Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

We report an all-optical radio-frequency (RF) spectrum analyzer with a bandwidth greater than 5 terahertz (THz), based on a 50-cm long spiral waveguide in a CMOS-compatible high-index doped silica platform. By carefully mapping out the dispersion profile of the waveguides for different thicknesses, we identify the optimal design to achieve near zero dispersion in the C-band. To demonstrate the capability of the RF spectrum analyzer, we measure the optical output of a femtosecond fiber laser with an ultrafast optical RF spectrum in the terahertz regime.

Fresh water springs are unique natural resources in Florida, currently under threat from increasing groundwater pumping and pollution resulting from a variety of sources. This paper estimates current recreation benefits from visiting springs using the travel cost method and elicits residents’ willingness to contribute for springs restoration using the contingent valuation method. It further compares the performance of count data models correcting for endogenous stratification and truncation, and finds that the annual consumer surplus per person per trip is between $20 and $43. Furthermore, visitors are willing to contribute $12 to $14 per person per trip for springs restoration without reducing trip demand.

Much has been explored in the individual health issue, and most of them adopt the objective data such as laboratory tests or health services utilization to analyze individual health assessment. However, the factors influencing individuals in self‐assessed health is still unclean. The study considers that self‐assessed health is viewed as catalyst in health management and explores various dimensions associated with self‐assessed health. Totally, 800 participants who were randomly sampled from the citizen of Porter County, Indiana completed the Needs Assessment Citizen Survey in 2007.After adjustment for age, gender, education, income, and health coverage, life quality (β=1.5538, sdandard erro of β=0.8404), and Medicaid assistance (β= -0.7715, sdandard erro of β= 0.3958) are the main determinants of individuals’ self‐assessed health. The results suggest that public health officials should consider improving citizens’ self-assessed health by providing good living and socio-economic environment.

A millimeter-wave microstrip leaky-wave antenna array based on the substrate-integrated waveguide (SIW) and the complementary split-ring resonator (CSRR) is proposed in this paper. The slow wave characteristics of the SIW are enhanced by etching two rows of symmetrical CSRR-type slots on the surface of the SIW layer. The magnetic coupling between the CSRR-SIW layer and equally spaced circular patches array on the upper layer realizes the radiation of electromagnetic energy. In the 23~30 GHz (relative bandwidth 26.4%) operating frequency band, the horizontal polarization radiation beam scanning from -62° to -2° is realized, with a peak gain of 9.6~11.7 dBi, and the cross-polarization ratio is more than 43.8 dB.

In order to properly cover different scenarios, radiation patterns of antennas should be accordingly adjusted before fabrication. However, most antennas are unable to provide both broadside beam and designable conical beam which are usually-used radiation patterns for radio coverage. In this paper, a planar Circular Polarized (CP) annular Leaky-Wave Antenna (LWA) with conical beam is proposed, which is realized on annular Substrate-Integrated Waveguide (SIW). Broadside beam or conical beam could be easily obtained by fabricating the LWA with modified structural parameters. The central operating band is 5.8 GHz. The LWA allows only the -1th spatial harmonic to radiate, while the fundamental wave and other spatial harmonics are suppressed in slow wave mode. In order to validate the design effectiveness, two examples for broadside beam and conical beam radiation are fabricated and measured. The measurement results show good agreement with the simulation results. The proposed LWA presents a promising radiation performance and is a good candidate for wireless communication applications.

Alzheimer’s Disease (AD), a progressive and debilitating condition, is reported to be the most common type of dementia, with at least 55 million people believed to be currently affected. Many causation hypotheses of AD exist, yet the intriguing link between viral infection and its possible contribution to the known etiology of AD has become an attractive focal point of research for the field and a challenging study task. In this review, we will explore the historical perspective and milestones that led the field to investigate the viral connection to AD. Specifically, several viruses such as Herpes Simplex Virus 1 (HSV-1), Zika virus (ZIKV), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), along with several others mentioned, include the various viruses presently considered within the field. We delve into the strong evidence implicating these viruses in the development of AD. We will also extend beyond these mere associations by carefully analyzing the potential mechanisms by which viruses may contribute to AD pathology. This includes but is not limited to direct neuronal infections, dysregulation of immune responses, and the impact on protein processing. Controversies and challenges of the viral-AD relationship emerge as we tease out these potential mechanisms considered. Looking forward, we emphasize the future directions the field should take to tackle the remaining unanswered questions and the glaring research gaps that persist. Overall, this review aims to provide a comprehensive survey of the past, present, and future of the potential link between viral infections and their association with AD development.

The meticulously engineered powertrain mounting system of hybrid-electric vehicles plays a critical role in minimizing vehicle vibrations and noise, thereby enhancing the longevity of vital powertrain components. However, developing and designing such a system demands substantial time and financial investments due to intricate analysis and modeling requirements. To tackle this challenge, this study integrates data-mining technology into the design and optimization processes of the powertrain mount system. The research focuses on the powertrain mounting system of a transverse four-cylinder hybrid-electric vehicle, employing the CRISP-DM (Cross-Industry Standard Process for Data Mining) methodology to establish a data-mining prediction model for mounting stiffness. This model utilizes three data mining algorithms—Multi-SVR, MRTs, and MLPR—assessing their predictive accuracy concerning mounting system stiffness estimation. A comparative analysis reveals that the MRTs algorithm outperforms others as the most effective prediction model. The proposed predictive model elucidates the quantifiable correlation between vibration isolation performance and installation stiffness, overcoming complexities associated with traditional modeling approaches. Applying this model in powertrain mounting system design showcases the efficacy of the CRISP-DM-based approach, significantly enhancing design efficiency without compromising prediction accuracy.

The present study employed a modifed QuEChERS method to systematically analyze the presence of fifteen Quinolones and seven Tetracyclines antibiotic residues in local animal food. Additionally, a multi-level-four-factor Box-Behnken design (BBD) within the framework of Response surface methodology (RSM) was utilized to evaluate the various factors affecting the detection efficiency of the sample pretreament procedure. The optimization was performed by Design Expert®, the factors including volume of the acetonitrle, the addition of formic acid, the duration of extract and the addition of EDTA were combined to experiment design until reach an optimal solution. Finally, the sample test was conducted by ultra-high performance liquid chromatography-quadrupole-linear ion trap mass spectrometry in both multiple reaction monitoring (MRM) and enhanced product ion (EPI) scan modes on a QTRAP® 5500 instrument. The overall average recoveries from actual samples fortified with 22 antibiotics at three levels ranged from 74.7 to 122.6% based on the use of matrix-fortified calibration with the variation ranging from 2.1 to 18.2% (n=6). The limits of detection and quantification were 0.3 μg kg-1 and 1.0 μg kg-1, respectively.

Background: Peroxiredoxins (Prxs) comprise antioxidant factors that are widely found in prokaryotes and eukaryotes. Abnormal expression of Prxs is closely related to tumorigenesis. Methods: This study examined the prognostic value and expression of Prxs in lung cancer by Human Protein Atlas (HPA), Gene Expression Profiling Interactive Analysis (GEPIA), UALCAN, Kaplan-Meier Plotter, cBioPortal and Functional Enrichment Analysis Tool (FunRich) databases. Results: We found that Prx1/2/3/4/5 were overexpressed in both lung squamous cell carcinoma (LUSC) and lung adenocarcinoma (LUAD) relative to normal lung cells. However, the expression level of Prx6 was lower in LUAD and higher in LUSC than normal lung cells. The level of Prx3 and Prx6 were associated with pathological stage. Prognostic analysis showed that elevated Prx1 and Prx2 expression were correlated with low Overall Survival (OS), whereas high Prx5 and Prx6 expression level predicted high OS. Conclusions: Our results effectively revealed the level of Prxs in lung cancer and its influence on the prognosis of lung carcinoma, contributing to the study of the role of Prxs in tumorigenesis.

A 'little brother' of pain, itch is an unpleasant sensation that creates a specific urge to scratch. To date, various machine-learning based image classifiers (MBICs) have been proposed for quantitative analysis of itch-induced scratch behaviour of laboratory animals in an automated, non-invasive, inexpensive and real-time manner. In spite of MBICs' advantages, the overall performances (accuracy, sensitivity and specificity) of current MBIC approaches remains inconsistent, with their values varying from ~50% to ~99%, for which the reasons underlying have yet to be investigated further, both computationally and experimentally. To look into the variation of the performance of MBICs in automated detection of itch-induced scratch, this article focuses on the experimental data recording step, and reports here for the first time that MBICs' overall performance is inextricably linked to the sharpness of experimentally recorded video of laboratory animal scratch behaviour. This article furthermore demonstrates for the first time that a linearly correlated relationship exists between video sharpness and overall performance (accuracy and specificity, but not sensitivity) of MBICs, and highlight the primary role of experimental data recording in rapid, accurate and consistent quantitative assessment of laboratory animal itch.

Water quality monitoring was an important objective in the surroundings. In this study, we investigated the sensing characteristics of the arrayed flexible chloride sensor with XBee wireless sensing system. The sensitivity and linearity of the wireless chloride sensing devices were 91.6 mV/pCl and 0.988, respectively. The hysteresis voltages were 50.14 mV and 36.71 mV during the cycles of 1 M → 10⁻¹ M → 1 M → 10⁻³ M → 1 M and 1 M → 10⁻³ M → 1 M → 10⁻¹ M → 1 M, respectively. The selectivity coefficients of the ClO⁻ ion, ClO₄⁻ ion, NO₃⁻ ion and I⁻ ion for Cl⁻ ion were 5.0 × 10⁻², 1.0 × 10⁻¹, 5.9 × 10⁻³ and 5.6×10⁻¹, respectively. The sensing characteristics of real time measurement were investigated for dynamic microfluidic. The arrayed flexible chloride sensor was integrated with the microfluidic device, syringe pump and wireless sensing system. The sensitivity and linearity were 273.1 mV/pCl and 0.978 at 35 μL/min, respectively.

A typical solid-state quantum sensor can be developed based on negatively charged nitrogen-vacancy (NV-) centers in diamond. The electron spin state of NV- can be controlled and read at room temperature. Through optical detection magnetic resonance (ODMR) technology, temperature measurement inside living cells can be achieved at the nanoscale. The key to ODMR technology is to apply microwave resonance to manipulate the electron spin state of NV-. Therefore, the microwave field characteristics formed near the NV- have a crucial impact on the sensitivity of ODMR measurement. This article mainly focuses on the temperature situation in cellular applications, and simulates the influence of structural parameters of double open loop resonant (DOLR) microwave antennas and broadband large-area (BLA) microwave antennas on the microwave field’s resonance frequency, quality factor Q, magnetic field strength, uniformity, etc. The parameters are optimized to have sufficient bandwidth, high signal-to-noise ratio, low power loss, and high magnetic field strength in the temperature range of 36 ℃ to 42.5 ℃. Finally, the ODMR spectra are used for effect comparison, and the signal-to-noise ratio and Q values of the ODMR spectra are compared when using different antennas. We have provided an optimization method for the design of microwave antennas and it is concluded that the DOLR microwave antenna is more suitable for living cell temperature measurement in our study.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

In order to understand the impact of lithologic heterogeneity of continental mixed fine-grained sedimentary rocks on reservoir brittleness in western Qaidam basin, the mechanical properties of the rocks and their correlation with mineral composition and petrographic characteristics were studied by measns of mineralogy, petrography and triaxial stress test. The results show that the reservoir rocks can be divided into 5 different types according to the mechanical properties of the reservoir (characteristics of stress-strain curves), among them Type I and III belong to similar elastoplastic failure model, type II shows a special pulse failure mode for plastic material, type IV shows a failure mode of mixed characteristics, and type V exhibits a typical plastic failure model. The correlation between minerals and mechanical properties indicates that quartz and feldspar, which are often considered brittle minerals, do not contribute much to the brittleness of continental fine-grained sedimentary rocks. The main minerals affecting reservoir brittleness are dolomite and clay minerals, and their contributions to reservoir brittleness are positive and negative, respectively. The petrographic analysis results prove that the abnormal correlation between rock mechanical properties and quartz and feldspar is caused by the different rock fabrics. When dolomite forms a rock skeleton, it typically exhibits greater strength, brittleness and physical properties than other minerals. Based on the results, a brittleness evaluation standard for continental fine-grained sedimentary rock reservoir is proposed, and the validity of the standard is verified by the spatial correlation between the lithology probability model and the micro-seismic monitoring data, indicating that the spatial heterogeneity of dolomite-rich rock is the main controlling factor for the development of ‘sweet spot’ in the Cenozoic continental fine-grained sedimentary rock reservoir in the Western Qaidam Basin.

Polysaccharide from Ficus carica L. (FCP) exert multiple biological activities, as a biological macromolecule, the available knowledge about the specific structures and mechanisms of biological activity of purified 'Brunswick' fig polysaccharide is currently limited. In the present study, by chemical purification and characteristics identified via specific instruments, and then the impact of FCP on the immunomodulation activity in vitro and in vivo was examined. Structural char-acteristics showed that the molecular weight of the FCP was determined to be 127.5 kDa, the primary monosaccharides present in the FCP were galacturonic acid (GalA), arabinose (Ara), galactose (Gal), rhamnose (Rha), glucose (Glc), and xylose (Xyl) at a ratio of 0.321:0.287:0.269:0.091:0.013:0.011. Based on the investigation of in vitro immunomodulatory ac-tivity, FCP was found to stimulate the production of NO, TNF-α, and IL-6 and increased the pi-nocytic activity of macrophages. Further analysis revealed that FCP activated macrophages by interacting with toll-like receptor 4 (TLR4). Moreover, the in vivo test results indicate that FCP showed significant increase serum pro-inflammatory factors in immunosuppressed mice. Overall, this study suggests that FCP has the potential to be utilized as a novel immunomodulator in the pharmaceutical and functional food industries.

In this paper, we consider a reconfigurable intelligent surface (RIS)-assisted integrated satellite-high altitude platform-terrestrial networks (IS-HAP-TNs) that can improve network performance by exploiting HAP's stability and RIS's reflection. Specifically, the reflector RIS is installed on the side of HAP to reflect signals from the multiple ground user equipments (UEs) to the satellite. To aim at maximising system sum rate, we jointly optimize the transmit beamforming matrix at the ground UEs and RIS phase shift matrix. Due to the limitation of the unit modulus of the RIS reflective elements constraint, the combinatorial optimization problem is difficult to tackle it effectively by traditional solving methods. Based on this, this paper studies deep reinforcement learning (DRL) algorithm to achieve online decision making for this joint optimization problem. In addition, it is verified through simulation experiments that the proposed DRL algorithm outperforms the standard scheme in terms of system performance and execution time, and higher computing speed, making real-time decision making truly feasible。

We investigate and discuss in detail the structure of the restricted singular value decomposition for a tensor triplet under t-product (T-RSVD). The algorithm is provided with a numerical example illustrating the main result. For applications, we consider color image watermarking processing with T-RSVD.

Neurogenesis in the adult brain plays a major role in the cognitive ability of animals including learning and memory. Poria cocos (Schw.) Wolf (P. cocos) has been known as a traditional Chinese edible medicinal herb with the potential effect to improve learning and memory. However, the effect mechanisms are still elusive. In this study, significant neuronal differentiation-promoting activities of the ethanol extracts of P. cocos (EEPC) were tested in Neuro-2a cells and mouse cortical neural stem/progenitor cells (NSPCs). Subsequently, 97 compounds of EEPC were identified using UHPLC-Q-Exactive-MS/MS. After investigation of neuronal differentiation-promoting activities of 4 major compounds (Ethyl palmitoleate, L-(-)-Arabitol, Choline and Adenosine), only Choline has significant neuronal differentiation-promoting activity. In summary, we investigated the neuronal differentiation-promoting activity and chemical compositions of EEPC, the study of the neuronal differentiation-promoting effect of ether extract of P. cocos indicated P. cocos’s positive effect on learning and memory functions. This is the first investigation of the neuronal differentiation-promoting effect of ether extract of P. cocos based on similar research references.

Activation of the NLRP3 inflammasome plays a crucial role in innate immune response. During cell division, the NLRP3 inflammasome activation must be strictly controlled. Here, we discovered the anaphase promoting complex subunit 10 (Anapc10, APC10), a substrate recognition protein of the anaphase promoting complex/cyclosome (APC/C), is a critical mediator of the NLRP3 inflammasome activation. APC10 protein interacts with NLRP3, and co-localizes with NLRP3 protein in the cytoplasm. During interphase, APC10 interacts with NLRP3 to promote the NLRP3 inflammasome activation. During mitosis, APC10 disassociates from the NLRP3 inflammasome to inhibit the inflammatory responses. This study reveals a distinct mechanism by which APC10 serves as a switch of the NLRP3 inflammasome activation during cell cycle.

The mining sector generates a substantial quantity of stone waste and tailings, which constitutes an environmental risk. The most prevalent method for disposing of this industrial waste is dumping, which contributes to soil deterioration and water contamination while acquiring precious land. It can be recycled using a number of processes, such as the promising geopolymerization technique, which transforms waste into value. This study reviews current developments in the manufacturing of mine tailings-based geopolymer composites from industrial waste as a possible sustainable building material. This paper also gives in-depth studies on the characteristics and behaviors of mine tailings composites used in geopolymer manufacturing, including durability, microstructure, thermal and leaching properties. This review also identifies knowledge gaps that must be filled in order to advance mine tailings composites for geopolymers.

The chloroplast genome is conservative and stable, which can be employed to resolve genotypes. Currently, published nuclear sequences and molecular markers failed to differentiate the species from taxa robustly, including Machilus leptophylla, Hanceola exserta, Rubus bambusarum, and Rubus henryi. In this study, the four chloroplast genomes were characterized, and then their simple sequence repeats (SSRs) and phylogenetic positions were analyzed. The results demonstrated the four chloroplast genomes consisted of 152.624 kb, 153.296kb, 156.309 kb, and 158.953 kb in length, involving 124, 130, 129, and 131 genes, respectively. Moreover, the chloroplast genomes contained typical four regions. Six classes of SSR were identified from the four chloroplast genomes, in which mononucleotide was the class with the most members. The types of the repeats were various within individual classes of SSR. Phylogenetic trees indicated that M. leptophylla was clustered with M. yunnanensis, and H. exserta was confirmed under family Ocimeae. Additionally, R. bambusarum and R. henryi were clustered together, whereas they did not belong to the same species due to the differing SSR features. This research would provide evidence for resolving the species and contributed new genetic information for further study.

Silicon is an essential trace nutrient for plant growth and is frequently employed to remediate soils contaminated with heavy metals in agriculture. However, silicon’s role and mechanism in reducing heavy metal toxicity have not been well understood, especially for multi-heavy metals. In this study, the effects of silicon-rich materials (silicate, rice husk biochar (RHB), and bentonite) on growth trait, antioxidant response, and heavy metal accumulation and distribution of wheat grown in two soils polluted by multiple heavy metals (Cd, Zn, Pb, and As) were investigated. The results revealed that the addition of silicon-rich materials enhanced plant growth, improved the photosynthetic attributes in leaf tissues, and decreased the contents of Cd, Zn, Pb, and As in wheat shoots and grains. The examination of the subcellular distribution of heavy metals in plants implied that silicon-rich materials transferred heavy metals as intracellular soluble fractions to the cell walls, indicating the reduction of mobility and toxicity of heavy metals in the plants. In addition, the application of the silicon-rich materials reduced oxidative damage in plants by downregulating plant antioxidant response systems and decreasing the production of malondialdehyde (MDA), ascorbic acid (AsA), and glutathione (GSH). Moreover, fractionation analysis of soil heavy metals showed that silicon-rich amendments could convert bioavailable heavy metals into immobilized forms. The results indicated that silicon-rich materials could remediate multi-heavy metal-polluted soils and promote wheat production.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

From a scientific standpoint, both temporal and spatial variables must be examined when developing programs for training various soccer scoring techniques (SSTs), but a review of current literature reveals that existing scientific studies have overlooked this combinatory influence. Consequently, there is no reliable theory on temporal-spatial identification when evaluating scoring opportunities. Quantified by using biomechanical modeling, anthropometry, and SSTs found in FIFA Puskás Award (121 nominated goals between 2009 and 2020), it is found that players’ proprioceptive/effective shooting volume (i.e. players’ attack space) could be sevenfold the currently-practiced shooting volume. The ignorance of some SSTs’ training leads to the underuse of the potential shooting volume. These overlooked SSTs are airborne and/or acrobatic techniques, perceived as high-risk and low-reward. Relying on the talent of an athlete to improvise on the fly can hardly be considered as a viable coaching strategy. Therefore, for developing science-based SST training regimes, groundbreaking studies are needed to: 1) expand the perception of shooting volume, and 2) entrain one-touch-shot techniques (airborne/acrobatic) within this volume, in short, Focusing-on-Time-in-Space. Whence, the new temporal-spatial theory could guide future researches and develop novel training programs. An increase of airborne/acrobatic goals would ultimately further enhance the excitement of the game.

The creep behaviors of TA2 and R60702 at low and intermediate temperature were presented and discussed in this paper. Experimental results indicated that an apparent threshold stress exhibited in the creep deformation of R60702. Meanwhile, the primary creep phase was found as the main pattern in the room temperature creep behavior of TA2. Compared with exponential law, the power law has been proved to be a proper constitutive model in the description of primary creep phase. It also showed that θ projection method had its significant advantage in the evaluation of accelerated creep stage. Thus, a composite model which combined power law with θ projection method was applied in the creep curves evaluation at low and intermediate temperature. Based on the multiaxial creep deformation results, the model was modified and discussed. A linear relationship existed between composite model parameters and applied load. Finally, the creep life could be accurately predicted and the composite model method is suitable for application in low and intermediate temperature creep life analysis.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

(1) Background: Bacterial reinfection and root fracture are the main culprits related to root canal treatment failure. This study aimed to assess the utility of quercetin solution as an adjunctive endodontic irrigant that strengthen root canal dentin with commitment anti-biofilm activity and bio-safety. (2) Methods: Based on a noninvasive dentin infection model, dentin tubules infected with Enterococcus faecalis (E. faecalis) were irrigated with sterile water (control group), and 0, 1, 2, 4 wt% quercetin-containing ethanol solutions. The live and dead bacteria proportions within E. fae-calis biofilms were analyzed using confocal laser scanning microscopy (CLSM). Elastic modulus and hydroxyproline release and X-ray photoelectron spectroscopy (XPS) characterization was tested on irrigant-treated demineralized dentin to evaluate irrigants’ biostability. The cytotoxicity of irrigants was tested by CCK-8 assay. (3) Results: Quercetin increased the proportion of dead bacteria volumes within E. faecalis, and improved the flexural strength of dentin collagen com-pared to control group. The XPS characterization revealed an increase in C-O peak area under both C1s and O1s narrow-scan spectra. The CCK-8 assay confirmed no cytotoxicity of quercetin solutions. (4) Conclusions: Quercetin exhibited anti-biofilm activity, collagen-stabilizing effect as well as cytocompatibility, supporting quercetin as a potential candidate for endodontic irrigant.

This study takes a two-echelon agricultural products supply chain (APSC) composed of an agricultural product processor (processor) and an agricultural product supermarket (supermarket) as the research object. In order to ensure the stable supply of high-quality agricultural products, this paper considers both fairness concern and corporate social responsibility (CSR), and establishes four Stackelberg game models with or without considering fairness concern and CSR, and obtains the influence mechanism of fairness concern and CSR on bilateral quality efforts in APSC through comparative analysis and numerical analysis. Research shows that the supermarket’s fairness concern can take the role of "profit distribution mechanism", but it is not conducive to improving bilateral quality efforts resulting in the inability to improve market demand, and it is not conducive to improving the utility of the supply chain system and consumer surplus; both members of APSC sharing CSR can not only improve the quality of agricultural products and promote the expansion of market demand, but also can achieve Pareto improvement of both profit of all members and supply chain system. Besides, The CSR shared by both members has a greater impact on bilateral quality efforts decision than the supermarket’s fairness concern, and thus the positive effect of CSR can overcome the negative effect of supermarket’s fairness concern.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

Previous control methods developed by our research team cannot satisfy the high-accuracy requirements of unmanned surface vessel (USV) path-tracking during bathymetric mapping because of the excessive overshoot and slow convergence speed. For this reason, this study developed an adaptive fuzzy integral-derivative line-of-sight (AFIDLOS) guidance law for USV path-tracking control. Integral and derivative terms were added to counteract the effect of the sideslip angle, with which the USV could be quickly guided to converge to the planned path for bathymetric mapping. To obtain a high-accuracy of the look-ahead distance, a fuzzy control method was proposed. The proposed method was verified using simulations and outdoor experiments. The results demonstrate that the AFIDLOS guidance law can reduce the overshoot by 79.85%, shorten the settling time by 55.32% in simulation experiments, and reduce the average cross-track error by 10.91%, and can ensure a 30% overlap of neighboring strips of bathymetric LiDAR outdoor mapping when compared with the traditional method.

Inflammation is the response of the immune system to infection and injury, with complex interactions with the body, tissues and cells, and plays an important role in the initiation and progression of many diseases such as cancer and cardiovascular disease. Traditional excipients functioning as drug delivery systems can reduce the side effects of systemic distribution of inflammatory drugs. Oil phase, a common excipient in nanoemulsions (NEs), has the advantages of assisting the formation of emulsions, loading lipophilic drugs, thermodynamic stability, wide sources, low price and easy availability. In particular, some of them, like linolenic acid and medium chain triglyceride (MCT), also function as inhibitors of systemic inflammation marker and vascular inflammation marker. However, the influences of different oil phases on the construction of NEs and their distribution in vivo have not been fully investigated. Herein, Tween 80 and ethyl alcohol were screened out as emulsifiers and co-emulsifiers, and three different oil phases used in clinical practice widely, including MCT, oleic acid (OA), and ethyl oleate (EO), were selected as the oil phase to prepare NEs delivery platform. Three NEs had consistent size, potential, morphology, excellent stability and mitochondrial localization function. Importantly, they exhibited superior cellular uptake capacity in inflammatory-injuried human umbilical vein endothelial cells and significantly targeted the brain, lung, heart and thoracic aorta in the lipopolysaccharide-induced mouse and zebrafish larvae inflammation models. Meanwhile, the fluorescence intensities of three NEs were different in these organs, suggesting that their differential enrichment might provide alternative delivery platform for disease treatment in the corresponding organs.

A novel electrospun nanofiber was developed using polyamide-6 (PA) and ε-poly-L-lysine (PL). PA is a popular textile polymer having desirable mechanical and thermal properties, chemical stability, and biocompatibility. However, PA nanofibers are prone to bacterial growth and user discomfort. PL, a natural homopolyamide, is non-toxic, antimicrobial, and hydrophilic but lacks spinnability due to its low molecular weight. Given its similar backbone structure as PA, with an additional amino side chain, PL was integrated with PA to develop multifunctional nanofibers. This study explores a simple, scalable method to obtain PL nanofibers by utilizing the structurally similar PA as the base. The goal was to enhance the functionality of PA by addressing its drawbacks. The study demonstrates spinnability of varying concentrations of PL with base PA while exploring compositions with higher PL concentrations than previously reported. Electrospinning parameters were studied to optimize the nanofiber properties. The effects of PL addition on morphology, hydrophilicity, thermal stability, mechanical performance, and long-term antimicrobial activity of nanofibers were evaluated. The inclusion of PL in PA-based nanofibers resulted in super hydrophilicity, increased tensile strength, and efficient antimicrobial properties with long-term stability. These enhanced characteristics hold promise for the composite nanofiber’s application in medical and protective textiles.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Network Embedding (NE) is an important method to learn the representations of network via a low-dimensional space. Conventional NE models focus on capturing the structure information and semantic information of vertices while neglecting such information for edges. In this work, we propose a novel NE model named BimoNet to capture both the structure and semantic information of edges. BimoNet is composed of two parts, i.e., the bi-mode embedding part and the deep neural network part. For bi-mode embedding part, the first mode named add-mode is used to express the entity-shared features of edges and the second mode named subtract-mode is employed to represent the entity-specific features of edges. These features actually reflect the semantic information. For deep neural network part, we firstly regard the edges in a network as nodes, and the vertices as links, which will not change the overall structure of the whole network. Then we take the nodes' adjacent matrix as the input of the deep neural network as it can obtain similar representations for nodes with similar structure. Afterwards, by jointly optimizing the objective function of these two parts, BimoNet could preserve both the semantic and structure information of edges. In experiments, we evaluate BimoNet on three real-world datasets and task of relation extraction, and BimoNet is demonstrated to outperform state-of-the-art baseline models consistently and significantly.

Accurate and reliable mid-long runoff prediction (MLTRP) is of great importance in water re-sources management. However the MLTRP is not suitable in each basin and how to evaluate the applicability of MLTRP is still a question. Therefore, the total mutual information (TMI) index is developed in this study based on the predictor selection method using mutual information (MI) and partial MI (PMI). The relationship between the TMI and the predictive performance of five models is analyzed by applying five models in 222 forecasting scenarios in Australia. The results over 222 forecasting scenarios demonstrate that, compared with the MI, the developed TMI index can better represent the available information in the predictors, and has more significant negative correlation with the RRMSE with the correlation coefficient between -0.62 and -0.85. This means the model's predictive performance will become better along with the increase of TMI, and there-fore the developed TMI index can be used to evaluate the applicability of MLTRP. When TMI is more than 0.1, the available information in the predictors can support the construction of MLTRP models. In addition, the TMI is used to partly explain the difference of predictive performance among five models. In general, the complex models, which can better utilize the contained infor-mation, are more sensitive to the TMI, and have more significant improvement in terms of predic-tive performance along with the increase of TMI. This research can provide support for the study of MLTRP.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

Although the Orthotropic steel decks (OSDs) have been widely used in the construction of long-span bridges, there are frequently reported fatigue cracks after years of operation, and the bridge deck overlay also presents severe damage due to OSD crack-induced stiffness reduction. The ultra-high performance concrete (UHPC), recognized as the most innovative cementitious composites and the next generation of high-performance materials, shows high strength, ductility, toughness and well performance on durability. After its first application to the OSD bridge in early 2000s, the orthotropic Steel-UHPC composite deck has been comprehensively studied worldwide. This review will summarize some important studies and findings on behavior and fatigue performance of orthotropic steel-UHPC composite deck. The existing studies and engineering application indicate that such deck system presents good bending behavior and high fatigue performance. The failure mode of shear studs in UHPC layer is dominated by shear fractures. The cracking of UHPC layer shall consider the superposition effect of stress from both the whole bridge structure and local decks. While some reasonable structural details in the traditional OSD may not work for the orthotropic steel-UHPC composite deck. It is recommended to evaluate the stress behavior and structural parameters, as well as fatigue life by conducting the field test under in-service traffic conditions.

To develop a lower-cost, excellent performance, and environmentally friendly phe-nol-formaldehyde (PF) resin, soybean meal was used to modify PF resin, and soybean meal-phenol-formaldehyde (SMPF) resins were prepared. Their physicochemical properties and curing performance were investigated, showing that SMPF resins have higher curing tempera-tures than PF resin. The Fourier transform infrared spectroscopy (FTIR) results indicated that the cross-linking reaction occurred between the amino groups of soybean protein and the hy-droxymethyl phenol. Moreover, with the addition of soybean meal, the viscosity of SMPF in-creased while the gel time decreased. It is worth mentioning that SMPF-2 resin has favorable viscosity, short gel time, low curing temperature (135.78 °C), and high water resistance and bonding strength (1.01 MPa). Finally, all the plywoods bonded with SMPF resins have good water resistance and bonding strength, which could meet the Standard (GB/T 17657-2013, type I) for plywood. The optimized SMPF resins showed the potential application to replace part of PF resin in the wood industry.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Given the documented wave-induced damage of elevated coastal decks during extreme natural hazards (e.g. hurricanes) in the last two decades, it is of utmost significance to decipher the wave-structure-interaction of complex deck geometries and quantify the associated loads. Therefore, this study focuses on the assessment of solitary wave impact on open-girder decks that allow the air to escape from the sides. To this end, an arbitrary Lagrangian-Eulerian (ALE) numerical method with a multi-phase compressible formulation is used for the development of three-dimensional hydrodynamic models, which are validated against a large-scale experimental dataset of a coastal deck. Using the validated model as a baseline, a parametric investigation of different deck geometries with a varying number of girders Ng and three different widths, was conducted. The results reveal that the Ng of a superstructure has a complex role and that for small wave heights the horizontal and uplift forces increase with the Ng, while for large waves the opposite happens. If the Ng is small the wave particles accelerate after the initial impact on the offshore girder leading to a more violent slamming on the onshore part of the deck and larger pressures and forces, however, if Ng is large then unsynchronized eddies are formed in each chamber, which dissipate energy and apply out-of-phase pressures that result in multiple but weaker impacts on the deck. The decomposition of the total loads into slamming and quasi-static components, reveals surprisingly consistent trends for all the simulated waves, which facilitates the development of predictive load equations. These new equations, which are a function of Ng and are limited by the ratio of the wavelength to the deck width, provide more accurate predictions than existing empirical methods, and are expected to be useful to both engineers and researchers working towards the development of resilient coastal infrastructure.

Paraphrase generation is an important yet challenging task in NLP. Neural network-based approaches have achieved remarkable success in sequence-to-sequence(seq2seq) learning. Previous paraphrase generation work generally ignores syntactic information regardless of its availability, with the assumption that neural nets could learn such linguistic knowledge implicitly. In this work we make an endeavor to probe into the efficacy of explicit syntactic information for the task of paraphrase generation. Syntactic information can appear in the form of dependency trees which could be easily acquired from off-the-shelf syntactic parsers. Such tree structures could be conveniently encoded via graph convolutional networks(GCNs) to obtain more meaningful sentence representations, which could improve generated paraphrases. Through extensive experiments on four paraphrase datasets with different sizes and genres, we demonstrate the utility of syntactic information in neural paraphrase generation under the framework of seq2seq modeling. Specifically, our GCN-enhanced models consistently outperform their syntax-agnostic counterparts in multiple evaluation metrics.

Mode locked pulse generation has been reported using both active and passive mode locking schemes. Active mode locking technique has been proven to be an effective way to generate high-repetition-rate pulses by incorporating a modulator inside the laser cavity. Compared to actively mode locked lasers, passively mode locked lasers can generate pulse train at ultrashort pulse width but with relatively lower repetition rate. Thus, it is a brilliant idea to build a hybrid mode locked system combining both active and passive mode lockers. In this review, several hybrid mode locked fiber ring laser systems are discussed and summarized. Hybrid mode locking is a promising method to generate high speed ultrashort optical pulses for fiber-optic telecommunication system.

With the great development of intelligent transportation systems (ITS), travel time prediction has attracted the attentions of many researchers and a large number of prediction methods have been developed. However, as an unavoidable topic, the predictability of travel time series is the basic premise for travel time prediction has received less attention than the methodology. Based on the analysis of the complexity of travel time series, this paper defines travel time predictability to express the probability of correct travel time prediction and proposes an entropy-based method to measure the upper bound of travel time predictability. Multiscale entropy is employed to quantify the complexity of travel time series, and the relationships between entropy and the upper bound of travel time predictability are presented. Empirical studies are made with vehicle trajectory data in an express road section. The effectiveness of time scales, tolerance, and series length to entropy and travel time predictability are analysis, and some valuable suggestions about the accuracy of travel time predictability are discussed. Finally, the comparisons between travel time predictability and actual prediction results from two prediction models, ARIMA and BPNN, are conducted. Experimental results demonstrate the validity and reliability of the proposed travel time predictability.

Microsoft has implemented several measures to defend against macro viruses, including the use of Anti-malware Scan Interface (AMSI) and automatic macro blocking. Nevertheless, evidence shows that threat actors have found ways to bypass these mechanisms. As a result, phishing emails continue to apply malicious macros as their essential attack vector. In this paper, we analyze 77 obfuscation features from the attacker’s point of view and extract 46 suspicious keywords in macro. We first combine the above two types of features to train machine learning models on a public dataset. Then, we carry out the same experiment on self-constructed dataset, a collection of newly discovered samples, to see if our proposed method could discover the unseen malicious macros. Experimental results demonstrate that, comparing with the existing researches, our proposed method has a higher detection rate and better consistency. Furthermore, ensemble multi-classifiers with distinct feature selection further improve the detection performance.

Adult neurogenesis involves generation of functional neurons from neural progenitor cells, which have the potential to complement and restore damaged neurons and neural circuits. Therefore, the development of drugs that stimulate neurogenesis represents a promising strategy in stem cell therapy and neural regeneration, greatly facilitating the reconstruction of neural circuits in cases of neurodegeneration and brain injury. Our study reveals that compound A5, previously designed and synthesized by our team, exhibits remarkable neuritogenic activities, effectively inducing neurogenesis in neural stem/progenitor cells (NSPCs). Subsequently, transcriptome analysis using high-throughput Illumina RNA-seq technology was performed to further elucidate the underlying molecular mechanisms by which compound A5 promotes neurogenesis. Notably, comparative transcriptome analysis showed that the up-regulated genes were mainly associated with neurogenesis and the down-regulated genes were mainly concerned with cell cycle progression. Furthermore, we confirmed that compound A5 significantly affected the expression of transcription factors related to neurogenesis and cell cycle regulatory proteins. Collectively, these findings identify a new compound with neurogenic activity and may provide insights into drug discovery for neural repair and regeneration.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

With the changing relationship between urban and rural areas in China, the rural areas are experiencing rapid social transformation. To ensure successful implementation of the rural revitalization strategy, land consolidation has become a major measure of rural economic reform. Existing research focuses on quantitative studies exploring the relationship between land consolidation and rural economic development, but there is a lack of studies on the relationship between land consolidation and social change. In this study, Jin’an Village is selected as the research area, using semi-structured interviews and semi-participatory observation to obtain original materials, aiming to make a detailed description of the specific practice of land consolidation, and to analyze the impact of land consolidation on the transformation of rural social consciousness. The study found that rural land consolidation involves villagers in the land consolidation process, which can effectively stimulate villagers’ participation in public affairs. Concurrently, the interaction between villagers and outside investors disrupts the conventional socialization model in rural areas and motivates villagers to act in accordance with contractual agreements. The conclusion is that land consolidation in rural areas can enhance the political democracy and legal consciousness of local villagers, which can lead to a change in local social consciousness. Our findings also emphasize the crucial necessity to grant rural villagers with improved accessibility to professional services and information, coupled with the continued promotion of land consolidation to advance modernization in these areas.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Directional solidification experiments were carried out to investigate the effect of micro-alloying element Sn and magnetic field on the solidification of Al-Bi immiscible alloys. Experimental results show that the size distribution of the dispersed particles in the low-speed solidified Al-3.4wt%Bi alloy presents two peaks, while it only shows one peak when solidified at a relatively high speed. The addition of Sn not only can enhance the nucleation rate and the number density of the Bi-rich droplets in the sample, but also decrease the Marangoni migration velocity and the axial resultant velocity of minority phase droplets in front of the solidification interface. Thereby it promotes the formation of Al-Bi alloys with a well-dispersed microstructure. A static magnetic with the strength of 0.2T increase the number density of the dispersed particles and decrease the average size and the size distribution width of the dispersed particles. Under the effect of Sn addition and static magnetic field, the average radius of the dispersed particles <R> and the solidification velocity V_0 satisfy <R>∝〖V_0〗^(-1/3) when the alloy was solidified at a relatively low velocity, <R> and V_0 satisfy <R>∝〖V_0〗^(-1/2) when the alloy is solidified at a high velocity.

Tourism is an important industry that promotes national economic and social progress. All-for-one tourism is a new concept of regionally coordinated development that uses the tourism industry as an engine to boost resource integration, industrial integration, and social sharing. Tourism service is the main embodiment of cultural ecosystem services for all-for-one tourism cities. Taking Liyang in China as an example, this paper used a combination of GIS spatial analysis and big data text mining to evaluate the tourism service from three aspects: the quality of tourism resources, the comprehensiveness of tourism service facilities, and the satisfaction of tourists. The results show that (1) the tourism service is better in the northwestern and eastern areas of the city, while it is lower in the northeastern and southwestern parts; (2) the hotspot areas should focus on improving the tour routes, the transport capacity, and excessive charges; the cold spot areas should work on ecological restoration and creating new tourism attractions by combining the local industries; (3) rural tourism integrating agriculture and visitation should be highlighted as a key growth point to improve the city’s tourism service function.

We found an important fact that the beam footprint line of Ping will intersect with the real water depth when the initial incidence angle is about 45°, and sound velocity error hardly has an effect on it. This is contrary to our previous experience that the soundings of the central beam of multi-beam bathymetric system (MBS) is the most accurate. Firstly, the influence of sound velocity errors on central beam and seafloor topography distortion was analyzed. Secondly, the process of proving this fact was given, and the topography correction method was proposed by compensating the sound velocity profile area (SVP area). Finally, we showed in the first simulation of four type errors in SVPs that this fact is verified. The topography correction method used in the second simulation to correct the topography distortion of the first simulation is also verified.

Aiming at the prediction of environmental vibrations induced by elevated high-speed railway, a machine-learning method is developed by combining random forest algorithm and Bayesian optimization, which using the dataset from on-site experiments . When it comes to achieving a rapid and effective prediction of environmental vibration, there is few research on com-parisons and verifications of different algorithms, and neither on parameter tuning and optimi-zation of machine learning algorithms. In this paper, a field experiment is firstly carried out to measure the ground vibrations caused by high-speed trains running on bridge, and then the en-vironmental vibration characteristics are analyzed in view of ground accelerations and weighted vibration levels. Subsequently, three machine-learning algorithms of linear regression, support vector machine and random forest are developed by using experimental database, and their prediction performance are discussed. Finally, two optimization models for the hyperparameter set of random forest algorithm are further compared. It turns out that the integrated random forest algorithm has higher accuracy in predicting environmental vibration than linear regression and support vector machine; the Bayesian optimization has excellent performance and high efficiency in achieving efficient and in-depth optimization of parameters, and can be combined with the RF machine learning algorithm to effectively predict the environmental vibrations induced by the high-speed railway.

Intelligent ship technology is currently an international research hotspot, and model predictive control is widely used in the path-tracking control of intelligent vehicles. To construct an intelligent ship anti-disturbance path-tracking control method, firstly, an environmental disturbance model was constructed with the actual meteorological data of the target sea area. Secondly, the Fossen ship equation of motion is linearized and discretized as the ship motion model. Thirdly, the expression of the prediction equation is derived from the ship motion model. Fourthly, the cost function is constructed by using the polar diameter and polar angle values of the ship. Fifth, the power function in the cost function is replaced with an exponential function to obtain an improved cost function. Sixthly, according to the Lyapunov theory and the MPC terminal constraint theory, the stability of the improved cost function is verified. Seventh, different test paths are set up, the environmental disturbance model is taken as the external disturbance, the ship motion model, the prediction equation, and the improved cost function are used to design the anti-disturbance path-tracking control algorithm according to the model prediction control idea for simulation experiments. Finally, different MATLAB simulation results show that the improved cost function can resist disturbance of the external wave, current, and wind, and effectively track the target path. Therefore, this study provides a reference for improving the navigation safety of ship path-tracking.

Arthropods, the most abundant group in ecosystems, play crucial roles in human production. Soil physicochemical properties reflect soil health and are linked to arthropods through cascading effects. Gravel-sand mulching, commonly practiced in dry farming regions, initially aids in water retention and temperature regulation. However, long-term cultivation can lead to land degradation and habitat fragmentation. This study aimed to investigate field systems using multiple comparison, linear, and nonlinear correlation analyses to explore the effects of different tillage durations on soil properties and arthropod diversity under gravel-sand mulching. Results indicate that arthro-pod diversity was lower while the fields maintained better soil fertility than the desert steppe. Both soil fertility and arthropod diversity declined significantly with increased years of cultivation. Mantel tests revealed no significant response of desert steppe arthropods to the altered soil properties of gravel-sand mulched fields. However, the Generalized Additive Model analysis indicated significant linear correlations between arthropod occurrence and total nitrogen (positive), available phosphorus, and water content (negative). Arthropod abundance showed significant nonlinear correlations with total potassium, alkali hydrolyzable nitrogen, and organic matter (OM), with OM changes having the most pronounced impact. Thus, gravel-sand mulching can maintain soil fertility over time but at the expense of local arthropod diversity.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

Mineral identification is an important part of geological analysis. Traditional identification methods rely on either the experiences of the appraisers or the various measuring instruments and the methods are either easily influenced by the experiences or need too much work. To solve the above problems, there have been studies using image recognition and intelligent algorithms to identify minerals. But the current studies can not identify many minerals, and the accuracy is low. To increase the number of identified mineral categories and the accuracy, we proposed the method that uses both the mineral images and the Mohs hardness in the deep neural networks to identify the minerals. The experimental results showed that the method can reach 94.0% Top-1 accuracy and 99.9% Top-5 accuracy for 28 common minerals. The model that combines image and Mohs hardness together can identify more minerals and increase the accuracy using less training data.

Cloud-based CNC is an emerging paradigm of Industry 4.0 where computer numerical control (CNC) functionalities are moved to the cloud and provided to manufacturing machines as a service. Among many benefits, C-CNC allows manufacturing machines to leverage advanced control algorithms running on cloud computers to boost their performance at low cost, without need for major hardware upgrades. However, a fundamental challenge of C-CNC is how to guarantee safety and reliability of machine control given variable Internet quality of service, especially on public Internet networks. We propose a three-tier redundant architecture to address this challenge. We then prototype tier one of the architecture on a 3D printer successfully controlled via C-CNC over public Internet connections, and discuss follow-on research opportunities.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

At different heat treatment temperatures, the hardness and flexural strength of M2 high-speed steel selective laser melting (SLM) parts show mixed trends. When the heat treatment temperature is 260°C, the hardness and flexural strength of the M2 high-speed steel SLM part are decreased, but the hardness difference between the upper and lower surfaces of the M2 high-speed steel SLM part is also reduced. When the heat treatment temperature is 560°C, the hardness and flexural strength of the M2 high-speed steel SLM part are almost close to that of the original M2 high-speed steel SLM part, and the performance gradient in the sample is improved, and the overall structure is uniform. When the subsequent heat treatment temperature is 860 °C, the hardness of the SLM parts reaches a minimum, with an average value of 24 HRC. However, the flexural strength exceeds that of the original SLM parts. Moreover, the microstructure of the sample is uniform, which significantly improves the anisotropy of performance.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Jumping side volley has created breathtaking moments and cherished memories for us. Regrettably, a scientific study on the skill has not been found in literature. Relying on talent of athletes to improvise on the fly can hardly be considered a viable learning strategy. This study targets to fill the gap by quantifying factors contributing to develop its coaching method. Using 3D motion capture (12-cameras, 200Hz) and full-body biomechanical modeling, our study aimed to identify elements that govern entrainment of the skill by examining jumping, kicking and falling phases of its execution. Given the rarity of players who have acquired this skill, we found five subjects for the study. Twenty-three trials were captured and quantified. The results unveil the following key elements: 1) the control of trunk rotation during the jumping, 2) the angle between thighs upon take-off, 3) the whip-like control of the kicking leg during airborne, 4) timing between ball motion and limbs’ coordination, and 5) damping mechanism during falling. An accurate kick can only be achieved through repetitive training. This underlines the need for athletes to master a safe landing technique that minimizes risk of injury during practice. Therefore, training should begin with learning a safe falling technique.

Controlling the selectivity of detonation initiation reaction of explosive is a Holy Grail, and it seems to be an “idiot's daydream”, by strengthening external electric field, to reduce the explosive sensitivity. The effects of external electric fields on the initiation reactions in NH2NO2∙∙∙NH3, a model system of the nitroamine explosive with alkaline additive, were investigated at the MP2/6-311++G(2d,p) and CCSD/6-311++G(2d,p) level. The concerted effect in the intermolecular hydrogen exchange is characterized by an index of the imaginary vibrations. Due to the weakened concerted effects by the electric field along the −x-direction opposite to the “reaction axis”, the dominant reaction changes from the hydrogen exchange to 1,3-intramolecular hydrogen transference with the increase of the field strengths. Furthermore, the stronger the field strengths, the higher the barrier heights become, indicating the lower sensitivities. Therefore, by strengthening the field strength and adjusting the orientation between the field and “reaction axis”, not only can the reaction selectivity be controlled, but also the sensitivity can be reduced, in particular under a super-strong field. Thus, a traditional concept, which the explosive is dangerous under the super-strong external electric field, is broken theoretically. Compared to the neutral medium, the low sensitivity of the explosive with alkaline can be achieved under the stronger field. Employing atoms in molecules, reduced density gradient and surface electrostatic potentials, the origin of the reaction selectivity and sensitivity change is revealed. This work provides a new idea to the technical improvement for adding the external electric field into the explosive system.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

The ability to handle spatiotemporal information makes contribution for improving the prediction performance of machine RUL. However, most existing models for spatiotemporal information processing are not only complex in structure but also lack adaptive feature extraction capabilities. Therefore, a lightweight operator with adaptive spatiotemporal information extraction ability named Involution GRU (Inv-GRU) is proposed for aero-engine RUL prediction. Involution, the adaptive feature extraction operator, is replaced by the information connection in the gated recurrent unit for obtaining the adaptively spatiotemporal information extraction ability and reducing the parameters. Thus, Inv-GRU can well extract the degradation information the of aero-engine. Then for RUL prediction task, the Inv-GRU based deep learning (DL) framework is firstly constructed, where features extracted by Inv-GRU and several human-made features are separately processed to generate the health indicators (HIs) from multi-raw data of aero-engines. Finally, fully connection layers are adopted are adopted to reduce dimension and regress RUL based on the generated HIs. By applying the Inv-GRU based DL framework to the Commercial Modular Aero Propulsion System Simulation (C-MAPSS) datasets, successful predictions of aero-engines RUL have been achieved. Comparative analysis reveals that the proposed model exhibits superior overall prediction performance compared to recent public methods.

The host-guest inclusion strategy has potential to surpass the limitations of energy density and suboptimal performances of single explosives. The guest molecules can not only enhance the detonation performance of host explosives but can also enhance their stability. Therefore, the deeply analysis the role of guest influence on the pyrolysis decomposition of the host-guest explosive is necessary. The whole decomposition reaction stage of CL-20/H2O, CL-20/CO2, CL-20/N2O, CL-20/NH2OH was calculated by ReaxFF-MD. The incorporation of CO2, N2O and NH2OH significantly increase the energy levels of CL-20. However, different guest has little influence on the initial decomposition paths of CL-20. The Ea1 and Ea2 values of CL-20/CO2, CL-20/N2O, CL-20/NH2OH systems are higher than the CL-20/H2O system. Clearly, incorporation of CO2, N2O, NH2OH can inhibit the initial decomposition and intermediate decomposition stage of CL-20/H2O. Guest molecules get heavily involved in the reaction and influence on the reaction rate. k1 of CL-20/N2O and CL-20/NH2OH systems are significantly larger than that of CL-20/H2O at high temperatures. k1 of CL-20/CO2 system is much complex, which can be affected deeply by temperatures. k2 of CL-20/CO2, CL-20/N2O system is significantly smaller than that of CL-20/H2O at high temperatures. k2 of CL-20/NH2OH system is little difference at high temperatures. For the CL-20/CO2 system, the k3 value of CO2 is slight higher than that for CL-20/H2O, CL-20/N2O, CL-20/NH2OH systems, while the k3 values of N2 and H2O are slight smaller than that for CL-20/H2O, CL-20/N2O, CL-20/NH2OH systems. For the CL-20/N2O system, the k3 value of CO2 is slight smaller than that for CL-20/H2O, CL-20/CO2, CL-20/NH2OH systems. For the CL-20/NH2OH system, the k3 value of H2O is slight larger than that for CL-20/H2O, CL-20/CO2, CL-20/N2O systems. These mechanisms revealed that CO2, N2O and NH2OH molecules inhibit the early stages of the initial decomposition of CL-20, and play an important role for the decomposition subsequently.

Based on data from the Yunnan Province farm household survey, we examine the effect of rural land rights policy on farmers’ income. The regression results show that right significantly raises the total income of farmers, with farm income serving as the primary source of total income. After performing numerous robustness tests, using instrumental variables to handle endogeneity and arriving at the same conclusion, the result is still valid. According to the heterogeneity analysis, in the sample of households with long-term migrant workers, the confirmation of rural land rights significantly increases total and nonfarm income while decreasing farm income. Furthermore, total income includes nonfarm income, which reflects the effect of different farmers' optimal labor allocation based on the external market environment. According to the impact mechanism anal-ysis, right can increase farmers' total income by promoting land transfer, and farmers in less developed areas are more willing to increase their income by land transfer out.

Surface urban heat island (SUHI) depicts the deteriorating thermal environment in high-density cities and local climate zone (LCZ) classification provides a universal protocol for SUHI identification. In this study, taking the central urbanized area of Guangzhou in the humid subtropical region of China as the study area, the maps or images of LCZ, land surface temperature (LST), SUHI and urban design factors were achieved by using Landsat satellite data, GIS database and a series of retrieval and classification algorithms, and the urban design factors influencing SUHI were investigated based on 625 samples of LCZs. The results show that in the summer daytime under the clear sky condition, the LST varied greatly from 26 °C to 40 °C and the SUHI changed in a wide range of -6 °C to 8 °C in the LCZs of the study area. Seven and five urban design factors influencing the summer daytime SUHI were identified for the two dominant LCZ of LCZs 1-5 (LCZ 1 to LCZ 5) and the mixed LCZ (containing at least three types of LCZs), respectively. The summer daytime SUHI prediction models were obtained by using the step-wise multiple linear regression, with the performance of R2 of 0.697, RMSE of 1.21 °C, and the d value of 0.81 for the model of LCZs 1-5, and the values of 0.666, 1.66 °C, and 0.76 for the model of the mixed LCZ, indicating that the models can predict the changes of SUHI with LCZs to a large and satisfactory extent. This study presents a methodology to efficiently achieve a large sample of SUHI and urban design factors of LCZs in the largely urbanized cities, and provides information beneficial to the urban designs and regenerations in the humid subtropical region.

In this paper, we propose a novel network representation learning model TransPath to encode heterogeneous information networks (HINs). Traditional network representation learning models aim to learn the embeddings of a homogeneous network. TransPath is able to capture the rich semantic and structure information of a HIN via meta-paths. We take advantage of the concept of translation mechanism in knowledge graph which regards a meta-path, instead of an edge, as a translating operation from the first node to the last node. Moreover, we propose a user-guided meta-path sampling strategy which takes users' preference as a guidance, which could explore the semantics of a path more precisely, and meanwhile improve model efficiency via the avoidance of other noisy and meaningless meta-paths. We evaluate our model on two large-scale real-world datasets DBLP and YELP, and two benchmark tasks similarity search and node classification. We observe that TransPath outperforms other state-of-the-art baselines consistently and significantly.

List-only entity linking is the task of mapping ambiguous mentions in texts to target entities in a group of entity lists. Different from traditional entity linking task, which leverages rich semantic relatedness in knowledge bases to improve linking accuracy, list-only entity linking can merely take advantage of co-occurrences information in entity lists. State-of-the-art work utilizes co-occurrences information to enrich entity descriptions, which are further used to calculate local compatibility between mentions and entities to determine results. Nonetheless, entity coherence is also deemed to play an important part in entity linking, which is yet currently neglected. In this work, in addition to local compatibility, we take into account global coherence among entities. Specifically, we propose to harness co-occurrences in entity lists for mining both explicit and implicit entity relations. The relations are then integrated into an entity graph, on which Personalized PageRank is incorporated to compute entity coherence. The final results are derived by combining local mention-entity similarity and global entity coherence. The experimental studies validate the superiority of our method. Our proposal not only improves the performance of list-only entity linking, but also opens up the bridge between list-only entity linking and conventional entity linking solutions.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

Hyperspectral images (HSI) contain abundant spectral information. Efficient extraction and utilization of this information for image classification remain prominent research topics. Previously, hyperspectral classification techniques primarily relied on statistical attributes and mathematical models of spectral data. Deep learning classification techniques have recently been extensively utilized for hyperspectral data classification, yielding promising outcomes. This study proposes a deep learning approach that uses polarization feature maps for classification. Initially, the polar coordinate transformation method is employed to convert the spectral information of all pixels in the image into spectral feature maps. Subsequently, the proposed Deep Context Feature Fusion Network (DCFF-NET) is utilized to classify these feature maps. The model is validated using three open-source hyperspectral datasets: Indian Pines, Pavia University, and Salinas. The experimental results indicated that DCFF-NET achieves excellent classification performance. Experimental results on three public HSI datasets demonstrate that the proposed method accurately recognizes different objects with an overall accuracy (OA) of 86.68%, 94.73%, and 95.14% based on the pixel method, and 98.15%, 99.86%, and 99.98% based on the pixel-patch method.

Aspergillus montevidensis is an important domesticated fungus that has been applied to produce many traditional fermented foods under high osmotic conditions. However, the detailed mechanisms of tolerance to osmotic stress remain largely unknown. Here, we construct a target-deleted strain (ΔLeuRS) of A. montevidensis and found that the ΔLeuRS mutants grew slowly and suppressed the development of the cleistothecium compared to the wide-type strains (WT) under salt-stressed conditions. Furthermore, differentially expressed genes (P<0.0001) governed by LeuRS were involved in salt tolerance, ABC transporter, amino acid metabolism, sugar metabolism, and reproduction process. The ΔLeuRS strains compared to WT strains under short- and long-term salinity stress especially altered accumulation levels of metabolites, such as amino acids and derivatives, carbohydrates, organic acids, and fatty acids. The study provides new insights into the underlying mechanisms of salinity tolerance and lays a foundation for favor improvement of foods fermented with A. montevidensis.

This paper proposed emotion recognition methods for consecutive facial images, and implements the inference of neural network model on a field-programmable gate array (FPGA). The proposed emotion recognition methods are based on a neural network model architecture that combines convolution neural networks (CNNs), long short-term memory (LSTM), and fully connected neural networks (FCNNs), called CLDNN or ConvLSTM-FCN. This type of neural network mod-el can analyze the local feature sequences obtained through convolution of data, making it suita-ble for processing time-series data such as consecutive facial images. In this paper, sequences of facial images are sampled from videos corresponding to various emotional state of subjects. The sampled images are then pre-processed with the processes includes facial detection, greyscale conversion, resize, and data augmentation if necessary. The 2-D CNN in ConvLSTM-FCN is used for feature extraction for these pre-processed facial images. These sequences of facial im-age features are time sequences with dependent properties between the elements within them. The LSTM is then used to model these time sequences followed by fully connected neural net-works (FCNNs) for classification. The proposed consecutive facial emotion recognition method achieves an average recognition rate of 99.51% on RAVDESS dataset, 87.80% on BAUM-1s dataset and 96.82% on eNTERFACE’05 data set, using 10-fold cross-validation on the PC. Some com-parisons of recognition accuracies between the proposed method and the other existing related works are conducted in this paper. According to the comparisons, the proposed emotion recog-nition methods outperform the existing related researches. The proposed emotion recognition methods are then implemented on an FPGA chip using the neural network model inference algo-rithms in this paper, and the accuracies of the experiments conducted on the FPGA chip are iden-tical to those obtained on the PC. This verifies that the proposed neural network model imple-mented on the FPGA chip performs well.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Lithium batteries are widely used due to their advantages such as high energy density, stable performance, low pollution, and long recyclable life. Accurate SOC estimation is important for the use of lithium batteries. To address the problem of low accuracy of SOC estimation by traditional methods, this paper proposes a joint method of fractional order robust unscented Kalman filter (FORUKF) and robust unscented Kalman filter (RUKF) to estimate SOC. The method is based on a fractional order model (FOM) that combines the unscented transformation (UT) technique, the H∞ observer and the joint estimator. Specifically, an adaptive genetic algorithm (AGA) was first used to identify the parameters of the FOM for lithium batteries and to verify the accuracy of the model. Estimation and updating of the ohmic resistance R0 and the capacity QN in the model in real-time by RUKF and then estimation of the SOC by FORUKF. Finally, the accuracy of FORUKF-RUKF was verified under the Federal Urban Driving Schedule (FUDS), US06 Highway Driving Schedule and Beijing Dynamic Stress Test (BJDST). According to the results, the FORUKF-RUKF estimated SOC was found to have better accuracy and robustness than the RUKF, FOUKF and EKF.

Informal caregivers are essential in supporting stroke survivors' recovery, but it is unclear whether community interventions can promote healthy eating behaviors and social participation among stroke survivors and their caregivers. The Train-Your-Brain (TYB) program's impact on adherence to national dietary guidelines and social participation among informal caregivers and stroke survivors were assessed in a quasi-experimental study. The TYB program had nine sessions, with one focusing on healthy lifestyle. Participants were prompted to discuss the topics covered, leading to social participation. Dietary habits were assessed using fruits and vegetables consumption questions, while social participation was measured using the Social Impact Measurement Framework. Mann-Whitney U-test and Wilcoxon Signed Rank Test were utilized to analyze the data. Eighteen informal caregivers and 27 stroke survivors participated in the program. Results showed a significant increase in fruit and vegetable intake and social participation in informal caregivers after the program, but there were no significant changes in stroke survivors. Informal caregivers play a crucial role in stroke survivors' lifestyle habits and in encouraging social connections with other stroke survivors. Thus, healthcare professionals should prioritize caregiver support and education to facilitate long-term dietary and social changes that can positively impact stroke survivor's recovery and quality of life.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The branch prediction units (BPUs) generally have security vulnerabilities, which can be used by attackers to obtain the execution status, jump directions, and jump address of conditional branches, and the existing protection methods cannot defend against these attacks. Therefore, this article proposes a hardware security protection method for conditional branches of embedded systems. This method calculates the number of updates to the branch target buffer (BTB). When it exceeds the threshold, BTB is locked to prevent attackers from analyzing the execution status of branches based on the time difference of whether BTB is updated. Moreover, the hybrid physical unclonable function (PUF) circuit is designed to provide confidentiality protection for the jump directions, jump addresses, and their indexes, preventing attackers from stealing these critical data. If these mechanism fails and attackers successfully tamper with conditional branches, this paper proposes a control flow integrity (CFI) protection mechanism based on branch labels to timely detect tampering with instruction codes, jump addresses, and jump directions. The proposed method is implemented and tested on FPGA. The experimental results show that this method can achieve fine-grained security protection for conditional branches, with about 5.4% resource overhead and less than 5.5% performance overhead.

Acid in-situ leaching (ISL) is a common approach to the recovery of uranium in the subsurface. As some toxic and harmful substances might be produced by the chemical reactions among the injected sulphuric acid, the groundwater, and the porous media during leaching processes, the pollution control of the mining plan for ISL is important. In this study, a three-dimensional reactive transport modeling (3DRTM) was applied to decide the pollution control mining plan, considering the partial penetration through wellbore in confined aquifer and complex chemical reactions between main minerals. Based on the 3DRTM, different pumping ratio and non-uniform injection schemes were compared. The results show that the preferential pollution control mining plan is non-uniform injection ratio equal 0.1. By analyzing the characteristics of water table and streamline, it is concluded that the scheme has a strong hydraulic capture effect. In this scheme, the concentration of UO22+, H+, SO42- obtained by 3DRTM is lower. The inner well injection rate is 194.09 m3/d, the outer well injection rate is 158.89 m3/d, and the pumping rate is 264.00 m3/d. A reasonable suggestion is to adopt non-uniform injection mining mode in ISL.

In order to further reduce the emissivity of the hydrophobic low infrared emissivity composite coating and improve the mechanical properties of the coating, the dispersant, adhesion enhancer, and defoamer were used to improve the dispersion state of the fillers, the interface structure, and the surface state of the hydrogen silicone oil modified polyurethane/Al composite coating. The effects of dispersant, adhesion enhancer, and defoamer on the micro-structure, emissivity, glossiness, hydrophobic property, and mechanical properties of the coating were systematically studied. The results show that the polycarboxylate anionic dispersant can obviously improve the dispersion state of flake Al powder and nano-SiO2 in the coating, so that the infrared emissivity of the coating can be reduced, and the coating can have higher hydrophobic and mechanical properties. The bonding strength between the resin matrix and the metal substrate of the coating can be significantly improved by the adhesion enhancer through the bridging action, so that the adhesion strength and impact strength of the coating can be significantly improved. The defoamer can significantly reduce the pores in the coating, so that the surface state of the coating can be significantly improved, and the mechanical properties of the coating can be significantly improved. The coating has the best emissivity (0.527), glossiness (4.3), adhesion strength (grade 1), impact strength (40 kg.cm), and hydrophobic property (water contact angle (WCA) is 140o) when the amount of dispersant, adhesion enhancer, and defoamer is 5 wt%, 4 wt%, and 1 wt%, respectively.

This paper investigates the problem of cooperative standoff tracking using multiple fixed-wing unmanned aerial vehicles (UAVs) with control input constraints. In order to achieve accurate target tracking in the presence of unknown background wind and target motion, a coordinated standoff target tracking algorithm is proposed. The objective of the research is to steer multiple UAVs to fly a circular orbit around a moving target with prescribed intervehicle angular spacing. To achieve this goal, two control laws are proposed, including relative range regulation and space phase separation. On one hand, a heading rate control law based on Lyapunov guidance vector field is proposed. The convergence analysis show that the UAVs can asymptotically converge to a desired circular orbit around the target, regardless of their initial position and heading. Through rigorous theoretical proof, it is concluded that the command signal of the proposed heading rate controller will not violate the boundary constraint on heading rate. On the other hand, a temporal phase is introduced to represent the phase separation and avoid discontinuity of the wrapped space phase angle. On this basis, a speed controller is developed to achieve equal phase separation. The proposed airspeed controller met the requirement of airspeed constraint. In addition, to improve the robustness of the aircraft during target tracking, an estimator is developed to estimate the composition velocity of the unknown wind and target motion. The proposed estimator uses the offset vector between the UAV’s actual flight path and the desired orbit which is defined by Lyapunov guidance vector field to estimate the composition velocity. The stability of the estimator is proved. Simulations are conducted under different scenarios to demonstrate the effectiveness of the proposed cooperative standoff target tracking algorithm. The simulation results of indicate that, the temporal-phase-based speed controller can achieve fast convergence speed and small phase separation error. Additionally, the composition velocity estimator exhibits fast response speed and high estimation accuracy.

Analytical mechanics is the most basic discipline. The basic principles of analytical mechanics should also be applicable to general deformed objects. However, the virtual displacement principle proposed by analytical mechanics is only applicable to particle systems and rigid body systems, but not to general deformed objects. In this paper, the generalized virtual displacement principle of general deformed objects (such as, elastic objects, plastic objects, elasto-platic objects and flexible objects etc ) is derived by the method of analytical mechanics, which is also applicable to particle systems and rigid body systems. First of all, according to the method of analytical mechanics, the external force, internal force, constraint reaction force and elastic recovery force of the deformed object system under the equilibrium state are analyzed, and the concepts of virtual displacement, ideal constraint and virtual work are introduced, and the generalized virtual displacement principle (also called generalized virtual work principle) of deformed objects is proposed; secondly, vector form, coordinate component form and generalized coordinate form of generalized virtual displacement principle of deformed object are given; thirdly, as the application of the principle, the virtual displacement principle of deformed objects in plane polar coordinate system, space cylindrical coordinate system and spherical coordinate system is given; finally, a brief conclusion is drawn. This work unifies the virtual displacement principle of elastic object, plastic, elastoplastic etc deformed object systems and rigid object systems with the basic method of analytical mechanics. It is a basic principle for dealing with the static problems of deformed objects. This work also lays a foundation for the further study of the dynamics of deformed object systems.

Acute ischemic strokes are the third leading cause of death and the leading cause of neurological disability worldwide. The oxygen and glucose deprivation associated with ischemic strokes not only leads to neuronal cell death, but also increases the inflammatory response and decreases functional output of the brain. The only intervention approved by US Federal Drug and Food Administration for treatment of ischemic strokes is tissue plasminogen activator (tPA), however, such treatment can only be given within 4.5 hours of the onset of stroke-like symptoms. This narrow time-range limits its application, and it also might induce detrimental rather than beneficial effects to stroke patients by treatment of the tPA. In order to reduce the infarct volume of an acute ischemic stroke while increasing the time period for treatment, emerging therapies reveal great potential by targeting inflammation, growth factors, ion channels, and neurotransmitter receptors with monoclonal antibody (MAB). With successfully application in the treatment of cancer patient by MAB, in this review, we will focus on recent advances on stroke therapy by using MAB on the treatment of stroke by targeting inflammation, growth factors, ion channels, and neurotransmitter receptors. Therefore, developing specific MAB targeting the signaling pathway of stroke will contribute to stroke therapy.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

This pioneering study presents an in-depth biomechanical examination of soccer's diving header, aiming to quantify its impact on ball speed enhancement (BSE) and effective offensive range (EOR). Despite the diving header's widespread acclaim and historical significance, there remains a dearth of scientific scrutiny into its biomechanical intricacies. Employing an innovative research design featuring a static hanging ball at varied offensive distances and heights, the study replicates diverse header scenarios. The results of 3D motion quantification have shown that a physically excellent player (identified through the maximal standing long jump test) could reach an EOR around 2.64 times his body height. Furthermore, the study unveils that proficient players could attain BSE surpassing 9 m/s, signifying the diving header's heightened efficacy compared to traditional heading techniques, which could only result in 4.5 m/s. Correlation analyses unveil noteworthy relationships, highlighting the pivotal role of head speed at impact and the influence of minimizing speed-drop and temporal disparities for amplified effectiveness. Considerations for optimizing diving header execution are introduced, emphasizing the necessity for targeted training programs. Despite acknowledged limitations inherent to its pilot nature, this exploration furnishes foundational knowledge to guide subsequent research and practical applications, providing valuable insights into soccer training and skill development through a biomechanical lens.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Segmental bone defects caused by trauma, infection, tumor resection or osteoporotic fractures present significant surgical treatment challenges. Host bone autograft is considered the gold standard to restore function but comes with the cost of harvest site comorbidity. Allograft bone is a secondary option but has its own limitations in incorporation with host bone as well as cost. Therefore, developing new bone tissue engineering strategies to treat bone defects is critically needed. In the past three decades, the use of stem cells delivered with different scaffolds or growth factors for bone tissue engineering has made tremendous progress. Many varieties of stem cells have been isolated from different tissues for use in bone tissue engineering. This review summarizes the progress in using different postnatal stem cells including bone marrow mesenchymal stem cells, muscle-derived stem cells, adipose-derived stem cells, dental pulp stem cells/periodontal ligament stem cells, periosteum stem cells, umbilical cord-derived stem cells, peripheral blood stem cells and urine-derived stem cells for bone tissue engineering and repair. This review also summarizes the progress using exosomes or extracellular vesicles delivered with various scaffolds for bone repair. The advantages and disadvantages of each type of stem cell are also discussed and explained in detail. It is hopeful in the future that these preclinical results will translate into new therapies for bone defect repair.

Objective: To explore the inflammatory markers for the development of obliterative bronchiolitis (OB) after adenovirus infection in children. Methods: In this retrospective study, the medical data of 62 children with adenovirus pneumonia treated in our hospital between February 2020 and November 2021 were collected and assigned to an OB group (n = 30) or non-OB group (n = 32) according to the presence of OB. Clinical characteristics of patients included gender, age, prematurity, underlying disease, length of hospitalization, type of adenovirus infection, ventilator use, length of ventilator use, and laboratory index levels. Results: Children with OB were associated with higher serum ferritin levels versus those without (P < 0.05). There were no significant differences in the immunoglobulin E (IgE), interleukin-6 (IL-6), partial arterial pressure of oxygen (PaO₂), D-dimer, lactate dehydrogenase (LDH), and lymphocyte absolute values between the two groups of children (P > 0.05). Logistic multifactorial regression analysis revealed that the length of ventilator use and serum ferritin level were inflammatory markers for the development of OB in children with adenovirus pneumonia. Conclusion: The length of ventilator use and serum ferritin levels are inflammatory markers for the development of OB after adenovirus infection in children, and timely measurement of the above indicators in children is instrumental in predicting the prognosis of children.

Due to the highly nonlinear, multi-stage, and strongly time-varying marine lysozyme fermentation process, it is difficult to assure the stability and prediction accuracy of the traditional single global soft sensor model on a global scale. This study innovatively proposed a soft sensor model based on an improved seagull optimization algorithm (ISOA) combined with Gaussian process regression (GPR) weighted ensemble learning. First, the sample data set is divided into multiple local sample subsets by the improved density peak clustering algorithm (ADPC). Second, the Gaussian process regression model is optimally altered with an improved seagull optimization algorithm for the purpose of establishing the corresponding sub-prediction model. Finally, the prediction model's fusion strategy is ultimately determined depending on the degree of connection between the test samples and a subset of local pieces. Simulation results show that the proposed soft sensor model, which searches GPR based on ISOA and combines various sub-models, can predict the key biochemical parameters of the marine lysozyme fermentation process better with less prediction error under the condition of fewer training data, and it can be expanded to the soft sensor models of general nonlinear systems, according to simulation results.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

The three-dimensional morphology of frictional sub-surfaces holds significant importance for studying tribological issues. However, the uniformity of horizontal datum in 3D scanning is limited for curved surfaces, resulting in the inability to obtain accurate contour characterization parameters from the scanning results. This study aims to address this issue by constructing regular surface equations and normalizing the 3D profiler scanning results. By fitting the data, a "plane" surface representative of the surface features is obtained, and the paper demonstrates this approach on the surface morphology of different worn parts in the frictional area of spherical bearings located in the specific environment of the Three Gorges gate. The results indicate that the obtained "plane" effectively reconstructs the three-dimensional morphology map of the regular surface. Moreover, this reconstructed plane not only clearly illustrates the surface characteristics but also provides the foundation for analyzing the wear mechanism.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.