for stress regulation. The deformation law of the thin-walled machining of the ring under different aging parameters is studied.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

The present study employed a modifed QuEChERS method to systematically analyze the presence of fifteen Quinolones and seven Tetracyclines antibiotic residues in local animal food. Additionally, a multi-level-four-factor Box-Behnken design (BBD) within the framework of Response surface methodology (RSM) was utilized to evaluate the various factors affecting the detection efficiency of the sample pretreament procedure. The optimization was performed by Design Expert®, the factors including volume of the acetonitrle, the addition of formic acid, the duration of extract and the addition of EDTA were combined to experiment design until reach an optimal solution. Finally, the sample test was conducted by ultra-high performance liquid chromatography-quadrupole-linear ion trap mass spectrometry in both multiple reaction monitoring (MRM) and enhanced product ion (EPI) scan modes on a QTRAP® 5500 instrument. The overall average recoveries from actual samples fortified with 22 antibiotics at three levels ranged from 74.7 to 122.6% based on the use of matrix-fortified calibration with the variation ranging from 2.1 to 18.2% (n=6). The limits of detection and quantification were 0.3 μg kg-1 and 1.0 μg kg-1, respectively.

Objective: To assess the recovery of voice in patients with unilateral vocal cord paralysis after thyroid surgery following treatment with nursing intervention combined with voice training. Methods: Thirty patients with unilateral vocal cord paralysis and hoarseness for 6-12 months post-thyroid surgery were selected. They first underwent two weeks of psychological and cognitive intervention, followed by a psychological resilience assessment, and then proceeded with 12 weeks of voice training. This training primarily included muscle relaxation exercises, breathing training, and phonation exercises. A comparative analysis was conducted on the patients' voice parameters before and after the training, including jitter, shimmer, maximum phonation time (MPT), noise to harmonic ratio (NHR), and the Voice Handicap Index (VHI) scores. Results: After psychological and cognitive intervention, scores for optimism, resilience, and self-strength among the 30 patients increased. Post-voice training, reductions were observed in jitter, shimmer, NHR, and VHI scores, the Maximum Phonation Time (MPT) increased compared to pre-training, with the difference being statistically significant (P<0.05). Conclusion: Nursing intervention combined with voice training can effectively improve voice quality in patients with unilateral vocal cord paralysis after thyroid surgery.

The variable-length arbitrary Lagrange-Euler (ALE)-ANCF finite element, which employ nonrational interpolating polynomials, cannot exactly describe the rational cubic Bezier curves such as conic and circular curves. The rational absolute nodal coordinate formulation (RANCF) finite element, whose reference length (undeformed length) is constant, can exactly represent the rational cubic Bezier curves. A new variable-length finite element called the ALE-RANCF finite element, which is capable of accurately describe the rational cubic Bezier curves, is proposed by combining the desirable features of the ALE-ANCF and RANCF finite element. In order to control the reference length of ALE-RANCF element within a suitable range, element segmentation and merging schemes are proposed. It is demonstrated that exact geometry and mechanic is maintained after the ALE-RANCF element is divided into two shorter ones, and compared with the ALE-ANCF elements, there are smaller deviations and oscillations after two ALE-RANCF elements are merged into a longer one. Numerical examples are presented and the feasibility and advantages of the ALE-RANCF finite element are demonstrated.

In order to reduce the vibration of the transporter and improve the stability of the transporter, the vibration characteristics and key structure optimization research of the mountain orchard transporter are carried out. In this paper, the vibration of electric monorail transporters under different working conditions is tested, and the causes of vibration generated by monorail transporter during operation are explored. The three-dimensional model of the trailer and transmission box is established using Solidworks, and the modal vibration modes of the structure are analyzed theoretically. The modal test system is used for modal test analysis of trailers and transmission boxes. By comparing the results of finite element and experimental modal analysis, the second-order frequency of the trailer is close to the motor's rotating excitation frequency of 50 Hz at rated speed, which is easy to generate resonance. By optimizing the structure of the trailer, the second and third natural frequencies are increased to 54.79 Hz and 58.35 Hz respectively, which avoid the resonance of the trailer during operation and effectively reduce the vibration generated during the transportation of the trailer. Through vibration testing of the optimized electric monorail transporter, the results of vibration testing before and after structural optimization are compared and analyzed, and it is found that the vibration amplitudes of the transporter in X, Y and Z directions are reduced by 0.308m/s², 0.351m/s² and 0.334m/s² respectively, the running stability of the conveyer is improved.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

This study presents a novel approach to enhance Large Language Models (LLMs) like Alpaca by dynamically integrating real-time information. This method addresses the issue of content hallucination and data relevancy by automatically collecting and integrating current data from credible sources into model prompts. Experiments show a significant improvement in accuracy and a decrease in content hallucination, with a manageable increase in response time. The research underscores the potential of real-time data integration in making LLMs more accurate and contextually relevant, setting a foundation for future advancements in dynamic data processing in AI.

Negative corona discharges occur widely in high voltage transmission lines and charged aircraft, which can cause strong electromagnetic interference. Negative corona discharge is typically performed simultaneously at multiple discharge points. In this study, the current and its EM radiation characteristics of single-needle and multi-needle negative corona discharge in different conditions were tested. The current and electromagnetic radiation characteristics of the two discharge structures were compared. The dipole radiation model was established to analyze the EM radiation characteristics of the negative corona discharge.The results show that, It is only when the voltage reaches a certain threshold that the current and electromagnetic radiation fields of the multi-needle discharge structure will be superimposed and their amplitudes will increase significantly. The frequency of electromagnetic radiation signal does not change with the number of needles, cathode geometry and applied voltage, but only depends on ambient pressure. It provides a basis for detecting corona discharge sources under different conditions.

In this paper, four types of open service signals of BDS-3 satellite (B1I, B1C, B2a, and B3I) and B2I signals broadcasted by BDS-2 satellites were used in the time frequency transfer and positioning experiments with signal coexisting in BDS system, and the single frequency PPP (precise point positioning) method was used. Modified GRoup And PHase Ionospheric Correction (GRAPHIC) method was proposed and verified by the experiment. The results show that 18 selected stations can achieve decimeter-level positioning results with single frequency. Compared with the general observation method, the proposed modified GRAPHIC method improves the stability and precision of positioning and timing significantly, and the positioning accuracy of 5 frequency signals is increased 40.4%, 32.2%, 80.3%, 12.4%, and 10.3%, respectively. The frequency stability can reach the same accuracy as that of dual-frequency with BDS in the current state.

For enhancing the efficiency of cantilever casting the construction in the bridge, a novel rhombus traveling track of hanging basket was developed and optimized. The civil software titled Midas was applied to analyse the mechanical properties of the hanging basket with full load and control load. The strength and distortion of the walking mechanism were within the specified range when the maximum beam unit internal force of 149.69Mpa, which was less than the allowable stress of steel 175Mpa, and the anti-overturning safety factor of the hanging basket was 2.5 to meet the requirements. Through the comparative analysis of the key components and the finite element calculation, it was found that there was about 30% redundancy in the structure performance. Therefore, further optimization of each structure was carried out, and the front elevation of the main truss of 20° was achieved. It obtained the best performance in all aspects.

These days, numerous organizations and Analysis Centers (AC) offer various Ambiguity Resolution (AR) products using various methodologies. To use it for time-frequency transfer, there is no associated study. This paper chooses 16 MGEX stations with external high-precision atomic clocks to constitute 15 international time comparison links and uses AR products data from CNES, SGG, CODE, and PRIDE laboratory, using three ambiguity-fixed strategies, to thoroughly evaluate the effects of various strategies and AR products for high-precision time-frequency transfer. We reach the following results by using the IGS final clock product as a reference and comparing it to ambiguity-float. With various ambiguity-fixed procedures, the time stability STD of time transfer is increased for a single GPS, and the improvement ranges from 10% to 40%. The frequency stability has barely improved; up to 40%, the most notable improvement comes from FCB with GRM products. The time stability STD of combinations has improved after the addition of the Galileo system compared to the single GPS, and the improvement ranges from 2% to 9%. Most strategies have improved, while a few techniques have weakened with the GEC (GPS+Galileo+BDS) combination. We feel that the stability has not significantly increased with the system's increase within short-term stability after comparing multiple groups of linkages.

A fast algorithm is established to transform points of the unit sphere into fundamental region symmetrically. With the resulting algorithm, a flexible form of invariant mappings is achieved to generate aesthetic patterns with symmetries of the regular polyhedra. This method avoids the order restriction of symmetry groups, which can be similarly extended to treat regular polytopes in n-dimensional space for n>=4.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

To improve the measurement accuracy of three-dimensional rotation angle of the spherical joint, a novel approach is proposed in this study, which combines the magnetic detection by Hall sensor and surface feature identification by eddy current sensor. Firstly, a permanent magnet is embedded in the ball head of spherical joint, and Hall sensors are set and distributed in the ball socket to measure the variation of magnetic flux density when spherical joint rotating, which are related to 3D rotation angle. In order to further improve measurement accuracy and robustness, we also set grooves on the ball head and use eddy current sensors to synchronously identify the rotation angle of the ball head. After the combination of two signals is adopted, a measurement model is established using the RBF neural network by training, and realized real-time measurement of the 3D rotation angle of spherical joint. The feasibility and superiority of this method are validated through experiments. The experimental results indicated that the measurement accuracy is promoted substantially compared to the preliminary measurement scheme based on spherical coding, the average measurement error of single axis is reduced by 9'9". The root mean square errors for the measurement of 3D rotation angles in this proposed method are as follows: the pitch angle α has an error of 1'8", the yaw angle β has an error of 2'15", and the roll angle γ has an error of 29'6".

The node position information is critical in the wireless sensor network (WSN). However, the existing positioning algorithms commonly have low positioning accuracy because of noise interferences in communication. To solve this problem, this paper presents an iterative positioning model based on distance correction to improve the positioning accuracy of the target node in WSN. First, the log-distance distribution model of received signal strength indication (RSSI) ranging is built and the noise impact factor is derived based on the model. Second, the initial position coordinates of the target node are obtained based on the triangle centroid localization algorithm, thereby calculating the distance deviation coefficient under the influence of noise. Then, the ratio of the distance measured by the log-normal distribution model to the median distance deviation coefficient is taken as the new distance between the anchor node and the target node. Based on the new distance, the triangular centroid positioning algorithm is used again to calculate the target node coordinates. Finally, the iterative positioning model is constructed, and the distance deviation coefficient is updated repeatedly to update the positioning result until the set number of iterations is reached. Experiment results show that the proposed iterative positioning model can improve positioning accuracy effectively.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

Chrysanthemum tea, a typical health tea with the same origin as medicine and food, is famous for its unique health benefits and flavor. To clarify the influence of metabolites of different varieties of chrysanthemum tea on the formation of taste and quality differences, nontargeted metabolomics combined with electronic tongue analysis were used to characterize the correlation between metabolites profiles and taste characteristics of different quality chrysanthemum tea. Thirteen metabolites were identified as the key metabolites of the sensory quality difference between Huangju and Jinsi Huangju tea. Kaempferol, luteolin, genistein, and some quinic acid derivatives were correlated with the ‘astringent’ and taste attributes. In contrast, l-(-)-3 phenyllactic acid and L-malic acid were found to be the ‘bitterness’ and ‘umami’ in chrysanthemum tea. KEGG pathway enrichment analysis showed that the flavonoid and flavonol biosynthesis pathway had important effects on the sensory quality of chrysanthemum tea.

The aim of this study was to examine usual daily micronutrient intake of Chinese children based on data from the 2011 China Health and Nutrition Survey. We analyzed data from 4 to 17-year-old participants, who provided dietary data on 3 consecutive days combined with the household weighing method in 2011. Usual daily intake of each nutrient was estimated using a mixed effects model based on the China Food Composition published in 2002 and 2004. The means, medians and percent below Estimated Average Requirements (EAR) were reported for selected micronutrients, including calcium, sodium, potassium, iron, zinc, selenium, vitamin A, thiamine, riboflavin and vitamin C. For sodium and potassium, means and the distribution of intakes were compared to the Adequate Intake (AI) level. The average usual daily intakes of all micronutrients increase with age and the intakes of boys higher than girls in the same age group. The average of calcium intakes increased from 272mg/d in 4-6y to 391mg/d in 14-17y, but the percentage of inadequate calcium intake remained very high (>96%). The prevalence of inadequacy of calcium was the highest among the mineral nutrients reported in this study. As the requirement of micronutrient increased with age, the percentage of subjects with inadequate intake increased in 11-17 age groups. Among the 14-17y, the percentages of study participants with dietary intakes of calcium, iron, zinc, selenium, vitamin A, thiamine, riboflavin and vitamin C below the EAR were 96.8%, 18.8%, 37.6%, 72.8%, 36.8%, 91.8%. 85.9% and 75.5%, respectively. Among the 11-13y, the percentages of study participants with dietary intakes of iron, zinc and vitamin A below the EAR were 23.5%, 41.5%, and 41.6%, respectively. Thus, the micronutrients deficiency is a problem in Chinese Children. Nutrition education and intervention programs are needed to address the nutritional gaps.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

Tropical island countries are often highly populated and deliver immense ecosystem service benefits. As human wellbeing depends on these ecosystems proper management is crucial in the resource-rich tropical lands where related research is less. Though the ecosystem service and biodiversity studies are a promising path to inform the ecosystem management for these mostly developing countries published evidence of using ecosystem service studies in decision-making is lacking. The purpose of this study is to provide an overview of ecosystem services and related research in Sri Lanka examining trends and gaps and how these studies are conceptualized. Out of considered 139 peer-reviewed articles majority of articles 42.4% were terrestrial and forest related while coastal ecosystems were considered in 34.5% of studies. In most studies, the ecosystem service category was provisioning (33.8%) followed by regulatory service (30.9%). Studies investigating and quantifying ecosystem services, pressures on ecosystems, and their management were fewer compared to studies related to biodiversity or species introduction. Moreover, studies investigating the value of ecosystem services and biodiversity to the communities or involvement of stakeholders in the development of management actions regarding the ecosystem services were rare in Sri Lanka and intense focus of future studies in these aspects are timely and necessary.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Cell-to-cell distant mechanical communication has been demonstrated by using in-vitro and in-vivo models. However, the molecular mechanisms underlying long-range cell mechanoresponsive interactions remain to be more elucidated. This study further examined the roles of α-Catenin and Piezo in traction force-induced rapid branch assembly of airway smooth muscle (ASM) cells on Matrigel hydrogel containing type I collagen. Our findings demonstrate that siRNA-mediated downregulation of α-Catenin or chemical inhibition of Piezo activity significantly reduced both cell directional movement and branching assembly. In regarding the role of N-cadherin in regulating branch assembly but not directional migration, our results further confirmed that siRNA downregulation of α-Catenin caused a remarked reduction of focal adhesion formation, as assessed by focal Paxillin and Integrin α5 localization. These observations implied that mechanosensitive α-Catenin was involved in both cell-cell and cell-matrix adhesions. Additionally, Piezo showed partial localization with Paxillin in focal adhesions, which was inhibited by α-Catenin downregulation with siRNA. This provides a plausible clue for Piezo mechanosensing traction force in the hydrogel. Collectively, our findings highlight the significance of α-Catenin in regulating cell-matrix interactions along with possible interpretation for Piezo mechanosensation at focal adhesions during cell-cell distant mechanical communication.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

The homeostasis of cellular calcium is fundamental for many physiological activities, while calcium levels maintain inhomogeneous within cells. During the onset of asthma, epithelial and inflammatory cells secrete platelet derived growth factor (PDGF), inducing proliferation and migration of airway smooth muscle (ASM) to the epidermal layer, narrowing the airway. The regulation of ASM cells by PDGF is closely related to the conduction of calcium signals. In this work, we generated subcellular-targeted FRET biosensors to investigate calcium regulations at different compartments of ASM cells. PDGF-induced cytoplasmic calcium [Ca2+]C increase was attributed from both extracellular calcium influx and endoplasmic reticulum (ER) calcium [Ca2+]ER release, which was partially regulated by PLC-IP3R pathway. Interestingly, removal of extracellular calcium influx led to inhibited ER calcium release, likely through inhibitory effect on calcium-dependent activation of ER ryanodine receptor. Inhibition of L-type calcium channel on plasma membrane, or SERCA pump on ER resulted in both reduced [Ca2+]C and [Ca2+]ER from PDGF stimulation, while IP3R channel inhibition led to reduced [Ca2+]C only. Inhibited SERCA pump caused immediate [Ca2+]C increase and [Ca2+]ER decrease, indicating an active calcium exchange between cytosol and ER storage in resting cells. PDGF-induced calcium at outer mitochondrial membrane sub-region showed similar regulatory response to cytosolic calcium, not influenced by inhibition of mitochondrial calcium uniporter channel. Therefore, our work identified calcium flow pathways among extracellular medium, cell cytosol, and ER by regulatory calcium channels. Particularly, extracellular calcium flow has an essential function to fully activate ER calcium release.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

β-glucosidases (BGLs) play a crucial role in the degradation of lignocellulosic biomass as well as in industrial applications such as pharmaceuticals, foods, and flavors. However, the application of BGLs has been largely hindered by issues such as low enzyme activity, product inhibition, low stability, etc. Many approaches have been developed to engineer BGLs to improve these enzymatic characteristics to facilitate industrial production. In this article, we review the recent advances in BGL engineering in the field, including the efforts from our laboratory. We summarize and discuss the BGL engineering studies according to the targeted functions as well as the specific strategies used for BGL engineering.

As novel materials for carbon capture, phase change solvents can separate into two immiscible phases during the CO2 capturing procedure under a certain temperature. The solvent systems can significantly decrease the energy consumption since the solvents can be regenerated by only heating the rich-CO2 phase. In this work, amino acid ionic liquids (AAILs) were synthesized using quaternary ammonium salts and amino acids as raw materials, and the aqueous solutions were prepared as novel liquid-solid phase change solvents. The results showed that the solvents had excellent CO2 absorption capacity, and the AAILs functionalized by glycine and tryptophan exhibited significant phase change properties. The mechanism of phase-change of the solvent were mainly due to the lower solubility of the product after reaction between AAILs and CO2. The solvent with tryptophan as anion could be regenerated by only heating the CO2-riched solid phase, which might significantly decrease energy consumption of regeneration. And the absorbent could be reused with the regenerated absorption ratio up to 79%. The solvent system has great potential in industrial application due to the easy operation process and efficient recycling ability.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Trehalose is a non-reducing disaccharide and participates in physiological activities such as or-gan formation, energy metabolism, and stress resistance of insects. In the present study, phylo-genetic analysis divided 21 Bmtret1 orthologs into three clades. These genes are equally distrib-uted on the nine chromosomes. Cis-elements in the promoter regions of Bmtret1s indicated the possible function of Bmtret1s in response to hormones and environmental stimulus. The qPCR analysis showed the significantly different expression levels of Bmtret1s in different tissues and organs, indicating possible functional divergence. In addition, most Bmtret1s showed disturbed expression levels in response to BmNPV stresses. Our results provide a foundation for further functional dissection of Tret1s in Bombyx mori and implicate them as potential regulators for an-tiviral responses.

In the contemporary world of science, continuous observation of specific fixed regions is required, awaiting the emergence of targets or phenomena within those areas to locate and identify them. Astronomy requires continuous monitoring of stars, swiftly pinpointing occurrences, such as flares, and acquiring their spectral data to aid identification. In military contexts, continuous observation of specific areas is essential for promptly locating enemy movements and obtaining target spectral data for deciphering enemy disguises. Additionally, continuous observation of experimental samples in biochemistry is mandatory to pinpoint localized changes and acquire spectral data from those areas. Hence, this paper develops a novel imaging spectrometer solution to monitor localized regions continuously. Specifically, this paper first elaborates on the developed instrument’s characteristics and optical structure, followed by optical design software simulations. The instrument has an F-number of 5, a focal length of 100mm, and a field of view covering the wavelength range from 400nm to 600nm. The optical path diagram indicates that the system’s dispersion and imaging images can be separated, meeting the system’s requirements. Besides, the Modulation Transfer Function (MTF) graph confirms that the image quality meets the requirements. Furthermore, a region-monitoring type imaging spectrometer was constructed to assess the instrument’s capability for spectral observation of fixed regions. The instrument can detect a fixed area, with the target placed within the detection area. Spectral data were successfully obtained by conducting image processing on the acquired images. The correlation coefficient between this data and reference data was as high as 0.9226, indicating the instrument’s successful measurement of the target’s spectrum. Thus, the developed instrument demonstrated that it can image the observed areas and acquire spectral data from targets within those regions.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

In this paper we study a class of impulsive delayed neural networks with parameter uncertainties and reaction-diffusion terms. Using the properties of M-matrices and some inequality techniques, some sufficient conditions are derived to guarantee the global exponential stability of the given system. The results obtained are presented by simple algebraic inequalities, which are certainly more concise than previous methods. Finally, the validity and usefulness of our results are illustrated by arithmetic examples.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

The Chinese honeybee (Apis cerana cerana) sacbrood virus (CSBV) causes death of larvae and colony collapse, and could damage the beekeeping industry in China. We sequenced complete genomes of CSBV strains derived from the Maerkang area, Wenjiang area, and Wanyuan area of Sichuan province of China. The genome length of CSBV strains from Sichuan was 8863bp, and it contained one complete Open Reading Frame of a gene with 8544 bp that encoded a protein with 2848 amino acids. The (G+C) % and (A+T) % composition ranged from 40.6 to 40.7 and 59.3 to 59.4, respectively. A phylogenetic tree was constructed using the three CSBV strains and previously reported SBV and CSBV sequences from other regions. We found that viral strains clustered based on their region of origin and host species. The genetic sequences of the CSBV strain from Maerkang were 98.7% and 99.6% similar to CSBV strains from Wanyuan and Wenjiang, respectively. In addition, CSBV from Maerkang had 88.4%-95.2% sequence similarity to previously published genomes of CSBV or SBV from other areas. The VP1 gene sequenced in our study had a 43 bp deletion compared to VP1 sequences of CSBV from other regions in Asia. We detected 10 antigenic determinants on the VP1 protein of CSBV form Aba. Our study provides new insight into the diversity of CSBV strains in China and may help with identifying methods to prevent infection of honeybee colonies.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

This paper proposed emotion recognition methods for consecutive facial images, and implements the inference of neural network model on a field-programmable gate array (FPGA). The proposed emotion recognition methods are based on a neural network model architecture that combines convolution neural networks (CNNs), long short-term memory (LSTM), and fully connected neural networks (FCNNs), called CLDNN or ConvLSTM-FCN. This type of neural network mod-el can analyze the local feature sequences obtained through convolution of data, making it suita-ble for processing time-series data such as consecutive facial images. In this paper, sequences of facial images are sampled from videos corresponding to various emotional state of subjects. The sampled images are then pre-processed with the processes includes facial detection, greyscale conversion, resize, and data augmentation if necessary. The 2-D CNN in ConvLSTM-FCN is used for feature extraction for these pre-processed facial images. These sequences of facial im-age features are time sequences with dependent properties between the elements within them. The LSTM is then used to model these time sequences followed by fully connected neural net-works (FCNNs) for classification. The proposed consecutive facial emotion recognition method achieves an average recognition rate of 99.51% on RAVDESS dataset, 87.80% on BAUM-1s dataset and 96.82% on eNTERFACE’05 data set, using 10-fold cross-validation on the PC. Some com-parisons of recognition accuracies between the proposed method and the other existing related works are conducted in this paper. According to the comparisons, the proposed emotion recog-nition methods outperform the existing related researches. The proposed emotion recognition methods are then implemented on an FPGA chip using the neural network model inference algo-rithms in this paper, and the accuracies of the experiments conducted on the FPGA chip are iden-tical to those obtained on the PC. This verifies that the proposed neural network model imple-mented on the FPGA chip performs well.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

In this paper, a novel microwave catalyst Ni@SiC/CNFs (NSC), C/Ni (NC), and C/SiC (SC) were successfully synthesized by electrostatic spinning method, and proved to degrade methylene blue with high efficiency under microwave irradiation. The results imply that the catalyst Ni@SiC/CNFs with double shell structure gave a 99.99 % removal rate in 90 s for the degradation of methylene blue under microwave irradiation, outperformed the C/Ni and C/SiC and most other reported catalysts in similar studies. On the one hand, the possible mechanism of the methylene blue degradation should be ascribed to that double shell structure increases the polarization source of the material, resulting in excellent microwave absorption properties; and on the other, the in-situ generation of active species OH• and O2 - under microwave radiation and the synergistic coupling effect of metal plasma greatly improved the degradation efficiency of methylene blue. The findings of this study could provide a valuable reference for the green degradation of industrial dye wastewater and its sustainable development process.

To guide analysts to select the right tool and parameters in differential gene expression analysis of single-cell RNA sequencing (scRNA-seq) data, we developed a novel simulator that recapitulates the data characteristics of real scRNA-seq datasets while accounting for all the relevant sources of variation in a multi-subject, multi-condition scRNA-seq experiment: the cell-to-cell variation within a subject, the variation across subjects, the variability across cell types, the mean/variance relationship of gene expression across genes, library size effects, group effects, and covariate effects. By applying it to benchmark 12 differential gene expression analysis methods (including cell-level and pseudo-bulk methods) on simulated multi-condition, multi-subject data of the 10x Genomics platform, we demonstrated that methods originating from the negative binomial mixed model such as glmmTMB and NEBULA-HL outperformed other methods. Utilizing NEBULA-HL in a statistical analysis pipeline (https://github.com/interactivereport/scRNAseq_DE) for single cell analysis will enable scientists to better understand cell-type specific transcriptomic response to disease or treatment effects and to discover new drug targets. Further, application to two real datasets showed the outperformance of our differential expression (DE) pipeline, with unified findings of differentially expressed genes (DEG) and a pseudo-time trajectory transcriptomic result. In the end, we made recommendations of filtering strategies of cells and genes based on simulation results to achieve optimal experimental goals.

The effect of low cycle fatigue (LCF) pre-damage on the subsequent very high cycle fatigue (VHCF) behavior is investigated in TC21 titanium alloy. LCF pre-damage is applied under 1.8% strain amplitude up to various fractions of the expected life and subsequent VHCF properties are determined using ultrasonic fatigue tests. Results show that 5% of LCF pre-damage insignificantly affects the VHCF limit due to the absent of pre-crack, but decreases the subsequent fatigue crack initiation life estimated by Pairs’ law. Pre-cracks introduced by 10% and 20% of LCF pre-damage significantly reduce the subsequent VHCF limits. The crack initiation site shifts from subsurface-induced fracture for undamaged and 5% of LCF pre-damage specimens to surface pre-crack for 10% and 20% of LCF pre-damage specimens in very high cycle region. The fracture mechanism analysis indicate that LCF pre-crack will re-start to propagate under subsequently low stress amplitude when stress intensity factor of pre-crack is larger than its threshold. Furthermore, the predicted fatigue limits based on EI Haddad model for the LCF pre-damage specimens well agree with the experimental results.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

Public safety and intelligent surveillance systems critically depend on anomaly behavior detection for effective monitoring. In real-world pedestrian detection scenarios, prevalent challenges such as missed detections, complex background interference, and small target sizes hinder accurate anomaly identification. To address these issues, this study introduces YOLO-ABD, a lightweight method for anomaly behavior detection that integrates small target detection and channel shuffling. This method employs YOLOv8n as the baseline model, incorporating a small target detection mechanism in the Head part and utilizing GSConv convolution in the Backbone to enhance perceptual capability. Additionally, the SimAM attention mechanism is integrated to mitigate complex background interference, thereby improving target detection performance. Evaluation on the IITB-Corridor dataset demonstrated mAP50 and mAP50-95 scores of 89.3% and 60.6%, respectively. Generalization testing on the street-view-gdogo dataset further highlighted the superiority of YOLO-ABD over advanced detection algorithms, underscoring its effectiveness and generalizability. With a relatively small parameter count, YOLO-ABD presents an excellent lightweight solution for pedestrian anomaly behavior detection.

Antibiotic resistance (ABR) is concerning issue due to its direct and indirect repercusions on public health, since decreased therapeutic effect of certain antibiotic to treatment complications that can cause death. There are several mechanism as to how ABR can be transferred from one microoorganisms to another, and many of them are dependant many environmental factors. The food supply chain is a environment in which ABR gene transfer can occur is multiple pathways, which generate concerns regarding food safety. Here, we summarize relevant mechanisms which are implied in ABR in food supply chain but also we are addressing routes of transmission and prevalence of ABR, implications on public health, and the application of new alternatives to antibiotics such as antimicrobial peptides, mainly bacteriocins, in order to countermeasure ABR.

The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.

C-terminal Src kinase (CSK) is the major inhibitory kinase for Src family kinases (SFKs) through phosphorylation of their C-tail tyrosine site, and regulates various cellular activities in association with SFKs functions. As a cytoplasmic protein, CSK need be recruited to the plasma membrane to regulate SFKs activities. The regulatory mechanism for CSK activity and its subcellular localization remains largely unclear. In this work, we developed a genetically encoded biosensor based on fluorescence resonance energy transfer (FRET) to visualize CSK activity in live cells. The biosensor with optimized substrate peptide confirmed crucial Arg107 site in CSK SH2 domain, and displayed sensitivity and specificity to CSK activity while little responses to co-transfected Src and Fyn. FRET measurements showed CSK having relatively mild level of kinase activity in comparison to Src and Fyn ones in rat airway smooth muscle cells. The biosensor tagged with different submembrane-targeting signals detected CSK activity at both non-lipid raft and lipid raft microregions, while showed higher FRET level at non-lipid ones. Co-transfected receptor-type protein tyrosine phosphatase alpha (PTPα) had inhibitory effect on the CSK FRET response. The biosensor didn’t detect obvious changes of CSK activity between metastatic cancer cells and normal ones. In conclusion, a novel FRET biosensor was generated to monitor CSK activity, and demonstrated CSK activity existing in both non-lipid and lipid raft membrane microregions while more present at non-lipid ones.

Abstract：This paper uses the balanced panel data from 29 provinces (autonomous regions and municipalities) in China for a total of 17 years from 2000 to 2016 as a research sample, and establishes an empirical model to examine the impact of environmental regulations and technological innovation on the quality of economic growth. Then this paper test technological innovation as a threshold variable, in which play a regulatory role. Taking the provincial balanced panel data as a research sample, a fixed effect model, a system GMM model, and a panel threshold model were established for empirical testing and the robustness test. Based on the empirical results, this article draws the following conclusions: from a national perspective, environmental regulations and technological innovation can significantly promote the quality of economic growth; from a regional perspective, there are regional differences in impact effects. Under the constraints of environmental regulations, the promotion effect of technological innovation on the quality of economic growth will be reduced; the impact of environmental regulation on the quality of economic growth will have a "threshold effect", and environmental regulation can significantly promote the quality of economic growth only after crossing the threshold and the threshold of technological innovation.

Atopic dermatitis (AD) is a chronic inflammatory skin disease, which can cause skin barrier function damaged. Although co-incubation with docosahexaenoic acid (DHA) exerts a positive effect in deficient skin model, there is no study to investigate the effects of topical treatment with DHA in inflammatory reconstructed human epidermis (RHE) model. The effects of DHA on monolayer normal human epidermal keratinocyte (NHEK) cells were evaluated via CCK-8, qPCR and ELISA. The skin related barrier function was assessed by hematoxylin-eosin (HE) staining, western blot (WB), Immunohistofluorescence (IF) and ELISA in normal and inflammatory RHE models. DHA upregulated filaggrin and loricrin expression at mRNA levels in addition to suppress overexpression of TNF-α，IL-1α and IL-6 stimulated by poly I:C plus LPS (stimulation cocktail) in cultured NHEK cells. After topical treatment with DHA, cocktail induced inflammatory characteristics of skin diseases including barrier morphological, differentiation proteins and TSLP secretion, which were alleviated in RHE models. Supplementation with DHA can improved related barrier function and have anti-inflammation effects in monolayer keratinocytes and RHE models, which indicated that DHA may have a potential value for the treatment of inflammation-associate skin diseases.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

Trichothecene mycotoxin T-2 toxin is an important environmental pollutant and poses a global threat to human and animal health. T-2 toxin could induce nephrotoxicity, however, the precise molecular mechanism remains unclear. In this study, the mice were intraperitoneally administrated with a single dose of 2 mg/kg T-2 toxin. The kidney function and ultrastructural observation were also assessed and found T-2 toxin exposure could cause kidney damage. Transmission electron microscopy showed a significant swelling and vacuolization of the mitochondria of renal cell. A total of 1122, 58, and 391 differential expression genes (DEGs) that were predominantly expressed in kidney tissues at 1 d, 3 d, and 7 d after T-2 toxin exposure, respectively. Early transcriptomic changes at 1 d after exposure were down-regulation of DEGs involved in the cell cycle, p53 signaling pathway, and cellular senescence, while up-regulation of DEGs referred to the ribosome pathway. The temporal variations in gene expression pattern in T-2 toxin exposure in mice kidney were presented and cellular metabolism was disturbed at the exposure recovery period with 7 d. In conclusion, this study, for the first time, provided a comprehensive comparative transcriptomic analysis of gene regulation in T-2 toxin exposure-induced nephrotoxicity at different temporal periods and explored the nephrotoxicity mechanism of T-2 toxin at the mRNA level.

The research fills the policy research gap for the women entrepreneurship and sustainability performance for examining key successful factors. Previous women entrepreneurship research fails to offer policy recommendations. The research purpose is to investigate these factors affect women entrepreneurship capabilities and sustainability performance by using SEM analysis and making policy recommendation. This research employs online and mail survey and obtains 175 women entrepreneur sample. The study finds that family support and motivation have positive effect on women entrepreneurship capabilities and sustainability performance. Barriers have no effect on performance. Hopefully, the research can provide the guidance to contribute to women’s entrepreneurship opportunities for achieving SDGs. Policy recommendation and managerial implication are discussed in the article.

Epitranscriptomic RNA modifications play a crucial role in the posttranscriptional regulation of gene expression. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic RNA and plays a pivotal role in RNA fate. RNA m6A modification is regulated by a group of cellular proteins, methyltransferases (writers) and demethylases (erasers), which add and remove the methyl group from adenosine, respectively. m6A modification is recognized by a group of cellular RNA-binding proteins (readers) that specifically bind to m6A-modified RNA, mediating effects on RNA stability, splicing, transport, and translation. The functional significance of m6A modification of viral and cellular RNA is an active area of virology research. In this review, we summarize and analyze current literature on m6A modification of HIV-1 RNA, the multifaceted functions of m6A in regulating HIV-1 replication, and the role of viral RNA m6A modification in evading the innate immune responses to infection. Furthermore, we briefly discuss future directions and therapeutic implications of mechanistic studies of HIV-1 epitranscriptomic modifications.

Threshing device is the core component of grain combine harvester, and its working performance determines the working quality and production efficiency of the harvester to a great extent. The straw guide plate plays an important role in the threshing device to dredge the threshing matter and control the threshing time of the combine harvester matter in the threshing chamber. In the past, the guiding structure of threshing device could not optimize the working performance of the machine by adjusting the spiral angle, that is, most cereal combine harvester may not be fed smoothly or even clogged when operating under different crop types, yield differences and operating environments, a kind of threshing device with adjustable guide straw board was studied. In this study, the movement model of the straw on the straw guide plate was analyzed, and it was found that the spiral angle “α”of the straw guide was 0<α<58°.Three-factor and three-level response surface method was used to carry out field experiment on drum speed, working speed and guide grass plate spiral angle, and the experimental data were analyzed by quadratic polynomial regression.The results show that the drum speed, working speed and the spiral angle of the guide grass plate have significant effects on the loss rate (PLR) , impurity content (PIR) and breakage rate (PBR) , the drum speed and working speed have an interactive effect on the impurity ratio (PIR) , and the working speed and the helical angle of the guide grass plate have an interactive effect on the loss ratio (PLR) and breakage ratio (PBR) , there is an interaction between the rotary speed of the roller and the helical angle of the guide grass plate on the crushing rate (PBR) .Further optimization analysis showed that the predicted value was PLR = 1.18% , PIR = 0.72% , PBR = 0.53% , the experimental verification value was PLR = 1.26% , PIR = 0.73% , PBR = 0.61% . The absolute error between the experimental value and the predicted value was very small, however, the optimized field test verified value decreased by 8.31% , 50.04% and 60.30% respectively, which indicated that the optimized harvester had better operation quality, in particular, PIR, PBR and other two indicators have a greater increase in the effect.

Economic development and advancements in information technology contributed to the shift on accounting objective from commission responsibility view to decision-making useful view. The decision-making useful view claims that the accounting measurement methods should be changed to improve the usefulness of accounting information, to enable information users to make correct decisions. In addition, the development of financial instruments leads to the birth of fair value accounting. In recent years, fair value has been one of the most important measurement methods in the International Accounting Standard and US Generally Accepted Accounting Principles. However, China has been quite cautious when it comes to applying fair value full time, especially after the global financial crisis happened in 2008, wherein fair value accounting was exposed to strong suspicion. Hence, studying the value relevance of fair value is of great significance to exploring the accounting profession and reforming accounting standards. This paper attempts to investigate the value-relevance of fair value based on the data of listed financial companies and manufacturing companies in China. The results indicate that the fair value information in the financial industry has a strong explanatory influence to corporate share price. In contrast, the fair value information shows limited relevance in the manufacturing industry. Finally, consulting with the results of normative analysis and empirical study, this paper suggests several rational advices for the application of fair value in China.

Technology can be seen everywhere and has been integrated into our lives.We are always using technology and enjoying the convenience brought by technology. However, physical retailers and e-commerce companies are also gradually adopting advanced technologies. Technology improves the purchasing environment and purchasing experience. Virtual reality and augmented reality have been hotly discussed in recent years. Technology, although virtual reality and augmented reality technology have not yet matured, it can be said that they will in the future It has great development potential. Virtual reality and augmented reality are also beginning to sprout in the retail industry. However, research on the acceptance of the use of virtual reality and augmented reality in the apparel shopping process is still lacking because This study explores how usefulness, ease of use, hedonicity, customer experience, customer engagement and satisfaction. To influence customer loyalty, this study adopted questionnaire survey and convenience sampling methods, and collected a total of 308 valid questionnaires. The analysis method used confirmatory factor analysis and structural equation model to verify the research hypothesis relationship. The results of this study found. Hedonic has a significant impact on customer loyalty, while usefulness, ease of use, customer experience, customer engagement and satisfaction Satisfaction does not have a significant impact on customer loyalty. This study explains the academic contribution of the research results. The practical implications in marketing are put forward, and specific suggestions and directions for future research are given.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

In this study, we investigated the effects of three surface treatment techniques on 316L stainless steel, low-temperature immersion corrosion, shot peening followed by immersion corrosion, and electrochemical corrosion. Surface alterations were analyzed using scanning electron microscopy, Raman spectroscopy, and α-step thin-film thickness profiling. Human osteoblast adhesion was evaluated using Liu’s stain and metallographic optical microscopy. The results revealed weak cell adhesion after low-temperature immersion and shot peening followed by immersion corrosion. By contrast, electrochemical corrosion, particularly with a high current density and low corrosive solution concentration, resulted in a uniformly corroded surface, thus promoting dense cell adhesion. All three techniques resulted in porous oxide layers. Overall, our experimental findings highlighted shot peening (1 kg/cm2 for 20 s) and electrochemical corrosion (0.5 M HCl) as effective processes. Electrochemical corrosion produced uniformly dense corrosion pits, whereas shot peening produced semicircular grooves with small corrosion pits, both favorable for cell adhesion. Electrochemical corrosion also yielded excellent cell adhesion, emphasizing its suitability for biomedical activity. We developed a process for creating a porous surface layer and thereby enhancing the cell adhesion to 316L stainless steel for potential biomedical implant applications.

To understand lung damage caused by COVID-19, we deduced two-phase lung damage mechanisms. After the lungs are infected with SARS-CoV-2 virus, the affected lung tissue swells and surface properties of pulmonary capillaries change, resulting in an increased flow resistance of affected capillaries. If a sufficient number of capillaries are affected by the infection, the swelling and increased cell wall adhesion collectively raise pulmonary vascular resistance. The increased vascular resistance further increases the dwell times of WBCs in affected capillaries and nearly capillaries. When pulmonary pressure is sufficiently higher, WBCs are forced to squeeze into interstitial spaces or alveolar spaces when local pressures are higher than what the capillaries can withstand. When more and more WBCs are dynamically retained, the flow resistance of more capillaries rises, pulmonary vascular resistance rises, and pulmonary pressure rises. The rise in the pulmonary pressure in turn results in elevated capillary pressures. When capillary pressures around the alveoli are sufficiently high, they cause interstitial pressures to change from normally negative values to positive values. The positive pressures cause fluid leakage to the alveolar space and thus degrade lung function. Tissue swelling, and occupation of WBCs in interstitial spaces and alveolar spaces further reduce compressible volume, and thus cause further rise in the pulmonary vascular resistance and pulmonary pressure. When the pulmonary pressure has reached a critical point as in the second phase, the blood breaks capillary walls and squeezes through interstitial spaces to reach alveolar spaces, resulting in irreversible lung damages. The available free volume in the thorax cage, organ usable capacities, temperature and humid are expected to have great impacts on degree of lung damages. The free volume in the thorax cage, lung usable surplus capacity, and other organ usable capacities determine the arrival time of last-phase irreversible damage. The mechanisms imply that the top priority for protecting lungs is maintaining pulmonary micro-circulation and preserving organ functions in the entire disease course while controlling viral reproduction should be stressed in the earliest time possible. The mechanisms also explain leukecytes are recruited and migrated into inflamed tissues by increasing their dwell times caused by increased local flow resistance.

We aimed to evaluate the protective effects of acetyl-xylogalactan on the activity of RAW264.7 macrophages against heat stress. To this end, we assessed cell survival, phagocytic activity, in-tracellular Ca2+ level, mitochondria potential exchange, apoptotic assay findings, galactosidase activity and the RNA-seq by NGS and real-time polymerase chain reaction (PCR) expression. In our evaluation of macrophage morphology at 37°C and 41°C, the macrophages showed an oval shape at 41°C , unlike the spindle shape at 37°C. Therefore, 41°C was chosen as the heat stress condition. Subsequently, we designed an experiment to evaluate changes in the RAW264.7 macrophages after acetyl-xylogalactan treatment under heat stress. The survival of RAW264.7 macrophages treated with acetyl-xylogalactan was higher than that of controls that were not treated with acetyl-xylogalactan. Moreover, on the basis of the results of the annexin-V detection assay, the apoptotic activity of macrophages appeared to have reduced after treatment with ac-etyl-xylogalactan. Moreover, treatment with acetyl-xylogalactan resulted in a stronger recovery trend in the intracellular Ca2+ and mitochondrial membrane potential after heat stress. RNA sequencing and real-time polymerase chain reaction (PCR) illustrated that Sarcodia suieae acetyl-xylogalactan could upregulate the expression of the anti-apoptosis Cflar gene and down-regulate the expression of the apoptosis factors Ddit3, and Hyou1 to protect macrophages under heat stress.

The fatigue delamination damage is one of the most important fatigue failure modes of laminated composite structures. However, the developments of the theoretical framework, mathematical/physical model and numerical simulation of fatigue delamination are still challenging issues, and there is a lack of systematic classification. This article reviews the experimental phenomena of the onset and propagation stage of delamination under fatigue loading, and summarizes the commonly used phenomenological models for laminated composite structures. The research methods, general modeling formulas and development prospects of the phenomenological models are presented in detail. In the light of the analysis of finite element model (FEM) for the laminated composite structures, a number of simulation methods of fatigue delamination crack propagation damage model are carefully classified. Furthermore, within the theoretical framework of strength theory model (SM), fracture mechanics model (FM), damage mechanics model (DM) and hybrid model (HM), the complete procedure, application, capability assessment, advantages and limitations of the models are also discussed in detail. Finally, several valuable suggestions are given for the research interests, and challenging technical problems that need to be overcome on the fatigue delamination prediction of laminated composite structures in the future.

In numerical simulations, achieving high accuracy without significantly increasing computational costs is often challenging. To address this, this paper presents an improved finite volume weighted essentially non-oscillatory (WENO) scheme tailored for applicability in computational fluid dynamics (CFD) and implemented in the flow solver NUAA-Turbo for simulating turbomachinery flows using both RANS and RANS/LES coupling. Firstly, the new WENO scheme is validated against classic numerical test cases to assess its stability and reliability in handling discontinuities, the Double problem, and Raleigh-Taylor (RT) instability issues. Compared to the original format, this enhanced finite volume WENO scheme demonstrates superior stability near discontinuities and resolves flow features with the same grid resolution more effectively. Next, for engineering applications related to turbomachinery, such as compressor and turbine characteristics, computations are performed using RANS, and the results obtained using WENO-ZQ3 and WENO-JS3 are compared. Finally, the new fifth-order WENO scheme is applied to RANS/LES coupled simulations of turbine wakes and film cooling. The results show that the enhanced finite volume WENO scheme offers improved stability and accuracy in engineering applications, allowing for high-precision calculations with fewer grid points to capture more detailed flow physics, thereby reducing computational costs in aerodynamic applications.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

Passion fruit is a valued tropical fruit crop that faces environment-related growth strains. TCP genes are important for both growth modulation and stress prevention in plants. Herein, we systematically analyzed the TCP gene family in passion fruit, recognizing 30 members. Genes exhibiting closer phylogenetic relationships exhibited similar protein and gene structures. Gene members of the TCP family showed developmental stage or tissue-specific expression profiles during the passion fruit life cycle. Transcriptome data also demonstrated that many PeTCPs showed induced expression in response to hormonal treatments and cold, heat, and salt stress. Based on transcriptomics data, eight candidate genes were chosen for preferential gene expression confirmation under cold stress conditions. Additionally, four TCP genes exhibited in silico binding with cold stress-related miRNA319s. This study will aid in the establishment of novel germplasm, as well as the further investigation of the roles of PeTCPs and their cold stress resistance characteristics.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

After reviewing cancer theories, cancer treatment development histories, randomized clinical trial's performance, cancer treatment strategy, trial follow-up times, and conducting numerous simulations using existing data, the authors found: (1) medical treatments come with three to four lethal factors: treatment side-effects, emotional distress and chronic dress, lack of exercises or physical inactivity, and excessive nutrition in some cases; (2) clinical trial exaggerates the benefits of fast-acting treatments and underestimates the slow-delivering adverse side effects as a result of statistical averaging, interfering effects of personal lifestyle factors, and insufficient follow-up times; (3) the benefits of medical treatments are limited by chain comparison, where surgery sets up a negative standard relative to the best way for resolving cancer; (4) the strategy of destroying the tumor is unworkable; (5) medical treatments can turn natural cancer growth curve into approximately doubly exponential curve; (6) multiple factor non-medical measures are much more powerful than medical treatments in controlling cancer growth and metastasis rates; and (7) cancer early diagnosis and over treatments are bad strategies that have great adverse impacts on cancer patients. Based on huge increases in cancer growth rate constants, substantial of loss of organ functional capacity, and severe systemic aging-like cellular damages, the authors concluded that medical treatments promote cancer growth and metastasis rates and shorten patient lives in most cases, and the claimed benefits are caused by triple biases of clinical trials. The authors believe that the better strategy for ending the global cancer epidemic is abandoning clinical trails as the research model, changing caner treatment strategy from killing cancer cells to slowing down cancer growth rates by using multiple factors optimization approach in personalized medicine.

This paper studies the contemporaneous relationship between S&P 500 index returns and log-increments of the market volatility index (VIX) via a nonparametric copula method. Specifically, we propose a conditional dependence index to investigate how the dependence between the two series varies across different segments of the market return distribution. We find that: (a) the two series exhibit strong, negative, extreme tail dependence; (b) the negative dependence is stronger in extreme bearish markets than in extreme bullish markets; (c) the dependence gradually weakens as the market return moves toward the center of its distribution, or in quiet markets. The unique dependence structure supports the VIX as a barometer of markets' mood in general. Moreover, applying the proposed method to the S&P 500 returns and the implied variance (VIX²), we find that the nonparametric leverage effect is much stronger than the nonparametric volatility feedback effect, although, in general, both effects are weaker than the dependence relation between the market returns and the log-increments of the VIX.

Tremor is a prevalent neurological disorder characterized by involuntary shaking or trembling of body parts. This condition impairs fine motor skills and hand coordination to varying degrees and can even affect overall body mobility. As a result, tremors severely disrupt the daily lives and work of those affected, significantly limiting their physical activity space. This study developed an innovative Spatial Augmented Reality (SAR) system aimed at assisting individuals with tremor disorders to overcome their physical limitations and expand their range of activities. The system integrates eye-tracking and Internet of Things (IoT) technologies, enabling users to smoothly control objects in the real world through eye movements. It employs a virtual stabilization algorithm for stable interaction with objects in the real environment. The study comprehensively evaluated the system's performance through three experiments: 1) assessing the effectiveness of the virtual stabilization algorithm in enhancing the system's ability to assist individuals with tremors in stable and efficient interaction with remote objects; 2) evaluating the system's fluidity and stability in performing complex interactive tasks; 3) investigating the precision and efficiency of the system in remote interactions within complex physical environments. The results demonstrate that the system significantly improves the stability and efficiency of interactions between individuals with tremor and remote objects, reduces operational errors, and enhances the accuracy and communication efficiency of interactions.

Innovation is an essential key factor in the technology development history. Past research on innovation focused more on the innovation behavior of technology, but seldom described knowledge assets which also influence innovation behavior greatly. The effect of knowledge assets attribute and result on disruptive innovation is therefore regarded as the research topic in this study, where disruptive innovation is divided into outbound and inbound to combine combination-embeddednessandmajor business specificityof knowledge assets as the research model. Manufacturing enterprises in China are proceeded the questionnaire survey, and 173 valid copies are collected. The empirical analysis shows that combination-embeddedness of knowledge assets presents significantly positive effects on major business specificity and outbound innovationof an enterprise but reveals remarkably negative effects on inbound innovation. Enterprises are suggested to constantly accumulate knowledge assets with low major business specificity before disruptive innovation in order to reduce ineffective inbound innovation.

An on-site, ultra-sensitive, and quantitative sensing method was developed based on quantum dot nanobeads (QDNBs) and test strip for the determination of total aflatoxins (AFTs) in rice and peanut. The monoclonal antibody against AFT (mAbAFT) was home-made and labeled with QDNB. After the pre-coating of the AFT antigen on the test line (T line), the competitive immunoreactions were conducted between AFT and AFT antigen on the T line with QDNBs-mAbAFT. Under optimal conditions, this approach allowed a rapid response towards AFT with a considerable sensitivity of 1.4 pg/mL and 2.9 pg/mL in rice and peanut matrices, respectively. The put-in and put-out duration were within 10 min. The recoveries for AFT in rice and peanut samples matrices were recorded from 86.25–118.0% with the relative deviations (RSD) below 12%. The assay was further validated via the comparison between this QDNB strip and the conventional HPLC method using spiked samples. Thus, the design provided a potential alternative for on-site, ultra-sensitive, and quantitative sensing of AFT that could also be expanded to other chemical contaminants for food safety.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

Under the dual background of underemployment and health inequality, this paper empirically analyzes the impact of education level on underemployed workers’ health based on CLDS2016 data. The results show that underemployment is significantly related to the decline of self-rated health, increased depression tendency, and morbidity in a certain period. The results indicate that underemployment can significantly reduce the health level of workers in the low education level group and the high education level group. However, it has no significant impact on workers’ health in the middle education level group; even if we change the measurement method of indicators and consider endogeneity, the research conclusion is still robust. Moreover, this kind of health inequality mainly comes from the difference in economic effect and leisure effect of underemployment to workers with different educational levels. This paper provides empirical support for increasing the labor protection mechanism of underemployed people and reducing the health inequality caused by educational level differences.

Leucokinins (LKs) constitute a neuropeptide family first discovered in a cockroach and later identified in numerous insects and several other invertebrates. The LK receptors are only distantly related to other known receptors. Among insects, there are many examples of species where genes encoding LKs and their receptors are absent. Furthermore, genomics has revealed that LK signaling is lacking in several of the invertebrate phyla and in vertebrates. In insects, the number and complexity of LK expressing neurons vary, from the simple pattern in the larva of Drosophila where the entire CNS has 20 neurons of three main types, to cockroaches with about 250 of many different types. Common to all studied insects is the presence or 1-3 pairs of LK-expressing neurosecretory cells in each abdominal neuromere of the ventral nerve cord, that, at least in some insects, regulate secretion in Malpighian tubules. This review summarizes the diverse functional roles of LK signaling in insects, as well as other arthropods and mollusks. These functions include regulation of ion and water homeostasis, feeding, sleep-metabolism interactions, state-dependent memory formation, as well as modulation of gustatory sensitivity and nociception. Other functions are implied by the neuronal distribution of LK, but remain to be investigated.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

Cancer/testis (CT) antigens exhibit selective expression predominantly in immunoprivileged tissues in non-pathological contexts but are aberrantly expressed in diverse cancers. Because of their expression pattern, they have historically been attractive targets for immunotherapies. The investigation of mechanistic roles of CT antigens in promoting oncogenesis has historically been a prominent research question, and a growing number of studies implicate CT antigens in promoting almost all the hallmarks of cancer. This suggests that CT antigens may act as cancer drivers. CT antigens are expressed in head and neck squamous cell carcinomas, although their role in the pathogenesis, prognostication, and treatment for this family of cancers remains poorly studied. Given that CT antigens hold intriguing potential as therapeutic targets and as biomarkers for prognosis and therapeutic response and that they can provide novel insights into oncogenic mechanisms, their further study in the context of head and squamous cell carcinoma is warranted.

The utilization of optical antennas for active control of far-field radiation at the subwavelength scale is crucial in various scientific and technological applications. We propose a thermally tunable disk design of indium tin oxide (ITO) and aluminum gallium nitride (Al0.18Ga0.82As), enabling a switch between absorption and scattering. Furthermore, the control of far-field radiation pattern can be easily realized by combining ITO and Al0.18Ga0.82As to enhance or suppress emission. Our results demonstrate that hybrid structure can be dynamically tuned with temperature variations. In the proposed design, a frequency is achieved at the epsilon-near-zero wavelength of 1240 nm. The thermal tunability of hybrid structure introduces new multifunctional possibilities for light manipulation, thereby enhancing the potential applications of new devices in the near-infrared range.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

Urban air pollution is a critical global environmental issue, necessitating an understanding of the spatiotemporal characteristics and driving factors for effective environmental protection and urban planning. This study introduced an advanced air quality assessment system that integrates environmental, socio-economic, and urban layout factors, addressing gaps in traditional models that often overlook the impact of urban spatial structures. Analyzing air quality data from Beijing's main urban area (2016-2020) alongside multi-source geographic data, the research develops a comprehensive evaluation system, incorporating 14 key driving factors. Employing Geographically Weighted Regression (GWR) and Multi-scale Geographically Weighted Regression (MGWR), the study quantitatively assessed the influence and spatial heterogeneity of these factors. Findings revealed an annual improvement in air quality, with a U-shaped seasonal pattern and significant spatial clustering (Global Moran’s I = 0.922). The MGWR model, in particular, provided a superior fit over GWR, effectively capturing the spatial variability of factors. Variables such as NDVI), economic output (GDP), and humidity space adjustment capability (HSAC) showed significant positive spatial impacts on air quality, while population density (POP), temperature (TEMP), and road density (RD) exhibited negative effects. These insights enhance the understanding of air pollution dynamics and aid in refining urban planning strategies.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

Objectives: The purposes of this study were to 1) analyze the disruption of intracardiac flow by flow components and kinetic energy (KE) parameters in single ventricle physiology patients and compare with controls; 2) investigate left ventricular diastolic dysfunction in terms of 4D flow parameters in repaired Fontan (rFontan) group; 3) compare intracardiac flow parameters in morphologic LV and RV rFontan patient groups. Methods: Twenty-five rFontan patients (age: 10±3, M/F: 15/10) and fourteen controls (age: 10±2, M/F: 8/6) were prospectively recruited. All underwent cine and 4D flow cardiovascular magnetic resonance (CMR) on 3.0T scanner. Cardiac function and inter-ventricular mechanical dyssynchrony were analyzed using cine images. From 4D flow CMR, ventricular flow components were assessed: direct flow, retained inflow, delayed ejection flow and residual volume. Global and regional blood flow KE parameters, normalized to end-diastolic volume (EDV) were analyzed for functional single ventricle (FSV). Left ventricular (LV) diastolic dysfunction was assessed on echocardiography guidelines. Results: In comparison of rFontan vs. controls, median FSV residual volume (28% vs. 23%, P= 0.034) were higher in rFontan; median FSV direct flow (32% vs. 40%, P=0.005) and delayed ejection flow (17% vs. 24%, P=0.024) were lower in rFontan. FSV KEiEDV parameters were all lower in rFontan (all P<0.05). No significant differences were observed for flow components and KE parameters between patients with and without inter-ventricular dyssynchrony. FSV direct flow (AUC=0.76, Sensitivity=86%, Specificity=70%) was an independent predictor of LV diastolic dysfunction. Residual volume and E-wave KEiEDV were significantly different between morphologic RV and morphologic LV patient group. Conclusions: The changed flow pattern and decreased KE may be hemodynamic disturbances and impaired ventricular filling in rFontan patients. Reduced direct flow is associated with LV diastolic dysfunction. Morphologic right ventricular subgroup is worse than morphologic left ventricular group in terms of the intracardiac hemodynamics.

Background: Colorectal cancer (CRC) is one of the most prevalent diseases and the second leading cause of death worldwide. However, the relationship between CRC and cerebrovascular-specific mortality (CVSM) remains elusive and less is known about the influencing factors associated with CVSM in CRC. Here, we aimed to analyze the incidence as well as the risk factors of CVSM in CRC. Methods: Patients with a primary CRC diagnosed between 1973 and 2015 were identified from Surveillance Epidemiology and End Results database with follow-up data available until 31 December 2016. Conditional standardized mortality ratios were calculated to compare the incidence of CVSM between CRC patients and the general US population. Univariate and multivariate survival analyses with a competing risk model were used to interrogate the risk factors for CVSM. Results: A total of 563298 CRC individuals were included. The CVSM in CRC patients was significantly higher than the general population in all age subgroups. Among competing causes of death in patients, the cumulative mortality caused by cerebrovascular-specific diseases steadily increased during study period. While age and surgery positively influenced CVSM on both univariate and multivariate analyses, male patients and those who had radiotherapy, chemotherapy, more recent year (2001-2015) of diagnosis as well as multiple primary or distant tumors experienced a lower risk of CVSM. Interpretation: Our data suggest a potential role for CRC in the incidence of CVSM and also identify several significant predictors of CVSM, which may be helpful for risk stratification and therapeutic optimization of cerebrovascular-specific diseases in CRC patients.

The combination of encryption and digital watermarking technologies is a trend to achieve full lifecycle data protection. Recently, reversible data hiding in encrypted domain (RDHED) has greatly aroused the interests of many scholars. But the fixed order of first encryption and then watermarking makes this kind of algorithms unsuitable to many applications. Commutative encryption and watermarking (CEW) technology realizes the flexible combination of encryption and watermarking, and suits more applications. However, most existing CEW schemes for vector maps are not reversible and unsuitable to high precision maps. To solve this problem, here we propose a commutative encryption and reversible watermarking (CERW) algorithm for vector maps based on virtual coordinates which are uniformly distributed on the number axis. The CERW algorithm consists of virtual interval step based encryption scheme and coordinate difference based reversible watermarking scheme. In the encryption scheme, the map coordinates are moved randomly by multiples of virtual interval step defined as distance between two adjacent virtual coordinates. In the reversible watermarking scheme, difference expansion (DE) technique is used to embed the watermark bit into the coordinate difference computed based on the relative position of a map coordinate in a virtual interval. Since the relative position of a map coordinate in a virtual interval keeps unchanged during the coordinate scrambling encryption process, the watermarking operation and the encryption operation don’t interfere with each other and the commutativity between encryption and watermarking achieves. Results show that: proposed method has high security, high capacity and good invisibility. In addition, the algorithm is not only applicable to polyline and polygon vector data, but also can be applied to sparsely distributed point data which the traditional DE watermarking algorithm often fails to watermark.

Ruminant animals naturally emit methane gas owing to anaerobic microbial fermentation in the rumen, and these gases are considered major contributors to global warming. Scientists worldwide are attempting to minimize methane emissions from ruminant animals. Some of these attempts include the manipulation of rumen microbes using antibiotics, synthetic chemicals, dietary interventions, probiotics, propionate enhancers, stimulation of acetogens, manipulation of rumination time, vaccination, and genetic selection of animals that produce low methane (CH4). The majority of synthetic additives are harmful to both beneficial rumen microbes and the host or only temporarily affect methanogenesis. Phytogenic feed additives (PFAs) have recently emerged as the best alternatives to antibiotics and synthetic chemicals because of growing public concerns regarding drug resistance and the negative impacts of antibiotics and synthetic chemicals on humans, livestock, and the environment. These additives reduce methane production and improve the volatile fatty acid profile. In this review, we provide an overview of PFA sources and how their bioactive components affect the rumen microbiome to reduce methane emissions. Additionally, we highlight the mechanisms of action of PFAs as a whole as well as some of their bioactive components.

This study aimed at exploring what role artificial intelligence techniques could play in the futural numerical analysis. In this paper, a convolutional neural network techniques based on modified loss function is proposed as a surrogate of finite element method(FEM). Several surrogate-based physics-informed neural networks(PINNs) are developed to solve representative boundary value problems based on elliptic partial differential equations (PDEs). Results from the proposed surrogate-based approach are in good agreement with ones from conventional FEM. It is found that modification of the loss function could improve the prediction accuracy of the neural network. It is indicated that to some extent the artificial intelligence technique could replace conventional numerical analysis as a great surrogate model.