Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

In precision grinding of hard and brittle materials, coarse-grained diamond grinding wheels are increasingly favored for their efficiency and contour accuracy. However, challenges in dressing these grinding wheels have hindered their widespread adoption. In this paper, the effects of dressing parameters on the surface profile and morphological characteristics of electroplated coarse-grained diamond were studied, thereby optimizing the dressing accuracy and dressing efficiency of the coarse-grained diamond grinding wheel. Models for the surface morphology of the large-grained diamond grinding wheel and its grinding surface were established. With a focus on optimizing dressing accuracy, we explored how the grain’s protruding height post-dressing affects the surface morphology of both the diamond grinding wheel and the grinding surface. The model’s accuracy was verified by electroplated coarse-grained diamond grinding wheel grinding experiments with different grain protrusion heights, and the causes of surface morphology formation were analyzed based on morphological characteristic parameters such as surface roughness and surface height difference. The results showed that compared with the undressed grinding wheel, the surface roughness Sa and Sq of the workpiece by the dressing wheel are reduced by 97.75%−99.77% and 97.57%−99.73%, respectively. Precision dressing enables the surface roughness of the electroplated coarse-grained diamond grinding wheel to reach nanometer levels, enhancing its feasibility and application potential.

Semi-continuous data are very common in the social science and economics. In this paper, a Bayesian variable selection procedure is developed to assess the influence of exogenous factors including observed and unobserved on the semi-continuous data. Our formulation is based on the two-part latent variable model with polytomous response. We consider two schemes for the penalties of regression coefficients and factor loadings: the Bayesian spike and slab bimodal prior and the Bayesian lasso prior. Within the Bayesian framework, we implement Markov Chains Monte Carlo sampling method to conduct posterior inference. To facilitate posterior sampling, we recast the logistic model in part one as the norm-like mixture model. Gibbs sampler is designed to draw observations from the posterior. Our empirical results show that with suitable hyper-parameters, the spike and slab bimodal method slightly outperforms the Bayesian lasso in the current analysis. Finally, a real example related to the China household finance survey is analyzed to illustrate the application of the methodology.. .

Azo dyes are the most widely used synthetic dyes in the printing and dyeing process. However, the discharge of untreated azo dyes poses potential threat for human health and aqueous ecosystem. Herein, we fabricated a novel heterogenous catalyst - activated carbon fiber-supported ferric alginate (FeAlg-ACF) . Together with peroxymonosulfate (PMS) and visible light, this photocatalytic oxidation system was used to remove an azo dye - azophloxine. The results indicated that the proposed catalytic oxidation system can remove 100% azophloxine within 24 min, while under the same system, the removal rate was only 92 % and 84 % when ferric alginate was replaced with ferric citrate and ferric oxalate respectively, which showed the superiority of activated carbon fiber-supported ferric alginate. The degradation of azophloxine is achieved by the active radicals (SO4•− and •OH) released from PMS and persistent free radicals from activated carbon fiber. After treating for 24 min, the total organic carbon of azophloxine solution (50 μmol/L) decreased from 1.82 mg/L to 79.3 μg/L and the nitrate concentration of ions increased from 0.3 mg/L to 8.6 mg/L. That is, up to 93.5% azophloxine molecules were completely degraded into inorganic compounds. Consequently, potential secondary contamination by intermediate organic products during catalytic degradation was prohibited. The azophloxine removal ratio was kept almost constant after seven cycles, indicating the recyclability and longevity of this system. Furthermore, the azophloxine removal was still promising at high concentrations of Cl-, HCO3-, CO32-. Therefore, our proposed system is potentially effective to remove dye pollutants from seawater. It provides a feasible method for the development of efficient and environmental friendly PMS activation technology combined with FeAlg-ACF, has significant academic and application value.

In the future, the pursuit of high-quality economic development and a focus on ecological environmental protection in China will inevitably result in significant conflicts between land use and ecological land use. The challenge lies in achieving sustainable high-quality development while simultaneously protecting the ecological environment, optimizing the land use structure, and promoting a harmonious relationship between humans and the land. These challenges are faced by all regions. Land use conflicts primarily occur in peri-urban areas characterized by prominent economic development and urban agglomeration. Previous studies have mainly focused on analyzing the effects of land use on habitat quality during intense urbanization. However, it is important to recognize that land pressure encompasses economic, ecological, and social aspects. To gain a comprehensive understanding of the spatial conflict of land use and the impact on habitat quality in Ankang, a city that has been advocating ecological protection for the past two decades, this study aims to objectively analyze the spatial trends in land use changes in such cities. Additionally, it aims to provide insights for the harmonious development of land use in eco-region-oriented cities. Using the SSP-RCP scenarios provided by CMIP6, this paper employs a system analysis method, PLUS model, InVEST model, and land use conflict measurement model to dynamically simulate the future habitat quality and spatial conflict patterns of land use in Ankang City. The study explores the spatial coupling effect of both factors under different scenarios. The results indicate the following:(1) Under different future shared socio-economic path scenarios, land use intensity and land conflict levels follow the order of SSP585 (high forcing scenario), SSP370 (medium to high forcing scenario), SSP245 (medium forcing scenario), and SSP126 (low forcing scenario), with intensity and conflict decreasing accordingly. (2) The overall development trend in Ankang City reveals an intensification of land use conflicts and a decrease in habitat quality. The expansion rate of construction land is increasing and exhibiting aggregation, while agricultural land area is expanding and forest land area is continuously decreasing. (3) Land use intensity exhibits a significant positive correlation with land conflict levels, while land conflict levels demonstrate a significant negative correlation with habitat quality. These findings suggest that land use has had some impact on the ecological environment, with indications of habitat degradation. Even in Ankang, where ecological development is highly valued, the city will gradually face conflicts between ecological protection and economic development in future scenarios. The study highlights that Ankang's future development space will be constrained within the context of environmental protection, leading to greater land use conflicts in urban and surrounding areas. Consequently, the quality of habitats will inevitably decline. Therefore, it is crucial to allocate sufficient space for economic development while simultaneously prioritizing ecological protection. This approach will ensure a healthy economic development trajectory and foster a harmonious relationship between humans and the land.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

Background: After allogeneic hematopoietic stem cell transplantation (allo-HSCT), acute leukemia relapse is common, and asymmetric bone marrow recurrence hasn’t been reported. Because the anatomical distribution of acute leukemia clones in the bone marrow after allo-HSCT is presumed to be diffuse, bone marrow aspirations are performed in single site. Case presentation: We identified two acute leukemia patients, whose leukemic burden in bilateral bone marrow specimens differed significantly. The first case was a 20-year-old man who was diagnosed with acute myelomonocytic leukemia and received haploidentical allo-HSCT. He had been in complete remission for two years and off immunosuppressive medications for a year, with normal peripheral blood count. Routine bone marrow biopsy of his left posterior iliac bone marrow showed 52% leukemia blasts, while the right side had 0% blasts ten days later. Due to the discordant results, the patient refused further intervention and died of high leukocyte syndrome four months later. The second case was a 23-year-old woman who was diagnosed with acute B lymphoblastic leukemia and received HLA-identical sibling allo-HSCT. Although 62% of blasts were found in her left iliac marrow on day +122, 0 % of blasts were found on a sample obtained from the right iliac crest on day +128. Whole-body 18F-FDG PET/CT scans confirmed that the leukemic infiltration in her bone marrow was asymmetric. Considering the higher leukemic burden on the left, we chose the left posterior iliac crest aspiration for further response evaluation. After chemotherapy combined with donor lymphocyte infusion, she achieved transient hematologic complete remission. She died of septic shock with heart failure at +258 days after allo-HSCT before infusion of anti-CD19 donor chimeric antigen receptor T cells. Conclusions: To our knowledge, these are the first case reports of asymmetric bone marrow infiltration of blasts in acute leukemia patients after allo-HSCT. Bilateral posterior iliac crest aspirations or 18F-FDG-PET/CT scans may help distinguish such distribution. If discordant bone marrow specimens are observed, physicians should restrict future bone marrow studies to the more involved side.

Innovations and improvements in hydraulic fracturing and horizontal well technologies have contributed to the success of the shale gas industry; however, the industry is also challenged by freshwater use and environmental health issues. Increasing water impact makes precise quantification of water consumption important. The objective in this study was to better understand water sustainability and availability of the projected shale gas from 2018 to 2030 in the Weiyuan play, China. The water footprint framework was used to quantify the potential water use and environmental impacts on different time scales. The results showed that the water use per well ranged from 11351.3 to 60664.73 m3, with a median of 36013.94 m3, totaling ~3.44 Mm3 for 97 wells. Yearly evaluation results showed that the gray water footprint was the main contributor and accounted for 83.82% to 96.76%, which was dependent on different scenarios of treatment percentages. The monthly environmental impact results indicated that the annual streamflow statistics were more likely to prevent water withdrawal. Water quality issues may be alleviated through recycling and retreatment measures that improve current waste water management strategies. Resource regulators should manage their water resources by matching water demand to water availability or replenishment.

The production of municipal solid waste incineration bottom ash (MSWIBA) is very massive and has the potential to replace cement despite the problems of complex composition, uneven particle size distribution, and low reactivity. This paper adopts sodium silicate activation of MSWIBA-slag to improve the reactivity to prepare composite cementitious materials. It explores the hydration performance study of the composite cementitious materials by isothermal calorimetric analysis, Fourier Transform Infrared (FTIR) spectroscopy, XRD physical diffraction analysis, and SEM/EDS tests. SEM/EDS tests will be used to explore the hydration properties of the composite gelling. The results showed that with the increase of MSWIBA doping, the porosity between the materials increased, the degree of Hydration decreased, and the compressive strength decreased with the rise of MSWIBA. When sodium silicate increased from 25% to 35%, too much alkaline material occurred over the alkaline effect, which inhibited the Hydration of the particles, and the degree of hydration reaction decreased, and the compressive strength decreased accordingly; the exothermic process of Hydration can be mainly divided into five stages, quartz and calcite did not participate in the hydration reaction completely, and sexual aluminum participated in the hydration reaction. The vibrational peaks of Si-O-Ti (T = Si and Al) were present in the material. The vibrational peaks of XRD, FTIR, and SEM-EDS all indicate the presence of silica-aluminate network structures in the hydration products, mainly N-A-S-H and C-A-S-H gels.

The accompanying mechanical behavior during the flow of ore-rock dispersion is an important factor leading to the instability and failure of the orepass in the ore storage section. It is of great significance to accurately understand the instability characteristics of the well wall in the ore section, during the ore drawing process by understanding the flow characteristics and internal mechanical transfer mechanism of ore-rock dispersion. Using the discrete element method to analyze the flow characteristics, contact compactness, stress distribution characteristics and contact force probability distribution of the ore-rock dispersion, it realizes the quantitative characterization of the damage degree of ore-rock flow, and reveals the damage mechanism of mine storage wall. The results show that: (1) The friction between ore-rock particles, between ore-rock and well wall is an important reason for the change of the macroscopic flow form of ore-rock from “one” to “V” type. (2) The compactness and stress concentration of ores are increasing with the increase of storage depth, which is shown that with the increase of storage depth, the greater the probability of well wall instability. (3) The probability distribution of contact force strength between particles decreases exponentially in the whole process of ore drawing, in which the strong chain plays a major role in the stability of the dispersion system. (4) The number of overpressure and the overpressure coefficient can be used to quantitatively characterize the wall damage degree under the action of ore-rock flow. The dynamic side pressure decreases periodically in the form of exponential fluctuations, and the dynamic load formed by the ore-rock flow mainly played a role in the lower area of the ore storage section.

To alleviate the contradiction between the increasing demand for water and the shortage of resources and to provide a favorable institutional environment for water rights trading, the Chinese government has strengthened the top-level design of water management system. However, the water-rich regions (southern regions of China) have good water resource endowment and a surplus of total water consumption indicators. Does this mean that there is no incentive and no need to conduct water rights trading in these regions? Through the investigation of water rights circulation cases in the Taihu Basin, a typical water-rich region of China, we established the existence of trading demand and some difficulties in conducting transactions. This paper argues that the needs of trading include alleviating the water gap in regional development, solving the water demand for large new projects, coordinating trans-jurisdiction water disputes. The plight of trading includes the lack of awareness, irregular process, excessive administrative intervention, and imperfect trading system.

Adult neurogenesis involves generation of functional neurons from neural progenitor cells, which have the potential to complement and restore damaged neurons and neural circuits. Therefore, the development of drugs that stimulate neurogenesis represents a promising strategy in stem cell therapy and neural regeneration, greatly facilitating the reconstruction of neural circuits in cases of neurodegeneration and brain injury. Our study reveals that compound A5, previously designed and synthesized by our team, exhibits remarkable neuritogenic activities, effectively inducing neurogenesis in neural stem/progenitor cells (NSPCs). Subsequently, transcriptome analysis using high-throughput Illumina RNA-seq technology was performed to further elucidate the underlying molecular mechanisms by which compound A5 promotes neurogenesis. Notably, comparative transcriptome analysis showed that the up-regulated genes were mainly associated with neurogenesis and the down-regulated genes were mainly concerned with cell cycle progression. Furthermore, we confirmed that compound A5 significantly affected the expression of transcription factors related to neurogenesis and cell cycle regulatory proteins. Collectively, these findings identify a new compound with neurogenic activity and may provide insights into drug discovery for neural repair and regeneration.

Inflammatory reaction after ischemia-reperfusion contributes significantly to prognosis, and microglia activation is the main resource of inflammation in nervous system. STAT5 is proving to be a highly effective anti-inflammatory therapy with great potential, and inhibition of STAT5 has demonstrated significant anti-inflammation and therapeutic effects, but rarely focus on mechanism of neuroinflammation and brain injury from ischemia-reperfusion. It is the first time to found that the anti-inflammation of dauricine is mainly through STAT5-NF-κB pathway, might act as a STAT5 inhibitor. Dauricine suppressed the inflammation cytokines Eotaxin, KC, TNF-α, IL-1α, IL-1β, IL-6, IL-12β, IL-17α, and also inhibited the microglia activation. STAT5b mutant at Tyr-699 reversed the protective effect of dauricine on oxygen-glucose deprivation-reperfusion injury of neurons, and reactivated the suppression of dauricine on P-NF-κB of microglia. These results suggest that dauricine might suppress the neuroinflammation and protect the neuron from the injury of post-ischemia-reperfusion via mediating the microglia activation through STAT5-NF-κB pathway, and ss a potential therapeutic target for neuroinflammation, STAT5 needs to be raised concern in ischemic stroke.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

Neurogenesis in the adult brain plays a major role in the cognitive ability of animals including learning and memory. Poria cocos (Schw.) Wolf (P. cocos) has been known as a traditional Chinese edible medicinal herb with the potential effect to improve learning and memory. However, the effect mechanisms are still elusive. In this study, significant neuronal differentiation-promoting activities of the ethanol extracts of P. cocos (EEPC) were tested in Neuro-2a cells and mouse cortical neural stem/progenitor cells (NSPCs). Subsequently, 97 compounds of EEPC were identified using UHPLC-Q-Exactive-MS/MS. After investigation of neuronal differentiation-promoting activities of 4 major compounds (Ethyl palmitoleate, L-(-)-Arabitol, Choline and Adenosine), only Choline has significant neuronal differentiation-promoting activity. In summary, we investigated the neuronal differentiation-promoting activity and chemical compositions of EEPC, the study of the neuronal differentiation-promoting effect of ether extract of P. cocos indicated P. cocos’s positive effect on learning and memory functions. This is the first investigation of the neuronal differentiation-promoting effect of ether extract of P. cocos based on similar research references.

Species identification and phylogenetic relationships clarification are fundamental goals in species delimitation. Yet these tasks pose challenges when based on morphologies, geographic distribution, and genomic data. Previously, two new species of fern genus Bolbitis, B. × multipinna and B. longiaurita, were described based on morphological traits, are phylogenetically intertwined with B. sinensis and fail to form monophyletic groups. To address the unclear phylogenetic relationships within the B. sinensis species complex, RAD sequencing was performed on 65 individuals from five populations. Our integrated analysis of phylogenetic tree, neighbor net, and genetic structure, indicate that the B. sinensis species complex should not be considered as separate species. Moreover, our findings reveal differences in the degree of genetic differentiation among five populations, ranged from low to moderate, which might be influenced by geographical distance and gene flow. The Fst values also confirmed that genetic differentiation intensifies with increasing geographic distance. Collectively, this study clarifies the complex phylogenetic relationships within the B. sinensis species complex, elucidates the genetic diversity and differentiation across the studied populations, and offers valuable genetic insights that contribute to the broader study of evolutionary relationships and population genetics within the Bolbitis species.

Topographic factors are recognized as one of the key factors influencing vegetation distribution patterns, and studying the interactions between them can contribute to enhancing our understanding of future vegetation dynamics. We used the Moderate-resolution Imaging Spectroradiometer Normalized Differential Vegetation Index (MODIS NDVI) image dataset (2000-2019), combined with Digital Elevation Model (DEM), and vegetation type data for trend analysis, and explored NDVI variation and its relationship with topographic factors through an integrated geographically-weighted model in the Three Parallel Rivers Region (TPRR) of southeastern Tibetan plateau in the past 20 years. Our results indicated that there was no significant increase of NDVI in the entire basin between 2000-2019, except for the Lancang River basin. In the year 2004, abrupt changes in NDVI were observed across the whole basin and each sub-basin. During 2000-2019, the mean NDVI value of the whole basin increased initially and then decreased with the increasing elevation. However, it changed marginally with changes in slope and aspect. We observed a distinct spatial heterogeneity in vegetation patterns with elevation, with vegetation in the southern regions showing higher NDVI than the north as a whole. Most of the vegetation cover was concentrated in the slope range of 8~35°, with no significant difference in distribution except flat-land. Furthermore, from 2000 to 2019, the vegetation cover in the TPRR showed an improving trend with the changes of various topographic factors, with the largest improvement area (36.10%) in the slightly improved category. The improved region was mainly distributed in the source area of the Jinsha River basin and the southern part of the whole basin. Geographically weighted regression (GWR) analysis showed that elevation was negatively correlated with NDVI trends in most areas, especially in the middle reaches of Nujiang River basin and Jinsha River basin, where the influence of slope and aspect on NDVI change was considerably much smaller than elevation.

Topographic factors are recognized as one of the key factors influencing vegetation distribution patterns, and studying the interactions between them can contribute to enhancing our understanding of future vegetation dynamics. We used the Moderate-resolution Imaging Spectroradiometer Normalized Differential Vegetation Index (MODIS NDVI) image dataset (2000-2019), combined with Digital Elevation Model (DEM), and vegetation type data for trend analysis, and explored NDVI variation and its relationship with topographic factors through an integrated geographically-weighted model in the Three Parallel Rivers Region (TPRR) of southeastern Tibetan plateau in the past 20 years. Our results indicated that there was no significant increase of NDVI in the entire basin between 2000-2019, except for the Lancang River basin. In the year 2004, abrupt changes in NDVI were observed across the whole basin and each sub-basin. During 2000-2019, the mean NDVI value of the whole basin increased initially and then decreased with the increasing elevation. However, it changed marginally with changes in slope and aspect. We observed a distinct spatial heterogeneity in vegetation patterns with elevation, with vegetation in the southern regions showing higher NDVI than the north as a whole. Most of the vegetation cover was concentrated in the slope range of 8~35°, with no significant difference in distribution except flat-land. Furthermore, from 2000 to 2019, the vegetation cover in the TPRR showed an improving trend with the changes of various topographic factors, with the largest improvement area (36.10%) in the slightly improved category. The improved region was mainly distributed in the source area of the Jinsha River basin and the southern part of the whole basin. Geographically weighted regression (GWR) analysis showed that elevation was negatively correlated with NDVI trends in most areas, especially in the middle reaches of Nujiang River basin and Jinsha River basin, where the influence of slope and aspect on NDVI change was considerably much smaller than elevation.

Forest ecosystems make a greater contribution to carbon (C) stocks than any other terrestrial ecosystem. To understand the role of regional forest ecosystems in global climate change and carbon exchange, forest C stock and its spatial distribution within the small (2,300 km2) Liuxihe River basin were analyzed to determine the different contributors to the C stock. Forest C stocks were quantified by measuring the biomass of trees, understory vegetation, litter and roots, as well as soil organic C, using data from field samples and laboratory experiments. The results showed that forests stored 38.04 Tg C in the entire basin, with secondary and planted forests accounting for 89.82% and 10.18%, respectively, of the stored C. Five types of forests, a subtropical evergreen broad-leaved forest, a subtropical coniferous and broad-leaved mixed forest, a subtropical coniferous forest, a timber forest, and a non-wood forest, stored 257.55 ± 15.01, 218.92 ± 9.59, 195.24 ± 18.29, 177.42 ± 17.55, and 117.86 ± 6.04 Mg C ha−1, respectively. In the forest ecosystem C stocks of the basin, soils averagely contribute about 73.78%, not including root underground biomass. It provides a comprehensive method for forest ecosystem carbon investigation and forest management in small basin scale.

Moso bamboo is famous for fast growing and biomass accumulation, as well as high annual output for timber and bamboo shoots. These high outputs require high nutrient inputs to maintain and improve stand productivity. Soil nitrogen (N), phosphorus (P) and potassium (K) are important micronutrients for plant growth and productivity. Due to high variability of soils, analysing spatial patterns of soil N, P and K stocks is necessary for scientific nutrient management in Moso bamboo forests. In this study, soils were sampled from 138 locations across Yong’an City and ordinary kriging was applied for spatial interpolation of soil N, P and K stocks. Soil N stock showed a strong spatial dependence while soil N and P stocks presented a moderate spatial dependence, indicating soil N was mainly controlled by intrinsic factors while soil N and P stocks were controlled by both intrinsic and extrinsic factors. Different spatial patterns were observed for soil N, P and K stocks across the whole study area, indicating that fertilizations with different ratios of N:P:K should be applied for different sites to maintain and improve stand productivity. The total soil N, P and K stocks within 0-60 cm were 0.624, 0.020 and 0.583 Tg, respectively.

The three-pronged sliding universal coupling is a new kind of three-pronged coupling. To study its kinematic and dynamic characteristics, directional cosine matrices are utilized as tools to analyze the coordinate systems by establishing simplified geometric models and corresponding motions. Through the analysis of the motions of the input and output shafts and employing the method of single-force element, a set of equilibrium equations for the forces acting on the output shaft and the input shaft are formulated for solution analysis. The research indicates that during the rotation process, there exists a small angular difference between the input shaft and the intermediate shaft, demonstrating the quasi-constant angular velocity characteristics of the new tripod sliding universal coupling. The curves of the forces and torques acting on each component of the coupling approximate sinusoidal curves. The optimal operating angle range for the new tripod universal coupling is at angle , during which the system exhibits good transmission and mechanical performance.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

The ADP-ribosylation factor 6 (Arf6), as the only member of the Arf family III protein, has been extensively studied for its diverse biological functions in animals. Previously, the Arf6 protein in Magnaporthe oryzae was found to be crucial for endocytosis and polarity establishment during asexual development. However, its role remains unclear in Sclerotinia sclerotiorum. Here, we identified and characterized SsArf6 in S. sclerotiorum using a reverse genetic approach. Deletion of SsArf6 impaired hyphal growth and development, and produced more branches. Interestingly, knockout of SsArf6 enhanced the tolerance of S. sclerotiorum to oxidative stress but the sensitivity to osmotic stress, and increased melanin accumulation, indicative of different roles of SsArf6 in various stress responses. Moreover, the appressorium formation was severely impaired, and fungal virulence to host plants was significantly reduced. Overall, our findings demonstrate the essential role of SsArf6 in hyphal development, stress responses, appressorium formation, and fungal virulence to host plants.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Green-space resources, in the context of urbanisation, cannot meet the actual needs of residents well, and the study of the balance of green-space resource allocation from the relationship between supply and demand is an urgent problem to be solved. This study quantitatively evaluates the green-space supply level from four dimensions by constructing a framework for assessment in the community life circle. It also evaluates the matching of green space supply and demand, resource distribution fairness, and distribution equilibrium under group differentiation through the supply–demand coupling matrix, Gini coefficient, and the Kruskal–Wallis H non-parametric rank-sum test, respectively. This study shows that (1) a significant spatial imbalance exists in green-space resource allocation in community life circles in different dimensions. (2) The comprehensive green-space supply level in the community life circle matched the total demand of residents to a low degree. (3) There was significant inequality in green-space resource allocation within the community life circle (the Gini coefficient of each evaluation perspective was > 0.4). Based on the study results, we were able to identify community life circles with spatial mismatches, different supply and demand, and other green-space resource allocation problems, which is of great significance to urban green-space research and planning practice under the "green justice" framework.

Previous control methods developed by our research team cannot satisfy the high-accuracy requirements of unmanned surface vessel (USV) path-tracking during bathymetric mapping because of the excessive overshoot and slow convergence speed. For this reason, this study developed an adaptive fuzzy integral-derivative line-of-sight (AFIDLOS) guidance law for USV path-tracking control. Integral and derivative terms were added to counteract the effect of the sideslip angle, with which the USV could be quickly guided to converge to the planned path for bathymetric mapping. To obtain a high-accuracy of the look-ahead distance, a fuzzy control method was proposed. The proposed method was verified using simulations and outdoor experiments. The results demonstrate that the AFIDLOS guidance law can reduce the overshoot by 79.85%, shorten the settling time by 55.32% in simulation experiments, and reduce the average cross-track error by 10.91%, and can ensure a 30% overlap of neighboring strips of bathymetric LiDAR outdoor mapping when compared with the traditional method.

Plain lakes play a crucial role in the hydrological cycle of a watershed, but their interactions with adjacent rivers and downstream water bodies can create complex river-lake relationships, often leading to frequent flooding disasters. Taking Poyang Lake as an example, this paper delves into its interaction with the Yangtze River, revealing the spatiotemporal patterns of flood propagation within the lake and its impact on surrounding flood control measures. The aim is to provide insights for flood management in similar environments worldwide. This study employs a comprehensive approach combining hydrological statistical analysis and two-dimensional hydrodynamic modeling, based on extensive hydrological, topographic, and socio-economic data. The results indicate that the annual maximum outflow from Poyang Lake is primarily controlled by floods within the watershed, while the highest annual lake water level is predominantly influenced by floods from the Yangtze River. The peak discharge typically reaches the lake outlet within 48 hours, with the peak water level taking slightly longer at 54 hours. However, water storage in the lake can shorten the time for the peak discharge to arrive. When converging with floods from the Yangtze River, the peak water level may be delayed by up to 10 days due to the top-supporting interaction. Furthermore, floods from the "Five Rivers" propagate differently within the lake, affecting various lake regions to differing degrees. Notably, floods from the Fu River cause the most significant rise in lake water level under the same flow rate. The top-supporting effect from the Yangtze River also significantly impacts the water surface slope of Poyang Lake. When the Yangtze River flood discharge far exceeds that of the "Five Rivers" (i.e., when the top-supporting intensity f value exceeds 4), the lake surface becomes as flat as a reservoir. During major floods in the watershed, the water level difference in the lake can increase dramatically, potentially creating a "dynamic storage capacity" of up to 840 million cubic meters.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

ABSTRACT Background It is important to be able to predict, for each individual patient, the likelihood of later metastatic occurrence, because the prediction can guide treatment plans tailored to a specific patient to prevent metastasis and to help avoid under- or over-treatment. Deep Neural Network (DNN) learning, commonly referred to as deep learning, has become popular due to its success in image detection and prediction, but questions such as whether deep learning outperforms other machine learning methods when using non-image clinical data remain unanswered. Grid search has been introduced to deep learning hyperparameter tunning for the purpose of improving its prediction performance, but the effect of grid search on other machine learning methods are under-studied. In this research, we take the empirical approach to study the performance of deep learning and other machine learning methods when using non-image clinical data to predict the occurrence of breast cancer metastasis (BCM) 5, 10, or 15-years after the initial treatment. We developed DNN models as well as models using 9 other machine learning methods including Naive Bayes (NB), Logistic Regression (LR), Support Vector Machine (SVM), LASSO, Decision Tree (DT), k-Nearest Neighbors (KNN), Random Forrest (RF), AdaBoost (ADB), and XGBoost (XGB). We used grid search to tune hyperparameters for all methods. We then compared the deep learning models to the models trained using the 9 other machine learning methods. Results Based on the mean test AUC results, DNN ranks 6th, 4th, and 3rd when predicting 5-year, 10-year, and 15-year BCM respectively, out of 10 machine learning methods. The top performing methods in predicting 5-year BCM are XGB(1^st), RF(2^nd), and KNN(3^rd). For predicting 10-year BCM the top performers are XGB (1^st), RF(2^nd), and NB(3^rd) . Finally, for 15-year BCM the top performers are SVM (1^st), LR and LASSO (tied for 2^nd), and DNN (3^rd). The ensemble methods RF and XGB outperform other methods when data are less balanced, while SVM, LR, LASSO, and DNN outperform other methods when data are more balanced. Our statistical testing results show that at a significance level of 0.05 DNN overall performs no worse than other machine learning methods when predicting 5-year, 10-year, and 15-year BCM. Conclusions Our results show that deep learning with grid search overall performs at least as well as other machine learning methods when using non-image clinical data. It is interesting to note that some of the other machine learning methods such as XGB, RF, and SVM are very strong competitors of DNN when incorporating grid search. It is also worth noting that the computation time required to do grid search with DNN is way more than that required to do grid search with the other 9 machine learning methods.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Pyrethroid pesticides (PYRs) as the third most widely used pesticides, following organophosphorus and carbamate pesticides, which are of significant importance in the analysis and detection of vegetables. However, the current pretreatment technology for PYRs confronts challenges of difficult separation and low enrichment efficiency, resulting in a cumbersome and time-consuming pretreatment process with poor selectivity. Here, a simple and efficient magnetic solid-phase extraction (MSPE) strategy was developed to simultaneously purify and enrich five PYRs in vegetables, with the magnetic covalent organic framework nanomaterial COF-SiO2@Fe3O4 as an adsorbent. The COF-SiO2@Fe3O4 was prepared by a simple solvothermal conditions method, using Fe3O4 as magnetic core, benzidine and 3,3,5,5-tetraaldehyde biphenyl as two building units. COF-SiO2@Fe3O4 could effectively capture the targeted PYRs by virtue of its abundant π-electron system and hydroxyl groups. The impact of various experimental parameters on extraction efficiency was investigated to optimize the MSPE conditions, including adsorbent amount, extraction time, elution solvent type and elution time. Subsequently, method validation was conducted under the optimal conditions in conjunction with gas chromatography-mass spectrometry (GC-MS). Within the range of 5.00–100 μg·kg-1 (1.00–100 μg·kg-1 for bifenthrin and 2.5–100 μg·kg-1 for fenpropathrin), the five PYRs exhibited a strong linear relationship, with determination coefficients ranging from 0.9990 to 0.9997. The limits of detection (LODs) were 0.3–1.5 μg·kg-1, and the limits of quantification (LOQs) were 0.9–4.5 μg·kg-1. The recoveries were 80.2–116.7% with relative standard deviations (RSDs) below 7.0%. Finally, COF-SiO2@Fe3O4, NH2-SiO2@Fe3O4 and Fe3O4 were compared as MSPE adsorbents for PYRs. The results indicated that COF-SiO2@Fe3O4 was an efficient and rapid selective adsorbent for PYRs. This method holds promising prospects for the determination of PYRs in real samples.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Litsea cubeba, an important medicinal plant, is widely used as traditional Chinese medicine and spice. Using cytotoxicity-guided fractionation, nine new lignans (1-9) and eleven known analogues (10-19) were obtained from the EtOH extract of the twigs of L. cubeba. Their structures were assigned by extensive 1D and 2D NMR experiments, and the absolute configurations were resolved by specific rotation and a combination of experimental and theoretically calculated electronic circular dichroism (ECD) spectra. In the cytotoxicity assay, 7',9-epoxylignans with feruloyl or cinnamoyl group (7-9, 13 and 14) were selectively cytotoxic against NCI-H1650 cell line, while the dibenzylbutyrolactone lignans (17-19) exerted cytotoxicities against HCT-116 and A2780 cell lines. The results highlighted the structure-activity relationship importance of a feruloyl or a cinnamoyl moiety at C-9′ or/and C-7 ketone in 7',9-epoxylignans. Furthermore, compound 11 was moderate active toward protein tyrosine phosphatase 1B (PTP1B) with an IC50 value of 13.5 μM, and compounds 4-6, 11 and 12 displayed inhibitions against LPS-induced NO production in RAW264.7 macrophages, with IC50 values of 46.8, 50.1, 58.6, 47.5, and 66.5 μM, respectively.

The giant panda (Ailuropoda melanoleuca) is one of the most endangered species of land mammals and has significant academic research value worldwide. The evaluation of hematological parameters in giant pandas is important for assessing the physiological status of animals. This study collected blood samples from 12 healthy giant pandas from September 2018 to August 2020 under non-anesthetic conditions. The samples were then analyzed for basic blood indices and blood rheology, and normal values for hematological parameters and blood rheology under non-anesthetic conditions in giant pandas in Beijing area were obtained. The study confirmed the influence of age and season on hematological and biochemical parameters in captive giant pandas: hematological morphology, blood rheology, and serum enzymes showed seasonal variations, while age affected the changes in serum enzymes, serum protein content, and serum metabolite content. There are significant differences in blood indicators among different age groups of giant pandas, indicating variations in the overall metabolic processes and differences among pandas of different age groups. Seasonal variations showed a regulatory effect on blood rheology parameters and a negative effect on blood viscosity. Further research should be conducted to investigate whether factors such as season and climate cause environmental stress in captive giant pandas. The results obtained in this study aim to better protect the stability of the giant panda population and provide references for the appropriate feeding and medical care of captive giant pandas.

In this paper we report a new development on the numerical model for aluminum-steam combustion. This model is based on diffusion flame of continuum regime and the thermal equilibrium between the particle and the flow field, which can be used to calculate the aluminum particle combustion model for two phase calculation conditions. The model prediction is in good agreement with the experimental data. A new type of vortex combustor was proposed for the combustion of aluminum and steam, and the mathematical model of the two phase reacting flow with in this combustor was established. The turbulence effects are modeled using the Reynolds Stress Model (RSM) with Linear Pressure-Strain approach, and the Eddy-Dissipation model is used to simulate the gas phase combustion. Aluminum particles are injected into the vortex combustor and form a swirling flow around the chamber and their trajectories are traced using the Discrete Phase Model (DPM). The simulation results show that the vortex combustor can achieve high efficient combustion of aluminum and steam. The influencing factors, such as the eccentric distance of the inlet of aluminum particles, particle size and steam inlet diameter, etc., are studied. The work described in this paper represents an attempt to the design of a vortex combustor in order to increase aluminum combustion efficiency.

Energy Measurement and Verification (M&V) aims to make inferences about the savings achieved in energy projects, given the data and other information at hand. Traditionally, a frequentist approach has been used to quantify these savings and their associated uncertainties. We demonstrate that the Bayesian paradigm is an intuitive, coherent, and powerful alternative framework within which M&V can be done. Its advantages and limitations are discussed, and two examples from the industry-standard International Performance Measurement and Verification Protocol (IPMVP) are solved using the framework. Bayesian analysis is shown to describe the problem more thoroughly and yield richer information and uncertainty quantification than the standard methods while not sacrificing model simplicity. We also show that Bayesian methods can be more robust to outliers. Bayesian alternatives to standard M&V methods are listed, and examples from literature are cited.

The hospital indoor environment plays a significant role in shaping the microbial exposures that humans encounter. Resistance to antibiotics is one of the mechanisms employed by bacteria to develop resilience against stress in indoor environments. The extensive usage of antibiotics has been a key factor in driving changes in the ecological function of antibiotic resistance genes (ARGs) and their acquisition by pathogenic bacteria. By integrating the 16S rRNA Illumina sequencing and high throughput-qPCR approaches with water and air dust samples across seven departments at Peking University Shenzhen Hospital, China, this study yielded intriguing findings regarding the department-specific variation, transmission, and correlation of bacteria, ARGs and MGEs within the hospital indoor environment. One notable observation was that the seasonal variation played a vital role in shaping the bacterial composition in the overall hospital indoor environment across seven studied departments. Nevertheless, a similar significant seasonal impact was only observed in the blood test room and emergency departments, rather than in the other five departments. Another intriguing finding was the correlation between ARGs and MGEs abundance. This correlation was evident in the overall hospital indoor environment, which was conversely not found in the emergency, pneumology and gynecology departments. Additionally, while there was no significant relationship that occurred between bacterial communities and ARGs/MGEs within the hospital, the gynecology department demonstrated a close link between bacterial communities and the presence of ARGs/MGEs. Notably, the gynecology department also stood out as an important source of bacteria and ARGs/MGEs for other departments. This study underscores the need for careful surveillance and monitoring of antibiotic resistance, particularly in Legionella spp. in man-made water systems. The findings also show the importance of monitoring and understanding the genetic elements such as Tp614 involved in gene transfer and recombination, as well as their impact on antimicrobial treatment efficacy.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Microcystis aeruginosa is a common cyanobacteria found in water blooms and often causes ecological harm. Antibiotics are also increasingly used for the prevention and treatment of bacterial infections in aquaculture. However, since most antibiotics cannot be fully metabolized, they enter the water environment and cause ecological impacts. In this paper, the effects of the two quinolone antibiotics (enrofloxacin and ciprofloxacin) on the population density and microcystins (MCs) production of Microcystis aeruginosa were studied. It is of great significance for the ecological risk assessment of antibiotics to the water environment. The results showed that the 96h EC50 values of enrofloxacin and ciprofloxacin to Microcystis aeruginosa were 56.10mg/L and 49.80mg/L respectively, and the toxicity of ciprofloxacin to Microcystis aeruginosa was slightly stronger than that of enrofloxacin. With the increase of the two quinolone antibiotic concentration, the growth inhibition rate (IR) increased, but when the concentration reached a certain height, the IR would reach its threshold. Long-term exposure to low concentrations of these two quinolone antibiotics is not only more likely to lead to the outbreak of Microcystis aeruginosa, but also increase its toxin production capacity. The highest contents of MCs in enrofloxacin and ciprofloxacin groups were 95.539 μg/g and 93.720 μg/g, respectively. The MCs value of these three enrofloxacin treatment groups was more than above 51.8 times that of control group (CK) on the 4th day; from 8th day to 14th day, the MCs value of these three enrofloxacin treatment groups was more than above 3.2 times that of CK group. For another ciprofloxacin, the MCs value of the treatment group was more than 64.98 times that of the CK group on the 4th day, and from 8th day to 14th day, the MCs value of the treatment group was more than 2.7 times that of the CK group. These findings provide crucial management rationale.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

The dynamic factors in the environment violate the static environment assumption of the SLAM algorithm, leading to a decrease in the accuracy of camera positioning. In recent years, many studies have attempted to address dynamic objects by combining semantic constraints and geometric constraints, but issues such as poor real-time performance, the potential for mistakenly treating humans as rigid objects, and subpar performance in high-dynamic scenes still persist. This paper proposes a dynamic scene visual SLAM algorithm called Dynamic SLAM based on target tracking and multi-view geometry (TKG-SLAM), based on object detection, Kalman filters, and multi-view geometry. This algorithm takes into consideration both real-time performance and algorithm accuracy. It combines semantic constraints and multi-view geometry constraints, selectively running the algorithm in different scenarios, filtering and preserving static points for camera pose estimation. Experimental results demonstrate that, compared to current state-of-the-art dynamic SLAM methods, our approach achieves optimal performance in some scenarios and exhibits stronger real-time capabilities.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

ABSTRACT Background Ubiquitination plays an important role in protein post-translational processes and has been found to be involved in a number of regulatory functions including proteasome degradation, DNA repair, transcription, signal transduction, endocytosis, and sorting. As the identification of ubiquitination site is critical to furthering our understanding of the mechanism of ubiquitination, various experimental and machine learning methods have been used to conduct this task. It has been an important but challenging task to improve the accuracy of ubiquitination site prediction. In this research, we explore the possibility of improving the prediction performance of machine learning by incorporating grid search in the training process. Method We developed grid search procedures for each of six widely used machine learning methods including NB, LR, DT, SVM, LASSO, and KNN, and applied them to ubiquitination site prediction using the six PCP datasets that were previously developed. For each of the ML methods, we developed a set of values for each of the tunable hyperparameters available to the method. These sets of values then can be combined to form a large grid of hyperparameter settings, and each of these settings is used in the grid search. We integrated 5-fold cross-validation in grid search to train and test ML models and applied an additional independent validation procedure by conducting a pre-training 80-20 sample split. We evaluated the performance of the six methods by comparing them side by side for each of the six datasets. We also compared the grid search results with the results that were previously published without doing grid search. To optimize the prediction performance, we trained 1.1 million ML models in total through grid search. Results We compared the overall prediction performance of these six methods, as well as their prediction performance when working with balanced vs. imbalanced data, and large-scale vs. small-scale data. From the perspective of dataset, we find that the overall performance of every PCP dataset has been significantly improved in this study compared to the previous study, with the percentage increase of the average AUC of all six datasets ranging from 7.9% (PCP-4) up to 17.0% (PCP-1). From the perspective of method, we find that three out of four methods significantly benefit from grid search comparing to their previously published non-grid search results, with the maximum AUC improvement as high as 47% (LASSO on PCP-5), 43.3% (NB on PCP-1), and 33.7% (SVM on PCP-6). SVM overall ranks number one, followed by KNN as the number two performer based on their average AUCs on all datasets. But these two also ranked the top two (KNN 76 days and SVM 15 days) in terms of the total running time that they need to do grid search. We also find that SVM, KNN, and DT tend to handle small-scale and imbalanced datasets better, while LR, and LASSO are doing well with large-scale and balanced datasets. NB is more sensitive to data imbalance while less sensitive to the size of a dataset. Conclusions Our results show that using grid search has improved the performance of ubiquitination prediction significantly. We find that the performance of a method is closely related to its hyperparameter setting and the type of data it handles. Even though SVM is on average an outperformer, none of the methods can provide the best performance for all datasets. When sufficient computing resources are well accessible, grid search is an effective way to identify both a top performing model for a machine learning method and a suitable machine learning method for a particular dataset.

Permanent magnet brushless DC motor (BLDCM) is usually controlled by six step commutation method, and flux-weakening method is used to make the motor run higher above the base speed. For now, it is considered that the weak magneto-electric angle range is 0-pi/3, and that of deep weakening is pi/3-pi/2. In the field- weakening control, the forward shift of commutation point will form inverter circulating current in the three-phase bridge of inverter and the stator winding of the motor. In this paper, the principle of inverter circulating current formed by inverter is analyzed. Through magnetic potential analysis and Simulink simulation, it is concluded that flux-weakening control will generate inverter circulating current in the inverter and motor stator winding. The inverter circulating current affects the magnetic potential of motor, and magnetic potential will move to the rotating direction of motor rotor. When the forward shift angle of inverter commutation point is 0-pi/6 electrical angle, the movement amplitude of current circulating current of inverter is less than pi/6, which plays the role of weakening magnetic field and driving effect; when the forward moving angle is pi/6-pi/3, the movement amplitude of inverter circulating current exceeds pi/6, which plays the role of magnetic weakening and braking. When the braking effect occurs, the reverse torque will appear, resulting in the decrease of motor torque and efficiency. Therefore, the range of weak magneto-electric angle should be between 0-pi/6.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Real estate industry is related to the national economy and people's livelihood，characterized by a high degree of financial intensity. The enterprises in this industry need certain financial ability and large shareholder controlling ability to support their survival. However，due to the multiple adverse impacts of current state policies，banks and private capital，the credit crunch，the sudden decrease in withdrawn funds and the limitation of internal financing，the problem of capital restraint of real estate enterprises has become more and more serious. From the perspective of corporate governance，this paper studies the interaction among financial constraints，ownership concentration and corporate performance under different shareholding states by analyzing the quantitative characteristics of equity structure，and looks for the appropriate range of the largest shareholder holding ratio，which has considered the financial performance and risk. It is found that raising the ownership concentration can effectively ease the financing constraints and improve the performance of enterprises，both of which are significant under the state of high ownership concentration， while the financial constraints play a significant intermediary effect under the State of absolute holding， while in the decentralized state of ownership，there is a significant regulatory effect，and the interaction of the three will be different due to the size of the enterprise.

Asian giant hornet, Vespa mandarinia, is an invasive species that could potentially destroy local honeybee industry in North America. It has been observed to nest in the coastal regions of British Columbia in Canada and Washington State in USA. What is the source population of the immigrant hornets? The identification of the source population can not only shed light on the route of immigration, but also on the similarity between the native habitat and the potential new habitat in the Pacific Northwest. We analyzed mitochondrial COX1 sequences of specimens sampled from multiple populations in China, South Korea, Japan and the Russian Far East. V. mandarinia exhibits phylogeographic patterns, forming monophyletic clades for 16 specimens from China, six specimens from South Korea and two specimens from Japan. The two mitochondrial COX1 sequences from Nanaimo, British Columbia are identical to the two sequences from Japan. The COX1 sequence from Blaine, Washington State, clustered with those from South Korea, and is identical to one sequence from South Korea (GenBank accession MN716828). Our geophylogeny, which allows visualization of genetic variation over time and space, provides evolutionary insights on the evolution and speciation of three closely related vespine species (V. tropica, V. soror and V. mandarinia). The geophylogeny also highlights a strong insufficiency in sample collection in China. The existing sequenced specimens from mainland China with geographic coordinates were represent only four provinces, missing populations along the coastal regions in East China. One therefore cannot exclude the possibility that the Asian giant hornet found in Canada and USA may also be identical to V. mandarinia in Eastern China. We strongly recommend more extensive DNA barcoding data with geographic information and longer DNA barcode (e.g., the entire mitochondrial genome) so that critical questions on invasive species and environmental conservation can be addressed more accurately than what is possible with existing data.

Aiming at the problem of hypersonic morphing vehicle avoiding no-fly zones and reaching the target, an improved predictor-corrector guidance method is proposed. Firstly, the aircraft motion model and the constraint model are established. Then, the basic algorithm is given, the Q-learning method is used to design the attack angle and sweep angle scheme to ensure that the aircraft can fly over the low-altitude zones. The B-spline curve is used to design the location of flight path points and the bank angle scheme is designed according to the predictor-corrector method, so that the aircraft can fly around to avoid high-altitude zones. Next, Monte Carlo reinforcement learning(MCRL) method is used to improve predictor-corrector method and Deep Neural Network(DNN) is used to fit reward function. The improved method can generate trajectory with better performance. Simulation results verify the effectiveness of the proposed algorithm.

Natural disasters are showing an increase in the magnitude, frequency, and geographic distribution. Studies have shown that individuals’ self-sufficiency, which largely depends on household preparedness, is very important for hazard mitigation in at least the first 72 hours following a disaster. However, for factors that influence a household’s disaster preparedness, though there are many studies trying to identify from different aspects, we still lack an integrative analysis on how these factors contribute to a household’s preparation. This paper aims to build a classification model to predict whether a household has prepared for a potential disaster based on their personal characteristics and the environment they located. We collect data from the Federal Emergency Management Agency’s National Household Survey in 2018 and train four classification models - logistic regression, decision trees, support vector machines, and multi-layer perceptron classifier models- to predict the impact of personal characteristics and the environment they located on household prepare for the potential natural disaster. Results show that the multi-layer perceptron classifier model outperforms others with the highest scoring on both recall (0.8531) and f1 measure (0.7386). In addition, feature selection results also show that among other factors, a household’s accessibility to disaster-related information is the most critical factor that impacts household disaster preparation. Though there is still room for further parameter optimization, the model gives a clue that we could support disaster management by gathering publicly accessible data.

Confronting the dual challenges of rapid urbanization and climate change, although extensive research has investigated the influencing factors and practical strategies of urban carbon emissions and urban vibrancy, respectively, the unclear mutual nexus between them and the development strategy of collaborative optimization requires further in-depth analysis. This study explores the delicate balance between urban vibrancy and low-carbon sustainability within the confines of Beijing’s Fifth Ring Road. By integrating OpenStreetMap, land use, population, and building carbon emission data, we have developed a reproducible method to estimate total carbon emission and emission intensity per capita. Furthermore, we have introduced vibrancy index data to distinguish the vibrancy evaluation of residential and non-residential land and applied cross-combinational classification technology to dissect the spatial correlation between urban carbon emissions and urban vibrancy. The results reveal that the four combination typologies show more significant differences and regularity in residential land. Based on the discovery of spatial correlation, this study puts forward corresponding development strategy suggestions for each typology based on geographical location and the requirements of urban development policies of these four combination typologies. In conclusion, our study highlights the importance of integrating carbon emissions and urban vibrancy comprehensively in sustainable urban planning and proposes that various land use combinations need targeted development strategies to achieve this goal, which need to consider population, energy, service facilities, and other diverse aspects.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

Background: With the trend of intelligent display, the interface design of in-vehicle HUD is an expanding research field; Methods: To solve the subjectivity and uncertainty in the optimization of HUD interface design schemes, this paper proposed a hybrid scheme evaluation and optimization method based on entropy weight and VIKOR. The entropy weight method was used to reduce the subjectivity the decision-maker's weighting and obtain the objective weight of each indicator; The VIKOR method was used to obtain the best ranking of alternative schemes, and then the optimal interface design scheme was selected; Results: The evaluation of in-vehicle HUD interface design schemes were taken as an example for verification and calculation. The results showed that this method considers the subjectivity and uncertainty of the decision-making process in the optimization of design scheme, which can effectively improve the objectivity and accuracy of the evaluation results, and provide a reference for designers to optimize interface design schemes.

Water resources are threatened nowadays by pollution that comes from domestic, industrial and agricultural discharges without prior treatment. This pollution causes the degradation of water quality. Surface pollutants can seep through the soil into water tables. The objective of our work is to assess and control the physicochemical quality of the Chari Baguirmi groundwater, to protect human health. The quality of 83 boreholes was assessed, while performing analysis for 12 physicochemical parameters at the National Water Laboratory and at the Center for Quality Control of Foodstuffs in Chad. These parameters are: pH, EC, Ca2+, Mg2+, Na+, K+, Cl-, SO42-, NH4+ and NO3- , Fe2+ and HCO3-. Also, the results obtained were compared with WHO standards. The geochemical statistical approach has made it possible to characterize the hydro geochemical properties and to understand the major processes of the mineralization of groundwater resources in Chari Baguirmi region in Chad. Some of its waters are acidic and weakly mineralized, rich in Fe2+ and NH4+. The origin of the mineralization is due to the alteration of the host rocks and to the hydrolysis of silicate and ferromagnesian minerals as well as anthropogenic pollution. The ammonium concentrations in N’Djamena boreholes are higher than WHO standards, indicating the presence of pollution which may come from organic waste. These results constitute a preliminary step in understanding hydro geochemical functioning and a basis for monitoring the physicochemical quality of the water in the study area.

We report neutralization titer data against contemporary SARS-CoV-2 sublineages from an ongoing, open-label, phase 2/3 trial of a single 30-μg dose of monovalent Omicron XBB.1.5-adapted BNT162b2 vaccine. Healthy participants had previously received ≥3 doses of a US-authorized mRNA vaccine, with the most recent being a bivalent Omicron BA.4/BA.5-adapted vaccine administered ≥150 days before study vaccination. In this analysis, Omicron XBB.1.5, BA.2.86, and JN.1 serum neutralizing titers were assessed at baseline and 1 month after vaccination in a subset of ≥18-year-olds (N = 40) with evidence of previous SARS-CoV-2 infection. Immunogenicity was also evaluated in a demographically matched group of participants who received bivalent BA.4/BA.5-adapted BNT162b2 in another study (ClinicalTrials.gov Identifier: NCT05472038). The XBB.1.5-adapted BNT162b2 vaccine elicited higher XBB.1.5, BA.2.86, and JN.1 neutralizing titers than those elicited by bivalent BA.4/BA.5-adapted BNT162b2. Overall geometric mean fold rises in neutralizing titers from baseline to 1 month after vaccination were higher among participants who received XBB.1.5-adapted BNT162b2 than those who received bivalent BA.4/BA.5-adapted BNT162b2 for XBB.1.5 (7.6 vs 5.6), slightly higher for JN.1 (3.9 vs 3.5), and similar for BA.2.86 (4.8 vs 4.9). ClinicalTrials.gov Identifier: NCT05997290.

In this paper, a class of nonlinear ordinary differential equations with impulses at variable times is considered. The existence and uniqueness of solution are given. At the same time, modifying the classical definitions of continuous dependence and Ga^teaux differentiability, some results on continuous dependence and Ga^teaux differentiable of solution relative to the initial value also are presented in new topology sense. For the autonomous impulsive system, the periodicity of solution is given. As an application, properties of solution for a type of controlled nonlinear ordinary differential equation with impulses at variable times is obtained. These results are foundation to study optimal control problems of systems governed by the differential equations with impulses at variable times.

Trichinellosis is a major worldwide health concern caused by T. spiralis infection without highly efficient and safe therapeutic method so far. To solve the problem of uncomplete drug treatment schemes and the rise of anthelmintic resistance, a potential protective effect of probiotic strains against zoonotic T. spiralis infection was investigated in the framework of a new therapeutic strategy aimed at using probiotics to control parasitic zoonoses. The study was focused on L. reuteri protected against T. spiralis infection in intestinal phase throughout the detection of adult worm number, inflammatory factors mRNA expression, antioxidant enzyme expression and Nrf2 signal pathway protein expression. Mice were divided randomly into 3 groups: 1) Control group: no treatment; 2) Ts group: T. spiralis infection; 3）LAB group: T. spiralis infected after orally administered L. reuteri for 7 days. Probiotics bacteria were administered daily in a dose of 109 CFU/mL, and mice were infected with 400 T. spiralis larvae in the experimental groups. The number of adult worms was also significantly increased after administration of probiotics. Meanwhile, L. reuteri alleviate the inflammatory response caused by T. spiralis infection in intestinal has been confirmed. In addition, the promotion of antioxidant enzyme expression can be inferred that L. reuteri regulate Nrf2 signal pathways against T. spiralis infection. Our study demonstrates that L. reuteri provide protection against T. spiralis infection in intestinal. Therapeutic approaches with probiotic strains admission could help to reduce the risks of trichinellosis or complement classical anti-parasite treatments.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

In infectious disease and clinical microbiology, rarely encountered species are often of special concern simply by virtue of their unfamiliarity, especially in settings of complicated underlying disease. This is all the more so when the infectious agent has an appearance that distinguishes it from most commonly encountered organisms, making it a mystery that must be explained. In this context, it is rare for histopathologists to be more familiar with a bacterial species than clinical microbiologists but Sarcina ventriculi is one such example. Infrequently seen in tissue and even less often in culture, we here report a case of Sarcina ventriculi in the GI tract of a geriatric patient with complex underlying history. A brief discussion of the history, clinical presentation, treatment, and culture conditions of this organism is provided, along with clarification of nomenclature, which has changed and could otherwise be a source of additional confusion in this rarely encountered bacterium.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

A robust guaranteed cost preview repetitive controller is proposed for a class of polytopic uncertain discrete-time systems. In order to improve the tracking performance, the repetitive controller combined with preview compensator is inserted in the forward channel. By using the L-order forward difference operator, an augmented dynamic system is constructed. Then, the guaranteed cost preview repetitive control problem is transformed into the guaranteed cost control problem for the augmented dynamic system. For given performance index, the sufficient condition of asymptotic stability for the closed-loop system is derived by combining parameter-dependent Lyapunov function method with linear matrix inequality (LMI) techniques. By incorporating the controller obtained into the original system, the guaranteed-cost preview repetitive controller is derived. A numerical example is also included to show the effectiveness of the proposed method.

Sedimentary microfacies division is the basis of oil and gas exploration research. The traditional sedimentary microfacies division mainly depends on human experience, which is greatly influenced by human factor and is low in efficiency. Although deep learning has its advantage in solving complex nonlinear problems, there is no effective deep learning method to solve sedimentary microfacies division so far. Therefore, this paper proposes a deep learning method based on DMC-BiLSTM for intelligent division of well-logging—sedimentary microfacies. First, the original curve is reconstructed multi-dimensionally by trend decomposition and median filtering, and spatio-temporal correlation clustering features are extracted from the reconstructed matrix by Kmeans. Then, taking reconstructed features, original curve features and clustering features as input, the prediction types of sedimentary microfacies at current depth are obtained based on BiLSTM. Experimental results show that this method can effectively classify sedimentary microfacies with its recognition efficiency reaching 96.84%.

A novel and highly pathogenic coronavirus (2019-nCoV)-induced pneumonia spread worldwide in a short time. However, studies on the effects of 2019-nCoV on the male reproductive system are limited. The aim of this study is to describe the clinical characteristics of the male reproductive system of COVID-19 patients and to explore the presence of 2019-nCoV in semen. Retrospective, single-center case series of 112 male patients with confirmed COVID-19 who were admitted to Renmin Hospital of Wuhan University from January 2 to March 7, 2020. Demographic data, symptoms and signs related to the male reproductive system, throat swabs and semen samples were collected and analyzed. 2019-nCoV RNA measured in throat swab and semen samples. The organ distribution of ACE2 mRNA and protein in human tissue on The Human Protein Atlas portal and investigated immunohistochemistry (IHC) images of the testis. The HPA dataset revealed relatively high levels of ACE2 protein and RNA expression in the testis. A total of 3 severe COVID-19 patients (2.7%) presented with orchidoptosis, while no patients experienced other symptoms or signs related to the male reproductive system. The analysis of 2019-nCoV RNA in semen included 17 patients with fertility needs. Among these patients, 9 (52.9%) remained positive for 2019-nCoV according to throat swab analysis, and 8 (47.1%) became negative. In the semen 2019-nCoV analysis, all 17 patients were negative for the N gene and ORF1ab gene. In view of the potential impairment, long-term follow-up for male COVID-19 patients with fertility needs is of great significance.

There is a growing consensus that culture influences the perception of facial expressions of emotion. However, little is known about whether and how culture shapes the production of emotional facial expressions, and even less so about whether culture differentially shapes the production of posed versus spontaneous expressions. Drawing on prior work on cultural differences in emotional communication, we tested the prediction that people from the Netherlands (a historically heterogeneous culture where people are prone to low-context communication) produce facial expressions that are more distinct across emotions compared to people from China (a historically homogeneous culture where people are prone to high-context communication). Furthermore, we examined whether the degree of distinctiveness varies across posed and spontaneous expressions. Dutch and Chinese participants were instructed to either pose facial expressions of anger and disgust, or to share autobiographical events that elicited spontaneous expressions of anger or disgust. Using the complementary approaches of supervised machine learning and information-theoretic analysis of facial muscle movements, we show that posed and spontaneous facial expressions of anger and disgust were more distinct when produced by Dutch compared to Chinese participants. These findings shed new light on the role of culture in emotional communication by demonstrating, for the first time, effects on the distinctiveness of production of facial expressions.

Sclerotinia sclerotiorum is a devastating fungal pathogen that causes severe crop losses worldwide. It is of vital importance to understand its pathogenic mechanism for disease control. Through a forward genetic screen combined with next-generation sequencing, a putative protein kinase, SsCak1, was found to be involved in growth and pathogenicity of S. sclerotiorum. Knockout and complementation experiments confirmed that deletions in SsCAK1 caused defects in mycelium and sclerotia development, as well as appressoria formation and host penetration, leading to complete loss of virulence. These findings suggest that SsCak1 is essential for growth, development and pathogenicity of S. sclerotiorum. Therefore, SsCak1 could serve as a potential target for the control of S. sclerotiorum infection through host-induced gene silencing (HIGS), which could increase crop resistance to the pathogen.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

The microglia, displaying diverse phenotypes, play a significant regulatory role in the development, progression, and prognosis of Parkinson's disease. Research has established that glycolytic reprogramming serves as a critical regulator of inflammation initiation in pro-inflammatory macrophages. Furthermore, the modulation of glycolytic reprogramming has the potential to reverse the polarized state of these macrophages. Previous studies have shown that levetistilide A (LA), a phthalide component derived from Angelica sinensis, possesses a range of pharmacological effects, including anti-inflammatory, antioxidant, and neuroprotective properties. In our study, we have examined the impact of LA on inflammatory cytokines and glucose metabolism in microglia induced by lipopolysaccharide (LPS). Furthermore, we explored the effects of LA on the AMPK/mTOR pathway and assessed its neuroprotective potential both in vitro and in vivo. The findings revealed that LA notably diminished the expression of M1 pro-inflammatory factors induced by LPS in microglia, while leaving M2 anti-inflammatory factor expression unaltered. Additionally, it reduced ROS production and suppressed IκB-α phosphorylation levels as well as NF-κB p65 nuclear translocation. Notably, LA exhibited the ability to reverse microglial glucose metabolism reprogramming and modulate the phosphorylation levels of AMPK/mTOR. In vivo experiments further corroborated these findings, demonstrating that LA mitigated the death of TH-positive dopaminergic neurons and reduced microglia activation in the ventral SNpc brain region of the midbrain and the striatum. In summary, LA exhibited neuroprotective benefits by modulating the polarization state of microglia and altering glucose metabolism, highlighting its therapeutic potential.

Our study explores the genetic mechanisms underlying the spotted leaf phenotype in rice, focusing on the rpt5a mutant characterized by persistent reddish-brown leaf spots from seedling stage to maturity, leading to extensive leaf necrosis. Through map-based cloning, we localized the responsible locus to a 330Kb region on chromosome 2 and identified LOC_Os02g56000 (named OsRPT5A) as the causative gene. A point mutation in OsRPT5A, substituting valine for glutamic acid, was identified as the critical factor for the phenotype. Functional complementation and generation of knockout lines in the IR64 background confirmed the central role of OsRPT5A in controlling this trait. Our study also revealed that OsRPT5A is constitutively expressed across various tissues, with its subcellular localization unaffected by mutations. Notably, we observed an abnormal accumulation of reactive oxygen species (ROS) in rpt5a mutants, suggesting a disruption in the ROS system. Complementation studies indicated OsRPT5A's involvement in ROS homeostasis and catalase activity regulation. Moreover, the rpt5a mutant exhibited enhanced resistance to Xanthomonas oryzae pv. oryzae (Xoo), highlighting OsRPT5A's role in rice's pathogen resistance mechanisms. These findings elucidate the genetic basis of the spotted leaf phenotype and emphasize the intricate interplay between plant defense responses and developmental pathways.

Next-generation sequencing (NGS) has actualized human papillomavirus (HPV) virome profiling for in-depth investigation of viral evolution and pathogenesis. However, viral computational analysis remains a bottleneck due to semantic discrepancies between computational tools and curated reference genomes. To address this, we developed and tested automated workflows for HPV taxonomic profiling and visualization using a customized Papillomavirus database in CLC Microbial Genomics Module. HPV genomes from Papilloma Virus Episteme were customized and incorporated into CLC “ready-to-use” workflows for stepwise data processing to include: 1) Taxonomic Analysis, 2) Estimate Alpha/Beta Diversities, and 3) Map Reads to Reference. Low-grade (n = 95) and high-grade (n = 60) Pap smears were tested with ensuing collective runtimes: Taxonomic Analysis (36 min); Alpha/Beta Diversities (5 sec); Map Reads (45 min). Tabular output conversion to visualizations entailed 1-2 keystrokes. Biodiversity analysis between low- (LSIL) and high-grade squamous intraepithelial lesions (HSIL) revealed loss of species richness and gain of dominance by HPV-16 in HSIL. Integrating clinically relevant, taxonomized HPV reference genomes within automated workflows proved to be an ultra-fast method of virome profiling. The entire process named “HPV DeepSeq” provides a simple, accurate and practical means of NGS data analysis for a broad range of applications in viral research.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

We report a simple and high-performance flexible strain sensor based on liquid metal nanoparticles (LMNPs) on polyimide substrate by laser induced deposition. The LMNPs were prepared by ultrasonic method, and then the femtosecond laser direct writing technology was used to induce the assembly and deposition of the LMNPs to form liquid metal microwires. Laser local sintering enhances the connection between particles, and a wearable strain sensor was fabricated with the high sensitivity as high as 76.18, the good linearity (a correlation coefficient of 0.999) in a wide sensing rage, the fast response/recovery time of 159 ms/120 ms. Attributed to these extraordinary strain sensing performances, the sensor can sense various dynamic strains in real time, monitor both subtle physiological activities and large human motions. It can be adhered to human skin, and well reflect the change of facial expression and realize real-time monitoring of facial expression. And the vocal cord vibration can be detected for speech recognition while the sensor attached to the outside of the throat.

Previous studies had shown that mRNA, miRNA and lncRNA were associated with cardiovascular diseases. The study was aimed to explore the differential expressions of mRNA, lncRNA and miRNA between coronary artery disease (CAD) and healthy control, and their interaction in CAD. We investigated the differential expression of ceRNA between CAD and healthy control through data collected from Gene Expression Omnibus (GEO) microarrays. Furthermore, we investigated the biological function of these differential expressions of ceRNAs by Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses. Protein-protein interaction (PPI) network was created to identify the hub genes. Biosystems and literature search were performed for signaling pathways and their function of the included differential expression ceRNAs. A total of 456 miRNA expression profiles, 16,325 mRNA expression profiles, and 2,869 lncRNA expression profiles were obtained. Eleven Go and KEGG pathways (count ≥9), top 15 of PPI network node connectivity rank, and top 15 of ceRNA network node degree centrality rank were achieved at the statistical significance level (P<0.05). We further identified that several differential expressions of ceRNAs and their signaling pathways were associated with CAD through biosystems and literature search. Based on eleven Go and KEGG pathways, top 15 of PPI network node connectivity rank, and top 15 of ceRNA network node degree centrality rank in CAD population, our findings would contribute to further exploration for the molecular mechanism of CAD.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

The study’s objective is to analyse the mechanical properties of steel pipe piles as a part of a trestle bridge subjected to five years of natural marine corrosion degradation. Sixteen tensile specimens were extracted from the steel pipe piles in the splash, tidal, and immersion zones. The experimental tensile test results are used to establish regression equations defining elastic modulus, yield strength, strain hardening index, and strength coefficient for the true stress-strain curves of the three regions. A non-linear time-dependent mathematical model is exploited to identify the corrosion degradation using the data from one single corrosion degradation measurement campaign. The analysis indicated that the splash zone experiences the most severe corrosion degradation, and there are progressive losses in the mechanical properties of each zone as the corrosion degradation progresses. The established relationships of the mechanical properties, as a function of the ratio of corroded plate thickness to the as-built one, can be used as a fast-engineering approach to identify the mechanical properties of severely corroded piles. The corrosion degradation allowance is also defined using the First Order Reliability Method, accounting for existing uncertainties covered by the partial safety factors. By examining the impact of marine corrosion on the mechanical properties of marine structures and developing predictive models to assess the corrosion’s effect on material strength and corrosion allowance, the study aims to improve offshore structures’ safety, design, and maintenance.

Soil temperature reflects the impact of local factors，such as vegetation，soil and the atmosphere of a region. Therefore, it is important to understand the regional variation of soil temperature. However, lack of observations with adequate spatial and/or temporal coverage, it would be difficult to use the observation data to study the regional variation. Based on the observation data from Nanchang and Ganzhou stations and ERA-Interim/Land reanalysis data, this study analyzed the temporal-spatial distribution characteristics of soil temperature over Poyang Lake Basin. The results showed close correlations between observation data and reanalysis data at different depths. Reanalysis data could mainly reproduce the temporal-spatial distributions of soil temperature over the Poyang Lake Basin, but generally underestimate their magnitudes. Temporally, there is an obvious warming trend in the basin. Seasonally, the temperature raised fastest in spring and slowest in summer, except for the ST4, which rising fastest in spring and slowest in winter. In terms of depths, the temperature of ST1 rises fastest. For the other layers, the warming trend is almost similar. An abrupt change of annual soil temperature at all depths occurred in 1997, and annual soil temperatures at all depths were abnormally low in 1984. Spatially, annual soil temperature decreased with latitude, except for the summer ST1. Because of the high temperature and precipitation in summer, the ST1 are higher around the lake and the river. The climatic trend of soil temperature presents the general increase trend from south to north, opposite to the distribution of soil temperature. The findings provide a basis for understanding and assessing the variation of the soil temperature over the Poyang Lake Basin.

In this paper, a method is developed for presenting a novel virtual torque sensor based on precise model and position measurements avoids the need of traditional strain gauges and amplifiers. More specifically, the harmonic drive compliance model and the Gaussian process regression (GPR) technique are used together to achieve virtual torque sensor measurement. While the harmonic drive compliance model provides the analytic part, the Gaussian process regression method is used to reconstruct the unmolded part based on motor-side and link-side joint angles as well as motor current. After an automatic offline calibration, the method allows for a lean online implementation. The virtual torque sensor measurement is compared with measurements of a commercial torque sensor, and the results have attested the effectiveness of the proposed method.

Colleges and universities play a crucial role in fostering innovation, making it essential to explore effective strategies for promoting innovation at the institutional policy level. This paper focuses on the establishment of intellectual property (IP) model cities as a starting point and conducts an empirical analysis using innovation data from 234 cities and 942 colleges and universities between 2007 and 2017. By constructing a multi-temporal double-difference model, this study reveals that the establishment of IP model cities effectively fosters innovation in colleges and universities. Further analysis demonstrates that this promotion effect is particularly significant in the western region, key cities, key colleges and universities, as well as in the fields of invention and utility model patents. These conclusions withstand a series of robustness tests, confirming their validity. In terms of the underlying mechanisms, it is found that the national IP pilot city policy has a substantial impact on university innovation by promoting research and development (R&D) investment and strengthening innovation cooperation. The insights provided by this study offer valuable policy recommendations for leveraging the innovation potential of the IP model city policy, thereby driving economic transformation, upgrading, and fostering innovation development in China.

Interface between matrix/coating or coating/coating in fact represents a very complicate thin interfacial layer. So interface model is necessary to avoid the difficulty on considering such a complicate thin layer in analysis. Classic interface model and cohesive model have been widely used in stress analysis of coating materials, though they cannot represent the effect of very thin interfacial layer accurately. A complete interface model has been deduced from the equivalent constitutive of interfacial layer in this paper. It is found that both classic interface model and cohesive model sometimes cannot give correct analysis results, while the complete interface model can always give a correct result. Moreover, the stress parallel to interface within the interfacial layer can also be analyzed by the new model. Besides, this model can also be used to describe the equivalent properties of interfacial layer, thereby, can provide a quantitative characterizing method for interfacial layer itself.

In this study, divalent Yb2+-doped silica fiber was fabricated using rod-in-tube technology. The fiber core of Yb2+-doped silica glass was prepared by high-temperature melting technology under vacuum conditions. The spectroscopic properties of the Yb2+-doped glass and fiber were studied. The experiments indicate that divalent Yb2+-doped glass has a high quantum efficiency and superbroadband fluorescence in the visible region with an excitation wavelength of 405 nm. In additionally, the results suggest that Yb2+-doped fiber has a potential for application in visible fiber laser and fiber amplification.

The relationship between the structure characteristics and performances of coal based hydrogenation isomeric base oil (CTL) and metallocene catalyzed coal based polyalphaolefin (mPAO) base oil was clarified here. CTL and mPAO were compared with typical petroleum based and natural gas based commercial API Class III and IV base oils. Pressurized differential scanning calorimetry (PDSC), Rotary Bomb Oxidation Test (RBOT) and four-balls friction tester were used to evaluate the oxidation stability and lubrication performance of base oils under different working conditions. The sensitivity of different base oils to typical antioxidants and extreme pressure antiwear agents was compared. Specially, the composition and structure of CTL base oil are obviously different from GTL and mineral base oil. The coal-based CTL and mPAO base oils exhibit commendable viscosity-temperature properties, characteristics, coupled with low-temperature fluidity, fire safety, and minimal evaporation loss. The lubricating properties, oxidation stability and the sensitivity to extreme pressure antiwear agents of CTL are close to those of similar base oils. But the sensitivity of CTL to typical antioxidants is relatively poor. Besides, compared with commercial PAO base oil, mPAO has lower isomerization degree and fewer isomerization types. The oxidation stability and sensitivity to typical antioxidants of mPAO base oil are comparable with those of commercial PAO base oil, while its lubrication performance and sensitivity to typical extreme pressure antiwear agents are significantly better than those of commercial PAO base oil.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Innovation is an essential key factor in the technology development history. Past research on innovation focused more on the innovation behavior of technology, but seldom described knowledge assets which also influence innovation behavior greatly. The effect of knowledge assets attribute and result on disruptive innovation is therefore regarded as the research topic in this study, where disruptive innovation is divided into outbound and inbound to combine combination-embeddednessandmajor business specificityof knowledge assets as the research model. Manufacturing enterprises in China are proceeded the questionnaire survey, and 173 valid copies are collected. The empirical analysis shows that combination-embeddedness of knowledge assets presents significantly positive effects on major business specificity and outbound innovationof an enterprise but reveals remarkably negative effects on inbound innovation. Enterprises are suggested to constantly accumulate knowledge assets with low major business specificity before disruptive innovation in order to reduce ineffective inbound innovation.

Compressed Sensing (CS) MRI has shown great potential in enhancing time efficiency. Deep learning techniques, specifically Generative Adversarial Networks (GANs), have emerged as potent tools for speedy CS-MRI reconstruction. Yet, as the complexity of deep learning recon-struction models increases, this can lead to prolonged reconstruction time and challenges in achieving convergence. In this study we present a novel GAN-based model that delivers superior performance without escalating model complexity. Our generator module, built on the U-net architecture, incorporates dilated residual (DR) networks, thus expanding the network's receptive field without increasing parameters or computational load. At every step of the downsampling path, this revamped generator module includes a DR network, with the dilation rates adjusted according to the depth of the network layer. Moreover, we have introduced a channel attention mechanism (CAM) to distinguish between channels and reduce background noise, thereby fo-cusing on key information. This mechanism adeptly combines global maximum and average pooling approaches to refine channel attention. We conducted comprehensive experiments with the designed model using public domain MRI datasets of the human brain. Ablation studies af-firmed the efficacy of the modified modules within the network. Compared to other relevant models, our proposed model exhibits exceptional performance, achieving not only excellent sta-bility but also outperforming other networks in terms of Peak Signal-to-Noise Ratio (PSNR) and Structural Similarity Index (SSIM). The model presents a promising pathway for enhancing the efficiency and quality of CS-MRI reconstruction.

Surface defect detection is a crucial step in the process of automotive wheel production. However, the task possesses challenges due to complex background and a wide range of defect types. In order to detect the defects on the wheel surface accurately and quickly, this paper proposes a YOLOv5-based algorithm for automotive wheel surface defect detection. The algorithm trains and tests the YOLOv5s model using the self-created automotive wheel surface defect dataset, which contains four kinds of defects: linear, dotted, sludge, pinhole. The extensive experimental results demonstrate that the deep learning network trained by our method can achieve an average accuracy of 71.7% and 57.14 FPS. Our findings prove that this detection algorithm performs better than other common target detection algorithms and meets the real-time requirements of industrial applications.

This paper investigates the leader–follower formation tracking control of underactuated surface vessels (USVs) with input saturation. Each vessel is subject to the uncertainties induced by model uncertainties and environmental disturbances. At first, an event-trigged extended state observer (ETESO) is used to recover the velocity, yaw rate and the uncertainties. Then, an estimator is used to estimate velocity of the leader. An event-trigged controller (ETC) is constructed based on the estimator, the observer and extra variables. Specifically, extra variables are used to solve the underactuated problem and input saturation. Stability analysis of control system is given to prove all signals are bounded. Simulations demonstrate that the ETESO can estimate accurately the uncertainties, the velocity and yaw rate; the ETC can largely reduce the action times of actuator.

How to effectively suppress thermal cracks in the metal laser additive manufacturing process is still one of the key issues to be solved in the field of laser additive manufacturing. Metal tin, with wide liquid phase working temperature range, high boiling point, low viscosity, high thermal conductivity and excellent electrical conductivity. The use of tin as an auxiliary thermal management material in the metal additive manufacturing process is expected to achieve effective regulation of the temperature field and stress field of the formed part, thereby inhibiting the initiation of cracks and obtaining formed parts with the target grain structure and high reliability. This paper presented a novel liquid metal-assisted laser additive manufacturing method (LMAAM). A numerical model for the laser additive manufacturing of tin-assisted titanium alloys was established. The differences of the flow field, temperature field and stress field of the formed parts with tin and without tin were compared and analyzed. The influence of the interaction position between the tin liquid level and the forming part on the temperature field and stress field of the forming part was deeply studied. The laser additive manufacturing experiment of tin-assisted titanium alloy was carried out, and the experimental results were basically consistent with the simulation results, which verified the validity of the model. LMAAM technology has proven to be an effective method for additive manufacturing of highly reliable formed parts.

The assessment of water quality consists of counting bacteria indicating fecal contamination or detecting the presence of pathogenic bacteria using standardized or validated methods of classical microbiology. Our present study aims to determine the bacteriological quality of drilling water in the Tandjilé region of Chad. Our method used was based on qualitative and quantitative research on suspected total coliforms, Echerichia Coli and fecal enterococci were analyzed according to the standard routine methods of the French Association for Normalization (AFNOR). Microbiological analysis shows the presence of indicators of fecal contamination such as total coliforms, Escherichia coli and fecal enterococci. The number of strains detected in 100 ml were E. coli (7 /29 samples), fecal Streptococcus (6 /29 samples) and total coliforms (29/29 samples), respectively from borehole water. The contamination rate of E. coli is 24.13%, total coliforms 100% and 20.68% of fecal enterococci in boreholes. The high number of these microorganisms is more than the values recommended by the WHO for the quality of drinking water. Corrective and urgent measures are needed to improve the quality of these water resources, rich in pathogens, which are health risks, and the causes of infectious diseases such as gastroenteritis, diarrhea, typhoid and skin diseases.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.