Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

In recent years, the consumption of over-the-counter probiotics used to promote health has grown rapidly worldwide and become an industry. In medicine, various studies have proven that probiotics can help improve the immune system and intestinal health. They are usually safe, but in some rare cases, they may cause concerning adverse reactions. Although the use of probiotics has been widely popularized in the public, the results of many probiotics clinical trials are contradictory. Especially for the cancer patients, the feasibility of probiotics management to provide benefits by targeting cancer and lessening anti-cancer side effects requires further investigations. And this review summarizes the interactions between probiotics and the host and current pros and cons of applying probiotics in the cancer patients.

Acute lymphoblastic leukemia is the most common malignancy in children and is characterized by numerous genetic and epigenetic abnormalities. Epigenetic mechanisms, which involve DNA methylations and histone modifications, result in the heritable silencing of genes without a change in their coding sequence. Emerging studies are increasing our understanding of the epigenetic role of leukemogenesis and have demonstrated the potential of DNA methylations and histone modifications as a biomarker for lineage and subtypes classification, predicting relapse, and disease progression in ALL. Epigenetic abnormalities are relatively reversible when treated with some small molecule-based agents compared to genetic alterations. In this review, we conclude the genetic and epigenetic characteristics in ALL and discuss the future role of DNA methylation and histone modifications in predicting relapse, finally focus on the individual and precision therapy targeting epigenetic alterations.

Background: Strong indicators of inflammation, such as C-reactive protein (CRP), hypersensitive CRP (hs-CRP), and a series of hematological indices, including platelet to lymphocyte ratio (PLR), neutrophil to lymphocyte ratio (NLR), hematocrit (HCT) and red blood cell distribution width (RDW), are regarded related with the incidence of contrast induced nephropathy (CIN) closely. Whereas, it remains unclear whether they can function as predictors of CIN onset. The objective of this meta-analysis was to determine the relationship between above indicators and CIN incidence among patients receiving coronary intervention. Methods: Clinical studies were retrieved from the electronic databases of PubMed, EMBASE, Google Scholar, Clinical Trials, and science direct from their inception to June 3rd, 2020. Meta-analysis was performed on pool eligible studies. Two reviewers screened all titles and abstracts and independently assessed all articles. Results: A total of 26 studies involving 29,454 patients were included in the meta-analysis. Pooled analysis results revealed that patients with higher CRP (odds ratio [OR]=1.06, 95% confidence interval [CI]: 1.01–1.12, P=0.02), hs-CRP (OR=1.03, 95% CI: 1.01–1.06, P=0.004), NLR (OR=1.11, 95% CI: 1.01–1.20, P=0.02), RDW (OR=1.35, 95% CI: 1.19–1.53, P<0.00001), and lower HCT (OR=0.94, 95% CI: 0.92–0.97, P=0.0003) all exhibited significantly higher CIN rates, but there was no significant association between PLR and CIN risk (OR=1.12, 95% CI: 0.99–1.26, P=0.07). Conclusion: The meta-analysis reported here demonstrates that pre-angiography CRP/hs-CRP and some hematological indices are associated with CIN.

Neurogenesis in the adult brain plays a major role in the cognitive ability of animals including learning and memory. Poria cocos (Schw.) Wolf (P. cocos) has been known as a traditional Chinese edible medicinal herb with the potential effect to improve learning and memory. However, the effect mechanisms are still elusive. In this study, significant neuronal differentiation-promoting activities of the ethanol extracts of P. cocos (EEPC) were tested in Neuro-2a cells and mouse cortical neural stem/progenitor cells (NSPCs). Subsequently, 97 compounds of EEPC were identified using UHPLC-Q-Exactive-MS/MS. After investigation of neuronal differentiation-promoting activities of 4 major compounds (Ethyl palmitoleate, L-(-)-Arabitol, Choline and Adenosine), only Choline has significant neuronal differentiation-promoting activity. In summary, we investigated the neuronal differentiation-promoting activity and chemical compositions of EEPC, the study of the neuronal differentiation-promoting effect of ether extract of P. cocos indicated P. cocos’s positive effect on learning and memory functions. This is the first investigation of the neuronal differentiation-promoting effect of ether extract of P. cocos based on similar research references.

Thymidylate synthase (TYMS) is an essential enzyme for the de novo synthesis of dTMP and has been a primary target for cancer chemotherapy. Although the physical structure of TYMS and the molecular mechanisms of TYMS catalyzing the conversion of dUMP to dTMP have been conducted thorough studies, oligomeric structure remains unclear. Here, we show that human TYMS not only exists in dimer but also octamer by intermolecular Cys43-disulfide formation. We optimize the expression condition of recombinant human TYMS using Escherichia coli system. Using HPLC-MS/MS, we show that purified TYMS has catalytic activity for producing dTMP. In the absence of reductant β-mercaptoethanol, SDS-PAGE and size exclusion chromatography (SEC) showed size of TYMS protein is about 35 KDa, 70 KDa, and 280 KDa. While the Cys43 was mutated to Gly, the band of ~280 KDa and the peak of octamer disappeared. Therefore, TYMS was determined to form octamer, dependent on the presence of Cys43-disulfide. By measuring Steady-State Parameters for monomer, dimer and octamer, we found the k_cat of octamer is increased slightly than monomer. On the basis of these findings, we suggest that octamer in the active state might have a potential influence on the design of new drug targets.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

In view of the fact that the field monitoring information can more intuitively and accurately reflect the stability state of slopes, this paper takes the warning threshold of slope deformation rate monitoring as the slope stability evaluation standard, and puts forward a method for solving the safety coefficient of rocky slopes. The discrete element method 3DEC, which is suitable for rocky slopes, is selected as the numerical calculation tool, and the convergence criterion of its strength reduction method is modified to the slope deformation rate threshold, and the method is realized by the bifurcation method through its built-in FISH programming language. The results of the classical case show that, by selecting the slope deformation rate threshold in the appropriate interval, the results of this paper's method are very close to those of the finite unit stress method and the limit equilibrium method, which verifies the reliability of this paper's method. Further, the method of this paper is applied to an open-pit mine slope project, based on the slope deformation on-site monitoring data, through the time series prediction method to determine the slope deformation rate warning threshold, using the threshold as an evaluation criterion to solve the slope's coefficient of safety, the calculation results show that: the slope's coefficient of safety in natural working conditions is 1.086, basically stable, suffered from continuous rainfall, the slope body is gradually saturated, the slope's coefficient of safety is reduced to 0.987, the slope's safety is reduced to 0.987. After continuous rainfall and gradual saturation of the slope, the coefficient of safety decreased to 0.987, destabilizing and destroying, which is consistent with the site conditions.

Based on 2010, 2013 and 2015 CGSS data, the impact of Internet use and social capital on the income gap among farmers in the past five years is assessed at three time points using the OLS method and a quantile regression method. The study finds that (1) the income gap among farmers increases continuously in the five-year period, while Internet use plays a positive impact on farmers’ income growth in all five quartiles; the coefficient differences are all significantly negative, indicating that Internet use plays a positive role in alleviating the income gap between high-income and low-income farmer subgroups, and (2) social capital plays a positive role in moderating the income gap among farmers and that Internet use by farmers expands the boundary of social capital, which in turn increases the income level of and alleviates the income gap among farmers.

The effects of heating rate before solution treatment and cooling rate after solution treatment on the morphological distribution and evolution of precipitation phase of nickel-based single crystal superalloy were studied. The dissolution, precipitation and growth of precipitation phase and matrix phase during heat treatment were analyzed by means of high power scanning electron microscopy. The results show that the morphology of precipitated phase has nothing to do with the distribution of precipitated phase and the heating rate in the heating process, but the cooling rate in the cooling process affects the shape, size and distribution of precipitated phase. The faster the cooling rate, the smaller the precipitated phase is, the more irregular the shape is, the smaller the equivalent edge length is, and the smaller the channel width of matrix phase is.

There are abundant coal, oil and natural gas resources in "Golden Triangle" energy region. Energy resources development, coal chemical industry, coal power and other industries play an important role in promoting regional economic growth, but facing the insufficient water supply. Under the condition of marginal equilibrium of water resources, the paper firstly analyzes the water utilization, and calculates the potential water-saving amount. Then, the paper constructs a cooperative game model and allocates the newly increased GDP by using the weight distribution method. Finally, the paper puts forward some policy suggestions to reduce the efficiency gap of water utilization among regions.

Industrial process control systems commonly exhibit features of time-varying, strong coupling, and strong nonlinearity. Obtaining accurate mathematical models of these nonlinear systems and achieving satisfactory control performance is still a challenging task. In this paper, data-driven modeling techniques and deep learning methods are used to accurately capture a category of smooth nonlinear system’s spatiotemporal features. The operating point of these systems may change over time, and their nonlinear characteristics can be locally linearized. We established the LSTM-CNN-ARX model by utilizing a fusion of long short-term memory (LSTM) network and convolutional neural network (CNN) to fit the coefficients of the state-dependent exogenous variable autoregressive (SD-ARX) model. Compared to other models, the hybrid LSTM-CNN-ARX model is more effective in capturing the nonlinear system’s spatiotemporal characteristics due to its incorporating the strengths of LSTM for learning temporal characteristics and CNN for capturing spatial characteristics. The model-based predictive control (MPC) strategy, namely LSTM-CNN-ARX-MPC, is developed by utilizing the model's local linear and global nonlinear features. The control comparison experiments conducted on a water tank system (WTS) show the effectiveness of the developed models and MPC methods.

Panax notoginseng is a traditional Chinese medicine, and saponins are its main active ingredients. The content of saponins in flower of P. notoginseng is the highest in the whole plant. Minor ginsenosides have stronger pharmacological activity than main ginsenosides, but its content in nature is very low. We can use extracted total saponins from P. notoginseng flower as the substrate to produce minor ginsenosides by biotransformation method. In this study, we used the fungus Talaromyces flavus and its crude enzymes to transform the extracted total saponins of P. notoginseng flower. Through the qualitative and quantitative analysis of the transformation substrates and products, it was found that minor ginsenosides Gyp-XVII, ginsenosides C-Mc1, C-Mx1, F2, Rg3, 20(R)-Rg3, Rk1 and Rg5 were found in the products and the conversion rate of the major saponins in P. notoginseng flower ranged from 44.16 to 55.22%, the yields of the minor ginsenosides ranged from 0.05 to 3.24%. This study provided a good experimental idea, greatly increased the utilization rate of total saponins in P. notoginseng flower, and laid a foundation for promoting the wide application of minor saponins.

Jade waste is a normal byproduct that makes up much more than the amount of jade extracted. Therefore, recycling jade waste is worth investigating from the point of view of energy conservation. Moreover, it is an environment-friendly material, which is desirable for use in building materials. In this study, Xiuyan jade waste was repurposed as antibacterial additives for building coatings. The powder waste was activated by milling and subsequent annealing. The antibacterial properties of the treated waste were mostly related to the annealing temperatures. Based on the investigations of the phase change and the release of metal ions of a series of samples and their antibacterial activities, the antibacterial mechanism of the treated samples was explored experimentally. The most applicable sample for coatings was finally chosen by considering its pH values and its antibacterial abilities. Antibacterial testing showed that the addition of treated jade waste could enhance the bacterial inhibition rate of building coatings from 60% to 99.9%.

The Sugarcane yellow leaf virus (SCYLV) is associated with sugarcane yellow leaf disease (SCYLD) and is considered to be the most economically deleterious emerging pathogen that represents a potential threat and danger to sugarcane cultivation in China. Over the last two decades, high genetic diversity in the SCYLV genotypes was observed worldwide, with a greater chance of YLD incidence for sugarcane injury. SCYLV infection has significantly damaged its economic traits and is responsible for substantial losses in biomass production in sugarcane cultivars. This study aims to identify and comprehensively analyze sugarcane microRNAs (miRNAs) as therapeutic targets against SCYLV using plant miRNA prediction tools. Mature sugarcane miRNAs are retrieved and are used for hybridization of the SCYLV. A total of seven common sugarcane miRNAs were selected based on consensus genomic positions. The biologically significant, top ranked ssp-miR528 was consensually predicted to have a potentially unique hybridization site at nucleotide position 4162 for targeting the ORF5 of the SCYLV genome; this was predicted by all the algorithms used in this study. Then, the miRNA–mRNA regulatory network was generated using the Circos algorithm, which was used to predict novel targets. There are no acceptable commercial SCYLV-resistant sugarcane varieties available at present. Therefore, the predicted biological data offer valuable evidence for the generation of SCYLV-resistant sugarcane plants.

A mild, efficient, and photocatalytic synthesis of 6-phosphorylated phenanthridines via tandem radical addition/cyclization/aromatization of 2-isocyanobiphenyls with diarylphosphine oxides is reported. The method features operational simplicity, metal-free conditions, using low-cost rose Bengal as catalyst and sustainable air as terminal oxidant at room temperature, and providing the desired products in moderate to good yields.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

Lead halide perovskite has become a promising candidate for high-performance photodetector (PD) applications due to its attractive optical and electrical properties such as high optical absorption coefficient, high carrier mobility, and long carrier diffusion length. However, the presence of highly toxic lead in these devices has limited their practical applications and even hindered their progress toward commercialization. Therefore, the scientific community has been committed to searching for low-toxic and stable perovskite-type alternative materials. Lead-free double perovskite materials, which are still in the preliminary stage of exploration, have achieved inspiring results in recent years. In this review, we mainly focused on two types of lead-free double perovskite based on different Pb substitution strategies, including A2M(I)M(Ⅲ)X6 and A2M(IV)X6. We reviewed the research progress and prospects of lead-free double perovskite photodetectors in the past three years. And more importantly, from the perspective of optimizing inherent defects in materials and improving device performance, we proposed some feasible pathways and made an encouraging perspective for the future development of lead-free double perovskite photodetectors.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Amidst the challenges posed by the COVID-19 crisis, marked variations in individuals' resilience and vulnerability have emerged. This eight-month longitudinal study engaged 535 community adults (58% female, M_age = 43.97) to explore the nuanced aspects of coping and personal growth during the challenging period. Grounded in Self-Determination Theory, the research examines the influence of autonomy support from close others—manifested through active listening and providing choices—on psychological need satisfaction (i.e., autonomy, competence, and relatedness), integrative regulation of emotions; posttraumatic growth; and subjective well-being (positive affect and life satisfaction). Structural equation modeling revealed that, over time, the experience of psychological need satisfaction was intricately related to integrative regulation, posttraumatic growth, positive affect, and life satisfaction. Notably, the impact was partially mediated by autonomy support. These findings shed light on the pivotal role that autonomy supported relationships play in fostering personal growth and meaning making during life's difficult junctures. The study underscores the practical significance of purposeful support from close others and paves the way for future research endeavors.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Prosocial behavior is vital for positive social development among adolescents, contributing to improved peer relationships, emotional well-being, and social competence. Gratitude, a positive emotion arising from recognizing and appreciating benefits received from others, has been identified as a potential contributor to adolescent prosocial behavior. This study aimed to investigate the mediating roles of social support and basic psychological needs in the relationship between gratitude and prosocial behavior among adolescents. A total of 390 middle school students participated in a longitudinal study, completing questionnaires assessing gratitude, social support, basic psychological needs, and prosocial behavior at two time points with a six-month interval. The results indicated that gratitude positively correlated with social support, basic psychological needs, and prosocial behavior. Structural equation modeling revealed that social support and basic psychological needs partially mediated the relationship between gratitude and adolescent prosocial behavior. Moreover, a chain-like mediation effect was observed, wherein social support influenced basic psychological needs, which in turn predicted prosocial behavior. These findings emphasize the importance of gratitude in fostering prosocial behavior among adolescents and highlight the mediating roles of social support and basic psychological needs in this relationship.

COVID-19 transmission models have conferred great value in informing public health understanding, planning, and response. However, the pandemic also demonstrated the infeasibility of basing public health decision-making on transmission models with pre-set assumptions. No matter how favourably evidenced when built, a model with fixed assumptions is challenged by numerous factors that are difficult to predict. Ongoing planning associated with rolling back and re-instituting measures, initiating surge planning, and issuing public health advisories can benefit from approaches that allow state estimates for transmission models to be continuously updated in light of unfolding time series. A model being continuously regrounded by empirical data in this way can provide a consistent, integrated depiction of the evolving underlying epidemiology and acute care demand, offer the ability to project forward such a depiction in a fashion suitable for triggering the deployment of acute care surge capacity or public health measures, support quantative evaluation of tradeoffs associated with prospective interventions in light of the latest estimates of the underlying epidemiology. We describe here the design, implementation and multi-year daily use for public health and clinical support decision-making of a particle filtered COVID-19 compartmental model, which served Canadian federal and provincial governments via regular reporting starting in June 2020. The use of the Bayesian Sequential Monte Carlo algorithm of Particle Filtering allows the model to be re-grounded daily and adapt to new trends within daily incoming data – including test volumes and positivity rates, endogenous and travel-related cases, hospital census and admissions flows, daily counts dose-specific vaccinations administered, measured concentration of SARS-CoV-2 in wastewater, and mortality. Important model outputs include estimates (via sampling) of the count of undiagnosed infectives, the count of individuals at different stages of the natural history of frankly and pauci-symptomatic infection, the current force of infection, effective reproductive number, and current and cumulative infection prevalence. Following a brief description of model design, we describe how the machine learning algorithm of particle filtering is used to continually reground estimates of dynamic model state, support probabilistic model projection of epidemiology and health system capacity utilization and service demand and probabilistically evaluate trade-offs between potential intervention scenarios. We further note aspects of model use in practice as an effective reporting tool in a manner that is parameterized by jurisdiction, including support of a scripting pipeline that permits a fully automated reporting pipeline other than security-restricted new data retrieval, including automated model deployment, data validity checks, and automatic post-scenario scripting and reporting. As demonstrated by this multi-year deployment of Bayesian machine learning algorithm of particle filtering to provide industrial-strength reporting to inform public health decision making across Canada, such methods offer strong support for evidence-based public health decision making informed by ever-current articulated transmission models whose probabilistic state and parameter estimates are continually regrounded by diverse data streams.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

Reconstruction of acoustic relaxation absorption curve is a powerful approach to ultrasonic gas sensing, but requires known of a series ultrasonic absorption at various frequencies around effective relaxation frequency. Ultrasonic transducer is a most widely deployed sensor for ultrasonic wave propagation measurement and works only at a fixed frequency or specific environment like water, so a large number of ultrasonic transducers operating at various frequencies are required to recover an acoustic absorption curve with a relative large bandwidth, which cannot suit for large-scale practical applications. This paper proposes a wideband ultrasonic sensor using a distributed Bragg reflector (DBR) fiber laser for gas concentration detection through acoustic relaxation absorption curve reconstruction. With a relative wide and flat frequency response, the DBR fiber laser sensor measures and restores a full acoustic relaxation absorption spectrum of CO2 using a decompression gas chamber between 0.1 and 1 atm to accommodate the main molecular relaxation processes, and interrogates with a non-equilibrium Mach-Zehnder (M-Z) interferometer to gain a sound pressure sensitivity of -45.4 dB. The measurement error of the acoustic relaxation absorption spectrum is less than 1.32%.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

The features of a class of cubic curves with a shape factor are analyzed by means of the theory of envelope and topological mapping. The effects of the shape factor on the cubic curves are made clear. Necessary and sufficient conditions are derived for the curve to have one or two inflection points, a loop or a cusp, or to be locally or globally convex. Those conditions are completely characterized by the relative position of the edge vectors of the control polygon and the shape factor. The results are summarized in a shape diagram, which is useful when the cubic parametric curves are used for geometric modeling. Furthermore we discussed the influences of the shape factor on the shape diagram and the ability for adjusting the shape of the curve.

Carbon dots have received much attention due to their unique physicochemical properties and diverse applications in bioimaging, optoelectronic devices, catalysis, and agriculture. Here in this work, we report a simple hydrothermal synthesis of nitrogen and phosphorus-doped carbon dots (N, P-CDs). The optical and physical properties of the synthesized N, P-CDs were analyzed using systematical spectroscopy and electrical characterization. The synthesized N, P-CDs show strong photoluminescence at 626 nm and demonstrate high stability under UV light and other conditions. Moreover, we incorporate the synthesized N, P-CDs into water spinach by root spraying and leaf spraying. It was found that N, P-CDs could effectively promote the growth of water spinach by increasing the photosynthetic rate, and the content of total phenols and anthocyanins in water spinach

In recent years, functional fluidic electrohydrodynamic (EHD) pumps have attracted considerable attention due to their remarkable features, such as simple structure, quiet operation, and energy-efficient utilization. EHD liquid pumps can be used in various industrial applications, like flow transfer, thermal management, and actuator drive. In this paper, the author reviewed EHD liquid pump research in these specific aspects: the first observation of the EHD effect, its mathematical modeling, and the choice of pump structure, electrode configuration, and working medium. Based on the review, a summary of the development and latest research on EHD pumps can be provided for the readers.

Nitric oxide (NO) is a key molecule in cardiovascular homeostasis and its abnormal delivery is highly associated with the occurrence and development of cardiovascular disease (CVD). The assessment and manipulation of NO delivery is crucial to the diagnosis and therapy of CVD, such as endothelial dysfunction, atherosclerotic progression, pulmonary hypertension, and cardiovascular manifestations of Coronavirus (COVID-19). However, due to the low concentration and fast reaction characteristics of NO in cardiovascular system, the clinical applications centered on the NO delivery are challenging. In this tutorial review, we first summarized the methods to estimate the in vivo NO delivery process based on the clinical images and mathematical modeling to assess the endothelial function and vulnerability of atherosclerotic plaque. Then, the emerging bioimaging technologies that have the potential to directly measure the arterial NO concentration were discussed, including the Raman spectroscopy and electrochemical sensor. Aside from the diagnostic methods, therapies aimed at controlling NO delivery to regulate CVD were reviewed, including the inhaled NO therapy to treat the pulmonary hypertension and COVID-19, stem cell therapy and NO-releasing platform to treat endothelial dysfunction and atherosclerosis.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Sugarcane mosaic virus (SCMV) is a deleterious pathogen which causes widespread Sugarcane mosaic disease (SCMD) and is classified in the genus Potyvirus (Potyviridae), disseminated by the aphid vector. RNA interference (RNAi)-mediated antiviral innate immunity is a key biological process and antiviral defence system to interfere with viral genomes for controlling plant pathogens. The current study aims to analyze sugarcane (Saccharum officinarum L. and Saccharum spp.) locus-derived microRNAs (sof-miRNAs/ssp-miRNAs) with predicted potential for targeting the SCMV +ssRNA-encoded mRNAs, using ‘five algorithms’ approach. The ultimate goal in this research is to mobilize the in silico endogenous predicted sof-miRNAs/ssp-miRNAs to trigger RNAi catalytic pathway experimentally and generate sugarcane cultivars for evaluating potential antiviral resistance monitoring capability and capacity for SCMV. Experimentally validated mature sugarcane (S. officinarum, 2n = 8X = 80) and (S. spp., 2n = 100-120) sof-miRNAs/ssp-miRNAs (n = 28) were acquired for alignment with the SCMV genome. Of the 28 targeting mature locus-derived sof-miRNAs/ssp-miRNAs investigated, one sugarcane miRNA homolog, sof-miR159c, was concluded to localize potential binding site at genomic nucleotide site 3847 targeting CI ORF of SCMV. In order to validate target prediction accuracy, whether the sugarcane sof-miRNA/ssp-miRNA might bind predicted SCMV mRNA target(s), we created an integrated Circos plot. Genome-wide in-silico-predicted miRNA-mediated target gene regulatory network validated interactions that warrant in vivo analysis. The current work provides valuable evidence and biological material for generating SCMV-resistant sugarcane varieties.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

Endophytic bacteria, especially those participate in nitrogen fixation, play critical roles in supplying essential nutrients for legume plant growth. Compared to the numerous bacterial microbiome reports targeting legume roots and nodules, little is known about embryonic bacteria that facilitate plant nutrient utilization after seed germination. Here, we collected and investigated endophytic bacterial microbiomes in edible pea (Pisum sativum) embryos using five representative cultivars and a pea sprout control. Twenty-six nitrogen-fixing bacteria (NFBs) were isolated from pea embryos, with three strains found in fresh pea (FGP) and snow pea (SP) exhibiting the strongest nitrogenase activity. Some NFB isolates are also potassium-solubilizing bacteria (KSBs) or phosphorus-solubilizing bacteria (PSBs) utilizing inorganic and/or organic phosphorus. All 26 NFBs showed variable levels of indole-3-acetic acid (IAA) secretion. The nutrient-solubilizing NFBs identified in our research are valuable resources for biofertilizer development. At the microbiome level, high-throughput 16S ribosomal RNA (rRNA) sequencing of 40 bacterial collections from pea embryos revealed similar community structures and species abundances and diversities in most samples. Our embryo-derived endophytic bacterial pool provides a microbiome platform for seed dormancy and germination research of edible peas.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

Abstract: Based on the survey data of 5 large grain-producing provinces in China, this paper studies the effect of agricultural production trusteeship on agricultural carbon emission reduction by using a propensity score matching method. The empirical results show that the carbon emission of wheat reduces by 7.107kg/mu, with a decrease rate of 15.5% after participating in agricultural production trusteeship. Among them, chemical fertilizers, manpower input, agricultural chemicals and diesel oil respectively reduces with rates of 14.2%, 27.7%, 14.1%, and 6%. However, there are differences in the facilitation effects of different trusteeship services, with the best promotion effect of field management services, followed by cultivation, planting and harvest services, and then agricultural material supply services, the ATT is -6.160, -5.732 and -5.530, respectively. Meanwhile, there are differences in the promotion effects for farm households with different factor endowments. The promotion effect is better for small farm households with 1 type of agricultural machinery or less, and an operation scale of 7 mus or less. Therefore, in order to better play the role of agricultural production trusteeship on agricultural carbon emission reduction, the government should vigorously support its development and guide more smallholders to choose agricultural production trusteeship.

Based on the survey data of 5 large grain-producing provinces in China, we studied the promo-tion effect of the agricultural production trusteeship on high quality production of grain by using a propensity score matching method. The empirical results show that the high-quality production of grain level increased by 0.292, with an increase of 87.4% after participating in agricultural production trusteeship. Among them, the level of high efficiency, premiumization, greenization and branding of grain production has respectively increased by 0.234, 0.373, 0.208, and 0.158. However, there are differences in the facilitation effects of different trusteeship services, with the best promotion effect of agricultural material supply services, followed by post-harvest services, and then land management services and cultivating and harvesting services, the ATT is 0.287, 0.230, 0.158, and 0.139, respectively. Meanwhile, there are differences in the promotion effects for farm households with different factor endowments. The promotion effect is better for small farm households with 3 laborers or less, a land management scale of 10 mus or less, and 1 type of ag-ricultural machinery or less. Therefore, in order to give full play to the promotion effect of agri-cultural production trusteeship on high quality production of grain, the government should vigorously support its development and guide more smallholders to choose agricultural produc-tion trusteeship.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

Cannabinoid metabolites have been reported to be more potent than the parent compounds. Among them, Ajulemic acid (AJA) is a synthetic analogue of Δ9-THC-11-oic which will be a good template structure for discovery of more potent analogues. Herein, we optimized the key allylic oxidation step to introduce the C-11 hydroxy group with high yield. And a series of compounds were prepared with this condition applied including HU-210, 11-Nor-Δ8-Tetrahydrocannabinol-9-carboxylic acid and Δ9-THC-COOH.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

In this paper, 6063 aluminum alloy for common building profiles is used as the research object. By adding a new Al-Ti-C-La composite alloy, the effect of 6063 aluminum alloy on the microstructure and properties of 6063 aluminum alloy is studied. The results show that Al-Ti-C-La composite alloy has obvious effect on grain refinement of 6063 aluminum alloy. With the addition of Al-Ti-C-La composite alloy, the grain size decreased significantly. When the addition amount of Al-Ti-C-La composite alloy is 1%, the grain size is reduced from 482 μm to 121 μm. Rare earth La is mainly distributed near the Mg2Si phase and β-AlFeSi, and complex compounds such as AlFeSiMgLa are formed. After aging for 270 days on the basis of T6 heat treatment, the tensile strength and elongation of 6063 aluminum alloy augmented with the addition of Al-Ti-C-La composite alloy, and the Vickers hardness gradually diminished. When the addition amount of Al-Ti-C-La composite alloy is 1%, the tensile strength, elongation and Vickers hardness of 6063 aluminum alloy reach 177.2 MPa, 17.8% and 60.9 HV, respectively, and the tensile strength is increased by 16.3%. The elongation is increased by 50.8%, the Vickers hardness is reduced by 15.4%, and the fracture of the alloy is mainly ductile fracture.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Innovation is an essential key factor in the technology development history. Past research on innovation focused more on the innovation behavior of technology, but seldom described knowledge assets which also influence innovation behavior greatly. The effect of knowledge assets attribute and result on disruptive innovation is therefore regarded as the research topic in this study, where disruptive innovation is divided into outbound and inbound to combine combination-embeddednessandmajor business specificityof knowledge assets as the research model. Manufacturing enterprises in China are proceeded the questionnaire survey, and 173 valid copies are collected. The empirical analysis shows that combination-embeddedness of knowledge assets presents significantly positive effects on major business specificity and outbound innovationof an enterprise but reveals remarkably negative effects on inbound innovation. Enterprises are suggested to constantly accumulate knowledge assets with low major business specificity before disruptive innovation in order to reduce ineffective inbound innovation.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

COX II containing a dual core CuA active site is one of the three core subunits of mitochondrial Cco, which plays a significant role in the physiological process. In this report, the full-length cDNA of COXⅡ gene was cloned from Sitophilus zeamais, which had an ORF of 684 bp encoding 227 amino acids residues. The predicted COXⅡ protein had a molecular mass of 26.2 kDa with pI value of 6.37, and multiple sequence alignment and phylogenetic analysis indicated that Sitophilus zeamais COXⅡ had high sequence identity 78.51% with the COXⅡ of other insect species, especially similarity to sitophilus oryzae. This gene was subcloned into the prokaryotic expression vector pET-32a, and induced by IPTG in E.coli Transetta (DE3) expression system. Finally the COXⅡ with 6-His tag was purified using affinity chromatography with Ni²⁺-NTA agarose. WB showed the recombinant COXⅡ was about 44 kD, and the concentration of fusion protein was 50μg/mL. UV-spectrophotometer and infrared spectrometer analysis showed that recombinant COXⅡ could catalyze the oxidation of substrate Cytc, and influenced by AITC. It was found that AITC could form a hydrophobic region with COXⅡ protein via molecular docking, besides, a sulfur atom of AITC structure could form a length of 2.9 Å hydrogen bond with Leu-31. These results will provide valuable information for elucidating the role of COXⅡ in Sitophilus zeamais responses to AITC, meanwhile, it will helpful to carry out a point mutation in AITC binding sites for the future research.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.

Abstract：This paper uses the balanced panel data from 29 provinces (autonomous regions and municipalities) in China for a total of 17 years from 2000 to 2016 as a research sample, and establishes an empirical model to examine the impact of environmental regulations and technological innovation on the quality of economic growth. Then this paper test technological innovation as a threshold variable, in which play a regulatory role. Taking the provincial balanced panel data as a research sample, a fixed effect model, a system GMM model, and a panel threshold model were established for empirical testing and the robustness test. Based on the empirical results, this article draws the following conclusions: from a national perspective, environmental regulations and technological innovation can significantly promote the quality of economic growth; from a regional perspective, there are regional differences in impact effects. Under the constraints of environmental regulations, the promotion effect of technological innovation on the quality of economic growth will be reduced; the impact of environmental regulation on the quality of economic growth will have a "threshold effect", and environmental regulation can significantly promote the quality of economic growth only after crossing the threshold and the threshold of technological innovation.

Trophoblast cell-surface antigen 2 (Trop 2) is a transmembrane glycoprotein that is highly expressed in various cancer types with relatively low or no baseline expression in most of normal tissues. Its overexpression is associated with tumor growth and poor prognosis; Trop 2 is therefore, an ideal therapeutic target for epithelial cancers. Several Trop 2 targeted therapeutics have recently been developed for the treatment of cancers, such as anti-Trop 2 antibodies and antibody-drug conjugates (ADCs), as well as Trop 2-specific cell therapy. In particular, the safety and clinical benefit of Trop 2-based ADCs have been demonstrated in clinical trials across multiple tumor types, including those with limited treatment options, such as triple-negative breast cancer, platinum-resistant urothelial cancer, and heavily pretreated non-small cell lung cancer. In this review, we elaborate on recent advances in Trop 2 targeted modalities and provide an overview of novel insights for future developments in this field.

The hydrodynamic behavior of the air-acetic acid system in a bubble column is studied using a differential pressure transmitter, double probe optical fiber probe, and the electrical resistance tomography (ERT) technique. The superficial gas velocity ranges from 0.016 to 0.094 m/s under ambient temperature and pressure. The influences of viscosity and surface tension on gas holdup, bubble rising velocity, and bubble chord distribution in the column are discussed with different mass fractions of an acetic acid solution. The results show that as the mass fraction of acetic acid increases, the surface tension of the liquid phase decreases, and the viscosity first increases and then decreases. This causes the gas holdup in the column to first increase and then decrease, and reaches the maximum value at an acetic acid mass fraction of 55% to 60%. The rising velocity of the bubbles in the column is high in the central region and has a low-value distribution near the wall. The bubble chord length distribution is concentrated, and the distribution of the bubble chord length in the column becomes narrow with any decrease in surface tension. Studying the hydrodynamic behavior of a bubble column with the air-acid system is of great significance considering the absence of data on air-organic acid systems.

The research fills the policy research gap for the women entrepreneurship and sustainability performance for examining key successful factors. Previous women entrepreneurship research fails to offer policy recommendations. The research purpose is to investigate these factors affect women entrepreneurship capabilities and sustainability performance by using SEM analysis and making policy recommendation. This research employs online and mail survey and obtains 175 women entrepreneur sample. The study finds that family support and motivation have positive effect on women entrepreneurship capabilities and sustainability performance. Barriers have no effect on performance. Hopefully, the research can provide the guidance to contribute to women’s entrepreneurship opportunities for achieving SDGs. Policy recommendation and managerial implication are discussed in the article.

Antibiotic resistance (ABR) is concerning issue due to its direct and indirect repercusions on public health, since decreased therapeutic effect of certain antibiotic to treatment complications that can cause death. There are several mechanism as to how ABR can be transferred from one microoorganisms to another, and many of them are dependant many environmental factors. The food supply chain is a environment in which ABR gene transfer can occur is multiple pathways, which generate concerns regarding food safety. Here, we summarize relevant mechanisms which are implied in ABR in food supply chain but also we are addressing routes of transmission and prevalence of ABR, implications on public health, and the application of new alternatives to antibiotics such as antimicrobial peptides, mainly bacteriocins, in order to countermeasure ABR.

Economic development and advancements in information technology contributed to the shift on accounting objective from commission responsibility view to decision-making useful view. The decision-making useful view claims that the accounting measurement methods should be changed to improve the usefulness of accounting information, to enable information users to make correct decisions. In addition, the development of financial instruments leads to the birth of fair value accounting. In recent years, fair value has been one of the most important measurement methods in the International Accounting Standard and US Generally Accepted Accounting Principles. However, China has been quite cautious when it comes to applying fair value full time, especially after the global financial crisis happened in 2008, wherein fair value accounting was exposed to strong suspicion. Hence, studying the value relevance of fair value is of great significance to exploring the accounting profession and reforming accounting standards. This paper attempts to investigate the value-relevance of fair value based on the data of listed financial companies and manufacturing companies in China. The results indicate that the fair value information in the financial industry has a strong explanatory influence to corporate share price. In contrast, the fair value information shows limited relevance in the manufacturing industry. Finally, consulting with the results of normative analysis and empirical study, this paper suggests several rational advices for the application of fair value in China.

Trichothecene mycotoxin T-2 toxin is an important environmental pollutant and poses a global threat to human and animal health. T-2 toxin could induce nephrotoxicity, however, the precise molecular mechanism remains unclear. In this study, the mice were intraperitoneally administrated with a single dose of 2 mg/kg T-2 toxin. The kidney function and ultrastructural observation were also assessed and found T-2 toxin exposure could cause kidney damage. Transmission electron microscopy showed a significant swelling and vacuolization of the mitochondria of renal cell. A total of 1122, 58, and 391 differential expression genes (DEGs) that were predominantly expressed in kidney tissues at 1 d, 3 d, and 7 d after T-2 toxin exposure, respectively. Early transcriptomic changes at 1 d after exposure were down-regulation of DEGs involved in the cell cycle, p53 signaling pathway, and cellular senescence, while up-regulation of DEGs referred to the ribosome pathway. The temporal variations in gene expression pattern in T-2 toxin exposure in mice kidney were presented and cellular metabolism was disturbed at the exposure recovery period with 7 d. In conclusion, this study, for the first time, provided a comprehensive comparative transcriptomic analysis of gene regulation in T-2 toxin exposure-induced nephrotoxicity at different temporal periods and explored the nephrotoxicity mechanism of T-2 toxin at the mRNA level.

Atopic dermatitis (AD) is a chronic inflammatory skin disease, which can cause skin barrier function damaged. Although co-incubation with docosahexaenoic acid (DHA) exerts a positive effect in deficient skin model, there is no study to investigate the effects of topical treatment with DHA in inflammatory reconstructed human epidermis (RHE) model. The effects of DHA on monolayer normal human epidermal keratinocyte (NHEK) cells were evaluated via CCK-8, qPCR and ELISA. The skin related barrier function was assessed by hematoxylin-eosin (HE) staining, western blot (WB), Immunohistofluorescence (IF) and ELISA in normal and inflammatory RHE models. DHA upregulated filaggrin and loricrin expression at mRNA levels in addition to suppress overexpression of TNF-α，IL-1α and IL-6 stimulated by poly I:C plus LPS (stimulation cocktail) in cultured NHEK cells. After topical treatment with DHA, cocktail induced inflammatory characteristics of skin diseases including barrier morphological, differentiation proteins and TSLP secretion, which were alleviated in RHE models. Supplementation with DHA can improved related barrier function and have anti-inflammation effects in monolayer keratinocytes and RHE models, which indicated that DHA may have a potential value for the treatment of inflammation-associate skin diseases.

Technology can be seen everywhere and has been integrated into our lives.We are always using technology and enjoying the convenience brought by technology. However, physical retailers and e-commerce companies are also gradually adopting advanced technologies. Technology improves the purchasing environment and purchasing experience. Virtual reality and augmented reality have been hotly discussed in recent years. Technology, although virtual reality and augmented reality technology have not yet matured, it can be said that they will in the future It has great development potential. Virtual reality and augmented reality are also beginning to sprout in the retail industry. However, research on the acceptance of the use of virtual reality and augmented reality in the apparel shopping process is still lacking because This study explores how usefulness, ease of use, hedonicity, customer experience, customer engagement and satisfaction. To influence customer loyalty, this study adopted questionnaire survey and convenience sampling methods, and collected a total of 308 valid questionnaires. The analysis method used confirmatory factor analysis and structural equation model to verify the research hypothesis relationship. The results of this study found. Hedonic has a significant impact on customer loyalty, while usefulness, ease of use, customer experience, customer engagement and satisfaction Satisfaction does not have a significant impact on customer loyalty. This study explains the academic contribution of the research results. The practical implications in marketing are put forward, and specific suggestions and directions for future research are given.

Rhododendron chrysanthum Pall., live in Changbai Mountain being exposed to chilling temperature, high light intensities and water scarcity condition. To adapt to the harsh environment, the cold resistance mechanisms of R. chrysanthum have been successfully evolved in the long-term adaptive process. In our present work, the methods of proteomics combined with physiological and biochemical analyses were used to investigate the effects of cold stress on the photosynthesis and antioxidant system of Rhododendron chrysanthum Pall. and the molecular mechanisms involved in cold resistance of plants. A total of 153 photosynthesis related proteins were identified in present work, of which 7 proteins including Rubisco large subunit (rbcL) were up-regulated in experiment group (EG) compared with control group (CG). Simultaneously, four chlorophyll fluorescence parameters were measured in present study. The results showed that the maximum photochemical efficiency of photosystem II (Fv/Fm), actual quantum yield of PSII (Y(II)) and photochemical quenching (qP) were significantly higher in EG, whereas the non-photochemical quenching (NPQ) was notably decreased. Cold stress could lead to a significant reduction in electron transport rate (ETR) accompanied with an increase in excitation pressure (1-qP). The abundance of PetE which involved in the plants photosynthetic electron transfer was also significantly influenced by cold stress. Moreover, the up-regulated expressions and higher levels of enzymatic activities of Glutathione peroxidase (GPX) and Ascorbate peroxidases (APXs) were detected in EG. All these changes which can help plants to survive in low temperature are considered as the crucial parts of cold tolerance mechanisms. These results revealed that photosynthesis and redox adjustment play significant roles in the defense of cold-induced damage.

Epitranscriptomic RNA modifications play a crucial role in the posttranscriptional regulation of gene expression. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic RNA and plays a pivotal role in RNA fate. RNA m6A modification is regulated by a group of cellular proteins, methyltransferases (writers) and demethylases (erasers), which add and remove the methyl group from adenosine, respectively. m6A modification is recognized by a group of cellular RNA-binding proteins (readers) that specifically bind to m6A-modified RNA, mediating effects on RNA stability, splicing, transport, and translation. The functional significance of m6A modification of viral and cellular RNA is an active area of virology research. In this review, we summarize and analyze current literature on m6A modification of HIV-1 RNA, the multifaceted functions of m6A in regulating HIV-1 replication, and the role of viral RNA m6A modification in evading the innate immune responses to infection. Furthermore, we briefly discuss future directions and therapeutic implications of mechanistic studies of HIV-1 epitranscriptomic modifications.

In this study, an improved UPLC-MS method for simultaneously quantifying twelve major components belonging to two chemical types was developed and validated, and was applied to quantitatively compare the quality of Astragali Radix sulfur-fumigated with different durations and the fresh reference sample. The results showed that the contents of triterpenes Astragaloside III and Astragaloside IV decreased moderately, while the flavonoids calycosin, formononetin, and 7,2'-dihydroxy-3',4'-dimethoxyisoflavane decreased significantly, and its corresponding flavonoid glycosides increased accordingly, which indicatied that the happening of chemical transformation of flavonoids and glycosides in the sulfur-fumigated process. These transformations were further confirmed by the the synthesis of flavonoid glycosides under the simulated sulphur-fumigation circumstances. Furthermore, the sulfur-fumigated duration had a proportional relationship with the contents of compounds 7, 11, and 12. All these results suggested that the established method was precise, accurate and sensitive enough for the global quality evaluation of sulfur-fumigated Astragali Radix, and sulfur-fumigation can not only change the proportions of bioactive components, but also cause the chemical transformation in the Astragali Radix.

Threshing device is the core component of grain combine harvester, and its working performance determines the working quality and production efficiency of the harvester to a great extent. The straw guide plate plays an important role in the threshing device to dredge the threshing matter and control the threshing time of the combine harvester matter in the threshing chamber. In the past, the guiding structure of threshing device could not optimize the working performance of the machine by adjusting the spiral angle, that is, most cereal combine harvester may not be fed smoothly or even clogged when operating under different crop types, yield differences and operating environments, a kind of threshing device with adjustable guide straw board was studied. In this study, the movement model of the straw on the straw guide plate was analyzed, and it was found that the spiral angle “α”of the straw guide was 0<α<58°.Three-factor and three-level response surface method was used to carry out field experiment on drum speed, working speed and guide grass plate spiral angle, and the experimental data were analyzed by quadratic polynomial regression.The results show that the drum speed, working speed and the spiral angle of the guide grass plate have significant effects on the loss rate (PLR) , impurity content (PIR) and breakage rate (PBR) , the drum speed and working speed have an interactive effect on the impurity ratio (PIR) , and the working speed and the helical angle of the guide grass plate have an interactive effect on the loss ratio (PLR) and breakage ratio (PBR) , there is an interaction between the rotary speed of the roller and the helical angle of the guide grass plate on the crushing rate (PBR) .Further optimization analysis showed that the predicted value was PLR = 1.18% , PIR = 0.72% , PBR = 0.53% , the experimental verification value was PLR = 1.26% , PIR = 0.73% , PBR = 0.61% . The absolute error between the experimental value and the predicted value was very small, however, the optimized field test verified value decreased by 8.31% , 50.04% and 60.30% respectively, which indicated that the optimized harvester had better operation quality, in particular, PIR, PBR and other two indicators have a greater increase in the effect.

Due to the long-term deformation settlement of foundations, issues such as damage and functional failure of buildings and structures have long been of concern in the engineering field. The creep of soil is one of the primary causes leading to long-term deformation of foundations. In this paper, the consolidation deformation, creep characteristics, and creep model of reconstituted saturated silty clay were studied by isotropic compression test and triaxial shear creep test. The results show that for the isotropic compression test, although the applied load adopts different stages of loading, as long as the final applied confining pressure is the same, the number of stages applied by the confining pressure has little effect on the final isotropic consolidation deformation of the sample and the triaxial undrained shear strength after creep. However, for the triaxial shear creep test, it is found that under the same final deviatoric stress, the final deviatoric strain of the sample is closely related to the number of loading stages of deviatoric stress. It shows that the more loading stages of the sample loaded with the same deviatoric stress, the smaller the final deviatoric strain, and the triaxial undrained shear strength of the sample after creep will increase. In addition, it is reasonable to determine the pore pressure dissipation of the sample to 95%((u0-u0)/u0=95%) as the main consolidation end time (tEOP) of the sample. The isotropic consolidation creep curves and the triaxial shear creep curves show certain nonlinearity. Then the logarithmic model and the hyperbolic model were used to fit the creep curves of the samples. It is found that the hyperbolic model has a better fitting effect than the logarithmic model, but for the triaxial shear creep test, the creep parameters of the sample change greatly. Therefore, studying the creep characteristics of soil under different pre-loading steps is of significant engineering importance for evaluating the long-term deformation of underground structures.

Background: The COVID-19 outbreak has accelerated the huge difference between medical care and disease prevention in Chinese medical institutions. This study aimed to investigated the relationship between the symbiotic units, environments, models, and effects of the integration of medical and disease prevention. Methods: This cross-sectional study involved 762 employees of public hospitals in 11 cities in Zhejiang Province by random stratified sampling. We analyzed the influence paths of elements in the mechanism of integration of medical and disease prevention and the mediating effect of symbiotic models among symbiotic units, symbiotic environments, and effects for on this integration. Results: The path coefficient of symbiotic unit on the symbiosis model was 0.46 (p&lt;.001), the path coefficient of symbiotic environment on symbiosis model was 0.52 (p&lt;.001). The path coefficient of the symbiotic unit and environment was 0.91 (p&lt;.001). The symbiotic models exhibited a partial mediation effect between symbiotic units and the effect of this integration. Sobel test = 3.27, β = 0.152, and the mediating effect accounted for 34.6%. Conclusions: It is suggested that Health policy-makers and public hospital managers should provide sufficient symbiotic units, establish collaborative symbiotic models, and improve the effects of integration of medical and disease prevention in public hospitals.

To understand lung damage caused by COVID-19, we deduced two-phase lung damage mechanisms. After the lungs are infected with SARS-CoV-2 virus, the affected lung tissue swells and surface properties of pulmonary capillaries change, resulting in an increased flow resistance of affected capillaries. If a sufficient number of capillaries are affected by the infection, the swelling and increased cell wall adhesion collectively raise pulmonary vascular resistance. The increased vascular resistance further increases the dwell times of WBCs in affected capillaries and nearly capillaries. When pulmonary pressure is sufficiently higher, WBCs are forced to squeeze into interstitial spaces or alveolar spaces when local pressures are higher than what the capillaries can withstand. When more and more WBCs are dynamically retained, the flow resistance of more capillaries rises, pulmonary vascular resistance rises, and pulmonary pressure rises. The rise in the pulmonary pressure in turn results in elevated capillary pressures. When capillary pressures around the alveoli are sufficiently high, they cause interstitial pressures to change from normally negative values to positive values. The positive pressures cause fluid leakage to the alveolar space and thus degrade lung function. Tissue swelling, and occupation of WBCs in interstitial spaces and alveolar spaces further reduce compressible volume, and thus cause further rise in the pulmonary vascular resistance and pulmonary pressure. When the pulmonary pressure has reached a critical point as in the second phase, the blood breaks capillary walls and squeezes through interstitial spaces to reach alveolar spaces, resulting in irreversible lung damages. The available free volume in the thorax cage, organ usable capacities, temperature and humid are expected to have great impacts on degree of lung damages. The free volume in the thorax cage, lung usable surplus capacity, and other organ usable capacities determine the arrival time of last-phase irreversible damage. The mechanisms imply that the top priority for protecting lungs is maintaining pulmonary micro-circulation and preserving organ functions in the entire disease course while controlling viral reproduction should be stressed in the earliest time possible. The mechanisms also explain leukecytes are recruited and migrated into inflamed tissues by increasing their dwell times caused by increased local flow resistance.

After reviewing cancer theories, cancer treatment development histories, randomized clinical trial's performance, cancer treatment strategy, trial follow-up times, and conducting numerous simulations using existing data, the authors found: (1) medical treatments come with three to four lethal factors: treatment side-effects, emotional distress and chronic dress, lack of exercises or physical inactivity, and excessive nutrition in some cases; (2) clinical trial exaggerates the benefits of fast-acting treatments and underestimates the slow-delivering adverse side effects as a result of statistical averaging, interfering effects of personal lifestyle factors, and insufficient follow-up times; (3) the benefits of medical treatments are limited by chain comparison, where surgery sets up a negative standard relative to the best way for resolving cancer; (4) the strategy of destroying the tumor is unworkable; (5) medical treatments can turn natural cancer growth curve into approximately doubly exponential curve; (6) multiple factor non-medical measures are much more powerful than medical treatments in controlling cancer growth and metastasis rates; and (7) cancer early diagnosis and over treatments are bad strategies that have great adverse impacts on cancer patients. Based on huge increases in cancer growth rate constants, substantial of loss of organ functional capacity, and severe systemic aging-like cellular damages, the authors concluded that medical treatments promote cancer growth and metastasis rates and shorten patient lives in most cases, and the claimed benefits are caused by triple biases of clinical trials. The authors believe that the better strategy for ending the global cancer epidemic is abandoning clinical trails as the research model, changing caner treatment strategy from killing cancer cells to slowing down cancer growth rates by using multiple factors optimization approach in personalized medicine.

This paper studies the contemporaneous relationship between S&P 500 index returns and log-increments of the market volatility index (VIX) via a nonparametric copula method. Specifically, we propose a conditional dependence index to investigate how the dependence between the two series varies across different segments of the market return distribution. We find that: (a) the two series exhibit strong, negative, extreme tail dependence; (b) the negative dependence is stronger in extreme bearish markets than in extreme bullish markets; (c) the dependence gradually weakens as the market return moves toward the center of its distribution, or in quiet markets. The unique dependence structure supports the VIX as a barometer of markets' mood in general. Moreover, applying the proposed method to the S&P 500 returns and the implied variance (VIX²), we find that the nonparametric leverage effect is much stronger than the nonparametric volatility feedback effect, although, in general, both effects are weaker than the dependence relation between the market returns and the log-increments of the VIX.

In this study, we investigated the effects of three surface treatment techniques on 316L stainless steel, low-temperature immersion corrosion, shot peening followed by immersion corrosion, and electrochemical corrosion. Surface alterations were analyzed using scanning electron microscopy, Raman spectroscopy, and α-step thin-film thickness profiling. Human osteoblast adhesion was evaluated using Liu’s stain and metallographic optical microscopy. The results revealed weak cell adhesion after low-temperature immersion and shot peening followed by immersion corrosion. By contrast, electrochemical corrosion, particularly with a high current density and low corrosive solution concentration, resulted in a uniformly corroded surface, thus promoting dense cell adhesion. All three techniques resulted in porous oxide layers. Overall, our experimental findings highlighted shot peening (1 kg/cm2 for 20 s) and electrochemical corrosion (0.5 M HCl) as effective processes. Electrochemical corrosion produced uniformly dense corrosion pits, whereas shot peening produced semicircular grooves with small corrosion pits, both favorable for cell adhesion. Electrochemical corrosion also yielded excellent cell adhesion, emphasizing its suitability for biomedical activity. We developed a process for creating a porous surface layer and thereby enhancing the cell adhesion to 316L stainless steel for potential biomedical implant applications.

We aimed to evaluate the protective effects of acetyl-xylogalactan on the activity of RAW264.7 macrophages against heat stress. To this end, we assessed cell survival, phagocytic activity, in-tracellular Ca2+ level, mitochondria potential exchange, apoptotic assay findings, galactosidase activity and the RNA-seq by NGS and real-time polymerase chain reaction (PCR) expression. In our evaluation of macrophage morphology at 37°C and 41°C, the macrophages showed an oval shape at 41°C , unlike the spindle shape at 37°C. Therefore, 41°C was chosen as the heat stress condition. Subsequently, we designed an experiment to evaluate changes in the RAW264.7 macrophages after acetyl-xylogalactan treatment under heat stress. The survival of RAW264.7 macrophages treated with acetyl-xylogalactan was higher than that of controls that were not treated with acetyl-xylogalactan. Moreover, on the basis of the results of the annexin-V detection assay, the apoptotic activity of macrophages appeared to have reduced after treatment with ac-etyl-xylogalactan. Moreover, treatment with acetyl-xylogalactan resulted in a stronger recovery trend in the intracellular Ca2+ and mitochondrial membrane potential after heat stress. RNA sequencing and real-time polymerase chain reaction (PCR) illustrated that Sarcodia suieae acetyl-xylogalactan could upregulate the expression of the anti-apoptosis Cflar gene and down-regulate the expression of the apoptosis factors Ddit3, and Hyou1 to protect macrophages under heat stress.

The fatigue delamination damage is one of the most important fatigue failure modes of laminated composite structures. However, the developments of the theoretical framework, mathematical/physical model and numerical simulation of fatigue delamination are still challenging issues, and there is a lack of systematic classification. This article reviews the experimental phenomena of the onset and propagation stage of delamination under fatigue loading, and summarizes the commonly used phenomenological models for laminated composite structures. The research methods, general modeling formulas and development prospects of the phenomenological models are presented in detail. In the light of the analysis of finite element model (FEM) for the laminated composite structures, a number of simulation methods of fatigue delamination crack propagation damage model are carefully classified. Furthermore, within the theoretical framework of strength theory model (SM), fracture mechanics model (FM), damage mechanics model (DM) and hybrid model (HM), the complete procedure, application, capability assessment, advantages and limitations of the models are also discussed in detail. Finally, several valuable suggestions are given for the research interests, and challenging technical problems that need to be overcome on the fatigue delamination prediction of laminated composite structures in the future.

For the last two decades, an increasing demand for low-cost adsorbents for drinking water treatment has been challenged in the rural areas of developing countries that have problems with arsenic (As) contamination. In this work, spent bleaching earth (SBE), a residual material that is formed during the process of refining vegetable oil, has been utilized to prepare the new magnetic adsorbent Fe-SBE/C by modifying its surface area through calcination and co-precipitation with iron. The experimental results demonstrate that Fe-SBE/C exhibits a substantial adsorption capacity towards both arsenite (As(III)) and arsenate (As(V)). Optimal pH conditions were found to be pH 10 for As(III) and pH 3 for As(V), resulting in adsorption percentages of 76.7% and 94.1%, respectively. Other experimental parameters such as calcination conditions, adsorbent dosage, iron-loading ratio, and the presence of co-existing ions were thoroughly investigated. The kinetic study revealed that the adsorption processes follow the Elovich and intraparticle diffusion models, suggesting a combined adsorption mechanism of boundary layer control and chemisorption. Furthermore, the isotherm followed the Langmuir model with a maximum adsorption capacity of 202.61 μg g-1 for As(III) and 187.61 μg g-1 for As(V). Through thermodynamic analysis and reinforcement by activation energy data, this research validates that the observed adsorption process is indicative through chemisorption. The regeneration study revealed the potential for multiple cycles of arsenic removal, highlighting the practical applicability of Fe-SBE/C in environmental contexts. In conclusion, the findings of this study underscore the efficacy of Fe-SBE/C in arsenic removal and present it as a promising and environmentally friendly solution for mitigating arsenic pollution.

Many types of banana (Musa spp.)—one of the most economically important horticultural crops—exist, and their ploidy (diploid, triploid, and tetraploid, usually) and genome types (containing A or/and B genome in most cases) differ. At present, observation and genome type detection are commonly used to identify banana germplasm resources. However, the former is tedious, while the latter cannot distinguish categories below genome types. It is therefore urgent that a simple and effective method for identifying banana germplasm resources is established. We sequenced and analyzed the ribosomal DNA internal transcribed spacer (ITS) sequences of 62 banana germplasm and found that the sequencing peaks, especially the 20 bp region near the 420 bp position (referred to as the “420 bp region”), exhibited relatively recognizable and repeatable polymorphism characteristics. Using the “420 bp region” as a marker, we were able to quickly distinguish bananas belonging to different genome type groups (comprising the AA, AB, AAA, ABB, AAB, ABBB, AAAB, and AAAA groups) or different subgroups in the same genome type group (for example, the Cavendish, Gros Michel, Red, Lakatan, and Ibota Bota subgroups in the AAA group; and the Pisang Raja, Plantain, Pome and Silk subgroups in the AAB group). Moreover, it appeared that Sanger sequencing of ITS could be used for identifying banana hybrid offspring. These results demonstrated that the banana ITS region contains rich genetic information that is useful for genotyping. In general, ITS sequencing simplifies the classification of banana germplasm resources and has potential application in several areas of Musa improvement.

Under the dual background of underemployment and health inequality, this paper empirically analyzes the impact of education level on underemployed workers’ health based on CLDS2016 data. The results show that underemployment is significantly related to the decline of self-rated health, increased depression tendency, and morbidity in a certain period. The results indicate that underemployment can significantly reduce the health level of workers in the low education level group and the high education level group. However, it has no significant impact on workers’ health in the middle education level group; even if we change the measurement method of indicators and consider endogeneity, the research conclusion is still robust. Moreover, this kind of health inequality mainly comes from the difference in economic effect and leisure effect of underemployment to workers with different educational levels. This paper provides empirical support for increasing the labor protection mechanism of underemployed people and reducing the health inequality caused by educational level differences.

Leucokinins (LKs) constitute a neuropeptide family first discovered in a cockroach and later identified in numerous insects and several other invertebrates. The LK receptors are only distantly related to other known receptors. Among insects, there are many examples of species where genes encoding LKs and their receptors are absent. Furthermore, genomics has revealed that LK signaling is lacking in several of the invertebrate phyla and in vertebrates. In insects, the number and complexity of LK expressing neurons vary, from the simple pattern in the larva of Drosophila where the entire CNS has 20 neurons of three main types, to cockroaches with about 250 of many different types. Common to all studied insects is the presence or 1-3 pairs of LK-expressing neurosecretory cells in each abdominal neuromere of the ventral nerve cord, that, at least in some insects, regulate secretion in Malpighian tubules. This review summarizes the diverse functional roles of LK signaling in insects, as well as other arthropods and mollusks. These functions include regulation of ion and water homeostasis, feeding, sleep-metabolism interactions, state-dependent memory formation, as well as modulation of gustatory sensitivity and nociception. Other functions are implied by the neuronal distribution of LK, but remain to be investigated.

Cancer/testis (CT) antigens exhibit selective expression predominantly in immunoprivileged tissues in non-pathological contexts but are aberrantly expressed in diverse cancers. Because of their expression pattern, they have historically been attractive targets for immunotherapies. The investigation of mechanistic roles of CT antigens in promoting oncogenesis has historically been a prominent research question, and a growing number of studies implicate CT antigens in promoting almost all the hallmarks of cancer. This suggests that CT antigens may act as cancer drivers. CT antigens are expressed in head and neck squamous cell carcinomas, although their role in the pathogenesis, prognostication, and treatment for this family of cancers remains poorly studied. Given that CT antigens hold intriguing potential as therapeutic targets and as biomarkers for prognosis and therapeutic response and that they can provide novel insights into oncogenic mechanisms, their further study in the context of head and squamous cell carcinoma is warranted.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a positive sense single stranded RNA genome containing virus which has infected millions of people all over the world particularly China. The virus has been mutating rapidly enough resulting in the emergence of new variants and sub-variants which have reportedly been spread from Wuhan city of China, the epicenter of the virus, to the rest of China and all over the world. The occurrence of mutations in the viral genome especially in the viral spike protein region has resulted in the evolution of multiple variants and sub-variants which gives the virus benefit of host immune evasion and render the modern-day vaccines and therapeutics ineffective. Therefore, there is a continuous need to study the genetic characteristics and evolutionary dynamics of the SARS-CoV-2 variants. Hence, in this study, a total of 833 complete genomes of SARS-CoV-2 variants (including the wild-type or reference sequence) from Taiyuan and Wuhan cities of China were genetically characterized and studies their phylogenetic and evolutionary dynamics using phylogenetics, genetic similarity, and phylogenetic network analysis. Our results show a lot of useful information regarding the evolutionary dynamics of the viral variants, their genetic similarities/dissimilarities, and their phylogenetic relationships. It has been reported in this study that the SARS-CoV-2 variants have nine recombinant events which suggest very important information regarding the viral evolution. In addition, the phylogenetic network analysis shows the number of mutations resulting in emergence and clustering of the viral variants of both cities which reveal significant information regarding the phylodynamics of the virus. This study, to the best of our knowledge, is the first ever genetic comparative study of Taiyuan and Wuhan cities. This study will help better understand the virus, cope with the emergence, and spread of new variants at local level as well as at international level and inform the public health authorities to make better informed decisions in designing new viral vaccines and therapeutics.

As the adoption of renewable energy sources grows, ensuring a stable power balance across various time frames has become a central challenge for modern power systems. In line with the "dual carbon" objectives and the seamless integration of renewable energy sources, harnessing the advantages of various energy storage resources and coordinating the operation of long-term and short-term storage have become pivotal directions for future energy storage deployment. To address the complexities arising from the coupling of different time scales in optimizing energy storage capacity, this paper proposes a method for energy storage planning that accounts for power imbalance risks across multiple time scales. Initially, the Seasonal and Trend decomposition using the Loess (STL) decomposition method is utilized to temporally decouple actual operational data. Subsequently, power balance computations are performed based on the obtained data at various time scales to optimize the allocation of different types of energy storage capacities and assess the associated imbalance risks. Finally, the effectiveness of the proposed approach is validated through hourly applications using real-world data from a province in China over recent years.

In recent years, video anomaly detection technology , which can intelligently analyze massive video and quickly find abnormal phenomena, has attracted extensive attention with the wide application of video surveillance technology . To address the complex and diverse problem of abnormal human behavior detection in surveillance videos, a surveillance video abnormal behavior detection and localization supervised method based on the deep network model and the traditional method is proposed. Specifically, we combined AGMM and YOLACT methods to obtain more accurate foreground information by fusing the foreground maps extracted by each technique. To further improve the accuracy , we use the PWC-Net technique to extract features of the foreground images and input them into an anomaly classification model for classification. The proposed method effectively detects and locates the abnormal behavior in the monitoring scene. In addition to the aforementioned methods, this paper also employs YOLOV5 and DeepSORT networks for object detection and tracking in the video, which allows us to track the detected objects for better understanding of the scene in the video. Experiments on the UCSD benchmark dataset and the comparison with state-of-the-art schemes prove the advantages of our method.

The cuttlebone-like structure is a complex porous bionic structure with asymmetric sinusoidal S-shaped wall structure connecting laminar septa, and studies have shown that the cuttlebone-like structure has light weight, high strength and excellent energy absorption capability. It has become an important research to investigate the mechanical mechanism of cuttlebone-like structure and to design a bionic structure beyond nature structure based on it. In order to investigate the mechanical properties of the static compression and shearing processes of the cuttlebone-like structure, this paper establishes theoretical formulas and analyzes the influence of dimensionless parameters such as height-to-thickness ratio $\lambda$, period-to-thickness ratio $\xi$ and amplitude to period ratio $\eta$ on the compression and shearing processes with the help of ABAQUS finite element software.The parameter sensitivity analysis method was used to compare the important influence degree of each dimensionless parameter on the mechanical properties of the structure and to determine the relative optimal parameters of the structural mechanical properties under compression and shearing. Based on the relatively optimal parameter of the cuttlebone-like structure, the cross-sectional geometry of the structure is improved to build a new cuttlebone-like structure.The experimental results showed that the new cuttlebone-like structure with revised cross-section improved the mechanical properties of the cuttlebone-like structure.The study results are of theoretical guidance to enhance the mechanical properties and geometric design of cuttlebone-like structures.

Nowadays the relationship between planning land use and actual land use is not so clear in general. A lot of efforts have been put in the failures of regulation for the expansion of construction land. However, it still lacks an integrated approach to study the effectiveness of land use regulation in terms of different land use types. Furthermore, the existing evaluation of land use plan mainly focuses on a general level, a detailed research on the regulation effectiveness of each construction land use type is absent. Therefore, this research tries to evaluate regulation effectiveness of land use plan, which takes Cangwu country, Guangxi Province as an example. The finding by analysis is that the total area of construction land expansion was about 3494.73 ha, nearly 1.1 times of the plan quota. Moreover, the effectiveness differs greatly in various construction land use types. Town, industrial/mining sites can be well regulated through the quota of land use plan. While, the quota regulation system is not as effective for other type of construction land. Thus, we suggest to improve the regulation effectiveness of construction land through different plan instruments.

The vegetation types on the Qinghai-Tibet Plateau are complex and diverse, and the ecological environment is fragile and sensitive. It is very important to study the dynamic changes in vegetation and the main factors related to these changes to grasp the present state of the regional ecosystem, maintain the balance of the ecosystem and promote the sustainable development of the ecosystem. Therefore, this paper is based on SPOT/VEG NDVI (normalized difference vegetation index) data, land use data, topographic data and meteorological data from 1999 to 2019. The spatiotemporal variation in the NDVI over the Tibetan Plateau in the last 21 years and its response to different driving factors were investigated by using the Sen slope method, Mann–Kendall mutation test, partial correlation analysis and geographical detector method. The results showed that (1) the vegetation coverage on the Qinghai-Tibet Plateau showed an increasing trend from 1999 to 2019, with increases in approximately 67.00% of the plateau area. (2) The spatial differences in vegetation coverage were large; notably, low-density vegetation areas decreased obviously, moderate-density vegetation areas accounted for approximately 50% of the total area, high-density vegetation areas were the least common, and the overall growth rate was significant. (3) The NDVI was positively correlated with temperature and precipitation, and a positive correlation was observed in more than 66% of the region. (4) The order of the influence of single driving factors on the NDVI was as follows: precipitation > soil type > altitude > temperature > gradient > slope > population density > GDP. (5) The effect of multiple factors was significantly higher than that of single driving factors, with a notable nonlinear influence. The interactions between meteorological factors, such as precipitation, and topographic factors, such as altitude, were important, with a q value over 0.79.

GaN ultraviolet photodetector with metal-semiconductor-metal structure is achieved by growing on a periodic trapezoid column-shape patterned sapphire substrate using metalorganic chemical vapor deposition. Under 5-V reverse bias, the photodetector fabricated on such patterned sapphire substrate exhibits a lower dark current, a higher photocurrent, and a 476 % enhancement in the maximum responsivity as compare with those of the photodetector fabricated on conventional flat sapphire substrate. It is also found that the much larger UV-to-visible rejection ratio and the fact that responsivity drops in a smaller cut-off region are observed from photodetector fabricated by using a periodic trapezoid column-shape patterned sapphire substrate. These phenomena may all be attributed to the reduction of threading dislocation density and the improved quality of GaN film, as well as the internal reflection and/or scattering effect on the interface between GaN film and the periodic trapezoid column-shape pattern of the substrate.

This study aimed at exploring what role artificial intelligence techniques could play in the futural numerical analysis. In this paper, a convolutional neural network techniques based on modified loss function is proposed as a surrogate of finite element method(FEM). Several surrogate-based physics-informed neural networks(PINNs) are developed to solve representative boundary value problems based on elliptic partial differential equations (PDEs). Results from the proposed surrogate-based approach are in good agreement with ones from conventional FEM. It is found that modification of the loss function could improve the prediction accuracy of the neural network. It is indicated that to some extent the artificial intelligence technique could replace conventional numerical analysis as a great surrogate model.

Based on the marine natural products piperafizine B, X334 and our previously reported compound 4m, fourteen novel 3,6-diunsaturated 2,5-diketopiperazine (2,5-DPK) derivatives (1-2, 4-6, 8-16), together with two known ones (3 and 7), were designed and synthesized as anticancer agents against cell lines A549 and Hela. The MTT assay results showed that the derivatives 6, 8-12 and 15 had moderate to good anticancer capacities with the IC50 values ranging from 0.7 to 8.9 μM. Among them, compound 11 with naphthalen-1-ylmethylene and 2-methoxybenzylidene functions at the 3- and 6-positions of 2,5-DPK ring, respectively, displayed good inhibitory activities to both cancer cells A549 (IC50 = 1.2 μM) and Hela (IC50 = 0.7 μM). It could also induce apoptosis and obviously block the cell cycle progression at G2/M phase in both cells at 1.0 μM. The electron withdrawing functions might not be favorable for the derivatives with high anticancer activities. Additionally, compared to piperafizine B and X334, these semi-N-alkylated derivatives have high liposolubilities (&gt; 1.0 mg•mL-1). Compound 11 can be further developed aiming to the discovery of novel anticancer candidate.