Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

In order to study the strength changes of concrete specimens under different loading conditions, based on the principle of minimum energy dissipation and from the Angle of concrete failure energy per unit area, the finite element numerical simulation software was applied to concrete specimens with different failure modes of tension, compression, bending and torsion, and the double-broken line damage constitutive model was adopted to simulate and analyze the failure forms of concrete specimens under different loading conditions. The failure area and failure energy of each specimen during loading were quantitatively calculated under each failure mode, and the relationship between the failure area and failure energy consumed under different failure modes was analyzed. The results show that under different failure modes, the failure area of concrete specimens is different, the energy consumed during failure is different, and the strength is different. However, in the process of failure, no matter how the failure mode changes, the failure energy W per unit area remains unchanged and is a constant, which is related to the physical properties of concrete itself.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

The ongoing revolution in Deep Learning is redefining the nature of computing that is driven by the increasing amount of pattern classification and cognitive tasks. Specialized digital hardware for deep learning still holds its predominance due to the flexibility offered by the software implementation and maturity of algorithms. However, it is being increasingly desired that cognitive computing occurs at the edge, i.e. on hand-held devices that are energy constrained, which is energy prohibitive when employing digital von Neumann architectures. Recent explorations in digital neuromorphic hardware have shown promise, but offer low neurosynaptic density needed for scaling to applications such as intelligent cognitive assistants (ICA). Large-scale integration of nanoscale emerging memory devices with Complementary Metal Oxide Semiconductor (CMOS) mixed-signal integrated circuits can herald a new generation of Neuromorphic computers that will transcend the von Neumann bottleneck for cognitive computing tasks. Such hybrid Neuromorphic System-on-a-chip (NeuSoC) architectures promise machine learning capability at chip-scale form factor, and several orders of magnitude improvement in energy efficiency. Practical demonstration of such architectures has been limited as performance of emerging memory devices falls short of the expected behavior from the idealized memristor-based analog synapses, or weights, and novel machine learning algorithms are needed to take advantage of the device behavior. In this work, we review the challenges involved and present a pathway to realize ultra-low-power mixed-signal NeuSoC, from device arrays and circuits to spike-based deep learning algorithms, with ‘brain-like’ energy-efficiency.

In the era of big data with increasingly complex data structures and ever-larger data scales, matrix-type data are becoming highly valued and their applications in the fields of medicine, industry, education, geography, and astronomy are growing in extent. In recent years, significant progress has been made in the practical use of matrix variable t-distribution finite mixture models for handling data in order to address the issues of multi-subgroup structures and long data tails. In this paper, the expectation-maximization (EM) algorithm with penalized maximum likelihood is proposed to resolve the problem of the unbounded nature of the likelihood function applied to the model by considering the degeneracy of the variance-covariance matrix of this model. Our data were analyzed through simulations and real data, and the results demonstrate that our model is effective in both preventing the likelihood function from being unbounded and in ensuring the accuracy of the estimated parameters of the EM algorithm.

Due to the incomplete of China's current social security system, health shocks are one of the main risks faced by rural families. Using data from the 2019 China Household Finance Survey, we examined the impact of borrowing on household welfare when rural households face health shocks. We found that household income and food expenditure both declined significantly when rural households faced health shocks; rural household borrowing was mainly used for the treatment of the diseases, and it had a crowding out effect on tourism and general health care expenditures, but not on education expenditures. We also found that the impact of borrowing on the western region was higher than that on the central and eastern regions from Looking at the impact of borrowing in different regions. Finally, we put forward some suggestions for promoting sustainable rural development from the perspective of medical security, such as accelerating the promotion of new rural medical insurance, helping rural low-income families improve health benefits, establishing diversified financing channels, improving rural financial platforms, and solving the financing difficulties of households to improve the ability of rural households to resist health shocks.

Underwater robots often encounter the influence of confined underwater environments during underwater exploration. These environments include underwater caves, sunken ships, submerged houses, and pipeline structures. Robot positioning in these environments is strongly disturbed, leading not only to the failure of some commonly used positioning methods but also to an increase in errors in positioning systems that normally function well in open water. In order to overcome the limitations of positioning methods in underwater confined environments, researchers have studied different underwater positioning methods and selected suitable methods for positioning in such environments. These methods can achieve high-precision positioning without relying on assistance from other platforms, and are referred to as autonomous positioning methods. Autonomous positioning methods for underwater robots mainly include SINS/DR positioning and SLAM positioning. In addition, in recent years, researchers have also developed some bio-inspired autonomous positioning methods. This article introduces the applicable robot positioning methods and sensors in underwater confined environments and discusses the research directions of robot positioning methods in such environments.

Inflammatory reaction after ischemia-reperfusion contributes significantly to prognosis, and microglia activation is the main resource of inflammation in nervous system. STAT5 is proving to be a highly effective anti-inflammatory therapy with great potential, and inhibition of STAT5 has demonstrated significant anti-inflammation and therapeutic effects, but rarely focus on mechanism of neuroinflammation and brain injury from ischemia-reperfusion. It is the first time to found that the anti-inflammation of dauricine is mainly through STAT5-NF-κB pathway, might act as a STAT5 inhibitor. Dauricine suppressed the inflammation cytokines Eotaxin, KC, TNF-α, IL-1α, IL-1β, IL-6, IL-12β, IL-17α, and also inhibited the microglia activation. STAT5b mutant at Tyr-699 reversed the protective effect of dauricine on oxygen-glucose deprivation-reperfusion injury of neurons, and reactivated the suppression of dauricine on P-NF-κB of microglia. These results suggest that dauricine might suppress the neuroinflammation and protect the neuron from the injury of post-ischemia-reperfusion via mediating the microglia activation through STAT5-NF-κB pathway, and ss a potential therapeutic target for neuroinflammation, STAT5 needs to be raised concern in ischemic stroke.

Building outlines extracted from remote sensing images and raster maps often have irregular boundaries, redundant points, inaccurate positions, and unclear turns due to factors such as image quality, complexity of the surrounding environment, and extraction methods. This study proposes a regularization algorithm for right-angled polygon building outlines with jagged edges. First, the minimum bounding rectangle of the building outline is established and populated with a square grid based on the smallest visible length principle. An overlay analysis is then applied to the grid and original building to extract the turning points of the outline. Finally, the building orientation is used as a reference axis to sort the turning points and reconstruct the simplified building outline. Analysis of the experimental results shows that the proposed simplification method enhances the morphological characteristics of building outlines, such as parallelism and orthogonality, while considering simplification principles, such as the preservation of direction, position, area, and shape of the building. The proposed algorithm provides a new regularization method for building outlines with jagged edges.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

To achieve a micro-destructive and rapid measurement of the wood density of standing trees, this study investigated the feasibility of using the micro-drilling resistance method, formulated a mathematical model, explored the potential for a unified model across multiple tree species, and analyzed the influence of moisture content on measurement accuracy. First, 231 tree cores and drill resistance data were sampled from Pinus massoniana, Cunninghamia lanceolate, and Cryptomeria fortunei. The basic density and moisture content of each core were measured, and the average value of each resistance data record was calculated. Second, the average drill resistance, the natural logarithm of average drill resistance, and absolute moisture content were used as independent variables, while the wood basic density was used as the dependent variable. Third, the total model of the three tree species and sub-model for each tree species were established through a stepwise regression method. Finally, the accuracy of each model was compared and analyzed with that of using the average basic density of each tree species as an estimated density. The results revealed that the estimation accuracy of the sub-model for each tree species was 1.670 percentage points higher than the average value of each tree species used as the density estimation value for these tree species. Additionally, except for Cryptomeria fortunei, the natural logarithm of drill resistance significantly influenced the wood density model at a significance level of 0.05. Moreover, moisture content significantly affected the total model and sub-models of Pinus massoniana at a significance level of 0.05. The estimation accuracy of the total mathematical model was 2.125 percentage points lower than that achieved using the average basic density of each tree species to predict their density. The results indicated the feasibility of using the micro-drilling resistance method to measure the wood density of standing trees. Moreover, the relationship between wood density and drill resistance did not follow a linear pattern, and moisture content slightly influenced the drill needle resistance. Furthermore, the establishment of a mathematical model for each tree species was deemed essential. This study provides valuable guidance for measuring the wood density of standing trees through the micro-drilling resistance method.

Virus infection is one of the most common etiologies of hearing loss. Hearing loss associated with viral infection can be unilateral or bilateral, mild or severe, sudden or progressive, and permanent or recoverable. Many viruses cause hearing loss in adults and children; however, the pathogenesis of hearing loss caused by viral infection is not fully understood. This review describes cytomegalovirus, the most common virus causing hearing loss, and other reported hearing loss-related viruses, along with their pathogenic characteristics and research progress on their pathology, hearing phenotypes, possible associated mechanisms, treatment and prevention measures, aiming to provide diagnostic and treatment assistance to clinical workers.

This study aimed to overcome the difficulty of conducting the horizontal-well cavity leaching test in the field and to investigate the long-term stability of the horizontal-well salt-cavity natural gas storage. The simulation test design is combined with the similarity theory to study the cavity expansion characteristics and the influence law of cavity leaching parameters. Through the design of a rubber hose connection, an integrated closed test system for multi-stage horizontal-well cavity leaching and brine drainage was built. The test system also realises the repeatable backward movement of the injection well during the test. A similarity simulation of the test design was carried out, and the test platform was constructed to carry out multi-stage horizontal-well leaching tests with a nitrogen cushion. In the horizontal-well leaching tests with a nitrogen cushion, the influence laws of the well spacing, flow rate and liquid level position on cavity expansion were investigated. Based on the morphological characteristics of the horizontal-well cavity, a numerical model of the horizontal-well salt cavity was developed, which reflects the real cavity morphology leached in the test. The long-term stability of the horizontal-well salt-cavity natural gas storage under different internal pressures was investigated through numerical simulation.

: This study explores the perceptions of Chinese learners in Spain regarding the use of social networks for informal Spanish language learning. The objective is to identify the challenges and benefits of using social networks to address the real needs of students in learning Spanish. A qualitative phenomenological approach was adopted, focusing on participants’ perceptions before and after using social networks. Eight Chinese students were selected for the study. The study was conducted in Valencia and Barcelona, Spain, from 1 September 2023 to 20 March 2024, and three commonly used social media networks were compared. The results indicate positive perceptions towards social media as a tool for learning Spanish, highlighting its usefulness in improving language skills and enhancing cultural awareness. Additionally, Xiaohongshu and Bilibili emerged as the most popular platforms for Spanish language learning among Chinese students. This study concludes that social media effectively meets the authentic needs of Chinese students learning Spanish in Spain, enhancing both language skills and cultural adaptation. This multifaceted approach reflects the complexity of learning Spanish in the digital age, combining personal passion, professional aspirations, and cultural adaptation needs.

Single-phase-to-ground fault in non-effectively grounded systems poses serious public safety concern. Along with increasing deployment of low-voltage (LV) sensors, new opportunities and ways are created for solving this traditional problem in distribution systems. A new approach, identifying primary single-phase-to-ground line fault and locating it through measurement data from smart sensors deployed in the secondary side of distribution transformers, is proposed in this paper. When a fault occurs in primary distribution feeder, the transient aerial mode voltage (AMV) of each LV smart sensor is calculated. The fault line can be identified by an abrupt change value of AMV at LV side. Next, by finding the position of the maximum value of this AMV from LV sensors on the fault line, the fault location can be pinpointed to two neighboring distribution transformers. The proposed method has been proven to be efficient and reliable by simulation studies.

Species have shown their habital variations in responding to climate change, especially during the spring and summer spawning seasons. The species distribution model (SDM) is considered the most favorable tool to study the potential effects of climate change on species distribution. Therefore, we developed the ensemble SDM to predict the changes in species distribution of Portunus trituberculatus among different seasons in 2050 and 2100 under the climate scenarios RCP4.5 and RCP8.5. The results of SDM indicate that the distribution of this species will move northward and have obviouse seasonal variations. Meanwhile, the suitable habitat for the species will be significantly reduced in summer, with loses rates ranging from 45.23% (RCP4.5) to 88.26% (RCP.8.5) by 2100s. Habitat reduction will mainly occur in the East China Sea and southern part of the Yellow Sea, while there will be a small increase in the northern Bohai Sea. These findings will be important to manage the ecosystem and fishery, provide an information forecast of this species in the future, and maintain species diversity if the seawater temperature rises.

The general circuit topology and principles of low-noise high-voltage power supply are investigated to meet the requirements of the high-voltage bias application in air kerma meters. Two topologies, flyback converter and Royer converter are simulated using SPICE simulation program. The simulation results indicate that the circuit structure of the Royer converter is more complex, but it obtains lower output high voltage noise. While we develop an adjustable high-voltage power supply according to the circuit structure of the Royer converter, and tested it to ensure the design requirements for continuously adjustable output high-voltage linearity. The test results show that the linear adjustment rate is not more than ±0.0025%, the load regulation rate is less than ±0.1%, and the output ripple noise voltage percentage is less than 0.01%. These tested performance make it more suitable for accurate nuclear measurements.

Excessive nitrogen application has become a hidden danger threatening the sustainable development of agriculture. Exploring the potential genes will help to improve the nitrogen availability of wheat through molecular breeding. We therefore conducted wheat transcriptomics and proteomics researches under complete culture medium without nitrogen (N0) and complete culture medium with nitrogen (N1). The results showed that, the nitrogen deficit decreased the fresh weight, N content and net photosynthetic rate of winter wheat. 3949 and 2675 differentially expressed genes (DEGs) were identified in the shoot and root, respectively, while 164 and 129 differentially expressed proteins (DEPs) were identified in the shoot and root respectively. 9 genes in shoot and 26 genes in root showed the same trends in RNA and protein levels. 5 genes in shoot and 4 genes in root showed the opposite trends in RNA and protein levels. Pathway enrichment of wheat transcriptome and proteome under nitrogen deficit proposed 3 candidate genes related to photosynthesis in shoot, 4 candidate genes related to carbon metabolism in shoot, and 12 candidate genes related to carbon metabolism in root. Meanwhile, the chromosomal and subcellular localization of these genes were listed, which will provide reference for improving nitrogen availability through molecular breeding.

Street view images can help us better understand the city environment and potential characteristics. With the development of computer vision and deep learning, the technology of semantic segmentation algorithms has become more mature. However, DeeplabV3+, which is commonly used in semantic segmentation, has shortcomings such as a large number of parameters, high requirements for computing resources, and easy loss of detailed information. Therefore, this paper proposes LM-DeeplabV3+, which aims to greatly reduce parameters and computations of the model while ensuring the segmentation accuracy. Firstly, the lightweight network MobileNetV2 is selected as the backbone network, and the ECA attention mechanism is introduced after MobileNetV2 extracts shallow features to improve the ability of feature representation; secondly, the ASPP module is improved, and on its basis, the EPSA attention mechanism is introduced to achieve cross-dimensional channel attention and important feature interaction; thirdly, a loss function named CL loss is designed to balance the training offset of multiple categories and better indicate the segmentation quality. This paper conducted experimental verification on the Cityspaces dataset, and the results showed that the mIoU reached 74.9%, which was an improvement of 3.56% compared to DeeplabV3+; the mPA reached 83.01%, which was an improvement of 2.53% compared to DeeplabV3+.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

Flapping wing aircraft represents a new frontier in biomimetic aviation. Researchers have developed various flapping wing aircraft intending to harness their high aerodynamic efficiency to enhance flight performance. However, current flapping wing designs still have differences in morphology and structure forms compared to real bird wings. These differences may contribute to the key problem of low lift generation in flapping wing aircraft while hovering. Hence, this paper aims to find the influence of morphology and to overcome the aerodynamic efficiency problems. By using fluid-structure interaction analysis, this study investigates the influence of variation in wing area, and aspect ratio. The results show that increasing the wing area will promote the flexible deformation and passive twist of the flapping wing, resulting in a 173.7% increase in lift coefficient. However, this also leads to increased structural stress that must be taken into consideration. Additionally, as the aspect ratio increases, total deformation and tip deformation also increase; lower aspect ratios result in a more pronounced passive twist on the wing surface (84.4% higher). Moreover, this study has designed different wing structure layouts. With different rib distributions, the passive twist, stress concentration between ribs and at rib joints, maximum stress values at the root of the wing spar, and fluctuations in stress curves are influenced. Based on the result of wing parameters and structure layout, this study proposed a flapping wing structure design with efficient aerodynamic performance. The results highlight the influence of the key parameters of wing design and lay the theoretical groundwork for future research endeavors.

This research seeks to advance the understanding of ecological management in the Huaihe River Basin, China. The spatiotemporal variability of the Normalized Difference Vegetation Index (NDVI) and its underlying driving forces are examined utilizing SPOT-NDVI data covering the period 2000-2019. Linear regression analysis is employed to quantify trends and assess the statistical significance of NDVI variations. A differencing approach is subsequently applied to discern the variability in NDVI. The distribution of its spatial pattern stability over 20 years is explored through the coefficient of variation. Lastly, the Geodetector method is utilized to elucidate the driving factors influencing NDVI dynamics. The results indicate that the overall NDVI is generally high, with an overall growth rate of 0.00148/year, and 2010 is identified as a significant inflection point in the trend. NDVI values are notably lower in urban areas, corresponding to urban expansion, except for regions near rivers and lakes. Land use type emerges as the strongest explanatory factor for NDVI among single factors, with climate factors exhibiting a relatively weaker degree of explanatory force. These findings suggest that the overall NDVI in the Huaihe River Basin is high, indicative of a vegetation condition that continues to improve.

Corneal opacity is a leading cause of vision impairment and suffering worldwide. Transplantation can effectively restore vision and reduce chronic discomfort. However, there is a considerable shortage of viable corneal graft tissues. Tissue engineering may address this issue by advancing xeno- keratoplasty as a viable alternative to conventional keratoplasty. In particular, livestock decellularization strategies offer the potential to generate bioartificial ocular prosthetics in sufficient supply to match existing and projected needs. To this end, we have examined the best practices and characterizations that have supported the current state-of-the-art driving preclinical and clinical applications. Identifying the challenges that delimit activities to supplement the donor corneal pool derived from acellular scaffolds allowed us to hypothesize a model for keratoprosthesis applications derived from livestock combining 3D printing and decellularization.

Abstract: Image aesthetic assessment (IAA) with neural attention has made significant progress due to its effectiveness in object recognition. Current studies have shown that the features learned by convolutional neural networks (CNN) at different learning stages indicate meaningful information. The shallow feature contains the low-level information of images and the deep feature perceives the image semantics and themes. Inspired by this, we propose a visual enhancement network with feature fusion (FF-VEN). It consists of two sub-modules, the visual enhancement module (VE module) and the shallow and deep feature fusion module (SDFF module). The former uses an adaptive filter in the spatial domain to simulate human eyes according to the region of interest (ROI) extracted by neural feedback. The latter not only takes out the shallow feature and the deep feature by transverse connection, but also uses a feature fusion unit (FFU) to fuse the pooled features together with the aim of information contribution maximization. Experiments on standard AVA dataset and Photo.net dataset show the effectiveness of FF-VEN.

A novel starch stabilized Mg/Al LDHs material (S-LDH) was prepared in a facile approach and its fluoride ion removal performance was developed. Characterization of S-LDH was employed by using XRD, FTIR and particle size distribution. The adsorption property was studied through the assessment of adsorption isotherms, kinetic models, thermal dynamics and pH influence. The result shows that a low loading of starch of 10 mg onto LDH could obviously improve fluoride removal rate. The S-LDH had 3 times higher adsorption capacity to fluoride than that of Mg/Al LDH to fluoride. The particle size was smaller and the particle size distribution was narrower for S-LDH than that for Mg/Al LDH. Langmuir adsorption isotherm model and pseudo-second-order kinetic model fitted well with the experimental data. In thermodynamic parameters, the enthalpy (△H0) value was 35.63 kJ mol-1 and the entropy (△S0) value was 0.0806 kJ mol-1K-1. The values of △G0 were negative, implying the adsorption process is spontaneous. S-LDH reveals stable adsorption property in a wide pH range from 3 to 9. The mechanism for fluoride adsorption on S-LDH included surface adsorption and interaction ion exchange.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

The tourism economy plays an essential role in supporting and driving tourism development. Therefore, studying its resilience is crucial for promoting sustainable and high-quality tourism development. Based on the core essentials of economic toughness, this paper constructs the tourism economic toughness evaluation index system, uses the entropy weight TOPSIS method to measure the tourism economic toughness of 10 counties and cities in the Yili River Valley in 2010-2019, analyzes its spatio-temporal evolution characteristics through the standard deviation ellipse, the traditional Markov chain, and the spatial Markov chain, and uses the grey correlation analysis method to analyze the driving factors of the tourism economic toughness. The results show that: (1) the economic resilience of tourism in the Yili River Valley shows a "W"-shaped time-series dynamic development trend with an average index of 0.28394, in which it experienced a decline from 0.28 to 0.27 during 2012-2013 and 2015-2016; (2) Spatial Pattern: The Yili River Valley tourism economic resilience is characterized by a clear uneven spatial distribution. The city of Yining, representing the northwestern region, exhibits a high level of resilience, while the southwestern region, endowed with rich tourism resources, demonstrates a medium level of resilience. Conversely, the central to southeastern counties and cities, such as ChabuchaerXibo Autonomous County and other counties and cities, are characterized by a lack of developed tourism facilities, which has resulted in a lower level of resilience and a weak development situation; (3) In terms of spatial and temporal evolution, the standard deviation ellipse is stabilized year by year pointing to "northwest-southeast", the clustering tendency is gradually enhanced, and five tourism economic resilience convergence clubs are identified, whose internal transition probability is significantly affected by spatial location, and which show obvious stability and neighborhood effects; (4) Regarding the driving factors, the impact of each driving factor on the resilience of the tourism economy reaches the statistical significance threshold of 0.77 or above. Among them, the number of employees in the tertiary industry, especially the input of high-quality talents in the tourism industry, plays a key role in improving the quality of tourism services and strengthening the industry's ability to withstand risks and development potential.

Looking at different operating climatic conditions, the electrical behavior predicting photovoltaic modules gets very important. For the estimation of output power from photovoltaic (PV) plants this is a very essential and basic aspect. In this paper, the relationship between the I-V curve and the irradiation spectrum is discussed by combining the single diode model. An explicit elementary analytical model with two defined shape parameters is discussed and improved with three approximations and second order Taylor expansion. Then, the explicit elementary analytical model is investigated under varying conditions leveraging the four parameters I_ph, I₀, R_s and R_sh from the single diode model. The relationship between the physical parameters and the condition parameters are discussed and applied to extract the shape parameters at different scenarios. Considering the aging effect, the process of calculation to predict the I-V curve under different splitting spectra is simplified as follow: (1) two shape parameters are gotten from the I-V data at measurement reference conditions (MRC); (2) the short circuit current, open circuit voltage and shape parameters under any splitting spectrum can be calculated based on the relationship provided in article; (3) the performance of PV panel can be predicted with parameters. The validation of this model was experimentally proven leveraging monocrystalline silicon photovoltaic module with different splitting films. Results showed that the model accurately predicts the I-V characteristics for the examined PV modules at different irradiance spectra and cell temperatures. Moreover, the presented model performs superior compared to other investigated models when looking at accuracy and simplicity.

This study aimed to investigate the incidence of Esox lucius with bacterial septicemia in five fish ponds of Xinjiang, China. We analyzed the water quality of each fish pond as well as the clinical symptoms and pathological changes of fish with bacterial septicemia. Furthermore, we isolated and identified pathogenic bacteria from the liver, spleen, and kidney of the infected fish based on morphology and physiology, as well as using biochemical and molecular biology techniques. By detecting the water quality of the infected fish pond, the clinical symptoms and pathological changes of the infected fish were observed, pathogenic bacteria were isolated and purified from the liver, spleen, and kidney of the died illness fish. the pathogenicity of pathogenic bacteria was identified by morphology, physiology, biochemistry, and molecular biology, and the drug sensitivity of 16 antibiotics was studied by standard Kirby–Bauer disk diffusion method. The results showed that bacterial septicemia of Esox lucius occurred in water with high levels of ammonia nitrogen, nitrates, pH, total alkalinity, and total hardness, mainly caused by the mixed infection of Aeromonas hydrophila, Aeromonas veronii and Aeromonas sobria. A rapid multiplex PCR method for the detection of pathogenic Aeromonas hydrophila was established. The isolates were sensitive to enrofloxacin, flufenicol, and doxycycline and resistant to penicillin and neomycin. This study laid a foundation for the early prediction, warning, rapid diagnosis, and effective prevention and control of bacterial septicemia.

Ammonium sulfate has been utilized in agriculture; however, there is a dearth of research on its application in maize cultivation subsequent to the implementation of nitrification inhibitors or coating. This study aims to analyze the impacts of various combinations of ammonium sulfate fertilizers on soil nutrients, plant nutrient uptake, yield, and fertilizer utilization efficiency in maize cultivation to ascertain the optimal and stabilized disposal method for ammonium sulfate. A completely randomized design was employed with five treatments (AU, the control using urea; AS, treatment using ammonium sulfate; ASN, treatment using ammonium sulfate with a nitrification inhibitor; ASG, treatment using oil-coated ammonium sulfate; ASD, treatment using oil-humic acid-coated ammonium sulfate). Results showed that: (1) Compared with AU and AS, ASN, ASG and ASD decreased the leaching rates of TN, NH4+-N and NO3-N to the 10-20 cm soil layer, and more residual N was obtained in 0-10 cm soil layer. The first-order kinetic equation Nt=N0(1-e-kt) can better fit the process of nitrogen accumulation and release, and the N release rate constant is AU>CK>AS>ASH>ASN>ASD; (2) Compared with AU and AS treatments, the plant dry weight, grain dry weight, spike width, spike length, and yields of maize increased by 8.85-11.08%, 12.98-14.15%, 2.95-3.52%, 5.50-5.65%, and 43.21-51.10% under ASG treatment respectively. The impact of effective spike number on maize yield was found to be significant, as demonstrated by the path analysis conducted in this study. Furthermore, the accumulation levels of nitrogen, phosphorus, and potassium within above-ground plants significantly increased under the ASG treatment compared to the AU and AS treatments. The partial productivity of nitrogen, phosphorus, and potassium increased by 1.43-1.51-fold under ASG treatment, while grain nitrogen balance, grain phosphorus balance, and grain potassium balance increased by 1.41-1.58-fold, 1.51-1.95-fold, and 1.15-l.96-fold respectively. The oil-coated ammonium sulfate, therefore, exhibited the optimal slow-release effect of nutrients, thereby achieving superior performance in enhancing maize production and efficiency.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

The refractive index of seawater is one of the essential parameters in ocean observation, so it is necessary to achieve high-precision seawater refractive index measurements. A seawater refractive index measurement system based on position-sensitive detectors is an effective means to achieve high-precision measurement of seawater refractive index. However, in the actual seawater refractive index measurement process, the impact of the measurement error caused by the jitter signal obtained from the measurement on the measurement results cannot be ignored. In this paper, we theoretically analyse the causes of the long jitter signals during seawater refractive index measurement and quantify the influencing factors. Through the analysis, it can be seen that the angle between the two windows in the refractive index measurement area of seawater causes a great error on the measurement results, so the angle between the two windows should be controlled within 2.06° in order to effectively reduce the measurement error. At the same time, the factors affecting the measurement accuracy of the position-sensitive detector are analysed, and the factors leading to the reduction of the measurement accuracy of the position-sensitive detector are mainly the background light, the size of the photosensitive surface, and the change of the temperature of the working environment. For the above factors, we add a narrow-band filter with a bandwidth of 0.9nm in front of the photosensitive surface of the position-sensitive detector during the construction of the measurement system, so as to filter out stray light other than the signal light source. On the premise of ensuring the measuring range of the refractive index of seawater, a position-sensitive detector with a photosensitive surface size of 4 mm×4 mm was selected. In order to reduce the temperature variation of the working environment of the position-sensitive detector, the measurement system was partitioned. In order to validate the testing error range of the optimised test system, standard seawater samples under the same conditions were measured. It can be seen that the jitter signal of the measurement system has been reduced from 0.0022mm before the optimisation to 0.0011mm after the optimisation, and the deviation of the refractive index has been reduced by 1.09×10−8RIU. The experimental results show that the refractive index of seawater has been effectively reduced by adjusting the optical path and the structure of the seawater refractive index measurement system.

The refractive index of seawater is one of the essential parameters in ocean observation, so it is necessary to achieve high precision seawater refractive index measurement. In this paper, we propose a method for measuring the refractive index of seawater based on a Position Sensitive Detector (PSD). Theoretical model is established to depict the correlation between laser spot displacement and refractive index change, utilizing a combination of position sensitive detector and laser beam deflection principle. Based on this optical measurement method, a seawater refractive index measurement system was established. To effectively enhance the sensitivity of refractive index detection, a focusing lens was incorporated into the optical path of the measuring system, and simulations were conducted to investigate the impact of focal length on refractive index sensitivity. The calibration experiment of the measuring system was performed based on the relationship between refractive index of seawater and underwater pressure (depth). By measuring laser spot displacement at different depths, changes in displacement with respect to both refractive index and depth were determined. Experimental results demonstrate that the system exhibits a sensitivity of 9.9277×10−9RIU (refractive index unit), the refractive index deviation due to stability is calculated as ±7.545×10−9RIU. Thereby the feasibility of highly sensitive measurement of seawater refractive index is verified.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P<0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

In order to solve the problem of the poor oil displacement effect of high molecular weight alkali/surfactant/polymer (ASP) solution in low permeability reservoirs, Daqing Oilfield uses a partial quality tool to improve the oil displacement effect in low permeability reservoirs. Without changing the oil displacement capability of high molecular weight ASP solution in high permeability oil layers, the ASP solution is actively sheared in low permeability oil layers by using a partial quality tool to increase the injection capability of the solution and improve the overall oil recovery. In order to study the ability of the partial quality tool to improve the oil displacement effect, firstly, the matching degree of high molecular weight ASP solution to low permeability cores is studied, and the ability of quality control tools to change the molecular weight is studied. Then, experimental research on the pressure and oil displacement effect of high molecular weight ASP solution before and after the actions of the partial quality tool is carried out. The results show that ASP solutions with molecular weights of 1900 × 104 and 2500 × 104 have a poor oil displacement effect in low permeability reservoirs. After the action of the partial quality tool, the injection pressure is reduced by 5.22 MPa, and the oil recovery is increased by 7.79%. The injection pressure of the ASP solution after shearing by the partial quality tool is lower than that of the ASP solution with the same molecular weight and concentration without shearing, but the oil recovery is lower. On the whole, the use of the partial quality tool can obviously improve the oil displacement effect in low permeability reservoirs.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

In view of the limitations of the existing optimization method of suspender cable force, in order to improve the stress of suspender under completion state and avoid frequent adjustment of cable force and grid beam elevation during construction, a new method of cable force optimization is proposed. The article takes the longest large span arch bridge in the world, Pingnan Third Bridge, a Concrete-filled steel tube (CFST) arch bridge with a span of 575m as the engineering background combined with the finite element analysis and multi-objective optimization method. One cable force optimization method that suspender “Real-time correction during construction, in the process variable optimal and results reliable” during panel girder lifting of long span CFST arch bridges is clarified. Taking the panel girder weight and displacement during the construction as parameter variables, the displacement and unevenness of the panel girder under completion state as constraint conditions, the displacement and cable force during the hoisting construction as the objective equation, through the optimization of the objective equation, the suspender cable force and dis-placement of each hoisting section are calculated. The results show that it is feasible to introduce the optimization theory into the cable force optimization when lifting the panel girder. the segment displacement variation is minimized to meet the destination. The cable force distributed evenly under completion state of the bridge that further making sure the completion state satisfies the requirements. No repeating iteration is needed, thus avoiding cumberso me calculation, getting cable force once. With higher optimization efficiency and better effects, the method provides high value for the cable force calculation of same type bridge suspender construction and for guiding construction.

To conduct high-precision and high-resolution numerical simulation of complex flow structures in turbomachinery, a high-order finite volume weighted essentially non-oscillatory (WENO) scheme for the large eddy simulation (LES) is improved and embedded into the three-dimensional viscous unsteady CFD solver NUAA-Turbo. Firstly, the spectral characteristics and unsteady convergence of the improved WENO scheme are studied. Compared with the classical WENO scheme, the improved WENO scheme has better dissipation and dispersion characteristics and faster convergence speed. Then, the coefficient CW of the Wall-Adapting Local Eddy-viscosity (WALE) model is calibrated by decaying homogeneous isotropic turbulence (DHIT) test case. Finally, the scheme is applied to conduct high-precision LES calculations of turbulent boundary layer flow, supersonic compression corner flow, and low-pressure turbine cascade separation flow. The numerical simulation results show that this WENO scheme has excellent shock wave capture ability and turbulence resolution and can capture more flow field details with less mesh size, greatly reducing the computational cost and laying a foundation for large-scale engineering application of LES.

Cytomegalovirus infection contributes to 10-30% congenital hearing loss in children. Vertebrate peripheral auditory organs include the outer, middle and inner ear. Their development is regulated by multiple signaling pathways. However, most ear diseases due to viral infections are due to congenital infections and reactivation, and affect healthy adults to a lesser extent. This may be due to the fact that viral infections affect signaling pathways that are important for the development of peripheral hearing organs. Therefore, an in-depth understanding of the relationship between viral infections and the signaling pathways involved in the development of peripheral hearing organs is important for the prevention and treatment of ear diseases. In this review, we summaries the effects of viruses on signaling pathways and signaling molecules in development of peripheral auditory organ, with a focus on Human cytomegalovirus as an example.

Herpesvirus is a prevalent pathogen that primarily infects human epithelial cells and has the ability to reside in neurons. In the field of otolaryngology, herpesvirus infection primarily leads to hearing loss and vestibular neuritis, and is considered the primary hypothesis regarding the pathogenesis of vestibular neuritis. In this review, we provide a summary of the effects of herpes virus on cellular processes in both host cells and immune cells, with a focus on HSV-1 as illus-trative examples.

Accurate evaluation of patients with disorders of consciousness (DoC) is crucial for personalized treatment. However, misdiagnosis remains a serious issue. Neuroimaging methods could observe the conscious activity in patients who have no evidence of consciousness in behavior, and provide objective and quantitative indexes to assist doctors in their diagnosis. In the review, we discussed the current research based on the evaluation of consciousness rehabilitation after DoC using EEG, fMRI, PET, and fNIRS, as well as the advantages and limitations of each method. Nowadays single-modal neuroimaging can no longer meet the researchers` demand. Considering both spatial and temporal resolution, recent studies have attempted to focus on the multi-modal method which can enhance the capability of neuroimaging methods in the evaluation of DoC. As neuroimaging devices become wireless, integrated, and portable, multi-modal neuroimaging methods will drive new advancements in brain science research.

The metro station ridership features are associated significantly with the built environment factors of the pedestrian catchment area surrounding metro stations. The existing studies have focused on the impact on total ridership at metro stations, ignoring the impact on varying patterns of metro station ridership. Therefore, the reasonable identification of metro station categories and built environment factors affecting the varying patterns of ridership in different categories of stations is very important for metro construction. In this study, we developed a data-driven framework to examine the relationship between varying patterns of metro station ridership and built environment factors in these areas. By leveraging smart card data, we extracted the dynamic characteristics of ridership and utilized hierarchical clustering and K-means clustering to identify diverse patterns of metro station ridership, and finally identified six main ridership patterns. We then developed a new built environment measurement framework and adopted multinomial logistic regression analysis to explore the association between ridership patterns and built environment factors. (1) The clustering analysis result revealed that six station types were classified based on varying patterns of passenger flow, representing distinct functional characteristics. (2) The regression analysis indicated that diversity, density, and location factors were significantly associated with most station function types, while destination accessibility was only positively associated with employment-oriented type station, and centrality was only associated with employment-oriented hybrid type station. These results could inform the coordinated development of rail transit and land use, and the renewal and enhancement of the built environment in the pedestrian catchment area surrounding metro stations.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

This paper focuses on the effect of malondialdehyde-induced oxidative modification (MiOM) on the gel properties of duck myofibrillar proteins (DMPs). DMPs were first prepared and treated with oxidative modification at different concentrations of malondialdehyde (0, 0.5, 2.5, 5.0 and 10.0 mmol/L). The physicochemical changes (carbonyl and free thiol group content) and gel properties (gel whiteness, gel strength, water holding capacity, rheological properties and mi-cro-structural properties) were then investigated. The results showed that the content of protein carbonyl groups increased with increasing MDA oxidation (P<0.05), while the content of free thiol groups decreased significantly (P<0.05). Meanwhile, there was a significant trend of decrease in gel whiteness; the hardness and water-holding capacity of protein gels increased significantly under the oxidation of low concentration of MDA (0-5 mmol/L), while the hardness of gels decreased under the oxidation of high concentration (10 mM). The storage modulus and loss modulus of oxidized DMPs also increased with increasing concentration; moreover, microstructural analysis confirmed that the gels oxidized at low concentrations were more compact and homogeneous in terms of pore size compared to the high concentration or blank group. In conclusion, moderate oxidation of malondialdehyde was beneficial to improve the gel properties of duck; however, excessive oxidation was detrimental to the formation of dense structured gels.

As one of the typical deposits in Sichuan-Yunnan-Guizhou Pb-Zn metallogenic province, the Daliangzi Pb-Zn deposit has a close genetic relation with the structural system of “black/fracture zone” formed under the action of NWW-approx. EW strike-slip structures in the metallogenic province, but the mechanism of rock and ore-controlling action of the structural system remains unclear. Based on detailed analysis of tectonite-mineralized alteration lithofacies of R1 “black/fracture zone”, the tectonite-mineralized alteration lithofacies zones can be divided into 4 types in succession outward from the Pb-Zn mineralization center, i.e., ① brecciated and stockwork-like Pb-Zn mineralization-complex breccia facies zone, ② stockwork-like Pb-Zn mineralization-simple breccia and cataclasite facies zone, ③ veined pyrite-sulfide-dolomitic cataclasite facies zone, and ④ fine-veined calcite-black carbonized dolomite facies zone; Cl- and SO42--rich high-temperature oxidizing ore-bearing fluid mixes with reducing fluid in Zone ① while migration and precipitation occur in Zone ④. With the evolution of ore-forming fluid, the homogenization temperature decreases from Zone ① to Zone ④, the salinity increases from Zone ① to Zone ② and then decreases to Zones ③ and ④, and the fluid density has little change on the whole; the contents of Zn, Pb, Cu, Ga, Ge, Cd, Ag, and other metallogenic elements, the Zn/Pb ratio, and the CaO/MgO mole ratio decrease gradually from Zone ① to Zone ④; and REE fractionation, calcilization, silicification, and pyritization enhance gradually from Zone ① to Zone ④. This series of changes are the product of diapirism (cryptoexplosion) of strike-slip structures and “black/fracture zone”, among which the second-order structures (F5, F100, and other faults) derived from NWW-approx. EW striking dextral shear-tension faults F1 and F15 control the brecciated and stockwork-like Pb-Zn mineralized complex breccia facies zones and the stockwork-like Pb-Zn mineralized simple breccia and cataclasite facies zones. Therefore, this paper establishes the zoning mode of tectonite-mineralized alteration lithofacies of “black/fracture zone” and proposes that Zones ① and ② are important prospecting criteria. conclusions.

The objective of this study was to investigate the concentration and spatial distribution patterns of six potentially toxic heavy metal elements (Mn, Zn, Cr, Pb, Cu and Ni) in bus station dusts in the Xifeng district of Gansu province, NW China. The contents were analyzed for Mn, Zn, Cr, Pb, Cu and Ni by using S8 TIGER Brochures wavelength dispersive X-ray fluorescence spectrometry. Geoaccumulation index (Igeo ), enrichment factor (EF), pollution index (PI) and integrated pollution index(IPI) were calculated to evaluate the heavy metal contamination level of bus station dusts. The results indicate that, in comparison with the background values of local soil, bus station dusts in Xifeng have elevated metal concentrations as a whole. The concentrations of heavy metals investigated in this paper are compared with the reported data of other cities. The results show that the arithmetic means of Mn, Zn, Cr, Pb, Cu and Ni are 440.8, 137.9, 60.0, 42.8, 33.5 and 19.8mg kg−1 respectively. The mean values of Igeo reveal the order of Ni<Mn<Cr<Cu<Zn<Pb. The high Igeo and EF for Cu, Zn and Pb in bus station dusts indicate that there is a considerable Cu, Zn and Pb pollution, which mainly originate from traffic and industry activities. The Igeo and EF of Ni, Mn and Cr are low and the assessment results indicate an absence of distinct Ni, Mn and Cr pollution in bus station dusts. The assessment results of PI also support Cu, Zn and Pb in bus station dusts presented middle pollution, and IPI indicates heavy metals of bus station dusts polluted seriously.

SOC stock (SOCS) changes caused by land use changes are still unclear, and understanding this response is essential for many environmental policies and land management practices. In this study, we investigated the temporal-spatial and vertical distribution characteristics of SOCS on the Western Sichuan Plateau (WSP) using the sparrow search algorithm-random forest regression (SSA-RFR) models with excellent model applicability and accuracy. The temporal-spatial varia-tions in the SOCS were modeled using 1080 soil samples and a set of nine environmental covariates. We analyzed the effect of land use changes on the SOCS on the WSP. The total SOCS increased by 18.03 Tg C from 1990 to 2020. The results of this study confirmed that the SOCS in the study area has increased significantly since 2010, with an increase of 27.88 Tg C compared to the total SOCS in 2010. We found that the spatial distribution of the SOCS increased from southeast to northwest, and the vertical distribution of the SOCS in the study area decreased with increasing soil depth. Forest and grassland are the main sources of SOCS, the total SOCS in the forest and grassland accounted for 37.53 and 59.39% of the total SOC pool in 2020, respectively. Expansion of the wetlands, forest, and grassland areas could increase SOCS in the study area.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

The oscillating heat pipe (OHP) is a new member in the family of heat pipes, and it has great potential applications in energy conservation. However, the fluid flow and heat transfer in the OHP as well as the fundamental effects of inner diameter on them have not been fully understood, which are essential to the design and optimization of the OHP in real applications. Therefore, by combining the high-speed visualization method and infrared thermal imaging technique, the fluid flow and thermal performance in the OHPs with inner diameters of 1, 2 and 3 mm are presented and analyzed. The results indicate that three fluid flow motions, including small oscillation, bulk oscillation and circulation, coexist or, respectively, exist alone with the increasing heating load under different inner diameters, with three flow patterns occurring in the OHPs, viz. bubbly flow, slug flow and annular flow. These fluid flow motions are closely correlated with the heat and mass transfer performance in the OHPs, which can be reflected by the characteristics of infrared thermal images of condensers. The decrease in the inner diameter increases the frictional flow resistance and capillary instability while restricting the nucleate boiling in OHPs, which leads to a smaller proportion of bubbly flow, a larger proportion of short slug flow, a poorer thermal performance, and easier dry-out of working fluid. In addition, when compared with the 2 mm OHP, the increasing role of gravity induces the thermosyphon effect and weakens the 'bubble pumping' action, which results in a little smaller and bigger thermal resistances of 3 mm OHP under small and bulk oscillation of working fluid, respectively.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The aim of this study was to investigate the biochemical properties and gel-forming capacity of duck myofibrillar proteins under the effects of 2,2'-azobis (2-amidinopropane) dihydrochloride (AAPH)-mediated oxidation. Duck myofibrillar proteins were extracted and treated with different concentrations of AAPH solutions (0, 1, 3, 5, 10 mmol/L) and then analysed for carbonyl content, dynamic rheology, protein profiles and gel-forming properties (colour, water holding capacity, hardness, protein profile, microstructure). The results showed that with increasing AAPH concentration, the carbonyl content of protein showed an increasing trend (p &lt; 0.05); SDS-PAGE pattern results indicated that moderate oxidation (3 mmol/L AAPH) induced myosin aggregation via covalent bonds including disulfide, enhanced protein-protein, and thus improved protein-water interactions and gel strength of DMPs heat-induced gels. However, high oxidation (5 and 10 mmol/L AAPH) led to partial degradation of myosin heavy chain (MHC), as evidenced by lower storage modulus and irregular microstructure, which significantly reduced gelation ability. These results suggest that the internal relationship between alkanoperoxy radical-induced oxidation should be taken into account in the processing of duck meat, as mild protein oxidation is conducive to improving gel quality.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Four Chinese herbs Zhishi, Zhiqiao, Qingpi and Chenpi from Citrus genus were widely used for treating various cardiovascular and gastrointestinal diseases. Although many pharmacological functions of these herb decoctions can be clarified from the bioactivities of identified ingredients, some of them remain confusing. To clarify the reasons of those confusing functions, depending on the extended structure-activity relationships of cholinergic and anti-cholinergic agents, here a simple method for quickly discovering possible choline analogs was established using a specific TLC method, and then stachydrine and choline were first identified from these Citrus herb decoctions based on their NMR and HRMS data. After this, two TLCS methods were first established respectively for the quantitatively analyses of stachydrine and choline, and the contents of both two ingredients and synephrine in 39 samples were determined using the valid TLCS and HPLC methods, respectively. The results showed the contents of stachydrine were 2.4 times to those of synephrine in Zhiqiao while about 1/3 to 2/3 in Zhishi, Qingpi and Chenpi. Simultaneously, the contents of stachydrine, choline and synephrine in these herbs present similar changing trends along with the delay of harvest time. However, the contents of synephrine decrease most rapidly, while those of stachydrine decrease most slowly. Based on these above, comparing with the pharmacological activities and pharmacokinetics reported of stachydrine and synephrine, it indicated that stachydrine and synephrine can be considered as a pair of bioactive equilibrists, especially in the cardio-cerebrovascular protection from these citrus herbs. Simultaneously, it confirmed that stachydrine should play an important role in the pharmacological functions, especially in dual-directionally regulating the uterus and various beneficial effects on cardio-cerebrovascular system, kidney and liver, of these citrus herbs.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

Polymer adhesives have emerged as a promising dielectric passivation layer in hybrid bonding for 3D integration while they raise misalignment problems during curing. In this work, the synergistic effect of oxygen plasma surface activation and wetting is utilized to achieve bonding between completed cured polyimides. The optimized process achieves a void-less bonding with a maximum shear strength of 35.3 MPa at a low temperature of 250 °C in merely 2 min, significantly shortening the bonding period and decreasing thermal stress. It is found that the plasma activation generated hydrophilic groups on the polyimide surface, and the wetting process further introduced more -OH groups and water molecular on the activated polyimide surface. The synergistic process of plasma activation and wetting facilitate bridging polyimide interfaces to achieve bonding, providing an alternative path for adhesive bonding in 3D integration.

Innovation is an essential key factor in the technology development history. Past research on innovation focused more on the innovation behavior of technology, but seldom described knowledge assets which also influence innovation behavior greatly. The effect of knowledge assets attribute and result on disruptive innovation is therefore regarded as the research topic in this study, where disruptive innovation is divided into outbound and inbound to combine combination-embeddednessandmajor business specificityof knowledge assets as the research model. Manufacturing enterprises in China are proceeded the questionnaire survey, and 173 valid copies are collected. The empirical analysis shows that combination-embeddedness of knowledge assets presents significantly positive effects on major business specificity and outbound innovationof an enterprise but reveals remarkably negative effects on inbound innovation. Enterprises are suggested to constantly accumulate knowledge assets with low major business specificity before disruptive innovation in order to reduce ineffective inbound innovation.

In this paper, we propose an unsupervised blind restoration model for images in hybrid degradation scenes. The proposed model encodes the content information and degradation information of images and then uses the attention module to disentangle the two kinds of information. It can improve the ability of disentangled presentation learning for a generative adversarial network (GAN) to restore the images in hybrid degradation scenes, enhance the detailed features of restored image and remove the artifact combining the adversarial loss, cycle-consistency loss, and perception loss. The experimental results on the DIV2K dataset and medical images show that the proposed method outperforms existing unsupervised image restoration algorithms in terms of peak signal-to-noise ratio (PSNR), structural similarity (SSIM), and subjective visual evaluation.

Current numerical methods for simulating biophysical processes in aquatic environments are typically constructed in a grid-based Eulerian framework or as an individual-based model in a particle-based Lagrangian framework. Often, the biogeochemical processes and physical (hydrodynamic) processes occur at different time and space scales, and changes in biological processes do not affect the hydrodynamic conditions. Therefore, it is possible to develop an alternative strategy to grid-based approaches for linking hydrodynamic and biogeochemical models that can significantly improve computational efficiency for this type of linked biophysical model. In this work, we utilize a new technique which links hydrodynamic effects and biological processes through a property-carrying particle model (PCPM) in a Lagrangian/Eulerian framework. The model is tested in idealized cases and its utility is demonstrated in a practical application to Sandusky Bay. Results show the integration of Lagrangian and Eulerian approaches allows for a natural coupling of mass transport (represented by particle movements and random walk) and biological processes in water columns which is described by a nutrient-phytoplankton-zooplankton-detritus (NPZD) biological model. This method is far more efficient than traditional tracer based Eulerian biophysical models for 3-D simulation, particularly for a large domain and/or ensemble simulations.

Considering the spectrum shortage problem of IoT devices, we introduce a collaborative spectrum sensing (CSS) framework in this paper to identify available spectrum resources, so that IoT devices can access it and meanwhile avoid causing harmful interference to the normal communication of the primary user (PU). However, in the process of the PU’s signal detection in IoT devices, the issue about the stopping time and decision cost arises. To this end, we propose a distributed cognitive IoT model, which includes two IoT devices independently using sequential decision rules to detect the PU. On this basis, we define the stopping time and cost function for IoT devices, and formulate an average cost optimization problem in CSS. To solve this problem, we further regard the optimal stopping time problem as a finite horizon problem, and solve the threshold of the optimal decision rule by dynamic programming. At last, numerical simulation results demonstrate the correctness of our proposal in terms of the global false alarm and miss detection probability, and it always achieves minimal average cost under various cost of each observation taken and thresholds.

Selenium nanoparticles (SeNPs) has higher bioavailability and safety than inorganic selenium, and was widely used in medical, agricultural, nutritional supplements, and antibacterial fields. The present study screened a strain L11 producing SeNPs from a selenium rich dairy cow breeding base in Hubei Province, China. The strain was identified as Bacillus subtilis through physiological, biochemical, and molecular biology analysis. Through optimization of cultivation conditions, the optimal cultivation parameters for L11 to produce SeNPs were pH=6, cultivation temperature of 37 °C, 4 mmol/L Na2SeO3, and cultivation for 48 hours. XPS, SEM-EDS, and TEM were used to verify that the Se particles produced by L11 are SeNPs with diameters ranging from 50 to 200 nm. The combination of protein analysis of different cell components and TEM analysis showed that L11 mainly produces SeNPs through the transformation of the cell's periplasmic space, cell membrane, and cell wall. Adding L11 SeNPs complex to sheep feed can significantly enhance the antioxidant activity and immunity of sheep, and increase the Se content in the neck muscles, liver, and spleen tissues.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

COX II containing a dual core CuA active site is one of the three core subunits of mitochondrial Cco, which plays a significant role in the physiological process. In this report, the full-length cDNA of COXⅡ gene was cloned from Sitophilus zeamais, which had an ORF of 684 bp encoding 227 amino acids residues. The predicted COXⅡ protein had a molecular mass of 26.2 kDa with pI value of 6.37, and multiple sequence alignment and phylogenetic analysis indicated that Sitophilus zeamais COXⅡ had high sequence identity 78.51% with the COXⅡ of other insect species, especially similarity to sitophilus oryzae. This gene was subcloned into the prokaryotic expression vector pET-32a, and induced by IPTG in E.coli Transetta (DE3) expression system. Finally the COXⅡ with 6-His tag was purified using affinity chromatography with Ni²⁺-NTA agarose. WB showed the recombinant COXⅡ was about 44 kD, and the concentration of fusion protein was 50μg/mL. UV-spectrophotometer and infrared spectrometer analysis showed that recombinant COXⅡ could catalyze the oxidation of substrate Cytc, and influenced by AITC. It was found that AITC could form a hydrophobic region with COXⅡ protein via molecular docking, besides, a sulfur atom of AITC structure could form a length of 2.9 Å hydrogen bond with Leu-31. These results will provide valuable information for elucidating the role of COXⅡ in Sitophilus zeamais responses to AITC, meanwhile, it will helpful to carry out a point mutation in AITC binding sites for the future research.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

The study of the currently known >3,000 species of snakes can provide valuable insights into the evolution of their genomes. Deinagkistrodon acutus, also known as Sharp-nosed Pit Viper, one hundred-pacer viper or five-pacer viper, is a venomous snake with significant economic, medicinal and scientific importance. Widely distributed in southeastern China and South-East Asia, D. acutus has been primarily studied for its venom. Here, we employed next-generation sequencing to assemble and annotate a highly continuous genome of D. acutus. The genome size is 1.46 Gb; its scaffold N50 length is 6.21 Mb, the repeat content is 42.81%, and 24,402 functional genes were annotated. This study helps to further understand and utilize D. acutus and its venom at the genetic level.

The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.

Abstract：This paper uses the balanced panel data from 29 provinces (autonomous regions and municipalities) in China for a total of 17 years from 2000 to 2016 as a research sample, and establishes an empirical model to examine the impact of environmental regulations and technological innovation on the quality of economic growth. Then this paper test technological innovation as a threshold variable, in which play a regulatory role. Taking the provincial balanced panel data as a research sample, a fixed effect model, a system GMM model, and a panel threshold model were established for empirical testing and the robustness test. Based on the empirical results, this article draws the following conclusions: from a national perspective, environmental regulations and technological innovation can significantly promote the quality of economic growth; from a regional perspective, there are regional differences in impact effects. Under the constraints of environmental regulations, the promotion effect of technological innovation on the quality of economic growth will be reduced; the impact of environmental regulation on the quality of economic growth will have a "threshold effect", and environmental regulation can significantly promote the quality of economic growth only after crossing the threshold and the threshold of technological innovation.

Laser scanning 3D imaging technology, because it can get accurate three-dimensional surface data, has been widely used in the search for wrecks and rescue operations, underwater resource development, and other fields. At present, the conventional underwater rotating laser scanning imaging system maintains a relatively fixed light window. However, in low-light situations underwater, the rotation of the scanning device causes some degree of water fluctuation, which warps the light strip data that the system sensor receives about the object's surface. To solve the problem, this research studies an underwater 3D scanning and imaging system that makes use of a fixed-light window and a spinning laser (FWLS). A refraction error compensation algorithm is investigated that is based on the fundamentals of linear laser scanning imaging and the dynamic refraction mathematical model is established by the motion of the imaging device. During the imaging process, the incident angle between the laser and the light window varies due to the scanning mode of the system. The experimental results show that the reconstruction radius error is reduced by 60% (from 2.5 mm to about 1 mm) when the measurement data for a standard sphere with a radius of 20 mm are compensated. Moreover, the compensated point cloud data exhibits a higher degree of correspondence with the model of the standard spherical point cloud. This study has a specific reference value for the refractive error analysis of an underwater laser scanning imaging system, and it provides certain research ideas for the subsequent refractive error analysis of various scanning imaging modalities.

The research fills the policy research gap for the women entrepreneurship and sustainability performance for examining key successful factors. Previous women entrepreneurship research fails to offer policy recommendations. The research purpose is to investigate these factors affect women entrepreneurship capabilities and sustainability performance by using SEM analysis and making policy recommendation. This research employs online and mail survey and obtains 175 women entrepreneur sample. The study finds that family support and motivation have positive effect on women entrepreneurship capabilities and sustainability performance. Barriers have no effect on performance. Hopefully, the research can provide the guidance to contribute to women’s entrepreneurship opportunities for achieving SDGs. Policy recommendation and managerial implication are discussed in the article.

Antibiotic resistance (ABR) is concerning issue due to its direct and indirect repercusions on public health, since decreased therapeutic effect of certain antibiotic to treatment complications that can cause death. There are several mechanism as to how ABR can be transferred from one microoorganisms to another, and many of them are dependant many environmental factors. The food supply chain is a environment in which ABR gene transfer can occur is multiple pathways, which generate concerns regarding food safety. Here, we summarize relevant mechanisms which are implied in ABR in food supply chain but also we are addressing routes of transmission and prevalence of ABR, implications on public health, and the application of new alternatives to antibiotics such as antimicrobial peptides, mainly bacteriocins, in order to countermeasure ABR.

Economic development and advancements in information technology contributed to the shift on accounting objective from commission responsibility view to decision-making useful view. The decision-making useful view claims that the accounting measurement methods should be changed to improve the usefulness of accounting information, to enable information users to make correct decisions. In addition, the development of financial instruments leads to the birth of fair value accounting. In recent years, fair value has been one of the most important measurement methods in the International Accounting Standard and US Generally Accepted Accounting Principles. However, China has been quite cautious when it comes to applying fair value full time, especially after the global financial crisis happened in 2008, wherein fair value accounting was exposed to strong suspicion. Hence, studying the value relevance of fair value is of great significance to exploring the accounting profession and reforming accounting standards. This paper attempts to investigate the value-relevance of fair value based on the data of listed financial companies and manufacturing companies in China. The results indicate that the fair value information in the financial industry has a strong explanatory influence to corporate share price. In contrast, the fair value information shows limited relevance in the manufacturing industry. Finally, consulting with the results of normative analysis and empirical study, this paper suggests several rational advices for the application of fair value in China.

Trichothecene mycotoxin T-2 toxin is an important environmental pollutant and poses a global threat to human and animal health. T-2 toxin could induce nephrotoxicity, however, the precise molecular mechanism remains unclear. In this study, the mice were intraperitoneally administrated with a single dose of 2 mg/kg T-2 toxin. The kidney function and ultrastructural observation were also assessed and found T-2 toxin exposure could cause kidney damage. Transmission electron microscopy showed a significant swelling and vacuolization of the mitochondria of renal cell. A total of 1122, 58, and 391 differential expression genes (DEGs) that were predominantly expressed in kidney tissues at 1 d, 3 d, and 7 d after T-2 toxin exposure, respectively. Early transcriptomic changes at 1 d after exposure were down-regulation of DEGs involved in the cell cycle, p53 signaling pathway, and cellular senescence, while up-regulation of DEGs referred to the ribosome pathway. The temporal variations in gene expression pattern in T-2 toxin exposure in mice kidney were presented and cellular metabolism was disturbed at the exposure recovery period with 7 d. In conclusion, this study, for the first time, provided a comprehensive comparative transcriptomic analysis of gene regulation in T-2 toxin exposure-induced nephrotoxicity at different temporal periods and explored the nephrotoxicity mechanism of T-2 toxin at the mRNA level.

Rhododendron chrysanthum Pall., live in Changbai Mountain being exposed to chilling temperature, high light intensities and water scarcity condition. To adapt to the harsh environment, the cold resistance mechanisms of R. chrysanthum have been successfully evolved in the long-term adaptive process. In our present work, the methods of proteomics combined with physiological and biochemical analyses were used to investigate the effects of cold stress on the photosynthesis and antioxidant system of Rhododendron chrysanthum Pall. and the molecular mechanisms involved in cold resistance of plants. A total of 153 photosynthesis related proteins were identified in present work, of which 7 proteins including Rubisco large subunit (rbcL) were up-regulated in experiment group (EG) compared with control group (CG). Simultaneously, four chlorophyll fluorescence parameters were measured in present study. The results showed that the maximum photochemical efficiency of photosystem II (Fv/Fm), actual quantum yield of PSII (Y(II)) and photochemical quenching (qP) were significantly higher in EG, whereas the non-photochemical quenching (NPQ) was notably decreased. Cold stress could lead to a significant reduction in electron transport rate (ETR) accompanied with an increase in excitation pressure (1-qP). The abundance of PetE which involved in the plants photosynthetic electron transfer was also significantly influenced by cold stress. Moreover, the up-regulated expressions and higher levels of enzymatic activities of Glutathione peroxidase (GPX) and Ascorbate peroxidases (APXs) were detected in EG. All these changes which can help plants to survive in low temperature are considered as the crucial parts of cold tolerance mechanisms. These results revealed that photosynthesis and redox adjustment play significant roles in the defense of cold-induced damage.

Atopic dermatitis (AD) is a chronic inflammatory skin disease, which can cause skin barrier function damaged. Although co-incubation with docosahexaenoic acid (DHA) exerts a positive effect in deficient skin model, there is no study to investigate the effects of topical treatment with DHA in inflammatory reconstructed human epidermis (RHE) model. The effects of DHA on monolayer normal human epidermal keratinocyte (NHEK) cells were evaluated via CCK-8, qPCR and ELISA. The skin related barrier function was assessed by hematoxylin-eosin (HE) staining, western blot (WB), Immunohistofluorescence (IF) and ELISA in normal and inflammatory RHE models. DHA upregulated filaggrin and loricrin expression at mRNA levels in addition to suppress overexpression of TNF-α，IL-1α and IL-6 stimulated by poly I:C plus LPS (stimulation cocktail) in cultured NHEK cells. After topical treatment with DHA, cocktail induced inflammatory characteristics of skin diseases including barrier morphological, differentiation proteins and TSLP secretion, which were alleviated in RHE models. Supplementation with DHA can improved related barrier function and have anti-inflammation effects in monolayer keratinocytes and RHE models, which indicated that DHA may have a potential value for the treatment of inflammation-associate skin diseases.

Technology can be seen everywhere and has been integrated into our lives.We are always using technology and enjoying the convenience brought by technology. However, physical retailers and e-commerce companies are also gradually adopting advanced technologies. Technology improves the purchasing environment and purchasing experience. Virtual reality and augmented reality have been hotly discussed in recent years. Technology, although virtual reality and augmented reality technology have not yet matured, it can be said that they will in the future It has great development potential. Virtual reality and augmented reality are also beginning to sprout in the retail industry. However, research on the acceptance of the use of virtual reality and augmented reality in the apparel shopping process is still lacking because This study explores how usefulness, ease of use, hedonicity, customer experience, customer engagement and satisfaction. To influence customer loyalty, this study adopted questionnaire survey and convenience sampling methods, and collected a total of 308 valid questionnaires. The analysis method used confirmatory factor analysis and structural equation model to verify the research hypothesis relationship. The results of this study found. Hedonic has a significant impact on customer loyalty, while usefulness, ease of use, customer experience, customer engagement and satisfaction Satisfaction does not have a significant impact on customer loyalty. This study explains the academic contribution of the research results. The practical implications in marketing are put forward, and specific suggestions and directions for future research are given.

Epitranscriptomic RNA modifications play a crucial role in the posttranscriptional regulation of gene expression. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic RNA and plays a pivotal role in RNA fate. RNA m6A modification is regulated by a group of cellular proteins, methyltransferases (writers) and demethylases (erasers), which add and remove the methyl group from adenosine, respectively. m6A modification is recognized by a group of cellular RNA-binding proteins (readers) that specifically bind to m6A-modified RNA, mediating effects on RNA stability, splicing, transport, and translation. The functional significance of m6A modification of viral and cellular RNA is an active area of virology research. In this review, we summarize and analyze current literature on m6A modification of HIV-1 RNA, the multifaceted functions of m6A in regulating HIV-1 replication, and the role of viral RNA m6A modification in evading the innate immune responses to infection. Furthermore, we briefly discuss future directions and therapeutic implications of mechanistic studies of HIV-1 epitranscriptomic modifications.

Threshing device is the core component of grain combine harvester, and its working performance determines the working quality and production efficiency of the harvester to a great extent. The straw guide plate plays an important role in the threshing device to dredge the threshing matter and control the threshing time of the combine harvester matter in the threshing chamber. In the past, the guiding structure of threshing device could not optimize the working performance of the machine by adjusting the spiral angle, that is, most cereal combine harvester may not be fed smoothly or even clogged when operating under different crop types, yield differences and operating environments, a kind of threshing device with adjustable guide straw board was studied. In this study, the movement model of the straw on the straw guide plate was analyzed, and it was found that the spiral angle “α”of the straw guide was 0<α<58°.Three-factor and three-level response surface method was used to carry out field experiment on drum speed, working speed and guide grass plate spiral angle, and the experimental data were analyzed by quadratic polynomial regression.The results show that the drum speed, working speed and the spiral angle of the guide grass plate have significant effects on the loss rate (PLR) , impurity content (PIR) and breakage rate (PBR) , the drum speed and working speed have an interactive effect on the impurity ratio (PIR) , and the working speed and the helical angle of the guide grass plate have an interactive effect on the loss ratio (PLR) and breakage ratio (PBR) , there is an interaction between the rotary speed of the roller and the helical angle of the guide grass plate on the crushing rate (PBR) .Further optimization analysis showed that the predicted value was PLR = 1.18% , PIR = 0.72% , PBR = 0.53% , the experimental verification value was PLR = 1.26% , PIR = 0.73% , PBR = 0.61% . The absolute error between the experimental value and the predicted value was very small, however, the optimized field test verified value decreased by 8.31% , 50.04% and 60.30% respectively, which indicated that the optimized harvester had better operation quality, in particular, PIR, PBR and other two indicators have a greater increase in the effect.

Due to the long-term deformation settlement of foundations, issues such as damage and functional failure of buildings and structures have long been of concern in the engineering field. The creep of soil is one of the primary causes leading to long-term deformation of foundations. In this paper, the consolidation deformation, creep characteristics, and creep model of reconstituted saturated silty clay were studied by isotropic compression test and triaxial shear creep test. The results show that for the isotropic compression test, although the applied load adopts different stages of loading, as long as the final applied confining pressure is the same, the number of stages applied by the confining pressure has little effect on the final isotropic consolidation deformation of the sample and the triaxial undrained shear strength after creep. However, for the triaxial shear creep test, it is found that under the same final deviatoric stress, the final deviatoric strain of the sample is closely related to the number of loading stages of deviatoric stress. It shows that the more loading stages of the sample loaded with the same deviatoric stress, the smaller the final deviatoric strain, and the triaxial undrained shear strength of the sample after creep will increase. In addition, it is reasonable to determine the pore pressure dissipation of the sample to 95%((u0-u0)/u0=95%) as the main consolidation end time (tEOP) of the sample. The isotropic consolidation creep curves and the triaxial shear creep curves show certain nonlinearity. Then the logarithmic model and the hyperbolic model were used to fit the creep curves of the samples. It is found that the hyperbolic model has a better fitting effect than the logarithmic model, but for the triaxial shear creep test, the creep parameters of the sample change greatly. Therefore, studying the creep characteristics of soil under different pre-loading steps is of significant engineering importance for evaluating the long-term deformation of underground structures.

Background: The COVID-19 outbreak has accelerated the huge difference between medical care and disease prevention in Chinese medical institutions. This study aimed to investigated the relationship between the symbiotic units, environments, models, and effects of the integration of medical and disease prevention. Methods: This cross-sectional study involved 762 employees of public hospitals in 11 cities in Zhejiang Province by random stratified sampling. We analyzed the influence paths of elements in the mechanism of integration of medical and disease prevention and the mediating effect of symbiotic models among symbiotic units, symbiotic environments, and effects for on this integration. Results: The path coefficient of symbiotic unit on the symbiosis model was 0.46 (p&lt;.001), the path coefficient of symbiotic environment on symbiosis model was 0.52 (p&lt;.001). The path coefficient of the symbiotic unit and environment was 0.91 (p&lt;.001). The symbiotic models exhibited a partial mediation effect between symbiotic units and the effect of this integration. Sobel test = 3.27, β = 0.152, and the mediating effect accounted for 34.6%. Conclusions: It is suggested that Health policy-makers and public hospital managers should provide sufficient symbiotic units, establish collaborative symbiotic models, and improve the effects of integration of medical and disease prevention in public hospitals.

To understand lung damage caused by COVID-19, we deduced two-phase lung damage mechanisms. After the lungs are infected with SARS-CoV-2 virus, the affected lung tissue swells and surface properties of pulmonary capillaries change, resulting in an increased flow resistance of affected capillaries. If a sufficient number of capillaries are affected by the infection, the swelling and increased cell wall adhesion collectively raise pulmonary vascular resistance. The increased vascular resistance further increases the dwell times of WBCs in affected capillaries and nearly capillaries. When pulmonary pressure is sufficiently higher, WBCs are forced to squeeze into interstitial spaces or alveolar spaces when local pressures are higher than what the capillaries can withstand. When more and more WBCs are dynamically retained, the flow resistance of more capillaries rises, pulmonary vascular resistance rises, and pulmonary pressure rises. The rise in the pulmonary pressure in turn results in elevated capillary pressures. When capillary pressures around the alveoli are sufficiently high, they cause interstitial pressures to change from normally negative values to positive values. The positive pressures cause fluid leakage to the alveolar space and thus degrade lung function. Tissue swelling, and occupation of WBCs in interstitial spaces and alveolar spaces further reduce compressible volume, and thus cause further rise in the pulmonary vascular resistance and pulmonary pressure. When the pulmonary pressure has reached a critical point as in the second phase, the blood breaks capillary walls and squeezes through interstitial spaces to reach alveolar spaces, resulting in irreversible lung damages. The available free volume in the thorax cage, organ usable capacities, temperature and humid are expected to have great impacts on degree of lung damages. The free volume in the thorax cage, lung usable surplus capacity, and other organ usable capacities determine the arrival time of last-phase irreversible damage. The mechanisms imply that the top priority for protecting lungs is maintaining pulmonary micro-circulation and preserving organ functions in the entire disease course while controlling viral reproduction should be stressed in the earliest time possible. The mechanisms also explain leukecytes are recruited and migrated into inflamed tissues by increasing their dwell times caused by increased local flow resistance.

After reviewing cancer theories, cancer treatment development histories, randomized clinical trial's performance, cancer treatment strategy, trial follow-up times, and conducting numerous simulations using existing data, the authors found: (1) medical treatments come with three to four lethal factors: treatment side-effects, emotional distress and chronic dress, lack of exercises or physical inactivity, and excessive nutrition in some cases; (2) clinical trial exaggerates the benefits of fast-acting treatments and underestimates the slow-delivering adverse side effects as a result of statistical averaging, interfering effects of personal lifestyle factors, and insufficient follow-up times; (3) the benefits of medical treatments are limited by chain comparison, where surgery sets up a negative standard relative to the best way for resolving cancer; (4) the strategy of destroying the tumor is unworkable; (5) medical treatments can turn natural cancer growth curve into approximately doubly exponential curve; (6) multiple factor non-medical measures are much more powerful than medical treatments in controlling cancer growth and metastasis rates; and (7) cancer early diagnosis and over treatments are bad strategies that have great adverse impacts on cancer patients. Based on huge increases in cancer growth rate constants, substantial of loss of organ functional capacity, and severe systemic aging-like cellular damages, the authors concluded that medical treatments promote cancer growth and metastasis rates and shorten patient lives in most cases, and the claimed benefits are caused by triple biases of clinical trials. The authors believe that the better strategy for ending the global cancer epidemic is abandoning clinical trails as the research model, changing caner treatment strategy from killing cancer cells to slowing down cancer growth rates by using multiple factors optimization approach in personalized medicine.

This paper studies the contemporaneous relationship between S&P 500 index returns and log-increments of the market volatility index (VIX) via a nonparametric copula method. Specifically, we propose a conditional dependence index to investigate how the dependence between the two series varies across different segments of the market return distribution. We find that: (a) the two series exhibit strong, negative, extreme tail dependence; (b) the negative dependence is stronger in extreme bearish markets than in extreme bullish markets; (c) the dependence gradually weakens as the market return moves toward the center of its distribution, or in quiet markets. The unique dependence structure supports the VIX as a barometer of markets' mood in general. Moreover, applying the proposed method to the S&P 500 returns and the implied variance (VIX²), we find that the nonparametric leverage effect is much stronger than the nonparametric volatility feedback effect, although, in general, both effects are weaker than the dependence relation between the market returns and the log-increments of the VIX.

In this study, we investigated the effects of three surface treatment techniques on 316L stainless steel, low-temperature immersion corrosion, shot peening followed by immersion corrosion, and electrochemical corrosion. Surface alterations were analyzed using scanning electron microscopy, Raman spectroscopy, and α-step thin-film thickness profiling. Human osteoblast adhesion was evaluated using Liu’s stain and metallographic optical microscopy. The results revealed weak cell adhesion after low-temperature immersion and shot peening followed by immersion corrosion. By contrast, electrochemical corrosion, particularly with a high current density and low corrosive solution concentration, resulted in a uniformly corroded surface, thus promoting dense cell adhesion. All three techniques resulted in porous oxide layers. Overall, our experimental findings highlighted shot peening (1 kg/cm2 for 20 s) and electrochemical corrosion (0.5 M HCl) as effective processes. Electrochemical corrosion produced uniformly dense corrosion pits, whereas shot peening produced semicircular grooves with small corrosion pits, both favorable for cell adhesion. Electrochemical corrosion also yielded excellent cell adhesion, emphasizing its suitability for biomedical activity. We developed a process for creating a porous surface layer and thereby enhancing the cell adhesion to 316L stainless steel for potential biomedical implant applications.

We aimed to evaluate the protective effects of acetyl-xylogalactan on the activity of RAW264.7 macrophages against heat stress. To this end, we assessed cell survival, phagocytic activity, in-tracellular Ca2+ level, mitochondria potential exchange, apoptotic assay findings, galactosidase activity and the RNA-seq by NGS and real-time polymerase chain reaction (PCR) expression. In our evaluation of macrophage morphology at 37°C and 41°C, the macrophages showed an oval shape at 41°C , unlike the spindle shape at 37°C. Therefore, 41°C was chosen as the heat stress condition. Subsequently, we designed an experiment to evaluate changes in the RAW264.7 macrophages after acetyl-xylogalactan treatment under heat stress. The survival of RAW264.7 macrophages treated with acetyl-xylogalactan was higher than that of controls that were not treated with acetyl-xylogalactan. Moreover, on the basis of the results of the annexin-V detection assay, the apoptotic activity of macrophages appeared to have reduced after treatment with ac-etyl-xylogalactan. Moreover, treatment with acetyl-xylogalactan resulted in a stronger recovery trend in the intracellular Ca2+ and mitochondrial membrane potential after heat stress. RNA sequencing and real-time polymerase chain reaction (PCR) illustrated that Sarcodia suieae acetyl-xylogalactan could upregulate the expression of the anti-apoptosis Cflar gene and down-regulate the expression of the apoptosis factors Ddit3, and Hyou1 to protect macrophages under heat stress.

The fatigue delamination damage is one of the most important fatigue failure modes of laminated composite structures. However, the developments of the theoretical framework, mathematical/physical model and numerical simulation of fatigue delamination are still challenging issues, and there is a lack of systematic classification. This article reviews the experimental phenomena of the onset and propagation stage of delamination under fatigue loading, and summarizes the commonly used phenomenological models for laminated composite structures. The research methods, general modeling formulas and development prospects of the phenomenological models are presented in detail. In the light of the analysis of finite element model (FEM) for the laminated composite structures, a number of simulation methods of fatigue delamination crack propagation damage model are carefully classified. Furthermore, within the theoretical framework of strength theory model (SM), fracture mechanics model (FM), damage mechanics model (DM) and hybrid model (HM), the complete procedure, application, capability assessment, advantages and limitations of the models are also discussed in detail. Finally, several valuable suggestions are given for the research interests, and challenging technical problems that need to be overcome on the fatigue delamination prediction of laminated composite structures in the future.

For the last two decades, an increasing demand for low-cost adsorbents for drinking water treatment has been challenged in the rural areas of developing countries that have problems with arsenic (As) contamination. In this work, spent bleaching earth (SBE), a residual material that is formed during the process of refining vegetable oil, has been utilized to prepare the new magnetic adsorbent Fe-SBE/C by modifying its surface area through calcination and co-precipitation with iron. The experimental results demonstrate that Fe-SBE/C exhibits a substantial adsorption capacity towards both arsenite (As(III)) and arsenate (As(V)). Optimal pH conditions were found to be pH 10 for As(III) and pH 3 for As(V), resulting in adsorption percentages of 76.7% and 94.1%, respectively. Other experimental parameters such as calcination conditions, adsorbent dosage, iron-loading ratio, and the presence of co-existing ions were thoroughly investigated. The kinetic study revealed that the adsorption processes follow the Elovich and intraparticle diffusion models, suggesting a combined adsorption mechanism of boundary layer control and chemisorption. Furthermore, the isotherm followed the Langmuir model with a maximum adsorption capacity of 202.61 μg g-1 for As(III) and 187.61 μg g-1 for As(V). Through thermodynamic analysis and reinforcement by activation energy data, this research validates that the observed adsorption process is indicative through chemisorption. The regeneration study revealed the potential for multiple cycles of arsenic removal, highlighting the practical applicability of Fe-SBE/C in environmental contexts. In conclusion, the findings of this study underscore the efficacy of Fe-SBE/C in arsenic removal and present it as a promising and environmentally friendly solution for mitigating arsenic pollution.

Many types of banana (Musa spp.)—one of the most economically important horticultural crops—exist, and their ploidy (diploid, triploid, and tetraploid, usually) and genome types (containing A or/and B genome in most cases) differ. At present, observation and genome type detection are commonly used to identify banana germplasm resources. However, the former is tedious, while the latter cannot distinguish categories below genome types. It is therefore urgent that a simple and effective method for identifying banana germplasm resources is established. We sequenced and analyzed the ribosomal DNA internal transcribed spacer (ITS) sequences of 62 banana germplasm and found that the sequencing peaks, especially the 20 bp region near the 420 bp position (referred to as the “420 bp region”), exhibited relatively recognizable and repeatable polymorphism characteristics. Using the “420 bp region” as a marker, we were able to quickly distinguish bananas belonging to different genome type groups (comprising the AA, AB, AAA, ABB, AAB, ABBB, AAAB, and AAAA groups) or different subgroups in the same genome type group (for example, the Cavendish, Gros Michel, Red, Lakatan, and Ibota Bota subgroups in the AAA group; and the Pisang Raja, Plantain, Pome and Silk subgroups in the AAB group). Moreover, it appeared that Sanger sequencing of ITS could be used for identifying banana hybrid offspring. These results demonstrated that the banana ITS region contains rich genetic information that is useful for genotyping. In general, ITS sequencing simplifies the classification of banana germplasm resources and has potential application in several areas of Musa improvement.

In this paper, a low-grade copper oxide ore with highly alkaline was treated. The thermodynamic model of CuO-(NH4)2SO4-NH3-H2O was established in the leaching system of tenorite (CuO) under the condition of double conservation of mass and charge. The fitting function of MATLAB and the diff and solve functions were used to calculate the optimal ammonia concentration and total copper ion concentration of tenorite under different ammonium sulfate concentrations. The effects of different ammonia-ammonium salt (ammonium sulphate, ammonium carbonate, ammonium chloride) solution on copper leaching rate were investigated. Results show that under the conditions of ammonia concentration of 1.2 mol/L, ammonia-ammonium ratio of 2:1 and liquid-solid ratio of 3:1, the copper leaching rate from the ammonium sulphate and ammonium chloride solution reaches 70%, slightly higher than that of ammonium carbonate. Therefore, ammonia ammonium sulfate system is selected to leach low-grade copper oxide due to its lower corrosion to the equipment than the chlorination system.

Cellobiose phosphorylase (CBP) catalyzes the reversible phosphorolysis of cellobiose into α-glucose 1-phosphate and glucose. When it was used in transforming cellulose to amylose (PNAS, 110: 7182-7187, 2013) as well as in constructing a yeast with the ability to phosphorolytically use cellodextrin to produce ethanol, a CBP with a broadened substrate specificity would be more desirable. Based on the structure differences in the catalytic loops of CBP and cellodextrin phosphorylase from Clostridium thermocellum (named CtCBP and CtCDP, respectively), CtCBP was mutated. A single-site mutant S497G was identified to have a 5.7-fold higher catalytic efficiency with cellotriose as a substrate in phosphorolytic reaction direction compared to wild type, without any loss of catalytic efficiency on its natural substrate cellobiose. When S497G variant was used in the transformation of mixed cellodextrin (cellobiose + cellotriose) to amylose, a significant increase in amylose yield was achieved compared to that of wild type CtCBP. Structure change in the substrate binding pocket of S497G variant accounted for its capacity to accept longer cellodextrins than cellobiose. Taken together, S497G variant of CtCBP was confirmed to acquire a promising feature favorable to those application scenarios involving cellodextrin’s phosphorolysis.