Atopic dermatitis (AD) is a chronic inflammatory skin disease, which can cause skin barrier function damaged. Although co-incubation with docosahexaenoic acid (DHA) exerts a positive effect in deficient skin model, there is no study to investigate the effects of topical treatment with DHA in inflammatory reconstructed human epidermis (RHE) model. The effects of DHA on monolayer normal human epidermal keratinocyte (NHEK) cells were evaluated via CCK-8, qPCR and ELISA. The skin related barrier function was assessed by hematoxylin-eosin (HE) staining, western blot (WB), Immunohistofluorescence (IF) and ELISA in normal and inflammatory RHE models. DHA upregulated filaggrin and loricrin expression at mRNA levels in addition to suppress overexpression of TNF-α，IL-1α and IL-6 stimulated by poly I:C plus LPS (stimulation cocktail) in cultured NHEK cells. After topical treatment with DHA, cocktail induced inflammatory characteristics of skin diseases including barrier morphological, differentiation proteins and TSLP secretion, which were alleviated in RHE models. Supplementation with DHA can improved related barrier function and have anti-inflammation effects in monolayer keratinocytes and RHE models, which indicated that DHA may have a potential value for the treatment of inflammation-associate skin diseases.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

Background The link between age at marriage and first birth in explaining completed family size is not always direct, due to heterogeneity in circumstances, that compel individual women to marry or initiate childbearing at a particular age. We analyzed data for 1020 women aged 45-49 in 2014 of the 1965-1969 birth cohort from the 2013-14 Zambia Demographic and Health Survey (ZDHS). Methods We fitted a bivariate and multivariate multinomial logistic regression to establish the relationship between a mother’s age at first marriage and at first birth on completed family size (CFS). Chi-square test of proportions measuring differences in proportions and relative risk ratios (RRR) with confidence intervals at 95% are reported. Results Our results show that the average CFS was 6.7 (95% CI: 6.5 – 6.9) among women completing their reproductive span in 2014 with mean age at first marriage and birth being 18.3 years (95% CI: 18.0 – 18.5) and 18.9 years (95% CI: 18.7 – 19.1) respectively. Women marrying at younger ages and having their first birth at younger ages were more likely (RRR: 1.187; 95% CI: 1.138-1.239 and RRR: 0.195; 95% CI: 0.074-0.511 respectively) to have higher CFS than their compatriots that initiated both marriage and childbearing at or after age 22 controlling for covariates as presented in the controlled model. The independent effects model shows that the risk of having 1-3 children compared to 6 or more children was lower (RRR: 0.073; 95% CI: 0.009-0.611; RRR: 0.136; 95% CI: 0,046-0.402 and RRR: 0.421; 05% CI: 0.135-1.312) for women whose ages at first marriage were <15, 15-18 and 19-21 respectively relative to 22+. Women with 1-3 children were 2.5 times more likely to use contraception than women with 6 or more children. Conclusion Having no education, being a rural resident and having a medium household wealth all increase the risk of having higher CFS. Women that marry before age 19 have a higher likelihood of having 6 or more children by the end of their reproductive period. The study concludes that apart from a woman’s age at first marriage and first birth, a complex network of factors interact to determined CFS.

Tryptanthrin has not been widely applied in clinical practice due to its poor solubility and low bioavailability in spite of possessing several biological and pharmacological activities. Here, to improve the solubility of tryptanthrin, two types of novel tryptanthrin-loaded micelles were prepared. One was tryptanthrin physically encapsulated by distearoyl phosphatidylethanolamine polyethylene glycol (DSPE-PEG) and the other was pegylated tryptanthrin synthesized by acid-sensitive hydrazone bond and further prepared as micelles. Molecular imprinting technology was used to separate pegylated tryptanthrin and free mPEG-COOH in the preparation of PEGylated tryptanthrin micelles with considerably high separation efficiency. The solubility of tryptanthrin-loaded DSPE-PEG micelles (TDMs) and PEGylated tryptanthrin micelles (PTMs) was increased by 300 and 1493 fold compared with that of tryptanthrin, respectively. The PTMs increased the solubility of tryptanthrin more effectively and 95% of tryptanthrin was released from PTMs at pH 5.5 in 12 h. The cytotoxicity of PTMs decreased under physiological conditions compared with that of tryptanthrin, whereas at pH 5.5, the PTMs showed comparable cytotoxicity with that of tryptanthrin, indicating successful drug release from the carrier in response to tumor cell pH. Overall, we elucidated an efficient method to improve water solubility of tryptanthrin and indicated pegylated tryptanthrin is a promising prodrug.

Accurate assessment of the breast cancer deterioration degree plays a crucial role in making medical plan, and the important basis for degree assessment is the number of mitoses in a given area of the pathological image. We utilized deep multi-scale fused fully convolutional neural network (MFF-CNN) combing with conditional random felid (CRF) to detect mitoses in hematoxylin and eosin stained histology image. Analyze the characteristics of mitotic detection ----scale invariance and sparsity, as well as the difficulties ---- small amount of data , inconsistent image staining and sample class unbalanced. Based on this, mitotic detection model is designed. In this paper, a tissue-based staining equalization method is used, and to establish an effective training sample set, we select training samples by using CNN. A mitotic detection model fusing multi-level and multi-scale features and context information was designed, and the corresponding training strategy was made to reduce over-fitting. As preliminarily validated on the public 2014 ICPR MITOSIS data, our method achieves a better performance in term of detection accuracy than ever recorded for this dataset.

It’s been reported that Mori Folium (MF) and Eucommiae Cortex (EC) exhibit pharmacological effects on the treatment of immunosuppression. However, the mechanism of MF and EC against immunosuppression remains unclear. This study aims to explore the mechanism of action of MF and EC for the treatment of immunosuppression through network pharmacology, molecular docking, molecular dynamics simulations and animal experiments. As a result, 11 critical components, 9 hub targets, and related-signaling pathways of treatment of immunosuppression were obtained based on network pharmacology. The molecular docking suggested that 11 critical components exhibited great binding affinity to 9 hub targets of immunosuppression. The molecular dynamics simulations results showed that (-)-Tabernemontanine-AR, beta-sitosterol-AR and Dehydrodieugenol-HSP90AA1 complexes are stably bound. Additionally, in the animal experiments, the treated group results compared to the control group suggest that MF and EC have a significant effect on the treatment of immunosuppression. Therefore, the MF and EC treatment for immunosuppression may take effects in a multi-component, multi-target, and multi-pathway manner. The results would provide novel insights into the treatment of immunosuppression in humans.

The low-altitude quasi-periodic (LQP) E-region echoes observed with the upgraded HCOPAR located in Hainan Island of China (19.5°N, 109.1°E) are presented. With the interferometry technique, the interferometry equations can be developed to investigate the structures of the irregularities. The results show that the plasma structures of the LQP echoes with negative slope mainly drift southwestward almost horizontally, but they also drifted southeastward in some striations. According to the movement of the plasma structures, we find strong wind shear in the region where the LQP echoes are produced. Meanwhile, The periodicity of the LQP echoes may be related to the strength of the wind shear. It is proposed that the plasma structures are most likely produced by the Kelvin-Helmholtz instability.

To mitigate the interference of waves on offshore operation vessels, heave compensation systems find widespread application. The performance of heave compensation systems significantly influences the efficiency and safety of maritime operations. This paper establishes a mathematical model for winch-based active heave compensation system. It introduces a three-loop active disturbance rejection control (ADRC) strategy encompassing piston position control, winch speed control, and load displacement control, enabling real-time estimation and compensation of system disturbances, thereby enhancing the performance of the heave compensation system. To assess the effectiveness of this control strategy, the study employs Matlab/Simulink and AME Sim to construct a co-simulation model and conducts a comparative analysis with traditional PID control systems. The research findings indicate that the three-loop ADRC position control strategy consistently delivers superior compensation performance across various operational scenarios.

Borneol and menthol were two terpenes wildly used as penetrate enhancer in transdermal drug delivery. To explore their penetration enhancement effect towards hydrophilic drug, 5-FU was selected as model drug. A method combined vitro permeation studies and coarse grain molecular dynamics was used to investigate their penetration enhancement effect towards 5-FU. As a result, although both borneol and menthol showed a penetration enhancement effect towards 5-FU, they differed a lot in the penetration enhancement mechanism, which was also thought to account for their different penetration enhancement effect. As for menthol, SC bilayer disrupting effect seemed to be its main mechanism. While for borneol, its mechanism seemed to be more complicated. Except for disrupting the SC bilayer, it could also increase the permeation of 5-FU by enhancing the diffusion rate of 5-FU or inducing the formation of transient pore. All of this enable us a molecular understanding of borneol and menthol’s penetration enhancement effect towards hydrophilic drug, which might provide some guidance in the latter research and application.

The electronic, optical, and magnetic properties of Nd-doped ZnO systems were calculated using the DFT/GGA+U method. According to the results, the Nd dopant causes lattice parameter expansion, negative formation energy, and bandgap narrowing, resulting in the formation of an n-type degenerate semiconductor. Overlapping of the generated impurity and Fermi levels results in a significant trap effect that prevents electron-hole recombination. The absorption spectrum demonstrates a redshift in the visible region and improved intensity, leading to enhanced photocatalytic performance. The Nd-doped ZnO system displays ferromagnetic, with FM coupling due to strong spd-f hybridization through magnetic exchange interaction between the Nd-4f state and O-2p, Zn-4s, and Zn-3p states. These findings imply that Nd-doped ZnO may be a promising material for DMS spintronic devices.

Laser shock peening as an innovative surface treatment technology can effectively improve the fatigue life, sur-face hardness, corrosion resistance, and residual compressive stress. Compared with the laser shock peening, the warm laser shock peening (WLSP) is a new surface treatment technology to improve materials’ surface performances, which takes advantage of thermal mechanical effects on stress strengthening and micro-structure strengthening, results in more stable distribution of the residual compressive stress under heating and cyclic loading process. In this paper, the microstructure of GH4169 nickel super-alloy processed by WLSP technology with differ-ent laser parameters were investigated. The proliferation and tangling of dislocations in GH4169 were observed and the dislocation density increased after WLSP treatment. The influences of different treatment by LSP and WLSP on the microhardness distribution of the surface and along cross-sectional depth were investi-gated. The microstructure evolution of the GH4169 alloy being shocked with WLSP were studied by TEM. The effect of temperature on the stability of high temperature microstructure and properties of GH4169 alloy WLP was investigated.

Comparing to males, females require much more morphine to produce comparable levels of analgesia, suggesting a difference in the endogenous hyperalgesia and analgesia modulation between sexes. Aside from hormones, emerging evidence suggests sex-differential intrinsic neural regulation of pain generation and maintenance. According to the International Association for the Study of Pain (IASP) and American College of Gastroenterology (ACG), up to 25 % of the population having visceral pain at any one time, and in the United States 10-15 percent of adults suffering from irritable bowel syndrome (IBS). Here we analyzed literatures on clinical reports of sex differences in visceral pain focusing on IBS, other form of bowel dysfunction and comorbidities, and summarized animal models that provided means to investigate the underlying molecular mechanisms in sexual dimorphism of visceral pain. Neurons and nonneuronal cells (glia and immune cells) in the peripheral and central nervous systems all contribute to sex-dependent nociception and nociplasticity in the painful signal processing. Emotion is another factor in pain perception and appears to have sexual dimorphism.

Two novel core-shell composites SiO2@PMDA-Si-Tb, SiO2@PMDA-Si-Tb-phen with SiO2 as the core and terbium organic complex as the shell, were successfully synthesized. The terbium ion was coordinated with organic ligand forming terbium organic complex in the shell layer. The bi-functional organosilane ((HOOC)2C6H2(CONH(CH2)3Si(OCH2CH3)3)2 (abbreviated as PMDA-Si) was used as the first ligand and phen as the second ligand. Furthermore, the silica-modified SiO2@PMDA-Si-Tb@SiO2, SiO2@PMDA-Si-Tb-phen@SiO2 core-shell-shell composites were also synthesized by sol–gel chemical route. An amorphous silica shell was coated around the SiO2@PMDA-Si-Tb and SiO2@PMDA-Si-Tb-phen core-shell composites. The core-shell and core-shell-shell composites both exhibited excellent luminescence in solid state. The luminescence of core-shell-shell composites was stronger than that of core-shell composites. Meanwhile, an improved luminescence stability property for the core-shell-shell composites was found in the aqueous solution. The core-shell-shell composites exhibited bright luminescence, high stability, long lifetime, and good solubility, which may present potential applications in the field of bio-medical.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

Sustaining learners’ motivation to keep learning has been concerned for over 60 years in education and SLA. Most research focusing on Japanese university students has contributed lots of theoretical and practical developments, but research focusing on motivations of non-traditional adult learners and those under 18-year-old to learn Chinese is still little even though previous research findings have proved age is one of the key variables influencing learning besides nationalities and Chinese language levels. In order to find an effective treatment for sustainable Chinese language learning in Japan, this study utilized a survey method to analyze the types of Japanese learners’ motivation to learn Chinese via analysis of a moment structures (AMOS), and to compare the differences of the motivation via one-way ANOVA. This study revealed that Japanese learners’ motivation to learn Chinese consists of eight common types, which are “instrumental motivation”, “personal orientation”, “identified regulation”, “Chinese cultural productions”, “integrating into Chinese community”, “external regulation”, “social responsibility”, and “Chinese for academic purposes”. Also, there are similarities and differences existing in the eight motivation types among the Japanese children, adolescents, (non-) traditional adult learners of Chinese as a foreign language (CFL). The findings contribute the understanding of motivation types and differences among the four aged Japanese learners to teachers of teaching Chinese to speakers of other languages (TCSOL), and to future research further exploring how differently aged Japanese learners can have and use a higher motivation as a main drive to learn Chinese language as a lifelong business.

The study of co-fusion was one of the essential topics in the history of metallurgy in China. Simulation experiments had been an essential concept in the study of the co-fusion steelmaking process. This paper mainly studied the simulation experiments of co-fusion from two aspects: the replication of co-fusion swords by three different methods, and the micro-analysis of the co-fusion samples. The experimental results indicated that several co-fusion swords could be made by different processes, but the carbon content and surface hardness were quite different. During repeated forging welded, the microstructure of the samples transformed from laminated to homogenized, finally the steel with a uniform carbon content was obtained. It was challenging to find the characteristics of co-fusion from the homogenized samples. The results prompted people to rethink the microstructure characteristics of ancient co-fusion artifacts.

The apple leaf-curling midge, Dasineura mali Kieffer (Diptera: Cecidomyiidae), is an invasive pest of apple. To provide crucial information for its pest risk analysis, forecast and management, we investigated the effects of temperatures (5, 10, 15, 20 and 25°C) and daylengths (10, 11, 12, 13, 14 and 15 hrs) on its development and survival. The midge could not complete its development at 10°C or lower. After transferred from 20°C to 10°C, mature larvae could survive for about two months and develop to adults. Pupation and emergence rates were significantly higher at 20°C than at 10°C and 25°C. Daylength had no effect on these parameters. The low temperature threshold and thermal requirement to complete development from eggs to adults were 3.7°C and 627 degree-days, respectively. The midge had significantly lower thermal requirement for completion of its lifecycle at 20°C (614.5 degree-days) than at 15°C (650.1 degree-days) and 25°C (634.8 degree-days). The thermal model developed in this study provided accurate predictions of the number of D. mali generations and adult emergence time in each generation in different regions of New Zealand. We suggest that the model could be used to predict population dynamics of this pest in other parts of the world.

The nuclear factor-ĸB (NF-ĸB) transcriptional system is a major effector pathway involved in inflammatory responses. Previous studies found that a Gardenia decoction (GD) inhibited the expression of NF-κB in a lipopolysaccharide (LPS)-stimulated mouse intestinal injury model. Herein, we hypothesized that geniposide (GE), a component of Gardenia jasminoides Ellis, also exerts anti-inflammatory effects and inhibits NF-ĸB activity in LPS-induced intestinal epithelial cells (IEC-6). IEC-6 cells were stimulated with LPS, following which the effects of GE on NF-ĸB signaling in the IEC-6 cells were examined by western blotting to detect IĸB phosphorylation/degradation. The expression of NF-κB was determined by immunofluorescence assay (IFA). Enzyme-linked immunosorbent assay (ELISA) was used to detect the inhibitory effect of GE on the release of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-1β (IL-1β) activated by LPS in IEC-6 cells. In addition, the migration ability of IEC-6 cells was observed by the scratch method. These results showed that GE dose-dependently downregulated levels of the proinflammatory cytokines TNF-α, IL-6 and IL-1β that had been upregulated by LPS and suppressed the phosphorylation of IĸB and NF-ĸB induced by LPS. Our findings indicated that GE could reduce LPS-induced NF-ĸB signaling and proinflammatory expression in IEC-6 cells and significantly enhance the migration of IEC-6 cells. Moreover, GE inhibited the expression of NF-κB, nuclear transfer, and transcriptional activity in IEC-6 cells. GE could block the synthesis of inflammatory factors of IEC-6 cells by inhibiting activation of the IĸB/NF-κB signaling pathway induced by LPS.

We demonstrate fabrication of single-mode optical waveguides on lithium niobate on insulator (LNOI) by optical patterning combined with chemo-mechanical polishing. The fabricated LNOI waveguides have a nearly symmetric mode profile of a mode field size of ~2.5 µm (full-width at half maximum). We develop a high-precision measurement approach by which the single mode waveguides are characterized to have a propagation loss of ~0.042 dB/cm.

Nickel-based Superalloy Inconel 718 is widely used in the aerospace industry for its excellent high-temperature strength and thermal stability. However, milling Inconel 718 presents challenges due to significantly increased cutting force and vibration, which is a typical difficult-to-machine material. This paper focuses on the milling process of Inconel 718, establishing a milling force model to analyze the force trends under various processing parameters. Finite element analysis is employed to study the stress and temperature fields during milling. Dynamic equations for milling Inconel 718 are developed, and stability lobe diagrams are generated based on modal experiments. Milling experiments on Inconel 718 validate the milling force model and finite element analysis results. The fmincon optimization algorithm is utilized to identify the optimal machining parameters for Inconel 718. Through this research, valuable insights into enhancing the efficiency and quality of Inconel 718 machining are provided. This study contributes to a deeper understanding of Inconel 718 milling behavior, offering crucial guidance for more efficient machining processes.

Abstract: The Hanqu Joint Station of the Dingbian Oil Production Plant of Yanchang Oilfield Co., Ltd is located at the edge of the desert in northern China. the bad field conditions and strong sandstorm, the hardware of computer monitoring system of Joint Station is often damaged. At the same time, the core equipment of the joint station three-phase separator oil chamber liquid level is hard to achieve high precision constant value control, the general control algorithm is difficult to meet the control requirements.This paper proposed a design scheme of a oilfield joint station computer monitoring system based on the Siemens S7-300 PLC, the hardware of the monitoring system adopts the redundancy scheme of dual monitoring computers, dual programmable logic controllers (PLCs), and dual industrial Ethernet. The BP neural network PID control algorithm was used to realize constant value control of the oil chamber liquid level of the three-phase separator of the core equipment of the joint station，and realized high control precision. The monitoring system could well adapt to the harsh environment of the scene, and showed high reliability and efficiency.

Thyroid nodules (TNs) are common thyroid lesions in older population. Few studies focused on the prevalence of TNs and its relationship to lifestyle characteristics and dietary habits in centenarians. The current study aimed to determine the prevalence of TNs in Chinese centenarians using high-resolution ultrasound equipment and investigate its relationship to lifestyles and dietary habits. The current study was part of China Hainan Centenarian Cohort Study (CHCCS) which conducted in Hainan, an iodine sufficient region in China. A total of 874 permanent residents aged 100 years or older (mean age, 102.8 ± 2.8 years) without any missing data were included in the analysis. Among the participants, 649 of them were detected at least one thyroid nodule under the ultrasound examinations. The overall prevalence rate of TNs was 74.3%. The prevalence of TNs was higher in participants who were females, hypertension, diabetes, and underweight than their counterparts. Multivariate logistic regression analyses showed that being female, hypertension, diabetes, betel quid consumption, red meat consumption were independent risk factors, while being underweight, and nut consumption were independent protective factors for TNs. Our findings indicate that the presence of thyroid nodules was highly prevalent in Chinese centenarians, particularly in females. In addition to gender, hypertension, diabetes, and underweight, the presence of TNs was independently associated with betel quid, red meat, and nut consumptions. Further prospective studies are warranted to verify these associations in population from different age strata, races, cultures, and iodine backgrounds.

In this paper, we propose an efficient numerical method to solve the diffusive logistic model with a free boundary which is often used to simulate the spreading of the new or invasive species. The boundary movement is tracked by the level-set method, where the Hamilton-Jacobi weighted essentially nonoscillatory (HJ-WENO) scheme is utilized to capture the boundary curve embedded by the Cartesian grids via the embedded boundary method. Then the radial basis function-finite difference (RBF-FD) method is adopted to the spatial discretization and the IMEX scheme is considered for time integration. A variety of numerical examples are carried out to demonstrate the evolution of diffusive logistic model in different initial boundaries.

We develop a technique for realizing lithium niobate on insulator (LNOI) waveguides of a multi-centimeter-length with a propagation loss as low as 0.027 dB/cm. Our technique relies on patterning a chromium (Cr) thin film coated on the top surface of LNOI into a hard mask with a femtosecond laser followed by the chemo-mechanical polishing for structuring the LNOI into the waveguides. The surface roughness on the waveguides is determined to be 0.452 nm with an atomic force microscope (AFM). The approach is compatible with other surface patterning technologies such as optical and electron beam lithographies or laser direct writing, enabling high-throughput manufacturing of large-scale LNOI-based photonic integrated circuits.

In order to solve the problem of measuring the distance and position between the flanges of two pipelines on the seabed, a measuring device for pulling rope in seawater was designed. Aiming at the sealing problem of the key equipment that is the rotating shaft of the rope winch, this paper used the principle of the magnetic coupling to transfer the driving moment, and adopted the method of converting the dynamic seal into the static seal structure to realize the reliable sealing of the motor. Through the experiment of measuring two pipelines with underwater rope pulling device, it was verified that the measuring accuracy of the device meets the design requirements, and the feasibility of the application of magnetic coupling technology in winch is also verified.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Variation in metabolite profiles of under high salinity and nitrogen constraint conditions are the key issues of study at the present. To investigate the optimum NaCl and NaNO3 concentration and the corresponding metabolic pathways of astaxanthin accumulation in H. pluvialis, a 26-day batch culture experiment of H. pluvialis treated under the variable concentration gradients of NaCl and NaNO₃ were conducted. The results indicated that 7.5g•L^-1 and nitrogen-deficient were the optimum NaCl and NaNO₃ concentration for the astaxanthin accumulation according to single factor experiments respectively, under which the highest contents of astaxanthin accumulated in H. pluvialis reached up to 7.51mg•L^-1 and 5.60mg•L^-1. A total of 132 metabolites were analysed using LC-MS/MS technique, among which 30 differential metabolites with statistical significance were highlighted. Subsequently, 18 and 10 differential metabolic pathways in the high salinity and nitrogen-deficient treatments with statistic significance were enriched and annotated respectively. Furthermore, the metabolic networks related to the astaxanthin accumulation were constucted based on the crucial pathways and metabolites. Moreover, the major carbon metabolism in H. pluvialis under the high salinity and nitrogen deficient stress were presented, which exhibited the characteristics in the identified metabolites changes under the different stress conditions. The results did not only demonstrate the differential metabolic networks and the distinct changes in the metabolites involved in the major carbon metabolism, related to the astaxanthin accumulation in H. pluvialis under the different stress factors, but provided the regulation targets for astaxanthin production in practice.

Curriculum teaching is the basic unit to realize the cultivation and achievement of students’ ability in undergraduate colleges, and it is very important to investigate the influence mechanism of the curriculum system on the achievement states of students' ability. This paper first puts forward the theoretical system and framework of curriculum chains, and constructs a “double-energy and double-space” (DEDS) which consist of the curriculum energy efficiency space and student ability space respectively. Investigating the space-time transformation relationship of curriculum chains in the DEDS, the forward transformation model, inverse transformation model and the rheological model of the achievement states in the curriculum energy efficiency space and student ability space are established. Studying the dynamic evolution mechanism of curriculum chains within the DEDS, the dynamic evolution model, which presents the relationship between achievement states of curriculum energy efficiency/students' ability and curriculum/students' dynamic potential, are established; the control methods of courses/students' dynamic potential based on the proposed dynamic evolution model are developed to ensure the achievements of the graduates’ social ability; the evaluation and detection methods of achievement states of curriculum chains in DEDS are proposed to obtain the actual achievement states of curriculum energy efficiency and students’ ability, and this will provide effective input for the control of curriculums/students’ dynamic potential; the planning and design methods of curriculum chains facing social needs are presented, which can provide theoretical basis for the formulation of the talent training scheme and curriculum system in colleges and universities.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

During chronic liver injury, inflammation leads to liver fibrosis— particularly due to the activation of hepatic stellate cells (HSCs). However, the involvement of inflammatory cytokines in HSC activation and the relationship among different liver cells is unclear. To examine their interactions, many in vitro liver models are performed in organoid or spheroid culture with random 3D structure, complicating analysis. Herein, we demonstrated the hierarchical coculture of primary rat hepatocytes with non-parenchymal cells such as the human-derived HSC line (LX-2) and liver sinusoidal endothelial cell line (TMNK-1). The cocultured tissue had high usability with simple operation of separating solid and liquid phases with improved liver functions such as albumin production and hepatic cytochrome P450 3A4 activity. We also studied the effects of stimulation by both oxygen tension and the key pro-fibrogenic cytokine, transforming growth factor beta (TGF-β), on HSC activation. Gene expression analysis revealed that lower oxygen tension and TGF-β1 stimulation enhanced collagen type I and alpha-smooth muscle actin expression from LX-2 cells in the hierarchical coculture. Therefore, this hierarchical in vitro cocultured liver tissue could provide an improved platform as a disease model for elucidating the interactions of various liver cell types and biochemical signals in future liver fibrogenesis studies.

Due to the rapid development of unmanned aerial vehicles (UAVs) communication technology, UAVs are gradually competing with primary users (PUs) for spectrum resources. Cognitive radio (CR) is a promising solution to meet the needs. Cooperative spectrum sensing (CSS) is considered as an effective method to detect the PU signal and identify available spectrum resources for UAVs in a cognitive UAV network (CUAVN). However, the cooperative mode among multiple UAVs may incur a high overhead, resulting in performance degradation. Therefore, we introduce a differential sequential 1 (DS1), which incorporates a differential mechanism and leverages the sequential idea based on the classical voting rule to enhance cooperative performance and efficiency. In view of this, we formulate three scenarios to characterize the PU activity and introduce a multi-slot cooperative mode within a single UAV to realize cooperative gain. Further, only the information change about the PU status is sequentially calculated in DS1, and combined with a sequential idea, the efficiency of the voting rule is greatly improved. Moreover, the application of support vector machines (SVM) in dynamic selection enables the selection of the most suitable voting rule based on diverse sensing parameters. This dynamic selection process ensures optimal performance and efficiency by adapting the voting rule to the specific characteristics of the given scenario. Finally, simulation results demonstrate that the superiority of our proposal with respect to the detection performance, sample size and the energy efficiency is evident, which proves the high performance of the proposed policy.

Due to the long duration and high cost of traditional pumping tests, the response of well water level to seismic wave, earth tide, and barometric pressure provides a feasible method for determining continuous changes in aquifer hydraulic parameters. Aiming at the problem that the response phase shift of well BB water level to tidal tide M2 is greater than that of tide O1, this paper preferentially calculated the time series changes of S, Be, n and BKu based on the response mechanism of well water level to barometric pressure and earth tide and with the help of smooth moving method. Then by using the mixed flow model, the variation of transmissivity and leakage coefficient over time were simultaneously obtained, and the evolution process and characteristics of aquifer parameters near well BB caused by the Wenchuan earthquake were ultimately discussed. The calculation results are basically consistent with the previous pumping test, and have been verified and compared by using other scholars' methods. This solving process avoids the problems such as excessive dependence on initial values, multiple solutions, and unstable tide O1, which has a promoting effect on the study of the impact of seismic activity on aquifer systems.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

To deal with the uncertainties in modeling offshore wind turbines, we proposed a parameter inversion method for the pile-soil interaction model based on structural health monitoring results and the numerical model. The proposed parameter inversion method has a numerical model, an objective function selected using both the numerical and identified results, and an inverse optimization using a random search algorithm in the assumed parameter space. The parameter results in the minimum optimization objective function are identified as the in-situ parameter. The proposed method is confirmed to converge after some iterations, whatever the initial parameter values are. However, different initial parameter cases may converge to slightly different optimal parameters, implying the pile results are sensitive to geological parameters. Moreover, a comparison with the original design results shows design redundancy or risks. Though the proposed method has several flaws, it can shed some light on the influence of uncertainties in offshore wind turbines, such as soil parameters in geological surveys.

Type II grass carp reovirus (GCRV-II) with high pathogenicity and infectivity causes severe hemorrhagic disease, which leads to extensive death in the grass carp and black carp aquaculture. However, the early invasion portal remains unclear. In this study, we explored the invasion portal, time, and pathway of GCRV-II by immersion infection in grass carp. Through the detection of the infected grass carp external body surface tissues, most of them could be detectable to carry GCRV-II within 45 minutes except for the skin covered by scales. Further shortening the duration of infection, we proved that GCRV-II rapidly invades through the nostril (especially), gill, and skin on head at only 5 min post immersion, rather than merely adhesion. Subsequently, visual localization investigations of GCRV-II were conducted on the nostril, olfactory system (olfactory bulb and olfactory tract), and brain by immunofluorescence microscopy and transmission electron microscopy. We found that few viruses were located in the nostril at 5 min post immersion infection, while significantly increased viruses were distributed in all these tissues at 45 min. Furthermore, semi-qRT-PCR and western blotting results of different infection time confirmed that GCRV-II invades grass carp via nostril-olfactory system-brain axis and then unfolds viral replication. These results revealed the infection mechanism of GCRV-II on the invasion portal, time, and pathway in grass carp. This study aims to understand the invasion mode of GCRV-II in grass carp, which provides theoretical support for the prevention and control strategies of hemorrhagic disease.

Rhododendron is well-known for the colorful corolla. Molecular marker systems have the potentials to elucidate genetic diversity as well as to assess the genetic fidelity in rhododendrons. In the present study, the reverse transcription domains of long terminal repeat retrotransposons were cloned from rhododendrons and used to develop inter-retrotransposon amplified polymorphism (IRAP) marker system. Subsequently, 198 polymorphic loci were generated from the IRAP and inter-simple sequence repeat (ISSR) markers, of which 119 were derived from the IRAP markers. It was justified that in rhododendrons, IRAP markers were superior to the ISSRs in some polymorphic parameters such as the average number of polymorphic loci (14.88 versus 13.17). In comparison with the single one, the combination of IRAPs and ISSRs systems was more discriminative for detecting 46 rhododendron accessions. Further, IRAP markers demonstrated more efficiency in genetic fidelity detection of in vitro R. bailiens, an endangered species just recorded in Guizhzhou Province, China. The available evidences revealed the distinct properties of IRAP and ISSR markers in the rhododendron-associated applications, and highlighted the availability of highly informative ISSR and IRAP markers in the genetic diversity evaluation and the genetic fidelity assessment of rhododendrons, which may facilitate the preservation and genetic breeding in rhododendron plants.

Tuberculosis (TB) is a leading infectious disease with serious antibiotic resistance. The benzothiazinone (BTZ) scaffold PBTZ169, an inhibitor of the decaprenylphosphoryl-β-D-ribose 2'-oxidase (DprE1) in Mycobacterium tuberculosis (Mtb), showed anti-TB potential in animal model and piloted clinical tests. Although highly potent, the BTZ type DprE1 inhibitors in general shows extremely low aqueous solubility, which adversely affect the drug like property. To improve the compounds physiochemical properties, we generated a series of BTZ analogues. Several optimized compounds had MIC values against Mtb in single digit nanomolar. The representative compound 37 displayed improved solubility and bioavailability compared to the lead compound. Additionally, compound 37 shows Mtb-killing ability in an acute infection mouse model.

An array of Ag nanowires has been prepared from a facile, templated approach on Cu(BTC) (1,3,5-benzenetricarboxylic acid) metal organic framework (MOF) micropillars. The Ag-deposited scaffolding material may be used to prepare electronic or optoelectronic devices for various applications.

Various factors and constraints should be considered when developing a manufacturing production schedule, and such a schedule is often based on rules. This paper develops a composite dispatching rule based on heuristic rules that comprehensively consider various factors in a semiconductor production line. The composite rule is obtained by exploring various states of a semiconductor production line (machine status, queue size, etc.), where such indicators as makespan and equipment efficiency are used to judge performance. A model of the response surface, as a function of key variables, is then developed to find the optimized parameters of a composite rule for various production states. Further, dynamic scheduling of semiconductor manufacturing is studied based on support vector regression (SVR). This approach dynamically obtains a composite dispatching rule (i.e. parameters of the composite dispatching rule) that can be used to optimize production performance according to real-time production line state. Following optimization, the proposed dynamic scheduling approach is tested in a real semiconductor production line to validate the effectiveness of the proposed composite rule set.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

The electronic structural evolution of LLM-105 crystal and the (101) plane of LLM-105 crystal under different pressures is investigated by the density functional theory (DFT) calculations and the surface properties of seven low-Miller-index planes of LLM-105 crystal were investigated in this study. The result demonstrates that the surface energy of (101) plane of LLM-105 is much smaller when compared with other low-Miller-index planes of LLM-105.In order to further investigate the stability of crystal structure and (101) plane of LLM-105 under different pressures, a series of pressures ranged from 0 GPa to 55 GPa were applied during the DFT calculation, and the result shows that the electronic structures of LLM-105 crystal and the (101) plane changed with the increase of external pressure and the evolution process of (101) plane is different from that of LLM-105 crystal structure.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

This study introduces a neural network-based approach to predict dust emission, specifically PM2.5 particles, during almond harvesting in California. Using a feedforward neural network (FNN), the research predicts PM2.5 emissions by analyzing key operational parameters of an advanced almond harvester. The model is trained on extensive field data from the almond pickup system, including variables like brush speed, angular velocity, and harvester forward speed. The results demonstrate a notable predictive accuracy of the FNN model, with a Mean Squared Error (MSE) of 0.02 and a Mean Absolute Error (MAE) of 0.01, indicating a high degree of precision in forecasting PM2.5 levels. The study also finds a strong correlation between certain operational parameters and PM2.5 emissions, highlighting specific areas for optimization in harvesting techniques. By integrating machine learning with agricultural practices, this research provides a significant tool for environmental management in almond production, offering a method to reduce harmful emissions while maintaining operational efficiency. This model presents a solution for the almond industry and sets a precedent for applying predictive analytics in sustainable agriculture.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

The Doppler band compensated by the keystone transform (KT) is limited. Therefore, it needs to be used in conjunction with the Doppler ambiguity compensation function to correct the range migration (RM) caused by maneuvering targets with Doppler ambiguity. However, the KT implemented by sinc interpolation suffers from significant performance loss at boundaries of compensation Doppler bands. Additionally, in a multi-target scenario, KT implementation methods occupy high complexity when the Doppler range of targets spans over two compensation Doppler bands. To address aforementioned issues, this study presents a variable Doppler starting point keystone transform (VDSPKT) method, where a new form of ambiguity compensation function is constructed, turning the Doppler starting point of the compensation band in KT variable. Firstly, the position of the compensation Doppler band is changed from fixed to adjustable as needed, enhancing the flexibility of KT. Crucially, the connection points of the compensation Doppler bands in sinc interpolation are reset, avoiding the performance loss at their boundaries. Also, the compensation band is adjusted to cover the narrow Doppler frequency range caused by targets, significantly improving the computational efficiency. Finally, the simulation results demonstrate that the proposed approach effectively addresses the performance degradation and high computational complexity of KT in the aforementioned scenarios, resulting in a computational load reduced by approximately 50% compared to traditional methods.

This paper systematically discusses the application of reinforcement learning in automatic driving system. Reinforcement learning frameworks show significant advantages in optimizing decision making, predictive perception, path planning, and controller design, exceeding the limitations of traditional supervised learning methods. The paper highlights the critical role of components such as scene understanding, positioning, and map making in autonomous driving systems, which provide reliable environmental awareness through deep learning and sensor fusion technologies to support intelligent decision-making in complex urban environments. In addition, the paper discusses innovative approaches to safety reinforcement learning to reduce risk in autonomous driving and ensure that systems adhere strictly to safety constraints while maximizing expected rewards. These findings provide an important theoretical and practical basis for further improving algorithm robustness, managing multi-agent interactions, and integrating ethical considerations in the future.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

(1) Background: Brassinosteroids (BRs) are an important hormone that participates in almost all stages of plant growth and development, and sterol dehydrogenase is a key enzyme that is involved in the biosynthesis of BRs. However, the steroid dehydrogenase gene family in Populus yunnanensis Dode (P. yunnanensis) has not been studied; (2) Methods: The PyDET2 gene family was identified and bioinformatics analyzed. Three genes were screened based on the RNA-seq of stem tip, the PyDET2e was further investigated by RT-qPCR (real-time quantitative polymerase chain reaction) and subcellular localization; (3) Results: We identified 14 DET2 family genes in P. yunnanensis that were classified into 4 groups according to sequence similarity and phylogenetic relationship, and 10 conserved protein motifs had been identified. The gene structure, chromosome distribution, collinearity, and codon preference of all PyDET2 genes identified in the genome of P. yunnanensis were analyzed. The codon of this family is biased to the end of A/U, and natural selection has a great influence on it. The expression level of PyDET2e in September was higher than in July, and it was significantly expressed in stems, stem tips, and leaves. The PyDET2e protein was localized in chloroplasts; (4) Conclusions: The PyDET2e is involved in the development of P. yunnanensis in the rapid growth stage. The systematic analysis provided a basis for the genome-wide identification of genes related to brassinolide biosynthesis processes in P. yunnanensis, and laid a foundation for the study on the mechanism of rapid growth of P. yunnanensis.

Multi-sensor data fusion of E-tongue and E-nose can provide a more comprehensive and more accurate analysis results. However, it also brings some redundant information, it is a hot issue to reduce the feature dimension for pattern recognition. In this paper, the taste-olfactory data fusion based on E-tongue and E-nose combined with Support Vector Machine (SVM) was used to classify five different beers. First, the taste and olfactory feature information were obtained based on E-tongue and E-nose. Second, the original feature data of single system were fused, then Principal Component Analysis (PCA) was applied to extract principal components, Genetic Algorithm-Partial Least Squares (GA-PLS) was used to select the characteristic variables, 20 subsets were generated with those variables based on the best Variable Importance of Projection (VIP) score. Finally, the classification models based on SVM were established, also c and g of SVM were calculated by Grid Search (GS), Genetic Algorithm (GA), and Particle Swarm Optimization (PSO), the classification results of all subsets were obtained. The results showed that the classification accuracy using data fusion was much higher over single E-tongue and single E-nose, and the variable selection method by VIP had the best classification performance in #12 subset coupled with GA-SVM.

Abstract: Dispersal strategies of a species can affect its invasion success. Investigation into the dispersal strategies of invasive species in relation to different factors helps our understanding of the invasion mechanisms and provides knowledge for population management and invasion evaluation. Tetranychus ludeni Zacher (Acari: Tetranychidae) is an invasive species, which is native to Europe but now cosmopolitan. Here, we examined the effects of age and density on dispersal in mated females. Our results show that older females with more eggs were more likely to disperse and moved longer distances than younger ones with fewer eggs. Older females spread most of their eggs out of the natal habitats and over longer distances, which reduced competition and increased offspring fitness. Females significantly increased dispersal probability and distance with the increase of population density to avoid crowding. The synchronization of dispersal and reproduction, along with the positive density-dependent dispersal strategy, may facilitate habitat colonization and invasion speed of T. ludeni.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Digital-Radio-Frequency-Memory (DRFM) has emerged as an advanced technique to achieve diverse jamming signals, due to its capability of intercepting waveforms within a short time. Multiple-Input Multiple-Output (MIMO) radars can transmit agile orthogonal waveform sets for different pulses to combat the DRFM-based jamming, where any two groups of waveform sets are also orthogonal. In order to design multiple groups of orthogonal waveform sets at the same time, this article formulates a group orthogonal waveforms optimal design model, whose objec-tive function is the weighted sum of the intra- and inter-group orthogonal performances metrics. To solve this optimization problem, this article proposes a group orthogonal waveforms design algorithm. Based on a primal-dual type method and proper relaxations, the proposed algorithm transforms the original problem into a series of simple sub-problems. Numerical results demonstrate that the proposed algorithm has the ability to balance the intra- and inter-group orthogonal performances by adjusting the weighting factors, which is not available using other state-of-the-art orthogonal waveform design algorithms.

The 2-Acetyl-1-pyrroline (2-AP) is the most important volatile in determining the aroma of fragrant rice, however, the transcriptional regulation mechanism of 2-AP biosynthesis in fragrant rice is still unclear. In this study, the Osp5cs1 knockout mutant lines and OsP5CS1 over-expression lines were constructed by genetic transformation of indica rice cultivar i.e., ‘Zhonghua11’, which was knocked out OsBADH2 to produce fragrance in aromatic rice. The OsP5CS1 gene was also identified as a key gene in the 2-AP biosynthesis pathway of aromatic rice. The OsP5CS1 promoter was used as bait, and the transcription factor OsbZIP60-like was screened by yeast one-hybrid assays. The transcription factor OsbZIP60-like specifically bound to the OsP5CS1 gene. The dual luciferase reporting system found that OsbZIP60-like transcription factor promoted the transcriptional activation of OsP5CS1. Compared with the wild type, the OsP5CS1 gene expression was significantly down-regulated in Osbzip60-like mutant, and resulted in substantial reduction in 2-AP biosynthesis. Moreover, the OsP5CS1 gene expression was significantly up-regulated in OsbZIP60-like over-expressed plants, and the 2-AP concentrations were also increased whereas the Osbzip60-like mutants were found to be sensitive to Zn deficiency. Overall, the OsbZIP60-like transcription factor promoted the 2-AP accumulation. This study provides a theoretical basis for the transcriptional regulation mechanism of 2-AP biosynthesis and explores the function of OsbZIP transcription factor in fragrant rice.

Understanding the thermal cracks of rock caused by high temperature is of great help to the development of underground engineering, such as geothermal mining, underground coal gasification. Although there has been many study on thermal cracking, it is not systematic and in-depth enough. In order to deeply study the thermal crack mechanism of rock, this paper conducted thermal cracking experiments on granite at different temperatures and heating/cooling paths, and qualitative and quantitative analysis was conducted on the crack initiation characteristics, propagation paths, and crack network morphology of rock thermal crack under different test conditions. The thermal crack mechanism was also analyzed from the perspectives of mineral petrology, fracture mechanics, thermodynamics, and other aspects. The research results show that there are two obvious mutation points in the study temperature range for samples with fast cooling paths (SF path: slow heating and fast cooling; FF path: fast heating and fast cooling), around 200-300 ℃ and 600 ℃, respectively, while for samples with slow cooling paths (SS path: slow heating and slow cooling; FS path: fast heating and slow cooling), there is only one mutation point around 600 ℃. The initiation positions of thermal cracking under all temperature paths are relatively similar, with intergranular crack located between particles at the edge of the sample or intercrystalline crack in the middle of feldspar or quartz aggregates. The initiation temperature of SF and FF path specimens is relatively low compared to SS and FS path specimens, and the number and size of cracks is small. The crack network structure formed by the SF path is the most complex, with the largest crack ratio and cumulative crack length; The crack network structure formed by the FF path is relatively complex, with a larger main crack size but relatively fewer secondary cracks; The FS and SS paths do not form a complex network with good connectivity. The process of thermal crack development can be divided into three stages: the development of small cracks, the joint development of main cracks and small cracks, and the connection of cracks into a network structure. The mechanism of thermal crack propagation is that the expansion and thermal conductivity between different crystals are different. The thermal stress caused by temperature gradient and the tension or shear stress caused by the inconsistent deformation of crystals form stress concentration in weak areas such as particles boundary, cleavage, and original cracks. Firstly, it causes some crystals with smaller strength or less rounded shape to crack, and when the combined stress is large, the cracks will gradually expand along the existing fine cracks. This also explains that the most main cracks of the SF and FF path specimens mainly surround some large mineral aggregates or between particles.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

In this paper we study a class of impulsive delayed neural networks with parameter uncertainties and reaction-diffusion terms. Using the properties of M-matrices and some inequality techniques, some sufficient conditions are derived to guarantee the global exponential stability of the given system. The results obtained are presented by simple algebraic inequalities, which are certainly more concise than previous methods. Finally, the validity and usefulness of our results are illustrated by arithmetic examples.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Recommender Systems (RecSys) are crucial in managing information overload and enhancing user satisfaction across various digital platforms, including e-commerce and entertainment. Evolving from traditional models to Deep Neural Networks (DNNs) and, more recently, Large Language Models (LLMs), these systems leverage sophisticated algorithms to analyze user behaviors and preferences. LLMs, such as GPT-4, are trained on extensive datasets to comprehend and generate natural language, significantly advancing their ability to deliver personalized recommendations. This tutorial explores the transformative impact of LLMs on RecSys, discussing their development, application in handling complex datasets, and the integration of contextual insights. Real-world examples illustrate how LLMs enhance recommendation accuracy and user experience, highlighting challenges and future directions in the field.

The straightness error of guideway is one of the key indicators of ultra-precision machine, which plays an important role in the machining accuracy of work-piece. In order to measure straightness error of long distance ultra-precision guideway accurately, a splicing measurement for straightness error of guideway using high-precision flat mirror and displacement sensor was proposed in this paper, and the data splicing processing algorithm based on coordinate transformation was studied. Then comparative experiments on splicing measurement and direct measurement of straightness error were carried out on a hydrostatic guideway grinder. The maximum difference between the two measurements was about 0.3μm, which was far less than the straightness error of 5.8μm. The experiment demonstrated the correctness of the proposed splicing measurement method and data processing algorithm. To suppress the influence of straightness error on machining accuracy, a straightness error compensation algorithm based on error rotation transformation and vertical axis position correction was proposed, and the grinding experiment of a plane optics with size of 1400mm×500mm was carried out, whose flatness error after grinding was about 2.98μm. The straightness error of the grinding machine had been well suppressed.

Nitrogen (N) is an important mineral nutrient for plant growth, as well as a limiting factor for crop yield, and how to improve the utilization efficiency of N fertilizer by plants is currently a research hotspot. This article uses bioinformatics methods to identify and analyze members of the glutamine synthetase (GS) and glutamate synthase (GOGAT) gene families in pecan. A total of 6 GS genes and 4 GOGAT genes were identified, and their physicochemical properties, gene structures, and homologous evolutionary relationships were analyzed. Analysis of tissue-specific expression of GS and GOGAT genes based on transcriptome data from pecan. The enzyme activities of GS and GOGAT and the gene expression were quantitatively analyzed under different N form ratios in pecan. According to the results, the promoter cis-acting elements of GS and GOGAT genes can be roughly divided into three types: light-responsive elements, hormone-responsive elements, and stress-responsive elements. The results of homologous evolution showed that there was no tandem duplication event for the two gene families, and GS and GOGAT have undergone purification during the evolutionary process. CiGS2s and CiFd-GOGATs were expressed mainly in leaves, and CiNADH-GOGATs were expressed mainly in fruits. The qPCR analysis results showed that T4 treatment significantly increased the expression levels of CiGS and CiGOGAT genes in the leaves. The enzyme activities of GS and GOGAT in pecan were significantly increased under T3, T4, and T5 treatments. In summary, a higher proportion of ammonium nitrogen (NH4+) in the nutrient solution was profit to pecan NH4+ assimilation. This study determined the appropriate nitrogen ratio for pecan, promoting a theoretical basis for reducing environmental pollution caused by nitrogen fertilizer and improving the nitrogen utilization efficiency of pecan. In summary, both CiGSs and CiGOGATs exhibit tissue specificity, and an ammonium-nitrate mixture with a higher proportion of NH4+ is more favorable for NH4+ assimilation in pecan. This study provides a reference basis for further understanding the functions of CiGSs and CiGOGATs in pecan, and offers a theoretical foundation for improving N use efficiency in pecan.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

This paper proposed emotion recognition methods for consecutive facial images, and implements the inference of neural network model on a field-programmable gate array (FPGA). The proposed emotion recognition methods are based on a neural network model architecture that combines convolution neural networks (CNNs), long short-term memory (LSTM), and fully connected neural networks (FCNNs), called CLDNN or ConvLSTM-FCN. This type of neural network mod-el can analyze the local feature sequences obtained through convolution of data, making it suita-ble for processing time-series data such as consecutive facial images. In this paper, sequences of facial images are sampled from videos corresponding to various emotional state of subjects. The sampled images are then pre-processed with the processes includes facial detection, greyscale conversion, resize, and data augmentation if necessary. The 2-D CNN in ConvLSTM-FCN is used for feature extraction for these pre-processed facial images. These sequences of facial im-age features are time sequences with dependent properties between the elements within them. The LSTM is then used to model these time sequences followed by fully connected neural net-works (FCNNs) for classification. The proposed consecutive facial emotion recognition method achieves an average recognition rate of 99.51% on RAVDESS dataset, 87.80% on BAUM-1s dataset and 96.82% on eNTERFACE’05 data set, using 10-fold cross-validation on the PC. Some com-parisons of recognition accuracies between the proposed method and the other existing related works are conducted in this paper. According to the comparisons, the proposed emotion recog-nition methods outperform the existing related researches. The proposed emotion recognition methods are then implemented on an FPGA chip using the neural network model inference algo-rithms in this paper, and the accuracies of the experiments conducted on the FPGA chip are iden-tical to those obtained on the PC. This verifies that the proposed neural network model imple-mented on the FPGA chip performs well.

Theoretic and empirical studies show that social surroundings experienced by male insects during their larval or adult stage can influence their testicular investment in diverse ways. Although insect pupae do not feed and crawl, they can communicate using sex-specific and/or non-sex specific cues. Yet, it is unknown, in any insect, whether and how male pupae can fine-tune their resource allocation to sperm production and testis size in response to socio-sexual environment. We investigated this question using a moth, Ephestia kuehniella, which produces fertile eupyrene sperm and unfertile apyrene sperm. We held male pupae individually or in groups with different sex ratios, and dissected adults upon eclosion, measured their testis size, and counted both types of sperm. We demonstrated that after exposure to conspecific pupal cues regardless of sex, male pupae increased production of eupyrenes and apyrenes at the same rate but kept testis size unchanged. We suggest that testis size is fixed after pupation because most morphological traits are formed during the larval stage, allowing little room for pupae to adjust testis size. Like adults, male pupae with fully grown testes have sufficient resources to produce more sperm of both types according to the perceived increase of sperm competition risk.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Cloud computing has become a widespread technology due to ICT advancements. It allows businesses to move and take advantage of the pay-as-you-go price model. Enterprises pay for what they use and don't have to buy, setup, or maintain resources. However, outsourcing core resources such as storage, servers, operating systems, and software applications from a third party needs careful decisions to take advantage of cloud facilities. Choice of appropriate service provider, deployment and service model must be aligned with business needs and goals. In this paper, we will present cloud computing benefits, cloud deployment methods, services, state-of-the-art migration methods, tools and techniques and will conclude with the role of SDN in cloud computing.

Bifidobacterium is the most beneficial flora of the human gastrointestinal tract, but there is a concentration threshold for Bifidobacterium to exert its beneficial properties. In this work, the effect of several simple culture methods on the number of viable bifidobacteria was discussed to improve its viable concentrations, and we unexpectedly discovered that bifidobacteria have inert growth. The concentration of viable bacteria of two isolated Bifidobacterium animalis subsp. lactis, BZ11 and BZ25 and Lactobacillus plantarum SQ-4 were investigated using solid-liquid-liquid circulation subculture, solid-liquid-liquid subculture and solid-liquid-liquid circulation subculture. These 3 subculture methods increase the viable cell concentration, and the best is the solid-liquid-liquid subculture. The highest concentrations of third-generation BZ11 and BZ25 were 9.62 × 109 CFU/mL and 1.21 × 1010 CFU/mL in order by solid-liquid-liquid subculture method, which was 10.38 times and 42.31 times higher (P<0.05) than those of the first generation, respectively. However, none of these three subculture methods increased the concentration of SQ-4. These results suggested that Bifidobacterium has growth inertia and Solid-liquid-liquid passage culture inhibiting the growth inertia. This finding is valuable in promoting the industrial application of probiotic bifidobacteria to potential probiotic food production.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

We assessed the growth performance, physiological traits, and gene expressions in steers fed with dietary rumen-protected L-tryptophan (RPT) under cold environment. Eight Korean native steers were assigned to two dietary groups, no RPT (Control) and RPT (0.1% RPT supplementation on a dry matter basis), 6 wks. Maximum and minimum temperatures throughout the experiment were 6.7°C and -7.0°C, respectively. Supplementation of 0.1% RPT to a total mixed ration did not increase body weight but had positive effects of elevating average daily gain (ADG) and reducing the feed conversion ratio (FCR) at day 27 and 48. Metabolic parameter showed higher glucose level (at day 27) in the 0.1% RPT group compared to the control group. Real-time PCR analysis showed no significant differences in the expression of muscle (MYF6, MyoD, and Desmin) metabolism genes between the two groups, whereas the expression of fat (PPARγ, C/EBPα, and FABP4) metabolism genes was lower in the 0.1% RPT group than in the control group. Thus, we demonstrate that long-term (6 wks) dietary supplementation of 0.1% RPT was beneficial owing to enhanced growth performance by increasing ADG and glucose level, decreasing FCR, and maintaining homeostasis in immune responses in beef steers during cold environment.

This study investigated the impact of chitosan (CH, 1%) and aloe vera gel (AL, 30%) edible coatings on the preservation of blue honeysuckle quality during a 28-day storage at -1°C. Coating with CH, AL, and CH+AL led to notable enhancements in several key attributes. These included increased firmness, total soluble solids, acidity, pH, and antioxidant capacity (measured through DPPH, ABTS, and FRAP assays), as well as the preservation of primary (ascorbic acid) and secondary metabolites (TPC, TAC, and TFC). These coatings also resulted in reduced weight loss, respiration rate, color, abscisic acid, ethylene production, and malondialdehyde content. Notably, the CH+AL treatment excelled in preserving secondary metabolites and elevating FRAP-reducing power, demonstrating a remarkable 1.43-fold increase compared to the control after 28 days. Overall, CH+AL exhibited superior effects compared to CH or AL treatment alone, offering a promising strategy for extending shelf life and preserving quality of blue honeysuckle during storage.

Antibiotic resistance (ABR) is concerning issue due to its direct and indirect repercusions on public health, since decreased therapeutic effect of certain antibiotic to treatment complications that can cause death. There are several mechanism as to how ABR can be transferred from one microoorganisms to another, and many of them are dependant many environmental factors. The food supply chain is a environment in which ABR gene transfer can occur is multiple pathways, which generate concerns regarding food safety. Here, we summarize relevant mechanisms which are implied in ABR in food supply chain but also we are addressing routes of transmission and prevalence of ABR, implications on public health, and the application of new alternatives to antibiotics such as antimicrobial peptides, mainly bacteriocins, in order to countermeasure ABR.

The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.

Objective: The aim of this study was to optimize the fermentation process of Radix Ranunculi ternate via microbial fermentation and analyze the changes in the contents of the main components, the antioxidant and hypoglycemic capacities of the extract before and after fermentation. Methods: The solid-state fermentation process was optimized using single-factor tests and the response surface method, with the yield of the alcohol extract of R. ternate as an evaluation index. Results: The best fermentation process was optimized using solid-state endophytic fungus fermentation technology as follows: strain addition ratio of Chaetomium globosum/Fusarium equiseti =1:1, fermentation for 5 d, sieve size of 40 mesh, liquid/material ratio of 0.8:1 mL·g−1, fermentation temperature of 31 °C, and inoculation amount of 7.5%. Under the optimized conditions, the contents of the water-soluble extract and total polysaccharides decreased by 12.71% and 12.95%, respectively, in the fermentation, The contents of ethanol-soluble-extract, flavonoids, saponins, polyphenols, organic acids, and total amino acids of fermented R. ternate increased by 19.77%, 57.14%, 79.67%, 14.29%, 17.63% and 3.82%, respectively, and the scavenging rate for DPPH, ABTS+, ·OH free radicals and inhibitory rate for α-amylase also increased by 19.02%, 14.17%, 7.53% and 34.54%, respectively, compared with unfermented R. ternate. Conclusions: Solid-state fermentation opens new avenues for the development and application of R. ternate as natural antioxidant and hypoglycemic food.

Abstract：This paper uses the balanced panel data from 29 provinces (autonomous regions and municipalities) in China for a total of 17 years from 2000 to 2016 as a research sample, and establishes an empirical model to examine the impact of environmental regulations and technological innovation on the quality of economic growth. Then this paper test technological innovation as a threshold variable, in which play a regulatory role. Taking the provincial balanced panel data as a research sample, a fixed effect model, a system GMM model, and a panel threshold model were established for empirical testing and the robustness test. Based on the empirical results, this article draws the following conclusions: from a national perspective, environmental regulations and technological innovation can significantly promote the quality of economic growth; from a regional perspective, there are regional differences in impact effects. Under the constraints of environmental regulations, the promotion effect of technological innovation on the quality of economic growth will be reduced; the impact of environmental regulation on the quality of economic growth will have a "threshold effect", and environmental regulation can significantly promote the quality of economic growth only after crossing the threshold and the threshold of technological innovation.

Trichothecene mycotoxin T-2 toxin is an important environmental pollutant and poses a global threat to human and animal health. T-2 toxin could induce nephrotoxicity, however, the precise molecular mechanism remains unclear. In this study, the mice were intraperitoneally administrated with a single dose of 2 mg/kg T-2 toxin. The kidney function and ultrastructural observation were also assessed and found T-2 toxin exposure could cause kidney damage. Transmission electron microscopy showed a significant swelling and vacuolization of the mitochondria of renal cell. A total of 1122, 58, and 391 differential expression genes (DEGs) that were predominantly expressed in kidney tissues at 1 d, 3 d, and 7 d after T-2 toxin exposure, respectively. Early transcriptomic changes at 1 d after exposure were down-regulation of DEGs involved in the cell cycle, p53 signaling pathway, and cellular senescence, while up-regulation of DEGs referred to the ribosome pathway. The temporal variations in gene expression pattern in T-2 toxin exposure in mice kidney were presented and cellular metabolism was disturbed at the exposure recovery period with 7 d. In conclusion, this study, for the first time, provided a comprehensive comparative transcriptomic analysis of gene regulation in T-2 toxin exposure-induced nephrotoxicity at different temporal periods and explored the nephrotoxicity mechanism of T-2 toxin at the mRNA level.

Epitranscriptomic RNA modifications play a crucial role in the posttranscriptional regulation of gene expression. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic RNA and plays a pivotal role in RNA fate. RNA m6A modification is regulated by a group of cellular proteins, methyltransferases (writers) and demethylases (erasers), which add and remove the methyl group from adenosine, respectively. m6A modification is recognized by a group of cellular RNA-binding proteins (readers) that specifically bind to m6A-modified RNA, mediating effects on RNA stability, splicing, transport, and translation. The functional significance of m6A modification of viral and cellular RNA is an active area of virology research. In this review, we summarize and analyze current literature on m6A modification of HIV-1 RNA, the multifaceted functions of m6A in regulating HIV-1 replication, and the role of viral RNA m6A modification in evading the innate immune responses to infection. Furthermore, we briefly discuss future directions and therapeutic implications of mechanistic studies of HIV-1 epitranscriptomic modifications.

Background: Currently, many detection methods have high sensitivity to the diagnosis of lung cancer. However, some postoperative patients with pulmonary nodule were eventually diagnosed as benign nodules. The ideal evaluation of an individual with a pulmonary nodule would expedite therapy for a malignant nodule and minimize testing for those with a benign nodule.Methods: This case-control study is designed to explore the relationship between ACE1 rs4646994 polymorphism and the risk of lung cancer in patients with pulmonary nodules, 400 individuals with lung cancer and benign pulmonary nodules were included. A DNA extraction kit was used to extract plasm DNA from peripheral blood. The relationship between ACE1 rs4646994 and the risk of lung cancer in patients with pulmonary nodules was determined by chi-square test, logistic regression analysis and cross analysis. Results: The results showed that the DD genotype of ACE1 rs4646994 may increase the risk of lung cancer in patients with pulmonary nodules, and this correlation was more significant in the female subgroup. In the age stratification analysis, it was found that the risk of lung cancer was significantly increased in the DD genotype of ACE1 rs4646994 in the older subgroup (&gt; 45 years). In addition, the possibility of EGFR mutation in lung adenocarcinoma patients with ACE1 rs4646994 DD genotype was lower than that of II or ID genotype carriers. Conclusions: Our study indicated that ACE1 rs4646994 polymorphism increases the risk of lung cancer in patients with pulmonary nodules from China.

The research fills the policy research gap for the women entrepreneurship and sustainability performance for examining key successful factors. Previous women entrepreneurship research fails to offer policy recommendations. The research purpose is to investigate these factors affect women entrepreneurship capabilities and sustainability performance by using SEM analysis and making policy recommendation. This research employs online and mail survey and obtains 175 women entrepreneur sample. The study finds that family support and motivation have positive effect on women entrepreneurship capabilities and sustainability performance. Barriers have no effect on performance. Hopefully, the research can provide the guidance to contribute to women’s entrepreneurship opportunities for achieving SDGs. Policy recommendation and managerial implication are discussed in the article.

Threshing device is the core component of grain combine harvester, and its working performance determines the working quality and production efficiency of the harvester to a great extent. The straw guide plate plays an important role in the threshing device to dredge the threshing matter and control the threshing time of the combine harvester matter in the threshing chamber. In the past, the guiding structure of threshing device could not optimize the working performance of the machine by adjusting the spiral angle, that is, most cereal combine harvester may not be fed smoothly or even clogged when operating under different crop types, yield differences and operating environments, a kind of threshing device with adjustable guide straw board was studied. In this study, the movement model of the straw on the straw guide plate was analyzed, and it was found that the spiral angle “α”of the straw guide was 0<α<58°.Three-factor and three-level response surface method was used to carry out field experiment on drum speed, working speed and guide grass plate spiral angle, and the experimental data were analyzed by quadratic polynomial regression.The results show that the drum speed, working speed and the spiral angle of the guide grass plate have significant effects on the loss rate (PLR) , impurity content (PIR) and breakage rate (PBR) , the drum speed and working speed have an interactive effect on the impurity ratio (PIR) , and the working speed and the helical angle of the guide grass plate have an interactive effect on the loss ratio (PLR) and breakage ratio (PBR) , there is an interaction between the rotary speed of the roller and the helical angle of the guide grass plate on the crushing rate (PBR) .Further optimization analysis showed that the predicted value was PLR = 1.18% , PIR = 0.72% , PBR = 0.53% , the experimental verification value was PLR = 1.26% , PIR = 0.73% , PBR = 0.61% . The absolute error between the experimental value and the predicted value was very small, however, the optimized field test verified value decreased by 8.31% , 50.04% and 60.30% respectively, which indicated that the optimized harvester had better operation quality, in particular, PIR, PBR and other two indicators have a greater increase in the effect.

The layered oxyselenide BiCuSeO has garnered significant interest because of its ability to exhibit low thermal conductivity and a high Seebeck coefficient. This study involved the preparation of Bi1−xNaxCuSeO1−xFx(x=0, 0.05, 0.10, 0.15, and 0.20) ceramics through the processes of high energy ball milling and cold isostatic pressing. A systematic study was conducted to investigate the impact of co−doping Na/F on the thermoelectric performance of BiCuSeO ceramics. Replacing Bi3+ with Na+ results in the introduction of a considerable amount of holes, leading to a notable enhancement in the electrical conductivity and power factor. The conductivity was significantly increased from 9.10 S cm−1 in the pure BiCuSeO to 94.5 S cm−1 in Bi0.85Na0.15CuSeO0.85F0.15 at 323 K. At 823 K, the power factor of the Bi0.85Na0.15CuSeO0.85F0.15 sample achieved 44.8×10−5 W/ m K2. Moreover, the Bi1−xNaxCuSeO1−xFx ceramics exhibit a minimum thermal conductivity of 0.43 W m−1 K−1. As a result, the Bi0.85Na0.15CuSeO0.85F0.15 sample achieves a maximum ZT value of 0.78, which is 7.09 times greater than that of the pure BiCuSeO sample (0.11) .

Economic development and advancements in information technology contributed to the shift on accounting objective from commission responsibility view to decision-making useful view. The decision-making useful view claims that the accounting measurement methods should be changed to improve the usefulness of accounting information, to enable information users to make correct decisions. In addition, the development of financial instruments leads to the birth of fair value accounting. In recent years, fair value has been one of the most important measurement methods in the International Accounting Standard and US Generally Accepted Accounting Principles. However, China has been quite cautious when it comes to applying fair value full time, especially after the global financial crisis happened in 2008, wherein fair value accounting was exposed to strong suspicion. Hence, studying the value relevance of fair value is of great significance to exploring the accounting profession and reforming accounting standards. This paper attempts to investigate the value-relevance of fair value based on the data of listed financial companies and manufacturing companies in China. The results indicate that the fair value information in the financial industry has a strong explanatory influence to corporate share price. In contrast, the fair value information shows limited relevance in the manufacturing industry. Finally, consulting with the results of normative analysis and empirical study, this paper suggests several rational advices for the application of fair value in China.

In this study, we investigated the effects of three surface treatment techniques on 316L stainless steel, low-temperature immersion corrosion, shot peening followed by immersion corrosion, and electrochemical corrosion. Surface alterations were analyzed using scanning electron microscopy, Raman spectroscopy, and α-step thin-film thickness profiling. Human osteoblast adhesion was evaluated using Liu’s stain and metallographic optical microscopy. The results revealed weak cell adhesion after low-temperature immersion and shot peening followed by immersion corrosion. By contrast, electrochemical corrosion, particularly with a high current density and low corrosive solution concentration, resulted in a uniformly corroded surface, thus promoting dense cell adhesion. All three techniques resulted in porous oxide layers. Overall, our experimental findings highlighted shot peening (1 kg/cm2 for 20 s) and electrochemical corrosion (0.5 M HCl) as effective processes. Electrochemical corrosion produced uniformly dense corrosion pits, whereas shot peening produced semicircular grooves with small corrosion pits, both favorable for cell adhesion. Electrochemical corrosion also yielded excellent cell adhesion, emphasizing its suitability for biomedical activity. We developed a process for creating a porous surface layer and thereby enhancing the cell adhesion to 316L stainless steel for potential biomedical implant applications.

Technology can be seen everywhere and has been integrated into our lives.We are always using technology and enjoying the convenience brought by technology. However, physical retailers and e-commerce companies are also gradually adopting advanced technologies. Technology improves the purchasing environment and purchasing experience. Virtual reality and augmented reality have been hotly discussed in recent years. Technology, although virtual reality and augmented reality technology have not yet matured, it can be said that they will in the future It has great development potential. Virtual reality and augmented reality are also beginning to sprout in the retail industry. However, research on the acceptance of the use of virtual reality and augmented reality in the apparel shopping process is still lacking because This study explores how usefulness, ease of use, hedonicity, customer experience, customer engagement and satisfaction. To influence customer loyalty, this study adopted questionnaire survey and convenience sampling methods, and collected a total of 308 valid questionnaires. The analysis method used confirmatory factor analysis and structural equation model to verify the research hypothesis relationship. The results of this study found. Hedonic has a significant impact on customer loyalty, while usefulness, ease of use, customer experience, customer engagement and satisfaction Satisfaction does not have a significant impact on customer loyalty. This study explains the academic contribution of the research results. The practical implications in marketing are put forward, and specific suggestions and directions for future research are given.

In this paper, an intelligent blind guide system based on 2D LiDAR and RGB-D camera sensing is proposed, and the system is mounted on the smart cane. The intelligent guide system relies on 2D LiDAR, RGB-D camera, IMU, GPS, Jetson nano B01, STM32 and other hardware. The main advantage of the intelligent guide system proposed by us is that the distance between the smart cane and obstacles can be measured by 2D LiDAR based on Cartographer algorithm, thus achieving Simultaneous localization and mapping (SLAM). At the same time, through the improved yolov5 algorithm, pedestrians, vehicles, pedestrian crosswalks, traffic lights, warning posts, stone piers, tactile paving and other objects in front of the visually impaired can be quickly and effectively identified. Laser SLAM and improved yolov5 obstacle identification tests were carried out inside a teaching building on the campus of Hainan Normal University and on a pedestrian crossing on Longkun South Road in Haikou City, Hainan Province. The results show that the intelligent guide system developed by us can drive the wheels and omnidirectional wheels at the bottom of the smart cane, and give the smart cane a self-leading blind guide function like a "guide dog", which can effectively guide the visually impaired to avoid obstacles and reach the predetermined destination, and can quickly and effectively identify the obstacles on the way out. The laser SLAM speed of this system is 25~31FPS, which can realize the short-distance obstacle avoidance and navigation function both in indoor and outdoor envionments. The improved yolov5 helps to identify 86 types of objects, the recognition rate for pedestrian crosswalks and for vehicles are 84.6% and 71.8%, respectively; the overall recognition rate for 86 types of objects is 61.2%, and the obstacle recognition rate of the intelligent guide system is 25-26FPS.

We aimed to evaluate the protective effects of acetyl-xylogalactan on the activity of RAW264.7 macrophages against heat stress. To this end, we assessed cell survival, phagocytic activity, in-tracellular Ca2+ level, mitochondria potential exchange, apoptotic assay findings, galactosidase activity and the RNA-seq by NGS and real-time polymerase chain reaction (PCR) expression. In our evaluation of macrophage morphology at 37°C and 41°C, the macrophages showed an oval shape at 41°C , unlike the spindle shape at 37°C. Therefore, 41°C was chosen as the heat stress condition. Subsequently, we designed an experiment to evaluate changes in the RAW264.7 macrophages after acetyl-xylogalactan treatment under heat stress. The survival of RAW264.7 macrophages treated with acetyl-xylogalactan was higher than that of controls that were not treated with acetyl-xylogalactan. Moreover, on the basis of the results of the annexin-V detection assay, the apoptotic activity of macrophages appeared to have reduced after treatment with ac-etyl-xylogalactan. Moreover, treatment with acetyl-xylogalactan resulted in a stronger recovery trend in the intracellular Ca2+ and mitochondrial membrane potential after heat stress. RNA sequencing and real-time polymerase chain reaction (PCR) illustrated that Sarcodia suieae acetyl-xylogalactan could upregulate the expression of the anti-apoptosis Cflar gene and down-regulate the expression of the apoptosis factors Ddit3, and Hyou1 to protect macrophages under heat stress.

Public safety and intelligent surveillance systems critically depend on anomaly behavior detection for effective monitoring. In real-world pedestrian detection scenarios, prevalent challenges such as missed detections, complex background interference, and small target sizes hinder accurate anomaly identification. To address these issues, this study introduces YOLO-ABD, a lightweight method for anomaly behavior detection that integrates small target detection and channel shuffling. This method employs YOLOv8n as the baseline model, incorporating a small target detection mechanism in the Head part and utilizing GSConv convolution in the Backbone to enhance perceptual capability. Additionally, the SimAM attention mechanism is integrated to mitigate complex background interference, thereby improving target detection performance. Evaluation on the IITB-Corridor dataset demonstrated mAP50 and mAP50-95 scores of 89.3% and 60.6%, respectively. Generalization testing on the street-view-gdogo dataset further highlighted the superiority of YOLO-ABD over advanced detection algorithms, underscoring its effectiveness and generalizability. With a relatively small parameter count, YOLO-ABD presents an excellent lightweight solution for pedestrian anomaly behavior detection.

The fatigue delamination damage is one of the most important fatigue failure modes of laminated composite structures. However, the developments of the theoretical framework, mathematical/physical model and numerical simulation of fatigue delamination are still challenging issues, and there is a lack of systematic classification. This article reviews the experimental phenomena of the onset and propagation stage of delamination under fatigue loading, and summarizes the commonly used phenomenological models for laminated composite structures. The research methods, general modeling formulas and development prospects of the phenomenological models are presented in detail. In the light of the analysis of finite element model (FEM) for the laminated composite structures, a number of simulation methods of fatigue delamination crack propagation damage model are carefully classified. Furthermore, within the theoretical framework of strength theory model (SM), fracture mechanics model (FM), damage mechanics model (DM) and hybrid model (HM), the complete procedure, application, capability assessment, advantages and limitations of the models are also discussed in detail. Finally, several valuable suggestions are given for the research interests, and challenging technical problems that need to be overcome on the fatigue delamination prediction of laminated composite structures in the future.