Null-flux Electro-dynamic suspension (EDS) system promises to be one of the feasible high-speed maglev systems above 600 km/h. On account of its greater current-carrying capacity, superconducting magnet can provide super-magnetomotive force that is required for null-flux EDS system and cannot be provided by electromagnets and permanent magnets. There is already a relatively mature high-speed maglev technology with low temperature superconducting (LTS) magnets as the core, which works in the liquid helium temperature region (T≤4.2 K). 2-Generation high temperature superconducting (HTS) magnet winded by REBa2Cu3O7−δ (REBCO, RE=rare earth) tapes works above 20 K region and do not need to count on liquid helium which is rare on earth. This paper designed HTS no-insulation closed-loop coils applied for EDS system and energized with persistent current switch. The coils can work at persistent current model and has premier thermal quench self-protection. Besides, a full size double-pancake module was designed and manufactured in this paper, and it was tested in liquid nitrogen. The double-pancake module’s critical current is about 54 A and it is capable of working at persistent current model, whose average decay rate measured in 12 hours is 0.58%/day.

The impacts of inflation on international finance are generally reflected in the decline of buying power, risks of investment and deposit loss from currency devaluation. For the purpose of optimized allocation and management of asset values, i.e., annual income or research grants, a framework of a three-level model for static financial management is presented to maximize banking interests, bonuses, and the remaining balance after spending necessary expenditures. Meanwhile, in retrospect to higher-level financial inflation, strategies of dynamic investment, i.e., posing regular tests of flipping coins, exploiting variations of the currency exchange rate, as well as applying the theory of broad money, are presented to increase the appreciation rate of net assets in and post the era of COVID-19. Quantitative evaluations in case studies verify the feasibility of improving the financial situation, indicating broader applications for budgeting and investing when US inflation rate is below 3.0%. Besides, combining approaches of static and dynamic strategies, the expected annual growth rate of individual zero-risk asset investment is predicted as within the range of 8.30~9.62% according to budgeted appreciation on net assets in 12 months, which is capable of overcoming negative impacts from higher level annual inflation, i.e., those as highest as 8.01% in the Year 2022.

Recently, the phase-sensitive OTDR (Φ-OTDR) based vibration sensor system has gained the focus of many researchers and some efforts have been undertaken to push further the limitations imposed on the performance of the Φ-OTDR sensor system. Then, progress in the different areas of its performance evaluation factors such as: improvement of the signal-to-noise ratio (SNR), spatial resolution (SR) in the sub-meter range, enlargement of the sensing range, frequency response bandwidth over the conventional limit and phase signal demodulation for quantitative measurement have been realized. This paper presents an overview of the recent progress in the Φ-OTDR based vibration sensing system in the different areas mentioned above.

The aim of this paper is to use the elementary method and the properties of the second kind Stirling numbers to study the congruence properties of a new sequence, which is closely related to Fubini polynomials and Euler numbers, and give some interesting congruences for it. This solves a problem proposed by the first author at an unpublished paper.

The Yixian Formation (Lower Cretaceous) of China is famous worldwide for its fossils of early angio-sperms, but there is only one record of flower bud hitherto. A previous fossil record of flower bud just showed the appearance and lacked any internal details. Such a lacuna in knowledge of flower buds hin-ders our understanding of the evolution of flowers. Our new specimen was collected from an outcrop of the Yixian Formation (the Barremian-Aptian, Lower Cretaceous) near Dawangzhangzi, Lingyuan, Liao-ning, China. The specimen was observed and photographed using a Sony ILCE-7 digital camera and a Nikon SMZ1500 stereomicroscope, and details were observed using a TESCAN MAIA3 SEM. Our ob-servations document a fossil flower bud, Archaebuda cretaca sp. nov, from the Lower Cretaceous of China. The occurrence of two species of Archaebuda in the Yixian Formation not only confirms the ex-istence of the expected gynoecium (and possible androecium) in a flower bud, but also underscores the occurrence of typical flowers in the Early Cretaceous.

Mulberry (Morus alba L), a significant fruit tree crop, requires magnesium (Mg) for its optimal growth and productivity. Nonetheless, our understanding of the molecular basis underlying magnesium stress tolerance in mulberry plants remains unexplored. In our previous study, we identified several differential candidate genes associated with Mg homeostasis via transcriptome analysis including xyloglucan endotransglucosylase/hydrolase (XTH) gene family. The XTH gene family is crucial for plant cell wall reconstruction and stress responses. These genes have been identified and thoroughly investigated in various plant species. However, there is no research pertaining to XTH genes within the M. alba plant. This research systematically examined the M. alba XTH (MaXTH) gene family at the genomic level using a bioinformatic approach. In total, 22 MaXTH genes were discovered and contained the Glyco_hydro_16 and XET_C conserved domains. The MaXTH’s were categorized into five distinct groups by their phylogenetic relationships. The gene structure possesses four exons and three introns. Furthermore, the MaXTH gene promoter analysis reveals a plethora of cis-regulatory elements; mainly stress responsiveness, growth and development, light responsiveness, and phytohormone responsiveness. GO analysis indicated that MaXTHs encode proteins that exhibit xyloglucan xyloglucosyl transferase and hydrolase activities in addition cell wall biogenesis as well as xyloglucan and carbohydrate metabolic processes. Moreover, a synteny analysis unveiled an evolutionary relationship between the XTH genes in M. alba and those in three other species: A. thaliana, P. trichocarpa, and Zea mays. Expression profiles from RNA-Seq data displayed distinct expression patterns of XTH genes in M. alba leaf tissue during Mg treatments. Real-time quantitative PCR analysis confirmed the expression of the MaXTH genes in Mg stress response. Overall, this research enhances our understanding of the characteristics of MaXTH gene family members and lays the foundation for future functional genomic study in M. alba.

In light of advancing technology, the conventional clock network architecture has become inadequate for addressing the intricacies inherent in modern System-on-Chip (SoC) designs. While clock mesh topology offers resilience against On-Chip Variation (OCV) fluctuations, it still necessitates manual intervention. Therefore, substantial scope exists for methodological enhancements and the refinement of rapid analytical techniques. This paper introduces a novel clock mesh synthesis approach, underpinned by dynamic programming algorithms, that guarantees latency constraints. Our experimental findings demonstrate that our algorithm achieves an additional 26.6% reduction in power consumption compared to the baseline methodology. Furthermore, it substantially reduces runtime by an average of 78.0% when contrasted with traditional simulation methods. These results highlight the potential of our methodology for enhancing the efficiency and power management of clock mesh.

Sympatric distribution and temporal overlap of cryptic zooplankton species pose a challenge to the framework of the niche differentiation theory and the mechanisms allowing competitor coexistence. We applied the methods of phylogenetic analysis, DNA taxonomy and statistical analysis to study the temporal distribution patterns of cryptic B. calyciflorus species, an excellent model, in three lakes, and to explore the putative mechanisms for their seasonal succession and temporal overlap. The results showed that in the warm-temperate Lake Yunlong, B. fernandoi and B. calyciflorus s.s. underwent a seasonal succession, which was largely attributed to their differential adaptation to water temperature. In the subtropical Lake Jinghu, B. fernandoi, B. calyciflorus s.s. and B. dorcas exhibited both seasonal succession and temporal overlap. Seasonal successions were largely attributed to their differential adaptation to temperature, and temporal overlap resulted from their differential responses to algal food concentration. In the tropical Lake Jinniu, B. calyciflorus s.s. persisted throughout the year, and overlapped with B. dorcas for 5 months. Temporal overlap resulted from their differential responses to copepod predation. These results indicated that the temporal distribution pattern of cryptic B. calyciforus species and the mechanism allowing competitor coexistence vary with different climate zones.

Fructan, a fructose polymer, is used as carbohydrate reserve in many plants. The nutritional and therapeutic benefits of fructans have attracted increasing interest by consumers and food industry. In the course of evolution, many plants have developed the ability of regulating plant frunctan metabolism genes to produce different structures and chain length fructans, which are strongly correlated with their survival in harsh environments. De nevo domestication of fructan-rich plants based on genome editing is a viable and promising approach to improve human dietary quality and reduce the risk of chronic disease. These advances will greatly facilitate breeding and production of tailor-made fructans as a healthy food ingredient from wild plants such as polygonati rhizoma. The purpose of this review is to broaden our knowledge on plant fructan biosynthesis, evolution and beneficial applications for human health.

In our article in Genome Biology Ecology six years ago, one complete plastid genome of Belian was assembled for comparative analyses of the plastomes in Lauraceae. However, Ariati et al. (2023) concluded that our sequenced Belian individual could be located in the clade of Myristicaceae instead of that of Lauraceae. Here, we performed re-analyses of additional two Belian plastomes, along with 42 plastomes from plants spanning ten families of the Magnoliids. The plastomes of the three Belian individuals range from 157,535 to 157,577 bp in length. Comparative genomic analysis revealed 170 mutation sites in their plastomes, which include 111 substitutions, 53 indels, and six microinversions. Phylogeny was reconstructed using maximum likelihood and Bayesian approaches for 44 magnoliids species indicated that our three Belian individuals are nested among the species in the family Lauraceae rather than Myristicaceae.

Land plants have undergone their great diversification and evolution in the past 400 million years. Although appearing complex and hard to grasp, the evolution of plants centers around an invariable core development process, SRC (Sexual Reproductive Cycle). Various modifications have been added sequentially to this core process, and thus creating various novel organs and distinguishing their bearers one from another. Reproductive organs of all land plants, including sporangium, megasporangium, metamegasporangium (= ovule), and various metamegasporangium complexes, are derived from terminal sporangia in the earliest land plants. Throughout the million-year-long evolution, plants sequentially recruit associating accessories to protect their vulnerable core parts (spore and gamete). The occurrence of every single of these novelties is a stair marking land plant reproduction evolution and leads to enhanced offspring development conditioning (ODC).

Abstract: Safety issues related to the electrification of more electric aircraft (MEA) need to be addressed because of the increasing complexity of aircraft electrical power systems and the growing number of safety-critical sub-systems that need to be powered. Managing the energy storage systems and the flexibility in the load-side plays an important role in preserving the system’s safety when facing an energy shortage. This paper presents a system-level centralized operation management strategy based on model predictive control (MPC) for MEA to schedule battery systems and exploit flexibility in the demand-side while satisfying time-varying operational requirements. The proposed online control strategy aims to maintain energy storage (ES) and prolong the battery life cycle, while minimizing load shedding, with fewer switching activities to improve devices lifetime and to avoid unnecessary transients. Using a mixed-integer linear programming (MILP) formulation, different objective functions are proposed to realize the control targets, with soft constraints improving the robustness of the model. Besides, an evaluation framework is proposed to analyze the effects of various objective functions and the prediction horizon on system performance, which provides the designers and users of MEA and other complex systems with new insights into operation management problem formulation.

Analyzing horse behavior is crucial for assessing training quality, particularly in accurately identifying actions like standing, walking, and running. Research has been conducted both domestically and internationally in this regard; however, challenges persist, including reliance on single sensors, poor real-time performance, and low identification accuracy. In view of these challenges, this study investigated real-time identification of horse behavior based on wearable devices. The system, centered around a microcontroller and utilizing a 4G network as a carrier, employs multi-axis IMU sensors as input sources to perceive horse posture. The study proposed a behavior classification method based on analysis of acceleration thresholds. The method consists primarily of two sequential stages: first, the resultant acceleration interval counting method, which employs a nonlinear segmentation approach for initial behavior classification; and second, the statistical analysis of variance parameters between segments, which when coupled with multi-level threshold processing, achieves a refined classification. Experimental results indicated that the interval counting method alone achieved an accuracy of 87.55%, while for the variance analysis method alone the accuracy was 90.87%. The proposed method, comprising the two stages, reached a classification accuracy of 91.57%, underpinning its usefulness in supporting future equine research.

Plant Factory Transplanter (PFT) is a key component of the plant factory system. Its operation status directly affects the quality and survival rate of planted seedlings, which in turn affects the overall yield and economic efficiency. To monitor the operation status and transplanting quality of a transplanting machine in a timely manner, the primary task is to use a computerized and easy-to-use method to monitor the transplanting units. Inspired by the latest developments in augmented reality and robotics, a DT model-based and data-driven online monitoring method for plant factory transplanting equipment is proposed. First, a data-driven and virtual model approach is combined to construct a multi-domain digital twin of the transplanting equipment. Then, taking the vibration frequency domain signal above the transplanting manipulator and the image features of the transplanting seedling tray as input variables, the evaluation method and configuration method of the PFT digital twin system are proposed. Finally, the effect of the transplanter is evaluated, and the cycle can be repeated to optimize the transplanter to achieve optimal operation parameters. The results show that the digital twin model can effectively use the sensor data to identify the mechanical vibration characteristics and avoid affecting transplanting quality due to mechanical resonance. At a transplanting rate of 3000 plants/h, the transplanting efficiency can be maintained at a high level and the vibration signal of X, Y, Z-axis above the transplanting manipulator is relatively calm. In this case, Combined the optimal threshold method with the traditional Wiener algorithm, the identification rate of healthy potted seedlings can reach 94.3%. Through comprehensively using the optimal threshold method and 3D block matching filtering algorithm for image threshold segmentation and denoising, the recognition rate of healthy seedlings has reached over 96.10%. In addition, the developed digital twin can predict the operational efficiency and optimal timing of the detected transplanter, even if the environmental and sensor data are not included in the training. The proposed digital twin model can be used for damage detection and operational effectiveness assessment of other plant factory equipment structures.

The main idea of this paper is to investigate the exact solutions and dynamic properties in optical nanofibers, which is modeled by space-time fractional perturbed nonlinear schr\"odinger equation involving Kerr law nonlinearity with conformal fractional derivative. Firstly, by the complex fractional traveling wave transformation, the traveling wave system of the original equation is obtained, then a conserved quantity, namely the Hamiltonian is constructed, and the qualitative analysis of this system is conducted via this quantity by classifying the equilibrium points. Moreover, the prior estimate of the existence of the soliton and periodic solution is established via the bifurcation method. Furthermore, all exact traveling wave solutions are constructed to illustrate our results explicitly by the complete discrimination system for polynomial method.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The need for cross-modal retrieval (CMR) among users is growing because of the swift advancements in computer vision and natural language processing. Promoting home operating systems is greatly aided by the openKylin home operating system. It is focused on enhancing the functionality of the operating system with safe and dependable operating technologies. Practical implications abound for integrating computer vision research into home operating systems. A multimodal retrieval approach based on openKylin is presented to improve the usability of text search graphs, audio, and video. The overview of pertinent domestic and international research is the main topic of this article. This technological advancement. It then offers details on the design, implementation procedure, and final implementation outcomes for demonstration. The works of natural operations show that this strategy has excellent accuracy and performance.

Quantifying the landscape pattern change can effectively demonstrate the ecological progresses and the consequences of urbanization. Based on remotely sensed land cover data in 1994, 2000, 2006 and a gradient analysis with landscape metrics at landscape- and class- level, we attempted to characterize the individual and entire landscape patterns of Shanghai metropolitan during the rapid urbanization. We highlighted that a roadscape transect approach that combined the buffer zone method and the transect-based approach was introduced to describe the urban-rural patterns of agricultural, residential, green, industrial, and public facilities land along the railway route. Our results of landscape metrics showed significant spatiotemporal patterns and gradient variations along the transect. The urban growth pattern in two time spans conform to the hypothesis for diffusion–coalescence processes, implying that the railway is adaptive as a gradient element to analyze the landscape patterns with urbanization. As the natural landscape was replaced by urban landscape gradually, the urban fringe expanded radically. The results also showed that the desakota region expanded its extent widely. Satellite towns witnessed the continual transformation from the predominantly rural landscape to peri-urban landscape. Furthermore, the gap between urban and rural areas remained large especially in public service. More reasonable urban plans and land use policies should push to make more of an effort to transition from the urban-rural separation to coordinated urban-rural development. This study is a meaningful trial in demonstrating a new form of urban–rural transects to study the landscape change of large cities from a strategic viewpoint. By combining gradient analysis with landscape metrics, we addressed the process of urbanization both spatially and temporally, and provided a more quantitative approach to urban studies.

The European Union Water Framework Directive (2000/60/EC; WFD) aims to achieve a good ecological and chemical status of all bodies of surface water by 2027. The development of an integrated guidance on surface water chemical monitoring (e.g. WFD Guidance Document No. 7/19) has been transferred into national German law (Ordinance for the Protection of Surface Waters, OGewV). For the majority of compounds, this act requires a monthly sampling frequency to assess the chemical water quality status of a surface water body. To evaluate the representativeness of the sampling strategy under the OGewV, high-frequency online monitoring data is investigated under different sampling scenarios and compared with current, monthly grab sampling strategy. About 23 million data points were analyzed for this study, three chemical parameters (dissolved oxygen, nitrate-nitrogen, chloride concentration) and discharge data were selected from four catchment of different sizes ranging from 51391 km² to 84 km² (Elbe, Vereinigte Mulde, Neiße and two stations at Lockwitzbach). In this paper we proposed short-term online-monitoring (STOM) as a sampling alternative. STOM considers the placement of online sensors over a limited duration and return interval. In general we: (I) compare the results of conventional grab sampling with STOM, (II) investigate the different performance of STOM and grab sampling using discharge data as proxy for analyzing event-mobilized pollutants and (III) investigate the related uncertainties and costs of both sampling methods. Results show, that STOM outperforms grab sampling for parameters where minimum/maximum concentrations are required by law as the probability to catch a single extreme value is higher with STOM. Furthermore, parameters showing a pronounced diurnal pattern, like dissolved oxygen, are also captured considerably better. The performance of STOM showed no substantial improvements for parameters with small concentration variability, as nitrogen-nitrate The analysis of discharge events as a proxy parameter for event-mobilized pollutants proved that the probability of capturing samples during events is significantly increased by STOM.

Digital technology makes energy systems more dynamic, efficient, reliable and sustainable. Promoting the digital governance of renewable energy is not only a key part of energy transformation, but also an important initiative to cope with the global energy crisis, which provides a new impetus for realizing the goal of net-zero emissions. In order to achieve the "dual-carbon" goal, China has been actively promoting energy reform and enhancing the wide application of digital technologies in the development and utilization of renewable energy. The digital governance system and governance capacity of renewable energy is an important support for the modernization of the national governance system and governance capacity. Although the digital governance of renewable energy in China has better policy support and advantages, the dilemmas it faces are still relatively prominent, including unsound laws and policies, insufficient governance capacity, and security loopholes in digital technology, etc. Therefore, this paper proposes a problem-oriented approach to the digital governance of renewable energy. Therefore, this paper puts forward problem-oriented optimization suggestions to innovate the legal system of renewable energy digital governance, promote the digital transformation of China's renewable energy industry, provide development space for renewable energy digital governance in a diversified mode, and enhance the digital governance capacity by improving the renewable energy security system.

A space charge density wireless measurement system based on the idea of distributed measurement is proposed for collecting and monitoring the space charge density in an ultra-high-voltage direct-current (UHVDC) environment. The proposed system architecture is composed of a number of wireless nodes connected with space charge density sensors and a base station. The space charge density sensor based on atmospheric ion counter method is elaborated and developed, and the ARM microprocessor and Zigbee radio frequency module are applied. The wireless network communication quality and the relationship between energy consumption and transmission distance in the complicated electromagnetic environment is tested. Based on the experimental results, the proposed measurement system demonstrates that it can adapt to the complex electromagnetic environment under the UHVDC transmission lines and can accurately measure the space charge density.

Currently, peptic ulcers are widely studied as an infectious disease caused by Helicobacter pylori primarily due to 3 supporting evidences, and this etiology may explain the other 3 observations, but cannot confront the challenges of the 15 major characteristics and the other 75 observations/phenomena of peptic ulcers. To address the challenges, a recently published Complex Causal Relationship with its accompanying methodologies was applied to analyze existing data. Peptic ulcers are identified as a psychosomatic disease triggered by psychological stress, where Helicobacter pylori plays a secondary role in only the late phase of ulceration. This new etiology elucidated all the 15 major characteristics and 81 observations/phenomena of peptic ulcers in a series of 6 articles. This sixth article focuses exclusively on the controversies surrounding the role of Helicobacter pylori in peptic ulcers. In-depth analyses find that all the 3 evidences supporting “peptic ulcers are an infectious disease caused by Helicobacter pylori” are deceiving, and 2 of the 3 explainable observations may have been misinterpreted. Meanwhile, the definitions of ‘etiological factor’ and ‘causality’ do not support ‘H. pylori infection is an etiological factor of peptic ulcers’, and existing literatures have presented a controversial view on the role of Helicobacter pylori in peptic ulcers. Interestingly, if “peptic ulcers are an infectious disease caused by Helicobacter pylori” is considered an illusion, all the characteristics of the disease, along with all the clinical, epidemiological, and laboratory observations/phenomena, can be fully understood. This illusion has misguided peptic ulcer research over the past 36 years with little progress in the field, and that may represent a widespread situation in modern medical research, resulting in a direct interference with the true understanding of disease. Evidently, keeping the concept “illusion” in mind may help remove a huge obstacle that impedes medical advance, thereby facilitating the in-depth study of disease.

Ti and its alloys are the most commonly used materials for biomedical applications. However, bacterial infection after implant placement is still one of the significant rising complications. Therefore, the application of the antimicrobial agents into implant surfaces to prevent implant-associated infection has attracted lots of attention. Scientific papers have shown that inorganic antibacterial metal element (e.g. Ag, Cu, Zn) can be introduced to implant surfaces with the addition of metal nanoparticles or metallic compounds into electrolyte via micro-arc oxidation (MAO) technology. In this review, the effects of the composition and concentration of electrolyte and process parameters (e.g. voltage, current density, oxidation time) on morphological characteristics (e.g. surface morphology, bonding strength), antibacterial ability and biocompatibility of MAO antimicrobial coating were discussed in detail. Anti-infection and osseo-integration can be simultaneously accomplished with the selection of the proper antibacterial elements and operating parameters. Besides, MAO assisted by magnetron sputtering (MS) to endow Ti-based implant materials with superior antibacterial ability and biocompatibility was also discussed. Finally, the development trend of MAO technology in the future was forecasted.

Tao and Ming (name) or Tao and Yan (language or speech) is an inseparable pair of important concepts in traditional Chinese language philosophy. In LaoTze’s opinion, Tao could not be spoken out, and language or speech could not reach Tao’s essence. Yan and Tao are separated from each other, and they are paradoxical. All the confusion derives from Yan regardless of how delicate they are. Tao can be expressed in words, but it will never be expressed through common languages. In this article, Tao is regarded as a human being’s thoughts or intentions and is even considered to be the origin of the real world. Language can express people’s thought, although it has some limitations. There exist some contradictions between the real word and the world expressed in words. To enable people to better understand the existence of the real world from multiple perspectives at the language or linguistic level without being constrained by words, this article studies LaoTze’s linguistic philosophy reflected in his opinion on the relationship between Tao and Yan and makes a comparative analysis of modern Western language philosophers’ stand on language (or speech) and existence.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

It is expected that scholars will continue to strengthen the depth and breadth of theoretical research on RIS, so as to provide a higher theoretical upper bound for the engineering application of RIS. While making breakthroughs in academic research, great progress has been made in engineering application research and industrialization promotion. This article will provide an overview of RIS engineering applications, mainly including the typical features, typical classifications, and typical deployment scenarios of RIS. Then the challenges and candidate solutions of the RIS are systematically and deeply analyzed, involving the cascade channel decoupling for solving the RIS beamforming, the influences and solutions of RIS regulation constraints, RIS system architecture of network controlled mode, the integrated channel regulation and information modulation, TDD mechanism used for RIS. Future trends and challenges are also provided.

Soil organic matter (SOM) is important for the global carbon cycle, and hyperspectral remote sensing has proven a promising method for fast SOM content estimation. However, soil physical properties significantly affect the sensitivity of satellite hyperspectral imaging to SOM, leading to poor generalization ability of the estimation model. This study aims to improve the spatiotemporal transferability of the SOM prediction model by alleviating the coupling effect of soil physical properties on the spectra. Based on satellite hyperspectral images and soil physical variables, including soil moisture (SM), soil surface roughness (root mean squared height, RMSH), and soil bulk weight (SBW), a soil spectral correction strategy was established based on the information unmixing method. Two important grain-producing areas in Northeast China were selected as study areas to verify the performance and transferability of the spectral correction model and SOM content prediction model. The results showed that soil spectral corrections based on fourth-order polynomials and the XG-Boost algorithm had excellent accuracy and generalization ability, with residual predictive deviations (RPD) exceeding 1.4 in almost all bands. In addition, when the soil spectral correction strategy was adopted, the accuracy of the SOM prediction model and the generalization ability after model migration were significantly improved. The SOM prediction accuracy based on the XG-Boost corrected spectrum was the highest, with a coefficient of determination (R2) of 0.76, root mean square error (RMSE) of 5.74 g/kg, and RPD of 1.68. The prediction accuracy, R2, RMSE, and RPD of the model after migration were 0.72, 6.71 g/kg, and 1.53, respectively. Compared with the direct migration prediction of the model, adopting the soil spectral correction strategy based on fourth-order polynomials and XG-Boost reduced the RMSE of the SOM prediction results by 57.90% and 60.27%, respectively. The performance comparison highlighted the advantages of considering soil physical properties in regional-scale SOM prediction.

An active power dispatch method for a microgrid (MG) with multi-type loads, renewable energy sources (RESs) and distributed energy storage devices (DESDs) is the focus of this paper. The MG operates in a grid-connected model, and distributed power sources contribute to the service for load demands. The outputs of multiple DESDs are controlled to optimize the active power dispatch. Our goal with optimization is to reduce the economic cost under time-of-use (TOU) price, and to adjust the excessively high or low load rate of distributed transformers (DTs) caused by the peak-valley demand and load uncertainties. To simulate a practical environment, the stochastic characteristics of multi-type loads are formulated. The transition matrix of system state is provided. Then, a finite-horizon Markov decision process (FHMDP) model is established to describe the dispatch optimization problem. A learning-based technique is adopted to search the optimal joint control policy of multiple DESDs. Finally, simulation experiments are performed to validate the effectiveness of the proposed method, and the fuzzification analysis of the method is presented.

The greatly diversified flowering plants (angiosperms) are the dominating and defining group in the current earth ecosystem. However, from which group by what way the flowers, especially their gynoecia (key characteristics of angiosperms), are derived have been the questions in botany unanswered over centuries. Such an embarrassing situation can be attributed to the lack of plants with partially enclosed ovules, which are supposed to be a post between gymnosperms and angi-osperms. Here we report a fossil plant that has an apparent coniferous vegetative and reproduc-tive morphologies but has a single seed partially wrapped by the subtending bract. Such a mor-phology suggests that the carpels in angiosperms may be equivalent to bracts enclosing their axil-lary seed(s). Such a non-traditional interpretation of the homology of angiosperm carpels is com-patible with various new progresses made in botany and is in line with Tomlinson’s recent hy-pothesis. Together with other fossil evidence reported recently, it appears that gynoecia in angio-sperms are derived in multiple ways.

Single-phase-to-ground fault in non-effectively grounded systems poses serious public safety concern. Along with increasing deployment of low-voltage (LV) sensors, new opportunities and ways are created for solving this traditional problem in distribution systems. A new approach, identifying primary single-phase-to-ground line fault and locating it through measurement data from smart sensors deployed in the secondary side of distribution transformers, is proposed in this paper. When a fault occurs in primary distribution feeder, the transient aerial mode voltage (AMV) of each LV smart sensor is calculated. The fault line can be identified by an abrupt change value of AMV at LV side. Next, by finding the position of the maximum value of this AMV from LV sensors on the fault line, the fault location can be pinpointed to two neighboring distribution transformers. The proposed method has been proven to be efficient and reliable by simulation studies.

As traditional supply chains face increasingly severe environmental issues and countries promote green development and sustainable development policy concepts, cultivating green supply chain operation models is gradually being highly valued by current governments and enterprises. Generally speaking, the production of green products incurs higher additional costs and thus their total production costs also increase. In this work, the product green level is related to the random demand. Under the green supply chain buy-back contract with the green product R&D cost sharing between the manufacturer and the retailer, both the product green level and the order quantity need to be decided to maximize the channel profit. In order to coordinate the green supply chain, the manufacturer needs to share both the risk of good salvage and the green product R&D cost with the retailer. We find that both the wholesale price and buy-back price increase in the manufacturer’s proposition of the green product R&D cost, but decrease in emission reduction efficiency coefficient or carbon trading price. In addition, the product green level, the optimal order quantity and the channel profit increase in emission reduction efficiency coefficient, but decrease in the R&D cost coefficient of the product green level. Interestingly, we find that if the carbon trading price is low, the manufacturer will set a low product green level and the product carbon emission trading is a cost for the supply chain. The increment of the carbon trading price leads to a higher cost such that the channel profit is decreased. However, if the carbon trading price is high, the manufacturer will set a high product green level and the product carbon emission trading is a revenue for the supply chain. The increment of the carbon trading price leads to a higher revenue such that the channel profit is increased.

Semantic communication is not obsessed with improving the accuracy of transmitted symbols, but is concerned with expressing the desired meaning that the symbol sequence exactly carried. However, the generation and measurement of semantic messages are still an open problem. Expansion combines simple things into complex systems and even generates intelligence, which is consistent with the evolution of the human language system. We apply this idea to semantic communication system, quantifying and transmitting semantics by symbol sequences, and investigate the semantic information system in a similar way as Shannon did for digital communication systems. This work was the first to propose the concept of semantic expansion and knowledge collision, which may provide a new paradigm for semantic communications. We believe that expansion and collision will be the cornerstone of semantic information theory.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

The Goldbach Conjecture, which is frequently termed as “1 + 1”, has been a fascinating goal for many mathematicians over centuries. A Chinese mathematician, Dr. Jingrun Chen, proved 1 + 2, which is a great success and the best result so far achieved. Although there were several attempts proving the conjecture, these attempts are either tediously long, complicated, or logically imperfect, thus not widely accepted. Taking advantage of the periodicity of primes, here the author provides a straight forward rigorous proof for the Conjecture.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The popularity and growth of additive manufacturing(AM) in recent years are due to its ability to provide innovative solutions to complex manufacturing challenges and its potential to transform the way products are designed, developed, and produced. In this work, the numerical simulation geometry of the model extruder from nozzle is established along with the material extrusion process. The high gravity material extrusion system (HG-MEX) properties and characteristics during filament fabrication are evaluated. This work investigates the effects of gravity on the material extrusion process from nozzle extrusion. This work is unique in the incorporation of fluid surface characteristics to represent the performance and contact with the material extrusion in additive manufacturing. The use of simulation in high gravity material extrusion in additive manufacturing is a meaningful and valuable approach to improving the quality and efficiency of the process.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

This work investigated the influence of current density, plating solution flow rate, and nozzle outlet-cathode distance on the properties of Ni-diamond composite coatings. A multi-physics field simulation is employed to analyze the interplay between current density, plating solution flow rate, and nozzle outlet-cathode distance on the flow field and electric field distribution. Additionally, particle tracing simulations were incorporated into the model to evaluate the incorporation efficiency of diamond particles during composite electrodeposition. Experimental validation of the findings shows a significant increase in the diamond particle content of the coating. This combined approach provides valuable insights for optimizing the jet electrodeposition process for Ni-diamond composite coatings with superior properties.

This study empirically examines the spatial spillover effect of various environmental regulations on green technology innovation using panel data from 284 county-level cities in China between 2007 and 2019. A geographical-economic spatial weight matrix is constructed, and the spatial Durbin model is employed to identify the specific characteristics of this spillover effect. The findings indicate that the spatial spillover effect of green technology innovation primarily occurs through geographical transmission. However, there is no significant spatial autocorrelation when using the economic distance weight matrix. Various types of environmental regulations influence the spatial spillover effect of green technology innovation in distinct ways. Specifically, Market-motivated environmental regulation exhibits a U-shaped relationship with the spatial spillover effect, while Command-controlled environmental regulation demonstrates an inverted U-shaped relationship, suggesting a complementary effect. Additional research shows that the upgrading of industrial structure acts as a mediator between command environmental regulation and the spatial spillover effect of green technology innovation. Government departments should comprehensively coordinate Market-motivated environmental regulation and Command-controlled environmental regulation, accurately assess the intensity of Command-controlled measures, and prevent the migration of green technology innovation elements caused by excessive regulatory measures within enterprises.

Purpose：Herein, aimed to explore routines to improve students' physical health.Methods:We explored the integration of extracurricular fitness running "Lerun" into college physical education curriculum. Firstly, experimental and the referring groups were selected by experimental method, in which only the experimental group was intervened in combination with extracurricular fitness running "Lerun". After two experiments, the experimental and referring groups were compared in terms of physical fitness (speed, strength, endurance, flexibility, explosive force, etc.), sports skills, body shape, cardiopulmonary function, etc. Results:After T-test, significant differences (p<0.05) between these two groups prove that the students' physical health status of experimental group is better than that of the referring group. Conclusion：It manifests that integrating extracurricular fitness running "Lerun" into college physical education curriculum is an effective means to improve students' physical health.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

MCrAlX (M: Ni or Co or both, X: minor elements) coatings have been widely used to protect hot components in gas turbines against oxidation and hot corrosion at high temperatures. Understanding the influence of the X-elements on oxidation behaviour is important in the design of durable MCrAlX coatings. In this study, NiCoCrAlX coatings doped with Y+Ru and Ce, respectively, were deposited on Inconel-792 substrate by HVOF. The samples were subjected to isothermal oxidation test in laboratory air at 9000, 1000, 1100 ºC and cyclic oxidation test between 100 ºC and 1100 ºC with 1 hour dwell time at 1100 ºC. It was observed that the coating with Ce shows a much higher oxidation rate than the coating with Y+Ru under both isothermal and cyclic oxidation tests. Besides, β-depletion due to interdiffusion between coating and substrate was significantly lower with Ru addition. Simulations results using both a moving phase boundary model and an established oxidation-diffusion model show that Ru stabilize β grains which reduces β-depletion of coating due to substrate interdiffusion. This paper presents a comprehensive study of the influence of Ce and Ru on oxidation behaviour including investigation of the microstructure evolution influenced by oxidation time at coating surface and coating-substrate interface combining experiment and simulation results.

Remote sensing technology is crucial for accurate rooftop detection, benefiting urban planning, disaster management, and solar resource estimation. This study employs Efficient Interactive Segmentation (EISEG) to enhance the efficiency of remote sensing image labeling, with a particular focus on rooftop detection. It is necessary to use modern technology because traditional manual labelling methods are labor-intensive and complicated. The study introduces a novel framework on deep learning semantic segmentation models, facilitating an efficient approach to rooftop identification using high-resolution UAV remote sensing datasets. Large dataset of labeled UAV rooftop building images, in which each superpixel region is assigned a binary label indicating rooftop presence. Advanced methods including Asymmetric Neural Network (ANN), Dual At-tention Network (DANet), PP-LiteSeg, and Deeplab3 are implemented for automatic rooftop detection due to their higher performance and advanced architectures. These models are executed on the Baidu deep learning platform PaddlePaddle, generating initial rooftop segmentation maps crucial for estimating photovoltaic resources. The ANN model emerges with the highest accuracy at 96%, followed by DANet at 95.09%, PP-LiteSeg at 94.54%, and Deeplab3 at 81.61%. The outcomes presenting efficient models for automated rooftop identification, and demonstrating the continuous need for improving deep learning techniques in smart and sustainable cities.

A lignin modified salt resistance branched high-performance water reducer was prepared via free radical polymerization. The water reducing agent was identified through Fourier transform infrared analysis, thermal gravimetric analysis, and scanning electron microscopy. The experiment conducted on cement paste demonstrates that the water-reducing efficiency can reach a maximum of 44%. Additionally, the significant spatial steric hindrance of the application enhances the dispersal capability of the water-reducing agent, resulting in effective water reduction and reduced viscosity. In addition, its compressive strength is the highest after 3-day curing and 3, 7, 28-day standard curing, and it has the best overall performance both in water and saline water prepared systems.The application in oil cement slurry shows that it exhibits good dispersibility in fresh water, saline water, and substitute ocean water. In the Halfaya and Missan Oilfields of Iraq, BHPWR was used in slurry with a density of 2.28g cm-3 for casing the 244.5 mm salt paste layer of five wells. Cementing results exceeded expectations with over 85% excellent and 100% qualified.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

Background: The seasonal variation of peptic ulcers is a rhythmic phenomenon reported worldwide, exhibiting diverse patterns and controversies. Unfortunately, it has remained an unresolved mystery for more than 90 years. Numerous studies have found that this phenomenon was closely associated with multiple environmental factors, but the underlying mechanism has never been elucidated. Objectives: This study aims to elucidate the seasonal variation of peptic ulcers and identify the role of environmental factors in the disease. Methods: Based on a recently identified etiology of peptic ulcers, two inverse operations in calculus, differentiation and integration, are iterated to analyze the existing data. First, the fluctuation curve in the seasonal variation is differentiated twice into the monthly incidences caused by multiple individual environmental factors, and the fluctuation curve due to each individual environmental factor is generated separately. Second, the monthly incidences caused by the individual environmental factors are integrated twice to reproduce the fluctuation curves in the seasonal variation of peptic ulcers. Results: The differentiations of the fluctuation curves in the season variation reveal a parallel relationship between the psychological impacts of each individual environmental factor and the monthly incidences of peptic ulcers. The integrations of the monthly incidences caused by 3 environmental factors reproduce the fluctuation curves in 3 representative seasonal patterns of peptic ulcers but make the parallel relationships invisible. Discussion: The parallel relationships revealed a causal role of environmental factors in peptic ulcers, whereas the reproduction of the fluctuation curves elucidated that multiple environmental factors cause the seasonal variation of peptic ulcers by Superposition Mechanism. The regional differences in environmental factors result in the diverse patterns, as well as the controversy questioning the seasonality of peptic ulcers. Significantly, the data analyses exemplify the application of a new concept, Superposition Mechanism, which might be an indispensable methodological complement to life science and medicine.

Background: In 1962, Susser and Stein observed that the mortality rates of peptic ulcers in England and Wales increased markedly in the 1910s, maintained at a high level during the 1910s-1940s, and began to decline steadily since the early 1950s. They termed this epidemic pattern a birth-cohort phenomenon, but its mechanism has never been elucidated. Susser and Stein speculated that the occurrences of extraordinary social environmental factors roughly fit the fluctuations, but the role of environmental factors in peptic ulcers has never been identified. Objectives: This study aims to elucidate the mechanism of the birth-cohort phenomenon of peptic ulcers and identify the role of environmental factors in the disease. Methods: Starting from an etiology identified recently, this study uses the two inverse operations in calculus, differentiation, and integration, to analyze the existing data. First, a fluctuation curve in the birth-cohort phenomenon is differentiated into multiple annual mortality rates caused by individual environmental factors. Second, these annual mortality rates are integrated to reproduce the fluctuation curve in the birth-cohort phenomenon. Results: The differentiation reveals a parallel relationship between the psychological impacts of environmental factors and the mortality rates of peptic ulcers, whereas the integration reproduces a representative fluctuation curve in the birth-cohort phenomenon. The successive occurrences of multiple social environmental factors from the 1910s to 1940s maintained the increase in mortality rates, while the sustained improvements in living environments explained the steady decline of the mortality rates from the early 1950s. Conclusion: The parallel relationship suggests a causal role of environmental factors in peptic ulcers, whereas the reproduction of a representative fluctuation curve indicates that multiple environmental factors caused the birth-cohort phenomenon by Superposition Mechanism. Significantly, this study challenges the current reductionist approach used to study disease in modern medicine by demonstrating the effectiveness of an opposite methodological concept focused on integration.

Under the development mode of deep blending of emerging technologies, major projects are important for enhancing China's comprehensive national strength and independent innovation capability. Based on the social benefits of major projects, and considering the influence of reputation factors, an evolutionary game model composed of a general contractor and subcontractor of major projects is established. This paper studies the influence of various factors including the income distribution coefficient of collaborative innovation, and MATLAB simulation software is analyzed the influence of factors on an evolutionary path. The results show that a reasonable income distribution coefficient can promote the game behavior of both parties to the direction of active collaborative innovation; The reduction of innovation cost and the improvement of spillover technology absorption capacity can make innovation subjects tend to choose active collaborative innovation strategies. In addition, reputation loss above a specific threshold can effectively inhibit free-riding behavior and encourage innovation subjects to choose active collaborative innovation strategies. The research results provide reference for promoting major projects' technology innovation.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

The Subtropical Front (STF) plays a key role in the ecology of Chilean jack mackerel Trachurus murphyi. Nonetheless, there are few remote sensing studies of the STF in the open Southeast Pacific Ocean, and almost all of them have been conducted by satellite oceanographers in Russia and Ukraine to support respective large-scale fisheries of jack mackerel in this region. We reviewed these studies that documented long-term seasonal and interannual variability of the STF from sea surface temperature (SST) and sea surface height (SSH) data. We also mapped the STF from satellite sea surface salinity (SSS) data of the SMOS mission (2012-2019). The Subtropical Front consists of two fronts -- North and South STF about 500 km apart -- that border the Subtropical Frontal Zone (STFZ) in-between. The STF is density-compensated, with spatially divergent manifestations in temperature and salinity. In the temperature field, the STF extends in the WNW to ESE direction in the Southeast Pacific. In the salinity field, the STFZ appears as a broad frontal zone, extending zonally between 30-35°S across the entire South Pacific. Three major types of satellite data – SST, SSH, and SSS – can be used to locate the STF. The SSH data is most advantageous with regard to the jack mackerel fisheries owing to the all-weather capability of satellite altimetry and the radical improvement of the spatial resolution of SSH data in the near future. Despite the dearth of dedicated in situ studies of the South Pacific STFZ, there is a broad consensus regarding the STFZ being the principal spawning and nursing ground of T. murphyi as well as a major migration corridor between Chile and New Zealand.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

The human serotonin transporter (hSERT) terminates neurotransmission by removing serotonin from the synaptic cleft, which is an essential process plays an important role in depression. In addition to substrate serotonin, hSERT is also the target of drugs of abuse like cocaine and clinically used antidepressants such as escitalopram and paroxetine. To date, few studies attempt to investigate the unbinding mechanism underlying the orthosteric and allosteric modulation of hSERT. The high-resolution X-ray structure of hSERT resolved recently enables us to theoretically study the unbinding of the above four ligands against the S1 or S2 site of hSERT, by means of molecular docking, molecular dynamics (MD) and potential of mean force (PMF) simulations. We proved that for either the S1 or S2 site, the other three ligands (cocaine, escitalopram and paroxetine) are much more favorable than the original substrate serotonin, whether in kinetics along the unbinding pathways or in thermodynamics at the equilibrium states. Furthermore, the S1 site is much more favorable than the S2 site, for each ligand. Interestingly, inspection revealed that there are ~ 3Å lengths between the allosteric site of serotonin and cocaine, and an unseen un-binding pathway for escitalopram at the S1 site except for verification of the broadest trail.

Loess is a special soil with high water sensitivity, which covers a large area in northwest China. Cracks are prone to generate in loess under the arid and semi-arid climate, which will provide the preferential channel for water and reduce the mechanical properties of soils. It is of great significance to understand the evolution characteristics and mechanisms of the cracks in loess areas. At present, the researches on cracks in soils are mainly concentrated in the characteristics of different cracking patterns. However, the spacing cracks are mostly discussed in materials like rock and concrete, rather than soils. The cracking characteristics and mechanisms of spacing cracks in loess is still inadequate. In this research, the drying tests of loess are carried out with different sizes of specimens. The parameters of spacing cracks and local strain distributions of the loess samples are obtained via PCAS and DIC methods during desiccation, respectively. The cracking modes, space cracking laws like insertion and saturation of spacing cracks are revealed. Finally, the size effect on the characteristics of spacing cracks is verified with a discrete element software MatDEM.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

As the COVID-19 pandemic has caused enormous damage to society, economy and public health security, it is crucial to combat the epidemic and allocate social and health resources effectively. Global optimization algorithms are extensively used in many domains to find optimal solutions to complex problems. Thus, a survey of three typical global optimizations applied on the COVID-19 pandemic is timely. This article is structured into three typical global optimization algorithms - Genetic Algorithm, Particle Swarm Optimization, and Cat Swarm Optimization - and summarizes the framework models and practical applications, as well as other optimization methods that may be applied to COVID-19. Finally, current unresolved challenges and future research opportunities to be explored are summarized.

Predators are dependent on the capture of prey to meet their energetic and nutritive requirements, imposing a regime of predation risk. Consequently, prey experience both consumptive and non-consumptive effects. Non-consumptive effects may manifest through altered growth and ontogenetic trajectories of prey species, a dynamic modulated by olfactory or other sensory cues from predators. Bactrocera dorsalis Hendel represents a great invasive threat to global horticulture. While earlier research has primarily centered on the consumptive interactions between B. dorsalis and its natural enemies, the potential consequences of non-consumptive interactions on the development of B. dorsalis have been overlooked. In this study, we investigated the impact of predation risk effects, induced by both visual exposure to the predatory mantis Hierodula patellifera Serville and its associated odor, on the life history traits of B. dorsalis. Female B. dorsalis demonstrated reduced development time in the presence of isolated H. patellifera or H. patellifera odor, yet evidenced significantly increased fecundity. Conversely, males displayed no significant change in development time. Additionally, neither female nor male body weight at death was significantly influenced by predation risk from isolated predators or predator odor. These results indicated adaptive developmental strategies of B. dorsalis when faced with risks from predators and highlight the important role of predator odor, which has the potential to lay the groundwork for improving biological control efforts and innovative approaches within pest control.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Pandemics caused by viruses have threatened lives of thousands of people. Viral infection is a complex and diverse process, and substantial studies have been complemented in understanding the biochemical and molecular interactions between viruses and hosts. However, the physical microenvironment where infections implement is often less carefully considered, and the role of mechanobiology in viral infection remains elusive. Mechanobiology focuses on sensation, transduction and response to intracellular and extracellular physical factors by tissues, cells and extracellular matrix. The intracellular cytoskeleton and mechanosensors have been proved to be extensively involved in virus life cycle. Furthermore, innovative methods in vivo and in vitro are being utilized to elucidate how extracellular factors including stiffness, forces and topography in regulating viral infection. Our current review covers how physical factors from different sources coordinate virus infection. We further discuss how this knowledge can be harnessed in future research on cross-fields of mechanobiology and virology.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

In recent years, semantic communication has received significant attention from both academia and industry, driven by the growing demands for ultra-low latency and high-throughput capabilities in emerging intelligent services. Nonetheless, a comprehensive and effective theoretical framework for semantic communication has yet to be established. In particular, finding the fundamental limits of semantic communication, exploring the capabilities of semantic-aware networks, or utilizing theoretical guidance for deep learning in semantic communication are very important yet still unresolved issues. In general, the mathematical theory of semantic communication and the mathematical representation of semantics are referred to as semantic information theory. In this paper, we introduce the pertinent advancements in semantic information theory. Grounded in the foundational work of Claude Shannon, we present the latest developments in semantic entropy, semantic rate-distortion, and semantic channel capacity. Additionally, we analyze some open problems in semantic information measurement and semantic coding, providing a theoretical basis for the design of a semantic communication system. Furthermore, we carefully review several mathematical theories and tools and evaluate their applicability in the context of semantic communication. Finally, we shed light on the challenges encountered in both semantic communication and semantic information theory.

Developing and utilising of underground space is an vital direction for urban growth. Underground commercial streets, as a significant component of underground space accommodating extensive human social activities, and consequently necessitate the creation of human-scale spaces. In the evolution of urban design development towards greater refinement, applying architectural theories and excessively subjective designs has resulted in a deficiency of human-centered design and a disordered spatial environment. This study merges environmental psychology and architectural theory to determine the appropriate length of spatial scale. Two experiments focusing on spatial perception evaluation were conducted using a virtual experimental platform that featured varying dimensions of spatial scale combinations. These quantified combinations were correlated with perception evaluation, and regression analysis was employed to identify appropriate scale ranges, which were superimposed on the range of length selection. Finally, the optimal length and scale combination for underground commercial street spaces were established, providing a reference for the human-centered design of these environments.

Thin-film lithium niobate has gained significant attention in photonics due to its broad optical transparency, high refractive index, nonlinear coefficient, and substantial electro-optic coefficient. It holds great promise for developing electro-optic modulators with low loss, a compact size, and wide bandwidth. This study focuses on a meticulous investigation utilizing microwave photonics to establish a high-performance electro-optic modulator. Specifically, we analyze the optical mode field distribution and traveling wave electrode structure of lithium niobate thin-film materials. The proposed modulator achieves an impressive half-wave voltage-length product of 1.69 V·cm, a negligible metal loss of 0.01 dB/cm, and a substantial 3dB electro-optic bandwidth of 50 GHz. This research successfully realizes low-loss, high-efficiency LNOI electro-optical modulators, providing a strong foundation for large-scale integrated optoelectronic systems.

Observe the synergistic effect and dose-effect relationship of Trimethoprim (TMP) on bactericidal activity with Flos Lonicerae in vitro. Microamount chessboard dilution method was conducted to determine the minimal inhibitory concentration (MIC) of Trimethoprim, Flos Lonicerae, as well as the combination of Trimethoprim and Flos Lonicerae separately against Staphylococcus aureus, Escherichia coli in vitro and Salmonella. The pour plate count method was used to determine the combined bactericidal activity of Flos Lonicerae combined with Different concentrations TMP. The results showed that the MIC values of the combination of Flos Lonicerae with TMP was much less than the MIC values of the independent use of Flos Lonicerae or TMP, The FIC values of the combination of Flos Lonicerae with TMP were between 0.5 and 1, there was additive effect between them. The bactericidal rates were fitted with least square method, the 95% confidence intervals of the optimal blending quantity about the combination of Flos Lonicerae with TMP on the test organisms were 231μg·mL^-1-249μg·mL^-1, 237μg·mL^-1-259μg·mL^-1, and 235 -259μg·mL^-1

Ce-promoted NiMgAl mixed-oxide (NiCex-C, x = 0, 1,5,10) catalysts were prepared from the quaternary hydrotalcite precursors for CO2 hydrogenation to methane. By engineering the Ce contents, NiCe5-C showed its prior catalytic performance in low-temperature CO2 hydrogenation, being about 3 times higher than that of Ce-free NiCe0-C catalyst (TOF of NiCe5-C and NiCe0-C: 1.19 h-1 vs 0.39 h-1 @ 250 oC). With extensive characterization, it was found that Ce dopants promoted the reduction of NiO by adjusting the interaction between Ni and Mg(Ce)AlOx support. The higest ratio of surface Ni0/(Ni2+Ni0) was obtained over NiCe5-C. Meanwhile, the surface basicity was tailored with Ce dopants. The strongest medium-strength basicity and highest capacity of CO2 adsorption was achieved on NiCe5-C with 5wt% Ce content. The TOF tests indicated a good correlation with medium-strength basicity over the NiCex-C samples. The results showed that the high medium-strength and Ce-promoted surface Ni0 species endows the enhanced low-temperature catalytic performance in CO2 hydrogenation to methane.

As the application of cyber-physical systems (CPSs) becomes more and more widespread, its security is becoming a focus of attention. Currently, there has been much research on the security defense of the physical layer of the CPS. However, most of the research only focuses on one of the aspects, for example, attack detection, security state estimation or recovery control. Obviously, the effectiveness of security defense targeting only one aspect is limited. Therefore, in this paper, a set of security defense processes is proposed for the case that a CPS containing multiple sensors is subject to three kinds of stealthy attacks (i.e., zero-dynamics attack, covert attack, and replay attack). Firstly, the existing attack detection method based on improved residuals is used to detect stealthy attacks. Secondly, based on the detection results, an optimal state estimation method based on improved Kalman filtering is proposed to estimate the actual state of the system. Then, based on the optimal state, internal model control (IMC) is introduced to complete the recovery control of the system. Finally, the proposed methods are integrated to give a complete security defense process, and the simulation is verified for three kinds of stealthy attacks. The simulation results show that the proposed methods are effective.

We propose a computer-generated hologram method for near-eye virtual reality and augmented reality 3D display. A 3D object located near the holographic plane is projected onto a projection plane to obtain a plurality of projected images with different angles. The hologram is calculated by superposition of projected image convolution with a specific PSF through the interference of reference wave with object wave. Holographic 3D display systems with LED as illumination, 4f optical filtering system and lens as eyepiece for near-eye VR display and HOE as combiner for near-eye AR display are designed. The results show that the proposed method is about 38 times faster than the conventional point cloud method. The proposed method is flexible to produce speckle noise free high-quality VR and AR images with efficient focus and defocus capabilities.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

China is a traditional agricultural country, and the integration of rural industries has become an essential policy direction for the current strategy of agricultural modernization in China. In recent years, the agricultural industrial chains across various regions of China have consistently expanded and extended. The multifunctionality of agriculture is continuously unearthed, and the principal entities managing agriculture have become increasingly diversified and have grown significantly. New industries and forms in agriculture emerge incessantly. Accurately and profoundly understanding the inherent features of the integration of industries in rural China, establishing a scientific and rational measurement index system in line with the current status and development goals of rural China, and employing appropriate measurement methods to assess its development level and process, is instrumental in comprehending the level of integrated development in various regions. This aids in identifying challenges in the developmental process and proposing targeted developmental strategies. Hence, this paper, rooted in the integration of rural industries, cross-industry, industry extension, industry agglomeration, and industry penetration, sets up an measurement index system. Using provincial panel data from 2011 to 2020, the paper measures the level of integrated development in rural industries across China and its 31 provinces. Based on the measurement results, further techniques such as kernel density estimation and Gini coefficient decomposition have been used to analyze the spatial distribution characteristics and dynamic trends of the integrated development of rural industries in China. Research indicates that during the sample period, the overall level of integrated development in rural industries in various provinces in China has shown an upward trend. Development among the eastern, central, and western regions is highly uneven, but this disparity has been gradually narrowing in recent years. Furthermore, the levels of integrated development in different provinces exhibit significant spatial agglomeration effects. The development level of neighboring regions significantly impacts the province's development status. In the process of integrated development of rural industries in China, there's a trend where "it's easier to downgrade than to upgrade," with very few regions achieving leapfrog development.

Wearable technology has been proposed as a potential tool to change the way of human life, such as the smart bracelet and the Google Glass. In the wearable technology, the inertial sensor has great significance in tracking the object movements. The paper focused on detecting the movements of user’s finger based on the inertial sensor to give the control signals. Firstly, the attitude matrix, which represented the transformation relation of carrier coordinate system and the navigation coordinate system, was obtained. Secondly, the attitude matrix was expressed based on the quaternions. Thirdly, the finger gesture was processed by the attitude matrix to get the attitude angle. Finally, the robot was controlled by attitude angle to make the moving action. The experimental results showed the detection of the finger movement is effective.

Forests play a pivotal role within the ecological milieu, with alterations to forested areas not only impacting the local environment but also serving as a significant contributing factor to the occurrence of landslide disasters. However, the significance of forests in connection with deep seated landslides is diminished. In instances of extreme events, heavy rainfall, highly weak slopes, or seismic events, it is improbable for forest cover to exert any influence. Due to extensive agricultural irrigation, the Heifangtai terrace of China has experienced a significant rise in groundwater levels, leading to the occurrence of numerous landslides. Through field investigations and remote sensing interpretation, this study has revealed dramatical geomorphological changes in the Heifangtai terrace due to the occurrence of widespread landslides. These changes are likely to disrupt the pre-existing hydrological balance within the study area, thereby altering the conditions for landslides. Therefore, understanding how the evolution patterns of loess landslides can be assessed is a crucial scientific issue for predicting the conditions of landslide occurrence. Taking the evolution of landslides along the edge of the Heifangtai terraces as an example, this study first classified different types of loess landslides. Subsequently, the temporal and spatial distribution characteristics of these landslides were analyzed. Finally, utilizing the FLAC3D software, the stability of the loess slopes at the edge of the Heifangtai terrace was examined under the lateral evolution mode. The research findings indicate that the current loess landslides in the Heifangtai terrace exhibits longitudinal multi-periodicity and lateral group-occurring behavior, which is significant for assessing loess landslides along the edge of Heifangtai terraces.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

Continuous Distributed Constraint Optimization Problem (C-DCOPs) are a powerful framework to model problems with continuous variables in multi-agent systems. Previous works about C-DCOP algorithms mainly use pseudo-trees to guarantee the anytime property or are without anytime property guarantees. However, there is a risk of privacy leakage in the pseudo-tree due to utility passing between agents. Therefore, based on the basic constraint graph instead of the pseudo-tree, we (i) extend the Maximum Gain Message (MGM) algorithm by combining the local search strategy to solve C-DCOPs, named Continuous MGM (C-MGM), and it’s able to guarantee the monotonicity of the solution quality; (ii) propose a Parallel C-MGM (C-PMGM) algorithm to improve the solution quality through parallel random search; and (iii) introduce the differential search into C-PMGM to design a Parallel Differential Search C-MGM (C-PDSM) algorithm, which constructs a heuristic method to speed up convergence and improve solution quality. Compared to other anytime C-DCOP algorithms using pseudo-trees, the proposed three algorithms can exhibit better performance in avoiding privacy violations. We theoretically prove that the proposed algorithms are the anytime algorithms and empirically demonstrate that our algorithms outperform the state-of-the-art C-DCOP algorithms.

This study addresses the escalating threat of data theft ransomware, a form of cyberattack that exfiltrates sensitive information from victim networks and demands ransom for its non-disclosure. Unlike traditional crypto-ransomware, data theft ransomware leverages various infiltration techniques to gain unauthorized access and control over critical data assets. The study introduces a novel Moving Target Defense (MTD) framework, specifically designed for the Windows operating system environment, to counter these sophisticated attacks. MTD increases the unpredictability of the system by dynamically altering its configurations, thereby disrupting the adversary's ability to execute successful attacks. Our research includes the development and empirical evaluation of the MTD framework, demonstrating its effectiveness in reducing ransomware operational capabilities through quantitative analysis, qualitative observations, and statistical significance testing. We also explore the challenges and complexities involved in implementing MTD in real-world scenarios and propose strategies to overcome these barriers. The study concludes with recommendations for future research directions and the potential of MTD in enhancing cybersecurity defense mechanisms.

Escherichia coli (E. coli) is a common pathogen in veterinary clinical infections, typically not causing disease. However, under certain conditions, it can cause severe diarrhea, septicemia, and respiratory infections in domestic animals. Here, we report a large-scale mortality event in young donkeys, caused by E. coli infection in a farm with a herd of 340 donkeys, of which over 100 were under 4 months old. The characteristics of the E. coli strain were determined through clinical observation, complete blood count, blood biochemical analysis, H&E staining, histopathological examination, 16S rRNA analysis, and antibiotic sensitivity testing. A mice experiment using the isolated bacteria was also conducted, resulting in the onset of clinical and pathological symptoms similar to those observed in the donkeys. Molecular Evolutionary Genetic Analysis (MEGA) showed that the isolated bacteria, named CEG-GZL20, shared 99.98% sequence identity with E. coli. CEG-GZL20 exhibited high antibiotic resistance and only showed sensitivity to two antibiotics, Tetracycline and Gentamicin. As E. coli is a key component of the gut microbiota, responsible for digestion, nutrient absorption, and immune health, diseases and mortality caused by E. coli have significant implications for animal husbandry and human health.

This paper presents the results of an experimental and analytical study on the behavior of cold-formed thick-walled steel plates connected by a single bolt under double shear. Experimental studies were conducted on a total of 54 bolted connections fabricated from two thickness of cold-formed thick-walled steel plates with the nominal thickness of 6 mm and 10 mm. The effects of end distance, edge distance and steel plate thickness were investigated on the bolt bearing behavior. Codes of (modified) ANSI/AISC 360-16 and EN1993-1-8 were applied to predict failure modes and bearing resistance of connections and the predictions were compared with that of measurements. A method was proposed to calculate the elongation of bolt hole at ultimate load. The studies show that fractures occurred on shear planes of specimens failed by shear out due to reduced ductility caused by cold forming process. The modified ANSI/AISC gives the most accurate predictions of failure modes and bearing resistance. However, the bearing resistance will be overestimated if the reduction in area of shear planes caused by occurrence of fracture is ignored for specimens with end distance being higher than 2.0d0 and a reduction factor is needed for calculating bearing resistance of connections. The method proposed in our paper can predict the elongation of bolt hole very well.

Noisy data is always encountered in real applications, such as bioinformatics, neuroimage and remote sensing. Existing methods mainly consider linear or generalized linear errors-in-variables regression, while relatively little attention is paid for the multivariate response case, and how to evaluate the estimation performance under perturbed covariates is still an open question. In this paper, we consider the information-theoretic limitations of estimating a low-rank matrix in the multi-response errors-in-variables regression model. By application of the information theory and statistical techniques on concentration inequalities, the minimax lower bound is provided in terms of the squared Frobenius loss, which recaptures the rate provided under the clean covariate assumption in previous literatures. Hence our result further indicates that though under the more realistic errors-in-variables situation, no more samples are required so as to achieve a rate-optimal estimation.

For personalized recommender systems,matrix factorization and its variants have become mainstream in collaborative filtering.However,the dot product in matrix factorization does not satisfy the triangle inequality and therefore fails to capture fine-grained information. Metric learning-based models have been shown to be better at capturing fine-grained information than matrix factorization. Nevertheless,most of these models only focus on rating data and social information, which are not sufficient for dealing with the challenges of data sparsity. In this paper,we propose a metric learning-based social recommendation model called SRMC.SRMC exploits users' co-occurrence pattern to discover their potentially similar or dissimilar users with symmetric relationships and change their relative positions to achieve better recommendations.Experiments on three public datasets show that our model is more effective than the compared models.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

In this paper, we propose a new mathematical model based on the association between susceptible and recovered individual, where the association between susceptible and recovered individual is disturbed by white noise. This model is based on demographic changes and is used for long term behavior. We study the stability of equilibria of the deterministic model and prove the conditions for the extinction of diseases. Then, we investigate and obtain the critical condition of the stochastic epidemic model for the extinction and the permanence in mean of the disease with the white noise. To verify our results, we present some numerical simulations for real data related to disease.

Aims: To assess the occurrence of Chemotherapy-induced nausea and vomiting (CINV) after standard antiemetic therapy in the acute (24 h post-chemotherapy) and delayed (2–5 days post-chemotherapy) phases, as well as to identify risk factors for CINV in the acute and delayed phases. Methods: This prospective longitudinal and observational study analyzed the data of 400 breast cancer patients scheduled for chemotherapy over two cycles in two hospitals. The self-report survey was developed to assess the occurrence of CINV and their associated factors. CINV was evaluated with a Multinational Association of Supportive Care in Cancer Antiemetic Tool (MAT) on days 2 and 6 of chemotherapy. The incidence of acute and delayed CINV were presented by frequency and percentage. Generalized equation estimates (GEE) was used to identify risk factors of acute and delayed CINV. Results: There were 400 evaluable patients with complete Round 1 data, 334 for Round 2 data. Among 400 patients, 29.8% and 23.5% experienced acute and delayed CINV, respectively. Risk factors associated with for acute CINV were pain/insomnia, history of CINV, history of motion sickness (MS), and highly emetogenic chemotherapy regimen, while history of MS, CINV history, number of completed chemotherapy cycle number < 3, and the incidence of acute CINV were risk factors of delayed CINV (all p < 0.05). Conclusions: The findings may help nurses working for Chinese population in identifying patients at risk for CINV and in planning effective program to reduce the occurrence of CINV.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

Cloud-induced atmospheric extinction and occlusion have a major effect on the effectiveness and quality of telescope observations. Real-time cloud cover distribution and long-term statistical data are essential for astronomical siting and telescope operations. At ground-based astronomical telescope sites, cloud cover distribution is currently analyzed using manual observation methods. However, the main disadvantages of manual observation methods are human subjective, heavy workloads and poor real-time performance. Therefore, a real-time automatic cloud images classification method is desperately needed. This paper presents a new cloud identification method, which is named PSO+XGBoost model by combining eXtreme Gradient Boosting (XGBoost) and Particle Swarm Optimization (PSO). The entire cloud image is divided into 37 sub-regions in order to more precisely identify the distribution of the clouds. 19 features are then extracted, including the sky background, star density, lighting conditions, and subregion grayscale values. The experimental results have shown that the overall classification accuracy of 96.91% and our model is able to outperform several state-of-the-art baseline methods. Our approach achieves high accuracy in comparison with the manual observation methods. Moreover, this method meets telescope real-time scheduling requirements.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

With the realization of the Grand Canal's full water supply and the strong pursuit of green and low-carbon transportation in contemporary society, the value of the Grand Canal's water transport has been further affirmed, and its coordinated development with other transportation modes has become inevitable and important. This paper analyzes and combs through the characteristics, development status and existing problems of Grand Canal water transport and other transport modes in depth, and takes Jiangsu as an example. A collaboration model of Grand Canal water transport and other transport modes was built and their collaboration degree has been calculated. It is believed that the coordinated development of Grand Canal water transport and other transport modes can be greatly promoted via four aspects: optimizing the construction and governance of Grand Canal water transport, building an integrated management platform of transport modes, improving the integrated transport network structure, and promoting the deep integration of integrated shipping and tourism.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

Predictive maintenance (PM) algorithms are widely applied for detecting operational anomalies on industrial processes to trigger maintenance before a possible breakdown; however, much less focus has been devoted to the use of such PM predictions as feedback in automated process control mechanisms. They usually integrate preventive solutions to protect the machines, usually causing downtimes. The premise of this study is to develop a holistic adaptive process scheduling mechanism that incorporates PM analysis as a safety component to optimize the operation mode of an industrial process toward preventing breakdowns while maintaining its availability and operational state, thereby reducing downtimes. As PM is largely a data-driven approach; hence, relies on the setup, we first compare different PM approaches and identify a one-class support vector machine (OCSVM) as the best performing option for the anomaly detection on our setup. Then, we propose a novel pipeline to integrate maintenance predictions into a real-time adaptive process scheduling mechanism. It schedules for the most suitable operation, i.e., optimizing for machine health and process efficiency, according to the abnormal readings. To demonstrate the pipeline on action, we implement our approach on a small-scale conveyor belt system utilizing our Internet of Things (IoT) framework. The results show that our PM-based adaptive process control provides an efficient process with less or no downtime. We also conclude that a PM approach does not provide sufficient efficiency without its integration into an autonomous planning process.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

Two coupled climate models which participated the CMIP6 project (Coupled Model Intercomparison Project Phase 6), the Earth System Model of Chinese Academy of Sciences version 2 (CAS-ESM2-0) and the Nanjing University of Information Science and Technology Earth System Model version 3 (NESM3), were assessed in terms of the impact of four new sea ice parameterization schemes. These four new schemes are related to air-sea heat flux, radiation penetration and absorption, melt ponds, ice-ocean flux, respectively. To evaluate the effectiveness of these schemes, key sea ice variables with and without these new schemes, such as sea ice concentration (SIC) and sea ice thickness (SIT), were compared against observation and reanalysis product from 1980 to 2014. The simulations followed the design of historical experiments within the CMIP6 framework. The results revealed that both models demonstrated improvements in simulating Arctic SIC and SIT when the new parameterization schemes were implemented. The model bias of SIC in some marginal sea ice zones of Arctic was reduced, especially during March. The SIT was increased and the transpolar gradient of SIT was reproduced. The changes of spatial pattern of SIC and SIT after adding new schemes bear similarities between the two coupled models. This suggests that the new schemes have potential for broad application in climate models, especially for those with underestimated SIT.

The spectra and global distributions of the X-ray emissions generated by the solar wind charge-exchange (SWCX) process in the terrestrial magnetosheath are investigated based on a global hybrid model and a global geocoronal hydrogen model. The solar wind O6+ ions which are the primary charge state for oxygen ions in solar wind are considered. The line emissivity of the charge-exchange born O5+ ions are calculated by Spectral Analysis System for Astrophysical and Lab oratory (SASAL). It is found that the emission lines from the O5+ ranges from 105.607 to 118.291 eV with the strong line at 107.047 eV. We then simulated the magnetosheath X-ray emission intensity distributions with a virtual camera at two positions of north pole and dusk at six stages during the passing of a perpendicular interplanetary shock combined with a tangential discontinuity structure through the Earth’s magnetosphere. During this process, the X-ray emission intensity increases with time, and the maximum value is 27.11 keV cm-2 s-1 sr-1 on the dayside, which is 4.5 times that before the solar wind structure reaches the Earth. A clear shock structure can be seen in the magnetosheath and moves earthward. The maximum emission intensity seen at dusk is always higher than that seen at north pole.