The end of 2019 marked a bushfire crisis for Australia that affected more than 100000km2 of land and destroyed more than 2000 houses. Here, we propose a method of in-orbit bushfire detection with high efficiency to prevent a repetition of this disaster. An LEO satellite constellation is first developed through NSGA-II (Nondominated Sorting Genetic Algorithm II), optimising for coverage over Australia. Then edge computing is adopted to run a bushfire detection algorithm using several constellation satellites as edge nodes to reduce fire detection time. A geostationary satellite is used for inter-satellite communications, such that an image taken by a satellite can be distributed among several satellites for processing. The geostationary satellite also maintains a constant link to the ground, so that a bushfire detection can be reported back without any significant delay. Overall, this system is able to detect fires that span more than 5m in length, and can make detections in 1.39s per image processed. This is faster than any currently available bushfire detection method.

In this paper, firstly, some questionable formulas and conceptual oversights of previous reduced sigma set unscented transformation (UT) methods are revised through theoretical analysis. Then the revised UT methods based Kalman filters are used in a GPS/INS tightly-coupled system. The Kalman filter flows are the kind of square-root, since the square-root unscented Kalman filters (SRUKFs) can guarantee the stability of the system. By using the reduced sigma set SRUKFs (which contain simplex sigma set square-root unscented Kalman filter (S-SRUKF), spherical simplex sigma set square-root unscented Kalman filter (SS-SRUKF) and minimum sigma set square-root unscented Kalman filter (M-SRUKF)), the computation cost is greatly saved compared with the standard SRUKF, while the accuracy of the GPS/INS tightly-coupled system still maintained. The structure of the GPS/INS tightly-coupled system is in the form of error state, and the time updates of the state and the state covariance of SRUKFs are directly estimated without using UT, thus the computational time is also greatly saved. The pseudo-satellite is introduced to aid the system when the observation information is deficient, for example, when the GPS signal is deficient in the maneuver environment. By using the pseudo-satellite, the optimal performance of the system is guaranteed. Experiment of unmanned aerial vehicle (UAV) showed that the pseudo-satellite aided mechanism worked well.

M87 is the best available source for studying the AGN jet-launching region. To enrich our knowledge of this region, with quasi-simultaneous observations using VLBA at 22, 43 and 86~GHz, we capture the images of the radio jet in M87 on a scale within several thousand R_s. Based on the images, we analyze the transverse jet structure and obtain the spectral-index distribution in the jet. We find that the absorption is enhanced at the collimation regions and the interruption of the jet. The external medium, which may not be uniform, may have contributed a lot to the absorption in the jet-launching region. Additionally, the temporal morphology of the jet in its launching region may be largely affected by the local, short-lived kink instability growing in itself.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

Dayaoshan, as an important metal ore producing area in China, is faced with the dilemma of resource depletion due to long-term exploitation. In this paper, remote sensing method is used to circle the favorable metallogenic areas and find new ore points for Gulong. Firstly, vegetation interference bas been removed by using mixed pixel decomposition method with hyperplane and genetic algorithm (GA) optimization; then, altered mineral distribution information has been extracted based on principal component analysis (PCA) and support vector machine (SVM) method; Thirdly, the favorable areas of gold mining in Gulong has been delineated by using ant colony algorithm (ACA) optimization SVM model to remove false altered minerals; Lastly, field survey verified that the extracted alteration mineralization information is correct and effective. The results show that the mineral alteration extraction method proposed in this paper has certain guiding significance for metallogenic prediction by remote sensing.

Consensus algorithms are the core technology of blockchain and a focus in the current distributed system research. The consensus algorithms are widely used in distributed systems, it has solved the decentralization problem. The traditional consensus algorithm needs the process of node legitimacy checking, identity authentication, and primary node view change, so the time cost of reaching an agreement between nodes is still exponential. In response to the problem, a lightweight consensus algorithm based on graph (LCAG) is proposed for the Internet of Things (IoT) in this paper, which is proposes an access control table, and reaches an agreement among nodes by calculating the probability of nodes in the control table, and reduces the time overhead of the reaching an agreement in distributed systems. We have carried out simulation experiments for the new algorithm, and the experiments show that: the new algorithm needs less time overhead than the classical Byzantine algorithm need, as well as Byzantine Generals problem (BGP), practical Byzantine fault-tolerant algorithm (PBFT) and directed acyclic graph (DAG) algorithm, and so on. The new algorithm can be applied to the devices of IoT, which have limited computing power.

Highly efficient, broadband and distinctively structured electromagnetic wave (EMW) absorption materials exhibit huge exceptions with multi-functions in both military and civilian fields. Searching the relationship between structural and EMW performance is beneficial to develop outstanding microwave absorption materials, and has become an attractive research topic. In this study, we briefly reviewed the different EMW absorption mechanisms and key influence factors, then, present the latest developments in low-dimensional (LD) EMW absorption materials. We provide a comprehensive discussion of remarkable examples and summarize the main information related to the structure-function relationship of dimensional design and structural engineering in order to facilitate the rapid evolution of this fascinating field.

Pathological Brain Detection (PBD) is a crucial field aimed at identifying and diagnosing structural or functional abnormalities in the brain related to neurological, neurodegenerative, or psychiatric disorders. This detection process typically employs medical imaging technologies such as MRI, CT, or PET scans, along with neurological evaluations, blood tests, and other diagnostic tools. Early detection is essential for effective treatment, improving prognosis, and enhancing the quality of life for affected individuals. Each common computational method provides unique insights into brain pathologies. Despite significant advancements in technology and methodology, PBD faces challenges such as variability in brain anatomy, the complexity of disorders, data quality, standardization issues, interpretability of models, and ethical concerns. Addressing these challenges necessitates collaboration among researchers, clinicians, and policymakers to develop robust and ethical methods for improving the detection and diagnosis of brain disorders.

This research investigates the complex transformation of the Baltic Clean and Dirty Tankers markets from 1998 to 2023. Our study quantifies the market multifractality in two distinct periods, from 1998 to 2010 and 2010 to 2023. We compare multifractal measures of the original, surrogated, and shuffled data, which indicate high multifractality and a complex market structure influenced by temporal organization and inherent volatility. Shuffled data analysis emphasizes the critical role of temporal sequences within market behaviour. Additionally, the study delves into external factors such as regulatory changes, economic disturbances, technological innovation, and environmental concerns contributing to market complexity. A distinct shift in multifractal values between the two periods suggests an evolution from crisis-induced complexities to a market influenced by diversified and modern dynamics. Our findings offer a concise understanding of the multifractal nature of the tanker markets and how global crises can impact the markets, emphasizing the importance of considering systemic risks in freight market analysis.

Abstract: (1) Background: Cancer immune escape is associated with the metabolic reprogramming of TME, and combining metabolic targets with immunotherapy has great potential to improve clinical outcomes. Among all metabolic processes, lipid metabolism, especially fatty acid (FA) metabolism, has a huge role in cancer cell survival, migration, and proliferation, but its mechanism and role in the tumor immune microenvironment remain to be investigated. (2) Methods: We comprehensively analyzed 309 fatty acid-related genes, screened 121 different genes, and used one-way COX regression to select 15 genes with prognostic impact. Systematically evaluated the correlation between FMGs modification patterns and Tumor Microenvironment Infiltration, prognosis, and Immunotherapy. The FMGs-Score was constructed to quantify the FMGs modification patterns using principal component analysis. (3) Results: Three clusters based on FMGs-related genes were demonstrated in breast cancer, with three patterns of distinct immune cell infiltration and biological behavior. An FMGsScore signature was constructed to reveal that patients with a low FMGsScore had higher immune checkpoint expression, higher immune checkpoint inhibitor (ICI) scores, increased immune microenvironment infiltration, better survival advantage, and were more sensitive to immunotherapy than those with a high FMGsScore. Finally, the expression and function of the signature key gene NDUFAB1 were examined by in vitro experiments. (4) Conclusions: This study significantly demonstrates the non-negligible role of FMGs in the immune microenvironment of breast cancer, and that FMGsScores can be used to guide the prediction of immunotherapy in breast cancer patients. In in vitro experiments, knockdown of the NDUFAB1 gene resulted in reduced proliferation and migration of MCF-7 cell lines.

To investigate the effect of montmorillonite on nonylphenol enrichment in a zebrafish model. The AB strain zebrafish were used as the animal subjects and three concentration gradients were set for both nonylphenol and montmorillonite, according to their actual concentrations in aquaculture water in Huzhou city. A group treated with nonylphenol alone was also set, adding up to 12 experimental groups. Concentrations of nonylphenol enriched in the liver, muscle, and gill of zebrafish were detected by solid phase microextraction–high performance liquid chromatography at Day 7, 15, and 30, respectively. Besides, the relative enzymatic activity of Superoxide dismutase (SOD) and the Glutathione S-transferase (GST) were also been detected, and the data were statistically analyzed. The results showed that the concentrations of nonylphenol in zebrafish peaked at Day 7 and gradually decreased afterwards for all the experimental groups. And the montmorillonite reduces short-term accumulation of nonylphenol in gills, and the high concentration of nonylphenol facilitates its enrichment in liver and muscle while the low concentration of nonylphenol doesn’t. Meanwhile, the low concentration of nonylphenol in liver exerts an influence on the inductive effect of SOD and GST while the high concentration of nonylphenol shows the inhibiting effect of SOD and GST.

This paper presents a study to accurately evaluate defects in reinforced concrete decks using ultrasonic pulse-echo signals. Two validation specimens were designed and tested where reinforced concrete deck slab specimens included planned voids and defects. A commercial Ultrasonic Pulse-Echo (UPE) device obtains 2-D images of the void/defect locations of the reinforced concrete deck. The UPE is based on the ultrasonic shear-wave test method using dry-point-contact transmitting and receiving transducers and employing a synthetic aperture focusing technique. The authors analyzed the recorded UPE A-scan data to enhance the accuracy of estimating the defects' locations using the synthetic aperture focusing technique imaging method. The analysis benefitted from an advanced denoising approach and defect echo peak extraction based on empirical modal decomposition, Hurst exponent characterization, and Hilbert envelope estimation. While output from conventional UPC devices can only provide qualitative results, the new method provides quantitative information on the anomalies inside the reinforced concrete deck. The developed approach accurately assists with assessing the location and depth of the voids/defects in the reinforced concrete deck slabs.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

To realize the energy recovery of wheat straw, the pyrolysis behavior of wheat straw was studied at three heating rates (10, 20, and 30 K/min) based on thermogravimetric analysis (TG–DTG). Kinetics and thermodynamics were analyzed using Flynn–Wall–Ozawa (FWO) and Kissinger–Akahira–Sunose (KAS) model-free methods, and reaction mechanism was determined using Coats–Redfern (CR) model-fitting method. The results show that there are three weightlessness stages in the pyrolysis process, of which the second stage was the main weightlessness stage and two distinct peaks of weightlessness were observed in this stage. With increasing heating rate, the main pyrolytic weightlessness peaks of DTG curve shifts to higher temperature. The pyrolysis activation energy calculated by FWO and KAS methods are 165.17–440.02 kJ/mol and 163.72–452.07 kJ/mol, and the pre-exponential factor vary in the range of 2.58×1012–7.45×1036 s-1 and 1.91×1012–8.66×1037 s-1, respectively. The thermodynamic parameters indicates that wheat straw has the favorable conditions for product formation and containes potential energy to be utilized for bioenergy production, its pyrolysis reaction was non-spontaneous and the energy output is stable. CR method analysis shows that the A1/3 random nucleation model is the most suitable mechanism to characterize the pyrolysis process, and random nucleation may be in charge of the main pyrolysis stage. This study can provide a theoretical basis for the thermochemical conversion and utilization of wheat straw.

Traditional graphene-based films normally possess high thermal conductivity (TC) only along single direction, which is not suitable for thermal interface materials (TIMs). Here, a graphene film with excellent bidirectional TC and mechanical properties was prepared by hot-pressing super-elastic graphene aerogel (SEGA). Thermal annealing at 1800℃ improves the further restacking of graphene sheets, bring the SEGA high structure stability for enduring the hot-pressing process. The junctions and nodes between the graphene layers in the hot-pressed SEGA (HPSEGA) film provide bidirectional heat transport paths. The in-plane TC and through-plane TC of HPSEGA film with thickness of 101μm reach 740 Wm-1K-1 and 42.5 Wm-1K-1, respectively. In addition, HPSEGA film with higher thickness still maintains excellent thermal transport properties due to the interconnected structure reducing the effect of the defects. The infrared thermal images visually manifest the excellent thermal-transfer capability and thermal dissipation efficiency of the HPSEGA films, indicating the great potential as advanced bidirectional TIMs.

Ship wave is of great interest for wave drag, coastal erosion and ship detection. In this paper, a highly-paralleled numerical scheme is proposed for simulating three-dimensional (3-D) nonlinear Kelvin ship waves effectively. First, a numerical model for nonlinear ship waves is established based on potential flow theory, boundary integral method and Jacobian-free Newton-Krylov (JFNK) method. In order to improve computational efficiency and reduce data storage of JFNK method, a banded preconditioner method is then developed by formulating the optimal bandwidth selection rule. After that, a Graphics Process Unit (GPU) based parallel computing framework is designed, and a GPU solver is developed by using Compute Unified Device Architecture (CUDA) language. Finally, numerical simulations of 3-D nonlinear ship waves under multiple scales are performed by using the GPU and CPU solvers. Simulation results show that the proposed GPU solver is more efficient than the CPU solver with the same accuracy. More than 66% GPU memory can be saved and the computational speed can be accelerated up to 20 times. Hence, the computation time for Kelvin ship waves simulation can be significantly reduced by applying the GPU parallel numerical scheme, which lays a solid foundation for practical ocean engineering.

The phosphogypsum (PG) pile of solid waste is of immense proportions and poses a grave threat to the ecological environment, with its reserves steadily increasing year after year. The urgent need for large-scale consumption and high-quality utilization of PG in industrial production has become apparent. The present study provides a comprehensive analysis of the correlation be-tween the macroscopic mechanical properties and microstructure of PG, elucidating the crystal morphology characteristics in different phases and outlining the crystallization preparation pro-cess. By integrating the physical and chemical properties of diverse PG phases with the intricacies associated with its preparation process, it is imperative to explore avenues for its high-value utili-zation, investigate possibilities for industrial-scale production, and analyze and predict the appli-cation trends and developmental directions in comprehensive PG utilization. These endeavors hold immense significance in guiding the realization of resource utilization potential inherent in PG.

In order to solve the problem of environmental pollution caused by a large number of discarded hickory husks in Lin'an, and to make them a clean energy source that can be recycled, in this paper,using crushed hickory husks as raw material, single factor test was carried out on a hydraulic plunger forming machine with different moisture content and length-diameter ratio of forming sleeve.The change of axial pressure and radial force in the forming sleeve is measured by the sensor, and the microstructure of the biomass moulding fuel briquette was observed by stereomicroscope. The results showed that the hickory husks could be compressed and formed at room temperature. When the moisture content of the hickory husks is 14% and the length-diameter ratio of the forming sleeve is 4.5, the forming quality is the best, and the relaxation density of the formed briquette is up to 0.98g /cm3. When the moisture` content is the same, the forming pressure increases with the increase of the length-diameter ratio of the forming sleeve. When the length-diameter ratio of molding sleeve is the same, the molding pressure increases first and then decreases with the increase of water content.

Address parsing is a crucial task in natural language processing, particularly for Chinese addresses. The complex structure and semantic features of Chinese addresses present challenges due to their inherent ambiguity. Additionally, different task scenarios require varying levels of granularity in address components, further complicating the parsing process. To address these challenges and adapt to low-resource environments, we propose CapICL, a novel Chinese address parsing model based on the In-Context Learning (ICL) framework. CapICL leverages a sequence generator, regular expression matching, BERT semantic similarity computation, and GPT modeling to enhance parsing accuracy by incorporating contextual information. We construct the sequence generator using a small annotated dataset, capturing distribution patterns and boundary features of address types to model address structure and semantics, mitigating interference from unnecessary variations. We introduce the REB-KNN algorithm, which selects similar samples for ICL-based parsing using regular expression matching and BERT semantic similarity computation. The selected samples, raw text, and explanatory text are combined to form prompts, and inputted into the GPT model for prediction and address parsing. Experimental results demonstrate significant achievements of CapICL in low-resource environments, reducing dependency on annotated data and computational resources. Our model's effectiveness, adaptability, and broad application potential are validated, showcasing its positive impact in natural language processing and geographical information systems.

Near-surface humidity (Qa) is a key parameter that modulates oceanic evaporation and influences the global water cycle. Remote sensing observations act as feasible sources for long-term and large-scale Qa monitoring. However, existing satellite Qa retrieval models are subject to apparent uncertainties due to model errors and insufficient training data. Based on in situ observations collected over the China Seas over the last two decades, a deep learning approach named Ensemble Mean of Target deep neural networks (EMTnet) was proposed to improve the satellite Qa retrieval over the China Seas for the first time. The EMTnet model outperforms five representative existing models by nearly eliminating the mean bias and significantly reducing the root-mean-square error in satellite Qa retrieval. According to its target deep neural networks selection process, the EMTnet model can obtain more objective learning results when the observational data are divergent. The EMTnet model was subsequently applied to produce a 30-year monthly gridded Qa data over the China Seas. It indicates that the climbing rate of Qa over the China Seas under the background of global warming are probably underestimated by current products.

The two-phase flow of water and reactive gas in the channel of proton exchange membrane fuel cell (PEMFC) plays an important role in high-quality water management. In this study, the removal effect of 3D wave channel and 2D straight channel for liquid water was studied by volume of fluid method. The dynamic behavior of droplet emerge from the gas diffusion layer (GDL) into the channel under the influence of gas flow was investigated. The effects of droplet growth, deformation, detachment, force, pore size on water critical behavior and water content in the channel are discussed. The results show that the 3D wave channel is superior to the removal of liquid water than the 2D straight channel. The increase of velocity is conducive to the discharge liquid water. While infinite increase of velocity will cause more parasitic power loss. The larger pore size of GDL is not advantageous to the performance of PEMFC, but the appropriate increase of pore size is conducive to the discharge of liquid water. The basic knowledge obtained in this study will help to deepen the understanding of droplet dynamics in PEMFC gas channels, and help to optimize the design and working conditions of these channels.

In order to improve the strength of PVA/xylan composite films and endow them with ultraviolet (UV) shielding ability, TiO2-KH550 nanoparticle was synthesized and added into the PVA/xylan matrix. The TiO2-KH550 nanoparticle dispersed well in the 0.04% sodium hexametaphosphate (SHMP) solution under ultrasonic and stirring treatments. Investigations on the properties of films showed that TiO2-KH550 had the positive impact on improving the strength, moisture and oxygen barrier properties of the composite films. The maximum tensile strength (27.3 MPa), the minimum water vapor permeability (2.75×10-11 g•m-1•s-1•Pa-1) and oxygen permeability (4.013 cm3•m-2•24h-1•0.1MPa-1) were obtained under the addition of 1.5% TiO2-KH550. The tensile strength of TiO2-KH550 reinforced composite film was increased by 70% than that of the pure PVA/xylan composite film, and the water vapor and oxygen permeability were decreased by 31% and 41%, respectively. Moreover, the UV transmittance of film at the wavelength of 400 nm was almost zero when adding 1.5~2.5% of TiO2-KH550, which indicated the PVA/xylan composite films were endowed with excellent UV light shielding ability.

Background: We assess locoregional drug targeting effectiveness of intraoperative (IO) cryoprobe-assisted injection of blue dye (BD) and cytotoxic-tracer mixture (TTM), in VX2 tumor model, and its translational value to cryo-assisted breast tumor surgery with BD alone. Methods: Under computed tomography (CT) guidance, we injected two ml TTM in five aliquots in the margin of 16 frozen or normothermic VX2 tumors. We evaluated the IO and post-operative drug targeting and therapeutic efficacy in tumor-host interface (T-HI) by CT, gross examination, and histopathology. In twenty-six T1 to T4 primary breast cancer (BRCA) we performed ultrasound-guided (US) cryoprobe-assisted tumor freezing, BD guided lymphatic mapping, and surgery. We evaluated, IO and in freshly resected specimen, BD distribution pattern in T-HI, lymph node(s), breast parenchyma, and resection cavity. Results: Fluids-impervious frozen VX2 or breast tumor transported drug(s) an arc-like pattern at T-HI regardless of freeze dose, number of freeze-thaw cycles, drug dose fractionation, tumor characteristics or dimensions. During melting, TTM spread within fifty percent VX2 tumor mirrored that of T-HI; it was massive in normothermia. In VX2 twenty percent focal margin necrosis at pathology coincided with CT gap; in both studies, BD dose-staining spread in T-HI and tumor was linear. Eighty-four patients had one to twelve stained axillary lymph nodes; sixty-nine percent and all respectively, had another quadrant and resection cavity stained. Conclusion: Intraoperative freezing-assisted drug delivery and targeting techniques during cryoablation of VX2 tumor translate successfully to locoregional BD targeting, lymphatic mapping during cryo-assisted surgery of breast cancer.

Fermented bamboo shoots are a distinctive ingredient in Southern cuisine. In this study, headspace solid-phase microextraction (HS-SPME) combined with gas chromatography-mass spectrometry (GC-MS), and 16S rRNA high-throughput sequencing technology (HTS) were employed to investigate the relationship among physicochemical properties, characteristic volatile compounds, and core microbial communities. The results show that the chewiness, fracturability, hardness, and pH decreased, while total acidity increased during 60d-fermentation. The contents of reducing sugar and nitrite reached the peak on the 14th day of fermentation and then decreased. A total of 80 volatile compounds were detected during sour bamboo shoot fermentation, with 2,4-Di-tert-butylphenol having the highest concentration. Among them, 12 volatile compounds (VIP ≥ 1) were identified as characteristic aroma substances of sour bamboo shoots. The dominant bacterial phyla in sour bamboo shoots were Firmicutes and Proteobacteria, while Bacillus and Acinetobacter were the dominant genus. Correlation analysis showed that Firmicutes positive correlation with 3,6-Nonadien-1-ol, (E,Z)-, Oxalic acid, isobutyl hexyl ester ,(-)-O-Acetylmalic anhydride, TA Bacillus was negative correlation with Silanediol, dimethyl-, and Oxime-, methoxy-phenyl-. This study provides a theoretical basis for screening flavor-enhancing microorganisms as fermentation agents in sour bamboo shoots, which can contribute to the improvement of their quality.

The synchronous generator, as the main component of power systems, plays a key role in these system’s stability. Therefore, utilizing the most effective control strategy for modeling and control the synchronous generator results in the best outcomes in power systems’ performances. The advantage of using a powerful controller is to have the synchronous generator modeled and controlled as well as its main task i.e. stabilizing power systems. Since the synchronous generator is known as a complicated nonlinear system, modeling and control of it is a difficult task. This paper presents a sum of squares (SOS) approach to modeling and control the synchronous generator using polynomial fuzzy systems. This method as an efficacious control strategy has numerous superiorities to the well-known T–S fuzzy controller, due to the control framework is a polynomial fuzzy model, which is more general and effectual than the well-known T–S fuzzy model. In this case, a polynomial Lyapunov function is used for analyzing the stability of the polynomial fuzzy system. Then, the number of rules in a polynomial fuzzy model is less than in a T-S fuzzy model. Besides, derived stability conditions are represented in terms of the SOS approach, which can be numerically solved via the recently developed SOSTOOLS. This approach avoids the difficulty of solving LMI (Linear Matrix Inequality). The Effectiveness of the proposed control strategy is verified by using the third-part Matlab toolbox, SOSTOOLS.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

The location and number data of individual fruit trees are critical for planting area investigation, fruit yield prediction, and smart orchard management and planning. These data are conventionally obtained through manual investigation and statistics with time-consuming and laborious effort. Object detection models in deep learning used widely in computer vision could provide an opportunity for accurate detection of individual fruit trees, which is essential for rapidly obtaining the data and reducing human operations errors. This study proposes an approach to detecting individual fruit trees and mapping their spatial distribution by integrating deep learning with unmanned aerial vehicle (UAV) remote sensing. UAV remote sensing collected high-resolution true-color images of fruit trees in the experimental pomelo tree orchards in Meizhou city, South China. An image dataset of deep learning samples of individual pomelo trees (IPTs) was constructed through visual interpretation and field investigation based on the fruit tree images captured by UAV remote sensing. Four different scales of YOLOv5 (YOLOv5s, YOLOv5m, YOLOv5l, and YOLOv5x) for object detection were selected to train, validate, and test on the image dataset of pomelo trees. The results show that the average precision ([email protected]) of the four YOLOv5 models for validation reach 87.8%, 88.5%, 89.1%, and 90.7%, respectively. The larger the model scale, the higher the average accuracy of the detection result of validation. It suggests that YOLOv5x is a preferred high-accuracy model among the YOLOv5 family and is suitable to realize the detection of IPTs. The number of the IPTs in the study area was counted using YOLOv5x, and their spatial distribution map was made using the non-maximum suppression method and ArcGIS software. This study will provide primary data and technical support for smart orchard management in Meizhou city and other fruit-producing areas.

Through analysis of the constituent components of the observation data from 12 geoe-lectric field stations located approximately 600 km form the epicenter of the Jishishan Ms6.2 earthquake, this study reveals that during earthquake preparation and occurrence, the geoelec-tric field at each station exhibit non-uniform variations. These variations are characterized by significant decreases or increases in correlation coefficients between different azimuths (δxy) and between long and short polar distances within the same azimuth (δxx). Additionally, there are discrete or extruding changes observed in the dominant azimuth angles of the telluric field at the stations, ranging approximately from 40° to 90°. These anomalies indicate local site effects and exhibit quasi-synchronous temporal characteristics. The study found that stations located in regions with intense tectonic activities, such as Menyuan and Jingtai, experience more significant anomalous changes influenced by the tectonic activities of the Qaidam-Qilian Mountain block. When multiple stations with anomalous changes are used to determine the earthquake epicenter, earthquakes often occur within or near the intersection area of the predicted ranges of these sta-tions. The specific time of earthquake occurrence shows no clear relationship with the locations or tectonic activities of the stations.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

The mutton quality of Chinese Tan lambs (Ovis aries) has declined as feeding patterns have shifted from pasturing to pen rationing. Mutton quality is affected by fatty acids, and rumen microorganisms play a role in the synthesis of short-chain fatty acids, long-chain fatty acids, and conjugated linoleic acids. We used 16S rDNA sequencing to analyze the effects of two feeding patterns on the rumen bacteria of Tan lambs. In a randomized block design with 24 newborn Tan lambs, 12 lambs were fed by ewes in pasture and 12 were fed by pen-fed ewes. At 2 months, the biceps femoris and the longissimus dorsi were analyzed by gas chromatography for intramuscular fat content and fatty acid composition, and DNA in the rumen contents was extracted and used to analyze the structure of the bacterial community. Different feeding patterns had no significant effect on the intramuscular fat content of the biceps femoris and longissimus dorsi of the lambs, but there was a significant effect on fatty acid composition. Rumen bacteria were significantly more diverse in the pasture group than in the pen-ration group (P < 0.01). Twenty-one phyla were identified in the pasture group, and 14 phyla were identified in the pen-ration group. The dominant phyla in the pasture group were Bacteroidetes and Fibrobacteres; the dominant phyla in the pen-ration group were Proteobacteria and Bacteroidetes. The relative abundance of Proteobacteria was significantly higher in the pen-ration group than in the pasture group (P < 0.01). Diversity at the genus level was also higher in the pasture group, with 176 genera in the pasture group and 113 genera in the pen-ration group. The dominant genera in the pasture group were Prevotella_1, Rikenellaceae_RC9_gut_group, and Bacteroidales_BS11_gut_group_Na; the dominant genera in the pen-ration group were Prevotella_1, Prevotella_7, Succinivibrionaceae_UCG-001, and Succinivibrionaceae_NA.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

Magnesium ions play an important immune-regulatory role during bone repair. For this study, we prepared micro-nano bioactive glass containing magnesium, which can release magnesium, silicon, and calcium ions and has a positive impact on osteogenic differentiation and vascular regeneration. In this study, MgMNBG was compounded and combined with PLGA and PCL for 3D printing. Afterwards, the physicochemical properties and bone repair performance of the scaffolds were evaluated through in vitro and in vivo experiments. We also investigated the effects of MgMNBG on osteogenic differentiation, immune regulation, and vascular regeneration. The results showed that MgMNBG can inhibit inflammation and promote osteogenesis and angiogenesis by regulating macrophages. PLGA/PCL/MgMNBG scaffolds have good osteogenic and angiogenic effects, and the composite scaffolds have excellent bone repair performance and potential application value.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Soil aggregates, as the basic component of soil, make great contributions to the stability of soil structure and soil carbon (C) sequestration. Recently, grassland is experiencing continuous grazing, which greatly affects soil aggregation and soil C storage. However, how soil aggregates and soil C in different grassland respond to grazing remain unclear. In this study, three national fenced grassland monitoring field stations which represented mountain meadow (MM), temperate steppe (TS), temperate steppe desert (TSD) were selected, soil samples at 0–10 cm depth of inside and outside the fence were collected to explore the effect of grazing and grassland type on composition, stability and nutrients of soil aggregates. The results showed that the bulk soil organic carbon (SOC), total nitrogen (TN), total phosphorus (TP), available nitrogen (AN) and available phosphorus (AP) varied greatly among the three grassland types, with the highest values in MM. Soil aggregates composition showed significantly response to both grassland type and grazing, especially the proportion of soil aggregates &gt;2 mm, which significantly decreased 51.68% on average in grazing plots compared with fenced plots, whereas sharply decreased in MM and TSD. A significant decrease (on average 25.08%) of the mean weight diameter (MWD) of soil aggregates under grazing was detected across all grassland types. The effect of grazing on nutrients in macroaggregates (&gt;0.25 mm) was greater than that in microaggregates (&lt;0.25 mm). Aggregate-associated SOC concentration decreased under grazing in MM and TSD, however, SOC density showed different response to grazing across all grassland types, with minor effect on MM, decreasing SOC density in TS and increasing on TSD, respectively. The magnitude of grazing effect size on aggregate-associated SOC varied in different soil particle size, with greater response in aggregates &gt; 2 mm and the biggest value in TDS. In addition, correlation analysis showed that MWD of soil aggregates had significant negative correlation with soil bulk density, but significant positive correlation with SOC, TN and TP concentration. Results of RDA showed that BD, soil nutrients were the main influence factors of the composition and stability of aggregates. Overall, grazing had significant influence on soil aggregation, stability and SOC, played a crucial role in grassland soil stability and the accumulation of SOC.

In recent years, how to combine intelligent prospecting algorithms such as random forest with a large number of geological and mineral data for quantitative prediction of exploration geochemistry has become an important topic of concern to quantitatively improve the accuracy of target delineation. The ore-forming geological conditions in the central Kunlun area of Xinjiang are great and have good prospecting prospects. However, due to the exhaustion of shallow deposits and the lag of geological prospecting work in the past ten years, there has been no expected breakthrough in the search for large and super-large metal deposits for many years. There has been a serious shortage of reserve resources. The use of new theories, new methods and new technologies for mineral resources investigation and evaluation has become an urgent need in the current prospecting work. In view of this, based on the existing spatial database of geological and mineral resources in the central Kunlun of Xinjiang, combined with the geological characteristics, genesis and metallogenic regularity of the area, this paper carried out a series of studies on gold polymetallic minerals with the help of geographic information system and data science programming software platform. The researchers integrated geological and regional geochemical data, and constructed a random forest metallogenic discriminant model based on two different sampling methods (integrated random undersampling and selection of training samples) to predict the mineralization of gold polymetallic minerals in the central Kunlun area of Xinjiang and delineate the metallogenic target area. The quantitative prediction of gold polymetallic mineral resources in the central Kunlun area of Xinjiang by two random forest models is compared and discussed: the known ore spots, fault structures and geochemical information are extracted, and the known gold polymetallic ore spots and geochemical data are used to form a training set and a prediction set to construct a machine learning random forest model. The results of prediction evaluation and metallogenic prospect division show that for different sampling methods, the performance evaluation parameters of the training process show that the prediction accuracy of the selected training samples is higher, and the selected training samples are more reliable because they can fully learn the complex information of the original data. In the metallogenic prospect prediction and metallogenic potential division, the random forest model of selecting training samples has more reference value and further exploration research significance in the production problem considering the actual exploration cost because of its small area of high potential prediction area and high proportion of ore bearing per unit area. At the same time, this study innovatively improves the prediction accuracy, reduces the exploration risk, and expands the prospecting idea of machine learning algorithm in mathematical geology in the central Kunlun area of Xinjiang. The delineated metallogenic potential area has positive guiding significance for the actual gold polymetallic prospecting work in this area.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

This paper systematically discusses the application of reinforcement learning in automatic driving system. Reinforcement learning frameworks show significant advantages in optimizing decision making, predictive perception, path planning, and controller design, exceeding the limitations of traditional supervised learning methods. The paper highlights the critical role of components such as scene understanding, positioning, and map making in autonomous driving systems, which provide reliable environmental awareness through deep learning and sensor fusion technologies to support intelligent decision-making in complex urban environments. In addition, the paper discusses innovative approaches to safety reinforcement learning to reduce risk in autonomous driving and ensure that systems adhere strictly to safety constraints while maximizing expected rewards. These findings provide an important theoretical and practical basis for further improving algorithm robustness, managing multi-agent interactions, and integrating ethical considerations in the future.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

This mini-review critically summarizes the knowledge of imprinted polymer-based electrochemical sensors, for the detection of pesticides, metal ions and waterborne pathogenic bacteria, focusing on the period the last 5 years (citation of 78 papers published in 2017-2021, ie 63% of total citations). MIP-based electrochemical sensors exhibit low limit of detection, high selectivity, high sensitivity and low cost. Herein, we focused on the timely topics of water pollution by organics, inorganics and micro-organisms represented by pesticides, metal ions and bacteria, respectively. We put the emphasis on the design of imprinted polymers and their composites and coatings by radical polymerization, oxidative polymerization of conjugated monomers or sol-gel chemistry. Whilst most imprinted polymers are used in conjunction with differential pulse or square wave voltammetry for sensing organics and metal ions, electrochemical impedance spectroscopy (EIS) appears as the chief technique for detecting bacteria. This successful combination of EIS and imprinting technology should be harnessed in the coming years in the case of bacteria. Interestingly, bacteria are not always probed by bacteria-imprinted polymers; we report here their detection by monitoring specific (macro)molecules that reflect bacterial activity, for example quorum sensing signaling molecules or flagella proteins. If much has been developed in the past decade with glassy carbon or gold electrodes, it is clear that carbon paste electrodes of imprinted polymers are more and more investigated due to their versatility. Shortlisted case studies were critically reviewed and discussed; clearly a plethora of tricky strategies of designing selective electrochemical sensors are offered to “Imprinters”. We anticipate this review will be of interest to experts and new comers in the field who are paying time and effort combining electrochemical sensors with MIP technology.

Two-dimensional (2D) materials have been a research hot topic in the passed decades due to their unique and fascinating properties. Among them, mechanical properties plays an important role for their application. However, there lacks an effective tool for high-throughput calculating, analysing and visualizing the mechanical properties of 2D materials. In this work, we present, mech2d package, a highly automated toolkit for calculating and analysing second-order elastic constants (SOECs) tensor and relevant properties of 2D materials with considering their symmetry. In the mech2d, the SOECs can be fitted by both strain-energy and stress-strain approach, where the energy or strain can be calculated by first-principles engine, such as VASP. As a key feature, the mech2d package can automatically submit and collect the tasks from local or remote machine with robust fault-tolerant ability, make it suitable for high-throughput calculation. The present code has been validated by several common 2D materials, including graphene, black phosphorene, GeSe2 and so on.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

Tunnel fires are generally detected using various sensors, including measuring temperature, CO concentration, and smoke concentration. To address the ambiguity and inconsistency in multi-sensor data, this paper proposes a tunnel fire detection method based on an improved Dempster-Shafer (DS) evidence theory for multi-sensor data fusion. To solve the problem of evidence conflict in DS theory, a two-level multi-sensor data fusion framework is adopted. The first level of fusion involves feature fusion of the same type of sensor data, removing ambiguous data to obtain characteristic data, and calculating the basic probability assignment (BPA) function through the feature interval. The second level fusion derives basic probability numbers from the BPA, calculates the degree of evidence conflict, normalizes to obtain the relative conflict degree, and optimizes the BPA using the trust coefficient. The classical DS evidence theory is then used to integrate and obtain the probability of tunnel fire occurrence. Different heat release rates, tunnel wind speeds, and fire locations are set, forming four fire scenarios. Sensor monitoring data under each simulation condition are extracted and fused using the improved DS evidence theory. The results show that the proposed improved DS evidence theory method detects the probability of fire occurrence in the four scenarios as 67.5%, 71.0%, 82.8%, and 83.5%, respectively, and identifies fire occurrence in approximately 2.4 seconds, an improvement of 64.7% to 70% over traditional methods. This demonstrates the feasibility and superiority of the proposed method, highlighting its significant importance in ensuring personnel safety.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Abies beshanzuensis, an extremely endangered species, attracts serious concerns on genetic diversity recovery and population protection. However, little genetic information was known about it till now. In this study, intra-/intergenomic ITS variation, secondary structure, and molecular phylogeny of A.beshanzuensis were determined by nrDNA-ITS marker, and results indicated that, ITS region featured rich polymorphism in ITS1 and highly conservative in 5.8S/ITS2 among intra-/inter-genome, implying rich genetic diversities and the occurrence of non-concerted evolution in ITS region. Predicated 5.8S structure possessed Helices-Loops with 3 motifs (M1/M2/M3) and 5 helices B4-B8, and ITS2 could form conservative Clover-like structure with 5 ribotypes, manifesting genetically structural generalities and individualities. Thirteen ITS pseudogenes were also identified from 76 samples (or clones). Molecular phylogeny revealed that, A.beshanzuensis shared genetically closer relationships with A.fanjingshanensis, A.chensiensis, A.yuanbaoshanensis among genus Abies. The available original data provided rich genetic information on ITS sequence, structure and molecular phylogeny of A.beshanzuensis, which not only updated the databases of ITS sequences as well as secondary structures essential for phylogenetic reference and DNA barcoding analyses, but also contributed to deep exploration of population diversities, origin and evolution as well theoretical direction for population recovery and protection of A.beshanzuensis.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

In this paper we study a class of impulsive delayed neural networks with parameter uncertainties and reaction-diffusion terms. Using the properties of M-matrices and some inequality techniques, some sufficient conditions are derived to guarantee the global exponential stability of the given system. The results obtained are presented by simple algebraic inequalities, which are certainly more concise than previous methods. Finally, the validity and usefulness of our results are illustrated by arithmetic examples.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Recommender Systems (RecSys) are crucial in managing information overload and enhancing user satisfaction across various digital platforms, including e-commerce and entertainment. Evolving from traditional models to Deep Neural Networks (DNNs) and, more recently, Large Language Models (LLMs), these systems leverage sophisticated algorithms to analyze user behaviors and preferences. LLMs, such as GPT-4, are trained on extensive datasets to comprehend and generate natural language, significantly advancing their ability to deliver personalized recommendations. This tutorial explores the transformative impact of LLMs on RecSys, discussing their development, application in handling complex datasets, and the integration of contextual insights. Real-world examples illustrate how LLMs enhance recommendation accuracy and user experience, highlighting challenges and future directions in the field.

The absolute absorption cross section of the ethyl peroxy radical, C2H5O2, in the Ã←X ̃ electronic transition with the peak wavelength at 7596 cm-1, has been determined by the method of dual wavelengths time resolved continuous wave cavity ring down spectroscopy. C2H5O2 radicals were generated from pulsed 351 nm photolysis of C2H6/Cl2 mixture in presence of O2 and detected on one of the CRDS paths. Two methods have been applied for the determination of the C2H5O2 absorption cross section: (i) based on Cl-atoms being converted alternatively to either C2H5O2 by adding C2H6 or to hydro peroxy radicals, HO2, by adding CH3OH to the mixture, whereby HO2 was reliably quantified on the second CRDS path in the 21 vibrational overtone at 6638.2 cm-1 (ii) based on the reaction of C2H5O2 with HO2, measured under either excess HO2 or under excess C2H5O2 concentration. Both methods lead to the same peak absorption cross section of C2H5O2,7596 cm-1 = (1.0±0.2) × 10-20 cm2. The rate constant for the cross reaction between of C2H5O2 and HO2 has been measured to be (6.5±1.6) × 10-12 cm3 molecule-1 s-1.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

This paper proposed emotion recognition methods for consecutive facial images, and implements the inference of neural network model on a field-programmable gate array (FPGA). The proposed emotion recognition methods are based on a neural network model architecture that combines convolution neural networks (CNNs), long short-term memory (LSTM), and fully connected neural networks (FCNNs), called CLDNN or ConvLSTM-FCN. This type of neural network mod-el can analyze the local feature sequences obtained through convolution of data, making it suita-ble for processing time-series data such as consecutive facial images. In this paper, sequences of facial images are sampled from videos corresponding to various emotional state of subjects. The sampled images are then pre-processed with the processes includes facial detection, greyscale conversion, resize, and data augmentation if necessary. The 2-D CNN in ConvLSTM-FCN is used for feature extraction for these pre-processed facial images. These sequences of facial im-age features are time sequences with dependent properties between the elements within them. The LSTM is then used to model these time sequences followed by fully connected neural net-works (FCNNs) for classification. The proposed consecutive facial emotion recognition method achieves an average recognition rate of 99.51% on RAVDESS dataset, 87.80% on BAUM-1s dataset and 96.82% on eNTERFACE’05 data set, using 10-fold cross-validation on the PC. Some com-parisons of recognition accuracies between the proposed method and the other existing related works are conducted in this paper. According to the comparisons, the proposed emotion recog-nition methods outperform the existing related researches. The proposed emotion recognition methods are then implemented on an FPGA chip using the neural network model inference algo-rithms in this paper, and the accuracies of the experiments conducted on the FPGA chip are iden-tical to those obtained on the PC. This verifies that the proposed neural network model imple-mented on the FPGA chip performs well.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Antibiotic resistance (ABR) is concerning issue due to its direct and indirect repercusions on public health, since decreased therapeutic effect of certain antibiotic to treatment complications that can cause death. There are several mechanism as to how ABR can be transferred from one microoorganisms to another, and many of them are dependant many environmental factors. The food supply chain is a environment in which ABR gene transfer can occur is multiple pathways, which generate concerns regarding food safety. Here, we summarize relevant mechanisms which are implied in ABR in food supply chain but also we are addressing routes of transmission and prevalence of ABR, implications on public health, and the application of new alternatives to antibiotics such as antimicrobial peptides, mainly bacteriocins, in order to countermeasure ABR.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

Coronavirus disease 2019 (COVID-19) is caused by infection with the 2019 novel coronavirus 2 (2019-nCoV, now referred to as SARS-CoV-2). COVID-19 has become a global pandemic since its outbreak at the end of Dec 2019. COVID-19 could lead to severe acute respiratory disease, especially to those who have reduced immunity. Binding of the viral Spike protein (S) to its receptor ACE2 (Angiotensin Converting Enzyme 2) on the surface of target cells has been proven to be key for virus entry and infection. Although ACE2 expression in the respiratory system is necessary for pneumonia infection by SARS-CoV-2, the regulation of ACE2 gene expression remains poorly investigated, especially for patients that are in pre-pathological conditions. Here, by analyzing The Gene Expression Omnibus (GEO) database, we investigated the expression regulation of ACE2 in various kinds of primary epithelial cells from the respiratory system after varies of respiratory viruses infection such as influenza A virus (IFV), respiratory syncytial virus (RSV) and human rhinovirus (hRV). Our analyses reveal that infection of multiple kinds of respiratory viruses or influenza vaccines greatly increased ACE2 expression, suggesting that respiratory viruses infection could represent a high risk factor for developing COVID-19. We also found that the regulatory effect of influenza A virus on ACE2 expression is associated with activation of the interferon beta-induced pathway and viral RNA-activated host response. Together, our data provide a theoretical framework for clinical classification for SARS-CoV-2 infection susceptibility and could be used for future prevention and therapy treatment for COVID-19.

The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.

Atopic dermatitis (AD) is a chronic inflammatory skin disease, which can cause skin barrier function damaged. Although co-incubation with docosahexaenoic acid (DHA) exerts a positive effect in deficient skin model, there is no study to investigate the effects of topical treatment with DHA in inflammatory reconstructed human epidermis (RHE) model. The effects of DHA on monolayer normal human epidermal keratinocyte (NHEK) cells were evaluated via CCK-8, qPCR and ELISA. The skin related barrier function was assessed by hematoxylin-eosin (HE) staining, western blot (WB), Immunohistofluorescence (IF) and ELISA in normal and inflammatory RHE models. DHA upregulated filaggrin and loricrin expression at mRNA levels in addition to suppress overexpression of TNF-α，IL-1α and IL-6 stimulated by poly I:C plus LPS (stimulation cocktail) in cultured NHEK cells. After topical treatment with DHA, cocktail induced inflammatory characteristics of skin diseases including barrier morphological, differentiation proteins and TSLP secretion, which were alleviated in RHE models. Supplementation with DHA can improved related barrier function and have anti-inflammation effects in monolayer keratinocytes and RHE models, which indicated that DHA may have a potential value for the treatment of inflammation-associate skin diseases.

Abstract：This paper uses the balanced panel data from 29 provinces (autonomous regions and municipalities) in China for a total of 17 years from 2000 to 2016 as a research sample, and establishes an empirical model to examine the impact of environmental regulations and technological innovation on the quality of economic growth. Then this paper test technological innovation as a threshold variable, in which play a regulatory role. Taking the provincial balanced panel data as a research sample, a fixed effect model, a system GMM model, and a panel threshold model were established for empirical testing and the robustness test. Based on the empirical results, this article draws the following conclusions: from a national perspective, environmental regulations and technological innovation can significantly promote the quality of economic growth; from a regional perspective, there are regional differences in impact effects. Under the constraints of environmental regulations, the promotion effect of technological innovation on the quality of economic growth will be reduced; the impact of environmental regulation on the quality of economic growth will have a "threshold effect", and environmental regulation can significantly promote the quality of economic growth only after crossing the threshold and the threshold of technological innovation.

Trichothecene mycotoxin T-2 toxin is an important environmental pollutant and poses a global threat to human and animal health. T-2 toxin could induce nephrotoxicity, however, the precise molecular mechanism remains unclear. In this study, the mice were intraperitoneally administrated with a single dose of 2 mg/kg T-2 toxin. The kidney function and ultrastructural observation were also assessed and found T-2 toxin exposure could cause kidney damage. Transmission electron microscopy showed a significant swelling and vacuolization of the mitochondria of renal cell. A total of 1122, 58, and 391 differential expression genes (DEGs) that were predominantly expressed in kidney tissues at 1 d, 3 d, and 7 d after T-2 toxin exposure, respectively. Early transcriptomic changes at 1 d after exposure were down-regulation of DEGs involved in the cell cycle, p53 signaling pathway, and cellular senescence, while up-regulation of DEGs referred to the ribosome pathway. The temporal variations in gene expression pattern in T-2 toxin exposure in mice kidney were presented and cellular metabolism was disturbed at the exposure recovery period with 7 d. In conclusion, this study, for the first time, provided a comprehensive comparative transcriptomic analysis of gene regulation in T-2 toxin exposure-induced nephrotoxicity at different temporal periods and explored the nephrotoxicity mechanism of T-2 toxin at the mRNA level.

Buruli ulcer (BU), caused by Mycobacterium ulcerans, is a neglected tropical disease associated with freshwater habitats. A variety of limnic organisms harbor this pathogen, including aquatic bugs (Hemiptera: Heteroptera), which have been hypothesized to be epidemiologically important reservoirs. Aquatic Hemiptera exhibit high levels of diversity in the tropics, but species identification remains challenging. In this study, we collected aquatic bugs from emerging foci of BU in the Southwest Region of Cameroon, which were identified using morphological and molecular methods. The bugs were screened for mycobacterial DNA and a selection of 20 mycobacteria-positive specimens from the families Gerridae and Veliidae were subjected to next-generation sequencing. Only one individual revealed putative M. ulcerans DNA, but all specimens contained sequences from the widespread alpha-proteobacterial symbiont, Wolbachia. Phylogenetic analysis placed the Wolbachia sequences into supergroups A, B and F. Circularized mitogenomes were obtained for seven gerrids and two veliids, the first from these families for the African continent. This study suggests that aquatic Hemiptera may have a minor role (if any) in the spread of BU in Southwest Cameroon. Our metagenomic analysis provides new insights into the incursion of Wolbachia into aquatic environments and generates valuable resources to aid molecular taxonomic studies of aquatic Hemiptera.

Epitranscriptomic RNA modifications play a crucial role in the posttranscriptional regulation of gene expression. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic RNA and plays a pivotal role in RNA fate. RNA m6A modification is regulated by a group of cellular proteins, methyltransferases (writers) and demethylases (erasers), which add and remove the methyl group from adenosine, respectively. m6A modification is recognized by a group of cellular RNA-binding proteins (readers) that specifically bind to m6A-modified RNA, mediating effects on RNA stability, splicing, transport, and translation. The functional significance of m6A modification of viral and cellular RNA is an active area of virology research. In this review, we summarize and analyze current literature on m6A modification of HIV-1 RNA, the multifaceted functions of m6A in regulating HIV-1 replication, and the role of viral RNA m6A modification in evading the innate immune responses to infection. Furthermore, we briefly discuss future directions and therapeutic implications of mechanistic studies of HIV-1 epitranscriptomic modifications.

The research fills the policy research gap for the women entrepreneurship and sustainability performance for examining key successful factors. Previous women entrepreneurship research fails to offer policy recommendations. The research purpose is to investigate these factors affect women entrepreneurship capabilities and sustainability performance by using SEM analysis and making policy recommendation. This research employs online and mail survey and obtains 175 women entrepreneur sample. The study finds that family support and motivation have positive effect on women entrepreneurship capabilities and sustainability performance. Barriers have no effect on performance. Hopefully, the research can provide the guidance to contribute to women’s entrepreneurship opportunities for achieving SDGs. Policy recommendation and managerial implication are discussed in the article.

Threshing device is the core component of grain combine harvester, and its working performance determines the working quality and production efficiency of the harvester to a great extent. The straw guide plate plays an important role in the threshing device to dredge the threshing matter and control the threshing time of the combine harvester matter in the threshing chamber. In the past, the guiding structure of threshing device could not optimize the working performance of the machine by adjusting the spiral angle, that is, most cereal combine harvester may not be fed smoothly or even clogged when operating under different crop types, yield differences and operating environments, a kind of threshing device with adjustable guide straw board was studied. In this study, the movement model of the straw on the straw guide plate was analyzed, and it was found that the spiral angle “α”of the straw guide was 0<α<58°.Three-factor and three-level response surface method was used to carry out field experiment on drum speed, working speed and guide grass plate spiral angle, and the experimental data were analyzed by quadratic polynomial regression.The results show that the drum speed, working speed and the spiral angle of the guide grass plate have significant effects on the loss rate (PLR) , impurity content (PIR) and breakage rate (PBR) , the drum speed and working speed have an interactive effect on the impurity ratio (PIR) , and the working speed and the helical angle of the guide grass plate have an interactive effect on the loss ratio (PLR) and breakage ratio (PBR) , there is an interaction between the rotary speed of the roller and the helical angle of the guide grass plate on the crushing rate (PBR) .Further optimization analysis showed that the predicted value was PLR = 1.18% , PIR = 0.72% , PBR = 0.53% , the experimental verification value was PLR = 1.26% , PIR = 0.73% , PBR = 0.61% . The absolute error between the experimental value and the predicted value was very small, however, the optimized field test verified value decreased by 8.31% , 50.04% and 60.30% respectively, which indicated that the optimized harvester had better operation quality, in particular, PIR, PBR and other two indicators have a greater increase in the effect.

Economic development and advancements in information technology contributed to the shift on accounting objective from commission responsibility view to decision-making useful view. The decision-making useful view claims that the accounting measurement methods should be changed to improve the usefulness of accounting information, to enable information users to make correct decisions. In addition, the development of financial instruments leads to the birth of fair value accounting. In recent years, fair value has been one of the most important measurement methods in the International Accounting Standard and US Generally Accepted Accounting Principles. However, China has been quite cautious when it comes to applying fair value full time, especially after the global financial crisis happened in 2008, wherein fair value accounting was exposed to strong suspicion. Hence, studying the value relevance of fair value is of great significance to exploring the accounting profession and reforming accounting standards. This paper attempts to investigate the value-relevance of fair value based on the data of listed financial companies and manufacturing companies in China. The results indicate that the fair value information in the financial industry has a strong explanatory influence to corporate share price. In contrast, the fair value information shows limited relevance in the manufacturing industry. Finally, consulting with the results of normative analysis and empirical study, this paper suggests several rational advices for the application of fair value in China.

This paper addresses the challenges faced by icebreakers in polar environments, particularly the difficulty in sensing underwater ice formations when navigating through thick ice layers, which often results in suboptimal icebreaking effectiveness. To overcome these challenges, this paper introduces a novel underwater robot equipped with both sensing and ice-breaking capabilities. We propose a path planning method for icebreaking that leverages the synergistic capabilities of the Safe Particle Swarm Optimization and Genetic Algorithm (GA-SPSO). The GA-SPSO algorithm integrates the global search prowess of the particle swarm optimization with the local optimization strength of the genetic algorithm, enabling efficient and adaptive path planning in complex ice environments. The underwater unmanned vehicle (UUV)-assisted icebreaking approach developed here utilizes the UUV's flexibility and high-precision environmental sensing to provide real-time optimization suggestions for icebreaker navigation paths. Simulation results demonstrate that the GA-SPSO algorithm not only effectively circumvents hazardous areas but also significantly reduces the energy consumption and operational time of icebreakers, thereby enhancing the safety and stability of navigation. When compared to the conventional Safe Particle Swarm Optimization (SPSO), our approach shows marked improvements in path length, convergence speed, and obstacle avoidance capabilities, significantly enhancing the success and efficiency of polar navigation missions.

In this study, we investigated the effects of three surface treatment techniques on 316L stainless steel, low-temperature immersion corrosion, shot peening followed by immersion corrosion, and electrochemical corrosion. Surface alterations were analyzed using scanning electron microscopy, Raman spectroscopy, and α-step thin-film thickness profiling. Human osteoblast adhesion was evaluated using Liu’s stain and metallographic optical microscopy. The results revealed weak cell adhesion after low-temperature immersion and shot peening followed by immersion corrosion. By contrast, electrochemical corrosion, particularly with a high current density and low corrosive solution concentration, resulted in a uniformly corroded surface, thus promoting dense cell adhesion. All three techniques resulted in porous oxide layers. Overall, our experimental findings highlighted shot peening (1 kg/cm2 for 20 s) and electrochemical corrosion (0.5 M HCl) as effective processes. Electrochemical corrosion produced uniformly dense corrosion pits, whereas shot peening produced semicircular grooves with small corrosion pits, both favorable for cell adhesion. Electrochemical corrosion also yielded excellent cell adhesion, emphasizing its suitability for biomedical activity. We developed a process for creating a porous surface layer and thereby enhancing the cell adhesion to 316L stainless steel for potential biomedical implant applications.

Technology can be seen everywhere and has been integrated into our lives.We are always using technology and enjoying the convenience brought by technology. However, physical retailers and e-commerce companies are also gradually adopting advanced technologies. Technology improves the purchasing environment and purchasing experience. Virtual reality and augmented reality have been hotly discussed in recent years. Technology, although virtual reality and augmented reality technology have not yet matured, it can be said that they will in the future It has great development potential. Virtual reality and augmented reality are also beginning to sprout in the retail industry. However, research on the acceptance of the use of virtual reality and augmented reality in the apparel shopping process is still lacking because This study explores how usefulness, ease of use, hedonicity, customer experience, customer engagement and satisfaction. To influence customer loyalty, this study adopted questionnaire survey and convenience sampling methods, and collected a total of 308 valid questionnaires. The analysis method used confirmatory factor analysis and structural equation model to verify the research hypothesis relationship. The results of this study found. Hedonic has a significant impact on customer loyalty, while usefulness, ease of use, customer experience, customer engagement and satisfaction Satisfaction does not have a significant impact on customer loyalty. This study explains the academic contribution of the research results. The practical implications in marketing are put forward, and specific suggestions and directions for future research are given.

We aimed to evaluate the protective effects of acetyl-xylogalactan on the activity of RAW264.7 macrophages against heat stress. To this end, we assessed cell survival, phagocytic activity, in-tracellular Ca2+ level, mitochondria potential exchange, apoptotic assay findings, galactosidase activity and the RNA-seq by NGS and real-time polymerase chain reaction (PCR) expression. In our evaluation of macrophage morphology at 37°C and 41°C, the macrophages showed an oval shape at 41°C , unlike the spindle shape at 37°C. Therefore, 41°C was chosen as the heat stress condition. Subsequently, we designed an experiment to evaluate changes in the RAW264.7 macrophages after acetyl-xylogalactan treatment under heat stress. The survival of RAW264.7 macrophages treated with acetyl-xylogalactan was higher than that of controls that were not treated with acetyl-xylogalactan. Moreover, on the basis of the results of the annexin-V detection assay, the apoptotic activity of macrophages appeared to have reduced after treatment with ac-etyl-xylogalactan. Moreover, treatment with acetyl-xylogalactan resulted in a stronger recovery trend in the intracellular Ca2+ and mitochondrial membrane potential after heat stress. RNA sequencing and real-time polymerase chain reaction (PCR) illustrated that Sarcodia suieae acetyl-xylogalactan could upregulate the expression of the anti-apoptosis Cflar gene and down-regulate the expression of the apoptosis factors Ddit3, and Hyou1 to protect macrophages under heat stress.

The fatigue delamination damage is one of the most important fatigue failure modes of laminated composite structures. However, the developments of the theoretical framework, mathematical/physical model and numerical simulation of fatigue delamination are still challenging issues, and there is a lack of systematic classification. This article reviews the experimental phenomena of the onset and propagation stage of delamination under fatigue loading, and summarizes the commonly used phenomenological models for laminated composite structures. The research methods, general modeling formulas and development prospects of the phenomenological models are presented in detail. In the light of the analysis of finite element model (FEM) for the laminated composite structures, a number of simulation methods of fatigue delamination crack propagation damage model are carefully classified. Furthermore, within the theoretical framework of strength theory model (SM), fracture mechanics model (FM), damage mechanics model (DM) and hybrid model (HM), the complete procedure, application, capability assessment, advantages and limitations of the models are also discussed in detail. Finally, several valuable suggestions are given for the research interests, and challenging technical problems that need to be overcome on the fatigue delamination prediction of laminated composite structures in the future.

To understand lung damage caused by COVID-19, we deduced two-phase lung damage mechanisms. After the lungs are infected with SARS-CoV-2 virus, the affected lung tissue swells and surface properties of pulmonary capillaries change, resulting in an increased flow resistance of affected capillaries. If a sufficient number of capillaries are affected by the infection, the swelling and increased cell wall adhesion collectively raise pulmonary vascular resistance. The increased vascular resistance further increases the dwell times of WBCs in affected capillaries and nearly capillaries. When pulmonary pressure is sufficiently higher, WBCs are forced to squeeze into interstitial spaces or alveolar spaces when local pressures are higher than what the capillaries can withstand. When more and more WBCs are dynamically retained, the flow resistance of more capillaries rises, pulmonary vascular resistance rises, and pulmonary pressure rises. The rise in the pulmonary pressure in turn results in elevated capillary pressures. When capillary pressures around the alveoli are sufficiently high, they cause interstitial pressures to change from normally negative values to positive values. The positive pressures cause fluid leakage to the alveolar space and thus degrade lung function. Tissue swelling, and occupation of WBCs in interstitial spaces and alveolar spaces further reduce compressible volume, and thus cause further rise in the pulmonary vascular resistance and pulmonary pressure. When the pulmonary pressure has reached a critical point as in the second phase, the blood breaks capillary walls and squeezes through interstitial spaces to reach alveolar spaces, resulting in irreversible lung damages. The available free volume in the thorax cage, organ usable capacities, temperature and humid are expected to have great impacts on degree of lung damages. The free volume in the thorax cage, lung usable surplus capacity, and other organ usable capacities determine the arrival time of last-phase irreversible damage. The mechanisms imply that the top priority for protecting lungs is maintaining pulmonary micro-circulation and preserving organ functions in the entire disease course while controlling viral reproduction should be stressed in the earliest time possible. The mechanisms also explain leukecytes are recruited and migrated into inflamed tissues by increasing their dwell times caused by increased local flow resistance.

After reviewing cancer theories, cancer treatment development histories, randomized clinical trial's performance, cancer treatment strategy, trial follow-up times, and conducting numerous simulations using existing data, the authors found: (1) medical treatments come with three to four lethal factors: treatment side-effects, emotional distress and chronic dress, lack of exercises or physical inactivity, and excessive nutrition in some cases; (2) clinical trial exaggerates the benefits of fast-acting treatments and underestimates the slow-delivering adverse side effects as a result of statistical averaging, interfering effects of personal lifestyle factors, and insufficient follow-up times; (3) the benefits of medical treatments are limited by chain comparison, where surgery sets up a negative standard relative to the best way for resolving cancer; (4) the strategy of destroying the tumor is unworkable; (5) medical treatments can turn natural cancer growth curve into approximately doubly exponential curve; (6) multiple factor non-medical measures are much more powerful than medical treatments in controlling cancer growth and metastasis rates; and (7) cancer early diagnosis and over treatments are bad strategies that have great adverse impacts on cancer patients. Based on huge increases in cancer growth rate constants, substantial of loss of organ functional capacity, and severe systemic aging-like cellular damages, the authors concluded that medical treatments promote cancer growth and metastasis rates and shorten patient lives in most cases, and the claimed benefits are caused by triple biases of clinical trials. The authors believe that the better strategy for ending the global cancer epidemic is abandoning clinical trails as the research model, changing caner treatment strategy from killing cancer cells to slowing down cancer growth rates by using multiple factors optimization approach in personalized medicine.

This paper studies the contemporaneous relationship between S&P 500 index returns and log-increments of the market volatility index (VIX) via a nonparametric copula method. Specifically, we propose a conditional dependence index to investigate how the dependence between the two series varies across different segments of the market return distribution. We find that: (a) the two series exhibit strong, negative, extreme tail dependence; (b) the negative dependence is stronger in extreme bearish markets than in extreme bullish markets; (c) the dependence gradually weakens as the market return moves toward the center of its distribution, or in quiet markets. The unique dependence structure supports the VIX as a barometer of markets' mood in general. Moreover, applying the proposed method to the S&P 500 returns and the implied variance (VIX²), we find that the nonparametric leverage effect is much stronger than the nonparametric volatility feedback effect, although, in general, both effects are weaker than the dependence relation between the market returns and the log-increments of the VIX.

Public safety and intelligent surveillance systems critically depend on anomaly behavior detection for effective monitoring. In real-world pedestrian detection scenarios, prevalent challenges such as missed detections, complex background interference, and small target sizes hinder accurate anomaly identification. To address these issues, this study introduces YOLO-ABD, a lightweight method for anomaly behavior detection that integrates small target detection and channel shuffling. This method employs YOLOv8n as the baseline model, incorporating a small target detection mechanism in the Head part and utilizing GSConv convolution in the Backbone to enhance perceptual capability. Additionally, the SimAM attention mechanism is integrated to mitigate complex background interference, thereby improving target detection performance. Evaluation on the IITB-Corridor dataset demonstrated mAP50 and mAP50-95 scores of 89.3% and 60.6%, respectively. Generalization testing on the street-view-gdogo dataset further highlighted the superiority of YOLO-ABD over advanced detection algorithms, underscoring its effectiveness and generalizability. With a relatively small parameter count, YOLO-ABD presents an excellent lightweight solution for pedestrian anomaly behavior detection.

Background: In recent years, computational aesthetics and neuroaesthetics have provided novel insights into understanding beauty. Building upon the findings of traditional aesthetics, this study aims to combine these two research methods to explore an interdisciplinary approach to studying aesthetics; Method: Abstract artworks were used as experimental materials. Based on traditional aesthetics and in combination, features of composition, tone, and texture were selected. Computational aesthetic methods were then employed to correspond these features to physical quantities: blank space, gray histogram, GLCM, LBP, and Gabor filters. An EEG experiment was carried out, in which participants conducted aesthetic evaluations of the experimental materials in different contexts (genuine, fake), and their EEG data was recorded to analyze the impact of various feature classes in the aesthetic evaluation process. Finally, a SVM was utilized to model the feature data, EEG data, context data, and subjective aesthetic evaluation data; Result: Behavioral data revealed that higher aesthetic ratings in the genuine context. EEG data indicated that genuine contexts elicited more negative deflections in the prefrontal lobes between 200-1000ms. Class II compositions demonstrated more positive deflections in the parietal lobes at 50-120ms, while Class I tones evoked more positive amplitudes in the occipital lobes at 200-300ms. Gabor features showed significant variations in the parieto-occipital area at an early stage. Class II LBP elicited a prefrontal negative wave with a larger amplitude. The results of the SVM models indicated that the model incorporating aesthetic subject and context data (ACC=0.76866) outperforms the model using only parameters of the aesthetic object (ACC=0.68657); Conclusion: A positive context tends to provide participants with a more positive aesthetic experience, but abstract artworks may not respond to this positivity. During aesthetic evaluation, the ERP data activated by different features show a trend from global to local. The SVM model based on multimodal data fusion effectively predicts aesthetics, further demonstrating the feasibility of the combined research approach of computational aesthetics and neuroaesthetics.

Background: Symmetry is a special kind of balance. This study aims to systematically explore and apply the role of balanced composition in aesthetic judgments by focusing on balanced composition features and employing research methods from computational aesthetics and Neuroaesthetics. Methods: First, experimental materials were classified by quantifying balanced composition using several indices, including symmetry, center of gravity, and negative space. An EEG experiment was conducted with 18 participants, who were asked to respond dichotomously to the same stimuli under different judgment tasks (balance and aesthetics), with both behavioral and EEG data being recorded and analyzed. Subsequently, participants' data were combined with balanced composition indices to construct and analyze various SVM classification models. Results: Participants largely used balanced composition as a criterion for aesthetic evaluation. ERP data indicated that from 300-500ms post-stimulus, brain activation was more significant in the aesthetic task, with unbeautiful and imbalanced stimuli eliciting larger frontal negative waves and occipital positive waves. From 600-1000ms, beautiful stimuli caused smaller negative waves in the PZ channel. The results of the SVM models indicated that the model incorporating aesthetic subject data (ACC=0.9989) outperforms the model using only balanced composition parameters of the aesthetic object (ACC=0.7074). Conclusions: Balanced composition is a crucial indicator in aesthetics, with similar early processing stages in both balance and aesthetic judgments. Multimodal data models validated the advantage of including human factors in aesthetic evaluation systems. This interdisciplinary approach not only enhances our understanding of the cognitive and emotional processes involved in aesthetic judgments but also enables the construction of more reasonable machine learning models to simulate and predict human aesthetic preferences.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

Passion fruit is a valued tropical fruit crop that faces environment-related growth strains. TCP genes are important for both growth modulation and stress prevention in plants. Herein, we systematically analyzed the TCP gene family in passion fruit, recognizing 30 members. Genes exhibiting closer phylogenetic relationships exhibited similar protein and gene structures. Gene members of the TCP family showed developmental stage or tissue-specific expression profiles during the passion fruit life cycle. Transcriptome data also demonstrated that many PeTCPs showed induced expression in response to hormonal treatments and cold, heat, and salt stress. Based on transcriptomics data, eight candidate genes were chosen for preferential gene expression confirmation under cold stress conditions. Additionally, four TCP genes exhibited in silico binding with cold stress-related miRNA319s. This study will aid in the establishment of novel germplasm, as well as the further investigation of the roles of PeTCPs and their cold stress resistance characteristics.

Depth-sensing technology has led to broad applications of inexpensive depth cameras that can capture human motion and scenes in 3D space. Background subtraction algorithms can be improved by fusing color and depth cues, thereby allowing many issues encountered in classical color segmentation to be solved. In this paper, we propose a new fusion method that combines depth and color information for foreground segmentation based on an advanced color-based algorithm. First, a background model and a depth model are developed. Then, based on these models, we propose a new updating strategy that can eliminate ghosting and black shadows almost completely. Extensive experiments have been performed to compare the proposed algorithm with other, conventional RGB-D algorithms. The experimental results suggest that our method extracts foregrounds with higher effectiveness and efficiency.

Under the dual background of underemployment and health inequality, this paper empirically analyzes the impact of education level on underemployed workers’ health based on CLDS2016 data. The results show that underemployment is significantly related to the decline of self-rated health, increased depression tendency, and morbidity in a certain period. The results indicate that underemployment can significantly reduce the health level of workers in the low education level group and the high education level group. However, it has no significant impact on workers’ health in the middle education level group; even if we change the measurement method of indicators and consider endogeneity, the research conclusion is still robust. Moreover, this kind of health inequality mainly comes from the difference in economic effect and leisure effect of underemployment to workers with different educational levels. This paper provides empirical support for increasing the labor protection mechanism of underemployed people and reducing the health inequality caused by educational level differences.

Link prediction is a fundamental problem in graphs. Currently, SubGraph Representation Learning (SGRL) methods provide state-of-the-art solutions for link prediction by transforming the task into a graph classification problem. However, existing SGRL solutions suffer from high computational costs and lack scalability. In this paper, we propose a novel SGRL framework called Augmented Feature Diffusion on Sparsely Sampled Subgraph (AFD3S). The AFD3S first uses a conditional variational autoencoder to augment the local features of the input graph, effectively improving the expressive ability of downstream Graph Neural Networks. Then, based on a random walk strategy, sparsely sampled subgraphs are obtained from the target node pairs, reducing computational and storage overhead. Graph diffusion is then performed on the sampled subgraph to achieve specific weighting. Finally, the diffusion matrix of the subgraph and its augmented feature matrix are used for feature diffusion to obtain operator-level node representations as inputs for the SGRL-based link prediction. Feature diffusion effectively simulates the message-passing process, simplifying subgraph representation learning, thus accelerating the training and inference speed of subgraph learning. Our proposed AFD3S achieves optimal prediction performance on several benchmark datasets, with significantly reduced storage and computational costs.

Innovation is an essential key factor in the technology development history. Past research on innovation focused more on the innovation behavior of technology, but seldom described knowledge assets which also influence innovation behavior greatly. The effect of knowledge assets attribute and result on disruptive innovation is therefore regarded as the research topic in this study, where disruptive innovation is divided into outbound and inbound to combine combination-embeddednessandmajor business specificityof knowledge assets as the research model. Manufacturing enterprises in China are proceeded the questionnaire survey, and 173 valid copies are collected. The empirical analysis shows that combination-embeddedness of knowledge assets presents significantly positive effects on major business specificity and outbound innovationof an enterprise but reveals remarkably negative effects on inbound innovation. Enterprises are suggested to constantly accumulate knowledge assets with low major business specificity before disruptive innovation in order to reduce ineffective inbound innovation.

Leucokinins (LKs) constitute a neuropeptide family first discovered in a cockroach and later identified in numerous insects and several other invertebrates. The LK receptors are only distantly related to other known receptors. Among insects, there are many examples of species where genes encoding LKs and their receptors are absent. Furthermore, genomics has revealed that LK signaling is lacking in several of the invertebrate phyla and in vertebrates. In insects, the number and complexity of LK expressing neurons vary, from the simple pattern in the larva of Drosophila where the entire CNS has 20 neurons of three main types, to cockroaches with about 250 of many different types. Common to all studied insects is the presence or 1-3 pairs of LK-expressing neurosecretory cells in each abdominal neuromere of the ventral nerve cord, that, at least in some insects, regulate secretion in Malpighian tubules. This review summarizes the diverse functional roles of LK signaling in insects, as well as other arthropods and mollusks. These functions include regulation of ion and water homeostasis, feeding, sleep-metabolism interactions, state-dependent memory formation, as well as modulation of gustatory sensitivity and nociception. Other functions are implied by the neuronal distribution of LK, but remain to be investigated.

To characterize the mechanisms by which the highly-conserved exocyst trafficking complex regulates eye physiology in zebrafish and mice, we focused on exoc5 (aka sec10), a central exocyst component. We analyzed both exoc5 zebrafish mutants and retinal pigmented epithelium (RPE)-specific Exoc5 knockout mice. Exoc5 is present in both the non-pigmented epithelium of the ciliary body and in the RPE. In this study we set out to establish an animal model to study the mechanisms underlying the ocular phenotype and to establish if loss of visual function is induced by postnatal RPE Exoc5-deficiency. Exoc5-/- zebrafish showed smaller eyes, with decreased number of melanocytes in the RPE and shorter photoreceptor outer segments. At 3.5 days post fertilization, loss of rod and cone opsins were observed in zebrafish Tg:exoc5 mutants. Mice with postnatal RPE-specific loss of Exoc5 showed retinal thinning associated with compromised visual function, and loss of visual photoreceptor pigments. This retinal phenotype in Exoc5-/- mice was present at 20-weeks, and the phenotype was more severe at 27-weeks, indicating progressive disease phenotype. We previously showed that the exocyst is necessary for photoreceptor ciliogenesis and retinal development. Here, we report that exoc5 mutant zebrafish and mice with RPE-specific genetic ablation of Exoc5 develop abnormal RPE pigmentation, resulting in retinal cell dystrophy and loss of visual pigments associated with compromised vision. As RPE cells are “downstream” of photoreceptor cells in the visual process, these data suggest exocyst-mediated retrograde communication and dependence between the RPE and photoreceptors.

Cancer/testis (CT) antigens exhibit selective expression predominantly in immunoprivileged tissues in non-pathological contexts but are aberrantly expressed in diverse cancers. Because of their expression pattern, they have historically been attractive targets for immunotherapies. The investigation of mechanistic roles of CT antigens in promoting oncogenesis has historically been a prominent research question, and a growing number of studies implicate CT antigens in promoting almost all the hallmarks of cancer. This suggests that CT antigens may act as cancer drivers. CT antigens are expressed in head and neck squamous cell carcinomas, although their role in the pathogenesis, prognostication, and treatment for this family of cancers remains poorly studied. Given that CT antigens hold intriguing potential as therapeutic targets and as biomarkers for prognosis and therapeutic response and that they can provide novel insights into oncogenic mechanisms, their further study in the context of head and squamous cell carcinoma is warranted.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

Tremor is a prevalent neurological disorder characterized by involuntary shaking or trembling of body parts. This condition impairs fine motor skills and hand coordination to varying degrees and can even affect overall body mobility. As a result, tremors severely disrupt the daily lives and work of those affected, significantly limiting their physical activity space. This study developed an innovative Spatial Augmented Reality (SAR) system aimed at assisting individuals with tremor disorders to overcome their physical limitations and expand their range of activities. The system integrates eye-tracking and Internet of Things (IoT) technologies, enabling users to smoothly control objects in the real world through eye movements. It employs a virtual stabilization algorithm for stable interaction with objects in the real environment. The study comprehensively evaluated the system's performance through three experiments: 1) assessing the effectiveness of the virtual stabilization algorithm in enhancing the system's ability to assist individuals with tremors in stable and efficient interaction with remote objects; 2) evaluating the system's fluidity and stability in performing complex interactive tasks; 3) investigating the precision and efficiency of the system in remote interactions within complex physical environments. The results demonstrate that the system significantly improves the stability and efficiency of interactions between individuals with tremor and remote objects, reduces operational errors, and enhances the accuracy and communication efficiency of interactions.