The leaves of Ligustrum robustum have been applied as Ku-Ding-Cha, a functional tea to clear heat and remove toxins; and served as a folk medicine to deal with diabetes, obesity, and hypertension. Trans-p-hydroxycinnamic acid and its esters, which were isolated from the leaves of L. robustum, might be a new resource to prevent diabetes and its complications because of their strong -glucosidase and fatty acid synthase (FAS) inhibitory activities and antioxidant effect. However, the quantitative analytical method for trans-p-hydroxycinnamic acid and its esters in the leaves of L. robustum hasn’t been reported so far. In addition, it was difficult and troublesome to analyze no less than 34 trans-p-hydroxycinnamic acid esters by usual HPLC. Therefore, a new HPLC-UV method using hydrolyzation with sodium hydroxide for quantitation of trans-p-hydroxycinnamic acid and its esters in the leaves of L. robustum was developed in the present study. The optimal hydrolyzation conditions were as follows: 1 mL sodium hydroxide aqueous solution (1 M) was added into 1 mL the extract of L. robustum and incubated at 80 °C for 2 h , and then 1 mL hydrochloride (1 M) solution was added. HPLC analysis was performed in reverse phase mode using a C-18 column, eluting with methanol-0.1% acetic acid aqueous solution (40:60, v/v) in isocratic mode at a flow rate of 1.0 mL/min, and detecting at 310 nm. The analytical method was simple and rapid, which simplified greatly the analytical process. The method was validated in terms of linearity, limit of detection (LOD), limit of quantification (LOQ), precision, and accuracy. High linearity was demonstrated with correlation coefficient of 1.000 for trans-p-hydroxycinnamic acid. The LOD and LOQ values were 1.55 and 4.69 μg/mL, respectively. The relative standard deviations (RSD) of intra-day and inter-day variabilities for trans-p-hydroxycinnamic acid were less than 2%. The percentage recovery of trans-p-hydroxycinnamic acid was 101.2% ± 0.8%. Finally, the proposed method was applied successfully to the determination and comparison of the contents of trans-p-hydroxycinnamic acid and its esters in various extracts of the leaves of L. robustum. The 60%-70% ethanol extracts of L. robustum showed the highest contents of free trans-p-hydroxycinnamic acid (3.96-3.99 mg/g), and the 50%-80% ethanol extracts of L. robustum displayed the highest contents of trans-p-hydroxycinnamic acid esters (202.6-210.6 mg/g). The method can be applied also to the quality control of the products of L. robustum.

Strigolactones (SLs) are a novel emerging plant hormones, which play important roles in regulating plant organ development and environmental stress tolerance. Even though the SL related genes have been identified and well characterized in some plants. The information of SL related genes in soybean is not fully established yet, especially in response to salt stress. In this study, we identified nine SL biosynthesis genes: two D27, two CCD7, two CCD8, and three MAX1, and seven SL signaling genes: two D14, two MAX2 and three D53 in soybean genome. We found that SL biosynthesis and signaling genes are conserved during evolution in different species. Syntenic analysis of these genes revealed their location on nine chromosomes as well as existence of ten pairs of duplication genes. Moreover, plant hormone and stress-responsive elements were identified in the promoter regions of SL biosynthesis and signaling genes. By using quantitative real-time PCR (qRT-PCR), we confirmed that SL genes have different tissue expression in roots, stems and leaves. Further, we also explored the expression profiles of SL biosynthesis and signaling genes under salt stress. These results suggested that SL signaling genes may play important regulatory roles in response to salt stress. In conclusion, we identified and provided valuable information on the soybean SL biosynthesis and signaling genes, and established a foundation for further functional analysis of soybean SL related genes in response to salt stress.

This paper aims to search for lump waves in a spatial symmetric (2+1)-dimensional dispersive wave model. Through an ansatz on positive quadratic functions, we conduct symbolic computations with Maple to generate lump waves for the proposed nonlinear model. A line of critical points of the lump waves is computed, whose two spatial coordinates travel at constant speeds. The corresponding maximum and minimum values are evaluated in terms of the wave numbers, and interestingly, all those extreme values do not change with time, either. The last section is the conclusion.

We present three reduced integrable hierarchies of nonlocal integrable NLS type equations from a vector integrable hierarchy associated with a matrix Lie algebra, not being A type. Three similarity transformations are taken to keep the invariance of the transformed zero curvature equations. The key step is to formulate a solution to a reduced stationary zero curvature equation so that the zero curvature formulation works for a reduced case.

Based on the data of A-share listed companies in Shanghai and Shenzhen of China from 2011 to 2018 and the digital inclusive finance index of Peking University (2011-2018), this paper empirically tests the impact of digital finance development on corporate social responsibility in various provinces of China and its impact mechanism. The results show that: (1) the development of digital finance helps to promote the fulfillment of corporate social responsibility; (2) the influence mechanism of the development of digital finance to promote the fulfillment of corporate social responsibility lies in that it reduces the cost of debt financing and leads to the improvement of corporate social responsibility.(3) Further research shows that the positive relationship between digital finance and corporate social responsibility is more significant in private enterprises. At the same time, the impact is more significant in areas with poor market environment. The above research shows that the development of digital finance has a significant positive effect, which will improve the level of corporate social responsibility.

The three-pronged sliding universal coupling is a new kind of three-pronged coupling. To study its kinematic and dynamic characteristics, directional cosine matrices are utilized as tools to analyze the coordinate systems by establishing simplified geometric models and corresponding motions. Through the analysis of the motions of the input and output shafts and employing the method of single-force element, a set of equilibrium equations for the forces acting on the output shaft and the input shaft are formulated for solution analysis. The research indicates that during the rotation process, there exists a small angular difference between the input shaft and the intermediate shaft, demonstrating the quasi-constant angular velocity characteristics of the new tripod sliding universal coupling. The curves of the forces and torques acting on each component of the coupling approximate sinusoidal curves. The optimal operating angle range for the new tripod universal coupling is at angle , during which the system exhibits good transmission and mechanical performance.

'Huangguan' pear has significant social and economic value, and phosphorus, as one of the three main mineral elements of plants, has an irreplaceable effect on the normal growth of 'Huangguan' pear trees. The objective of this study was to predict the content of phosphorus in the pulp and peel of ‘Huangguan’ pears nondestructively and conveniently by using near-infrared spectroscopy (900–1700 nm) technology. First, twelve algorithms are used to preprocess the original spectral data, and the partial least squares regression algorithm and the gradient boosting regression tree algorithm are used to build a full-band prediction model based on the original spectral data and the processed spectral data. The characteristic wavelengths were extracted using genetic algorithms, followed by establishing a characteristic wavelength prediction model. The prediction accuracy of the models was evaluated according to the coefficient of determination R² and the relative analysis error RPD. The study found that the best prediction model for predicting phosphorus content in the pulp of 'Huangguan' pear was MSC-GA-PLSR, which had R²=0.843 and RPD=1.857 in the modelling set and R²=0.989 and RPD=7.041 in the prediction set. The best prediction model for predicting phosphorus content in the peel of ‘Huangguan’ pear was SG+SNV+FD-GA-PLSR, which had R²=0.991 and RPD=7.470 in the modelling set and R²=0.974 and RPD=4.414 in the prediction set, and the effect was good and met expectations. The results demonstrated that near-infrared spectroscopy could successfully achieve nondestructive detection of phosphorus content in the pulp and peel of 'Huangguan' pears.

The sexual reproduction of ascomycetes is controlled by the mating-type(MAT) locus. (Pseudo)homothallic reproduction has been hypothesized based on genetic data from Hirsutella sinensis (Genotype #1 of Ophiocordyceps sinensis). In this study, the differential occurrence of the mating-type genes in the MAT1-1 and MAT1-2 idiomorphs, which constitute the genetic control of O. sinensis reproduction, was analyzed in 237 strains and 5 genomes of H. sinensis. The mating-type genes were differentially transcribed in H. sinensis Strain L0106, and the MAT1-2-1 transcript in H. sinensis Strain 1229 was alternatively spliced, with an unspliced intron I containing stop codons; these findings constitute O. sinensis reproduction controls at the transcriptional and coupled transcriptional-translational levels. The occurrence of the mating-type genes and a-/α-pheromone receptor genes differed among the 5 H. sinensis genomes. The differential occurrence and transcription of these genes are inconsistent with self-fertilization under (pseudo)homothallism but suggest self-sterility of H. sinensis, which therefore needs a mating partner to achieve sexual outcrossing under heterothallism or hybridization. Consistent occurrence and transcription of the mating-type genes of both the MAT1-1 and MAT1-2 idiomorphs have been reported in natural and cultivated Cordyceps sinensis, but these findings are insufficient to determine the reproduction mode(s) because of the co-occurrence of >90 fungal species and multiple genomically independent genotypes of O. sinensis. The mutant MAT1-1-1 and α-pheromone receptor transcripts in natural C. sinensis result in the N-terminus or middle-truncated proteins, with changes in hydrophobicity and secondary structures of the proteins, suggesting heterogeneous fungal source(s) of the proteins and hybridization reproduction.

Celtis sinensis is an adaptable species that is widely grown in southern China. In June 2022, a leaf blotch disease of C. sinensis was observed in Nanjing, Jiangsu, China. Based on morphological characterization, three isolates were identified as Alternaria species. Phylogenetic analysis of combined ITS, GAPDH, TEF1-α, RPB2 and Alt a 1 sequences identified the three isolates we obtained as Alternaria alternata and Alternaria koreana. Koch’s postulates were fulfilled in the greenhouse, and the pathogenicity of A. alternata and A. koreana was determined by leaf inoculation tests on C. sinensis seedlings. The symptoms of indoor inoculation were consistent with those in the field. A. alternata and A. koreana can grow at 15-35 °C, with an optimal growth temperature of 25 °C. The results of fungicide sensitivity experiments indicated that A. alternata and A. koreana were the most sensitive to prochloraz, which may be a useful strategy for the future prevention and control management of A. alternata and A. koreana. This study provides the first step for further research on A. alternata and A. koreana as pathogens of C. sinensis and provides a theoretical basis for future control strategies.

Recently, generative adversarial networks (GANs) can be used to generate the photo-realistic image from a low-dimension random noise. It is very dangerous that the synthesized or generated image is used on inappropriate contents in social media network. In order to successfully detect such fake image, an effective and efficient image forgery detector is desired. However, conventional image forgery detectors are failed to recognize the synthesized or generated images by using GAN-based generator since they are all generated but manipulation from the source. Therefore, we propose a deep learning-based approach to detect the fake image by combining the contrastive loss. First, several state-of-the-art GANs will be collected to generate the fake-real image pairs. Then, the contrastive will be used on the proposed common fake feature network (CFFN)to learn the discriminative feature between the fake image and real image (i.e., paired information). Finally, a smaller network will be concatenated to the CFFN to determine whether the feature of the input image is fake or real. Experimental results demonstrated that the proposed method significantly outperforms other state-of-the-art fake image detectors.

L-Theanine, a unique non-protein amino acid, is an important bioactive component of green tea. Previous studies have shown that L-theanine has many potent health benefits, such as anti-anxiety effect, regulation of immune response, relaxing neural tension, reducing oxidative damage. However, little is known concerning whether L-theanine can improve the clearance of mitochondrial DNA (mtDNA) damage in organisms. Here, we reported that L-theanine treatment increased ATP production and improved mitochondrial morphology to extend the lifespan of UVC-exposed nematodes. Mechanistic investigations showed that L-theanine treatment enhanced the removal of mtDNA damage and extended lifespan by activating autophagy, mitophagy, mitochondrial dynamics, and mitochondrial unfolded protein response (UPRmt) in UVC-exposed nematodes. In addition, L-theanine treatment also up-regulated the expression of genes related to mitochondrial energy metabolism in UVC-exposed nematodes. Our study provided a theoretical basis for the possibility that tea drinking may prevent mitochondrial related diseases.

The chemically synthesized polymer polyacrylamide (HPAM) in conventional reservoirs has achieved excellent oil displacement, but its oil displacement is poor in extreme reservoir environments. To develop biopolymer oil flooding agent under extreme reservoir conditions, the viscosity increasing and rheological properties of three biopolymers, diutan gum, xanthan gum, and scleroglucan, were studied under extreme reservoir conditions (high salt, high temperature, strong acid, and alkali), and the effects of temperature, mineralization, pH, and other factors on their viscosities and long-term stability properties were analyzed and compared. The results showed that under the temperature of 90℃ and below, the three kinds of biopolymers had the best viscosity-increasing ability. The viscosity of the three kinds of biopolymers was 80.94, 11.57, and 59.83mPa·s, respectively, when the concentration was 1500mg/L and the salinity was 220g/L. At the shear rate of 250s-1,100℃~140℃, scleroglucan has the best viscosification. At 140℃, the solution viscosity is 19.74mPa·s, and the retention rate can reach 118.27%. The results of the long-term stability study showed that the solution viscosity of scleroglucan with mineralization level of 220 mg/L was 89.54% viscosity retention in 40 days, and the diutan gum could be stabilized for 10 days, and the viscosity was maintained at 90 mPa·s. All three biopolymers are highly acid and alkali-resistant, with viscosity variations of less than 15% in the pH3~10 range. Rheological tests have shown that both of them have better viscoelastic properties than xanthan gum due to the peculiar double-helix structure of xanthan gum and the rigid triple-helix structure of scleroglucan. Therefore, the two biopolymers, diutan gum, and scleroglucan have the potential for extreme reservoir oil displacement applications, and it is recommended to use diutan gum for oil displacement in reservoirs up to 90℃ and scleroglucan for oil displacement in reservoirs between 100℃ and 140℃.

Background: Coronavirus Disease 2019 (COVID-19) has been demonstrated to be the cause of pneumonia. Nevertheless, it has not been reported as the cause of acute myocarditis or fulminant myocarditis. Case presentation: A 63-year-old male was admitted with pneumonia and cardiac symptoms. He was genetically confirmed as having COVID-19 according to sputum testing on the day of admission. He also had elevated troponin I (Trop I) level (up to 11.37 g/L) and diffuse myocardial dyskinesia along with a decreased left ventricular ejection fraction (LVEF) on echocardiography. The highest level of interleukin-6 was 272.40 pg/ml. Bedside chest radiographs showed typical ground-glass changes indicative of viral pneumonia. Laboratory test results for viruses that cause myocarditis were all negative. The patient conformed to the diagnostic criteria of the Chinese expert consensus statement for fulminant myocarditis. After receiving antiviral therapy and mechanical life support, Trop I was reduced to 0.10 g/L, and interleukin-6 was reduced to 7.63 pg/ml. Moreover, the LVEF of the patient gradually recovered to 68%. The patient died of aggravation of secondary infection on the 33^rd day of hospitalization. Conclusion: COVID-19 patients may develop severe cardiac complications such as myocarditis and heart failure. This is the first report of COVID-19 complicated with fulminant myocarditis. The mechanism of cardiac pathology caused by COVID-19 needs further study.

Satellite-based monitoring can retrieve ground-level PM_2.5 concentrations with higher-resolution and continuous spatial coverage to assist in making management strategies and estimating health exposures. The Sichuan Basin has a complex terrain and several city clusters that differ from other regions in China: it has an enclosed air basin with a unique planetary boundary layer dynamic which accumulates air pollution. The spatiotemporal distribution of 1-km resolution Aerosol Optical Depth (AOD) in the Sichuan Basin was retrieved using the improved dark pixel method and Moderate Resolution Imaging Spectroradiometer (MODIS) data in this study. The retrieved seasonal AOD reached its highest values in spring and had the lowest values in autumn. The higher correlation (r = 0.84, N = 171) between the ground-based Lidar AOD and 1-km resolution MODIS AOD indicated that the high-resolution MODIS AOD could be used to retrieve the ground-level PM_2.5 concentration. The Lidar-measured annual average extinction coefficient increased linearly with the Planetary Boundary Layer Height (PBLH) in the range of 100 ~ 670 m, but exponentially decreased between the heights of 670 ~ 1800 m. Both the correlation and the variation tendency of simulated PBLH from WRF_SHIN/CALMET were closer to the Lidar observation than that of three other Planetary Boundary Layer (PBL) schemes (the Grenier-Bretherton-McCaa (GBM) scheme, the he Total Energy-Mass Flux (TEMF) scheme and the University of Washington (UW) scheme), which suggested that the simulated PBLH could be used in the vertical correction of retrieval PM_2.5. Four seasonal fitting functions were also obtained for further humidity correction. The correlation coefficient between the aerosol extinction coefficient and the fitted surface-level PM_2.5 concentration at the benchmark station of Southwest Jiao-tong University was enhanced significantly from 0.62 to 0.76 after vertical and humidity corrections during a whole year. During the evaluation of the retrieved ground-level PM_2.5 with observed values from three cities, Yibin (YB), Dazhou (DZ), and Deyang (DY), our algorithm performed well, resulting in higher correlation coefficients of 0.78 (N = 177), 0.77 (N = 178), and 0.81 (N = 181), respectively.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

Traditional potential transformers have problems of large volume, difficulty in insulation, iron core saturation, ferroresonance overvoltage and poor transient response characteristics. The voltage sensor based on the principle of electric field coupling and differential input structure does not need to contact the measured object or ground, and can avoid the above problems. However, it requires a sufficiently high capacitance between the differential electrodes to obtain sufficient accuracy and a high voltage division ratio. The existing method of using mutual capacitance between the differential electrodes will cause many problems and fail to meet the practical needs. To solve the above problems, this paper innovatively uses multi-layer ceramic capacitor to replace the mutual capacitance and designs a new type of voltage sensor. In addition, by using single bypass small resistance grounding method to increase the input impedance of the differential signal processing circuit, error of the sensor is further reduced. The experimental results show that the sensor has excellent accuracy and great transient response characteristics. The ratio error under power frequency is within ±0.5% and the phase error is within 1. The ratio error in the range of 500 Hz∼30 kHz is within ±5% and the phase error is within 5. Moreover, it has the advantages of low cost, miniaturization, flexible shape and easy to adjust the voltage division ratio. These characteristics indicate that the sensor has good voltage measurement and sensor network potential.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

An adaptive operation strategy for on-demand control of DMFC system is proposed as an alternative method to enhance the voltage stability. Based on a single-cell DMFC stack, a newly simplified semi-empirical model is developed from the uniform-designed experimental results to describe the I-V relationship. Integrated with this model, the multi-objective optimization method is utilized to develop an adaptive operation strategy. Although the voltage instability is frequently encountered in unoptimized operations, the voltage deviation is successfully decreased to a required level by adaptive operations with operational adjustments. Moreover, the adaptive operations are also found to be able to extend the range of operating current density or to decrease the voltage deviation according to ones requirements. Numerical simulations are implemented to investigate the underlying mechanisms of the proposed adaptive operation strategy, and experimental adaptive operations are also performed on another DMFC system to validate the adaptive operation strategy. Preliminary experimental study shows a rapid response of DMFC system to the operational adjustment, which further validates the effectiveness and feasibility of the adaptive operation strategy in practical applications. The proposed strategy contributes to a guideline for the better control of output voltage from operating DMFC systems.

In this study, we had investigated the use of high-pressure homogenization (HPH) as a novel pretreatment method for the extraction of sodium alginate (SA) from Laminaria japonica. Our results demonstrated that under optimal condition of 100 MPa HPH pressure, 4 cycles, pH 6.0, and 0.5% ethylene diaminetetra acetic acid tetrasodium salt (EDTA) concentration (w/v) for 3.0 hours, the extraction yield of HPH reached 34%, which was higher than that achieved by previous methods such as complex enzyme hydrolysis (CE), ultrasonic-assisted extraction (UAE), and complex enzyme-ultrasonic combined method (CE-UC). To further characterize the extracted SA, we conducted a comprehensive analysis using SEM, FTIR, MRS, NMR, XRD, TGA, and T-AOC assay. Our findings revealed the following: 1) HPH treatment significantly disrupted the structure of L. japonica cells and reduced their crystallinity to 76.27%, the lowest among all pretreatment samples; 2) the extracted SA had a greater tendency to form elastic gels; and 3) the antioxidant activity of HPH-extracted SA reached 0.02942 mgVceq∙mg-1, which was the highest among all tested methods. Based on these results, we concluded that HPH extraction not only increased the yield of SA but also enhanced its antioxidant activity.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

The buildup dynamics of diode-pumped passively mode-locked solid-state laser is thoroughly explored by the real-time measurement with temporal sampling rate up to 40 GHz. A concise cavity is developed to ensure the transient dynamics purely arising from the gain medium and saturable absorber. Experimental results reveal that the laser output in the buildup process exhibits numerous passively Q-switched pulses followed with a damped relaxation oscillation prior to the stable mode locking. Furthermore, it is confirmed that the laser output has already displayed single clean mode-locked pulses inside the first several Q-switched envelopes before stepping into the stage of relaxation oscillation. The present real-time exploration is expected to provide important information for practical applications with temporal modulation of the pump intensity.

Fractures of the talar neck and body are associated with spine fractures and scoliosis deformity, which affect cosmetic appearance and cause difficulty in ambulation. The implant design for talus surgery is thriving as a functional alternative in case of severe talar destruction, focusing on segmentation and reconstruction of the talus’s shape. However, manual segmentation of the talus is time-consuming and subjective. In this study we exploited the automatic segmentation framework to efficiently train a deep learning-based model to accurately segment the talus based on computed tomography imaging. We developed three model configurations with nnU-Net and investigated their Dice similarity coefficients (DSC) and 95% Hausdorff distances (HD95) for talus segmentation on a CT image dataset. The three configurations performed well (DSC > 0.95, HD95 < 0.6). When tested on the same samples, one of the configurations was more efficient while ensuring higher accuracy. We propose to focus on talus anatomic variations with increasing age based on this framework and apply it to clinical trials at the next stage.

Numerical simulations of turbulent flows in a stirred dead-end membrane bioreactor are performed by the RNG k-ε model based on finite volume method using Fluent codes. Comparisons of numerical and experimental results confirm the reliability and feasibility of the constructed model. Flow structures such as wake flows and circulation loops in stirred flows were well simulated. An increase of stirring speed is proposed to use to minimize the low velocity region. The single vane stirrer is found to be beneficial for biological separations. Results reveal that the increase of vane number can enhance the mixing effect in flow domains. However, a circular disk stirrer goes against the formation of vertical circulations. The six-vane stirrer is found to be able to provide a uniform distribution of high shear stress.

Shrews (Soricidae) are common small wild mammals with a significant overlap in their habitats with humans and domestic animals. Currently, viruses from 24 families have been identified in shrews, including Adenoviridae, Arenaviridae, Arteriviridae, Astroviridae, Bornaviridae, Caliciviridae, Circoviridae, Coronaviridae, Filoviridae, Flaviviridae, Hantaviridae, Hepadnaviridae, Hepeviridae, Nairoviridae, Orthoherpesviridae, Paramyxoviridae, Parvoviridae, Phenuiviridae, Picornaviridae, Polyomaviridae, Poxviridae, Rhabdoviridae, Sedoreoviridae, and Spinareoviridae, which pose potential threats to humans and domestic animals. This review compiled fundamental information about shrews and provided a comprehensive summary of the viruses that have been detected in shrews, with the aim to facilitating a deeper understanding of shrews and the diversity and risks of their viruses for researchers and the general public.

Chinese pepper rust is a live parasitic fungal disease caused by Coleosporium zanthoxyli, which seriously affects the cultivation and industrial development of Z. armatum. Cultivating and planting resistant cultivars is considered the most economical and environmentally friendly strategy to control this disease. Therefore, the mining of excellent genes for rust resistance and analysis of the mechanism of rust resistance are the key strategies to achieve the targeted breeding of rust resistance. However, there is no relevant report on pepper rust resistance at present. The aim of the present study was to further explore the resistance mechanism of pepper by screening the rust-resistant germplasm resources in the early stage. Combined with the analysis of plant pathology, transcriptomics, and metabolomics, we found that the genes and metabolites related to phenylpropanoid metabolism were highly enriched in resistant varieties after pathogen infection, which indicated that phenylpropanoid metabolism might mediate the resistance of Z. armatum. This finding was further confirmed by real-time quantitative polymerase chain reaction analysis, which revealed that the expression levels of core genes involved in phenylpropane metabolism in disease-resistant varieties were high. In addition, the difference in flavonoid content in the leaves between resistant and susceptible varieties further supported the conclusion that the flavonoid pathway is one of the main pathways involved in resistance formation in Chinese pepper, and MeJA is involved in the formation of resistance. Our research results not only help to better understand the resistance mechanism of Z. armatum rust but also contribute to the breeding and utilization of resistant varieties.

Mangrove plant seedling cultivation is crucial for the protection, management and restoration of mangrove ecosystem. In this study, we focused on Kandelia obovata, a typical mangrove, and evaluated nursery cultivation with different combinations of three salinity levels (S1: 0 ppt, S2: 10 ppt, and S3: 20 ppt), three genealogies (EZD, JX, and YZ), and five growth media (M1: 100% loess, M2: 100% sandy, M3: 50% loess + 50% sandy, M4: 40% loess + 40% sandy + 20% peat, and M5: 40% loess + 40% sandy + 20% coir), by measuring the growth parameters such as mortality rate, seedling height, diameter, and biomass partition. These growth indexes were significantly affected by salinity and medium, and genealogies also had significant effects on mortality rate and biomass accumulation. S2 or S3 both had lower mortality and higher growth indexes than S1. M1 was the medium that increased seedlings height, diameter and biomass the most and had the lowest death rate. EZD and JX were also higher levels than YZ in these indicators, but the difference between them was not obvious. S3, M1, and EZD consistently performed well in fuzzy evaluation and quality assessment. Furthermore, combinations involving these treatments also produced highly favorable results. These results furnish both a theoretical and practical foundation for advancing nursery cultivation techniques and germplasm breeding of K. obovata in mangroves.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

Scattering hyperspectral technology is a nondestructive testing method with many advantages. Here, we propose a method to improve the accuracy of egg freshness, research the influence of incident angles of light source on the accuracy and explain its mechanism. A variety of weak classifiers classify eggs based on the spectra after preprocessing and feature wavelength extraction to obtain three classifiers with the highest accuracy. The three classifiers are used as metamodels of stacking ensemble learning to improve the highest accuracy from 96.25% to 100%. Moreover, the highest accuracy of scattering, reflection, transmission and mixed hyperspectral of eggs are 100.00%, 88.75%, 95.00% and 96.25%, respectively, indicating that the scattering hyperspectral for egg freshness detection is better than that of the others. In addition, the accuracy is inversely proportional to the angle of incidence due that the smaller the incident angle, the camera collects a larger proportion of scattering light, which contains more biochemical parameters of an egg than that of reflection and transmission. These results are very important for improving the accuracy of non-destructive testing and selecting the incident angle of the light source, and have potential applications in online non-destructive testing.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (&gt;90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

Endoscopic retrograde cholangiopancreatography (ERCP) is a routinely used therapeutic procedure for the biliary and pancreatic diseases. Population aging may increase the typical indications of ERCP and come with more complexity and difficulties, especially in cannulation. This study aimed to evaluate the incidence, causes, and management of difficult biliary cannulation during ERCP in super-aged patients and the role of difficult cannulation as a risk factor for adverse events. A total of 614 patients, underwent ERCP, were prospectively studied as a cohort and divided into two groups based on their age. There were 146 patients aged 80 years or older in group A and 468 patients aged less than 80 years in group B. The primary outcome measures were the difficulty grade of papilla cannulation, clinical outcomes, and ERCP-related complications in the two groups. The adverse events were analyzed using logistic regression for patient age, co-morbidities, indications, and cannulation difficulty grade variables. There was no difference in the incidence of difficult cannulation between the two groups (32.9% vs. 34.4%, p=0.765) though, as expected, super-aged Group A had a higher prevalence of periampullary diverticulum (29.5% vs. 16.7%, p=0.001). The technical cannulation success rate was (96.6% vs. 96.8%, p= 0.54). All used cannulation techniques in the elderly group were efficient and safe. Logistic regression showed that age ≥80 was not associated with increased adverse events; however, difficult cannulation (adjusted odds ratio [AOR]=3.478; 95% confidence interval [CI]=1.877, 6.442; p<0.001) and CCI ≥2 (AOR=1.824; 95% CI=0.993, 3.349; p=0.045) were more likely to have adverse events. Age ≤65 (AOR=3.460; 95% CI=1.511, 7.922; p=0.003), female gender (AOR=2.362; 95% CI=1.089, 5.124; p=0.030), difficult cannulation (AOR=4.527; 95% CI=2.078, 9.860; p<0.001), and patients with cholangitis (AOR=3.261; 95% CI=1.204, 8.832; p=0.020) were strongly associated with increasing Post-ERCP Pancreatitis (PEP). Advanced age has not proved to be a risk factor of difficult cannulation, and secondary cannulation techniques can be safely and efficaciously utilized for this group. CCI ≥2 and difficult cannulation are associated with increased overall adverse events rate while age ≥80 factor is not.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Fusarium species are one of the filamentous fungal taxa with the most pronounced impact on agri-cultural production and human health. The mycotoxins produced by pathogenic Fusarium not on-ly attack various plants including crops, causing various plant diseases that lead to reduced yields and even death, but also penetrate into the food chain of humans and animals to cause food poi-soning and consequent health hazards. Although sporadic studies have revealed some of the bio-synthetic pathways of Fusarium toxins, they are insufficient to satisfy the need for a comprehen-sive understanding of Fusarium toxin production. In this study, we focused on 35 serious patho-genic Fusarium species with available genomes and systematically analyzed the ubiquity of the dis-tribution of identified Fusarium and non-Fusarium derived fungal toxin biosynthesis gene clusters (BGCs) in these species through the mining of core genes and comparative analysis of correspond-ing BGCs. Additionally, novel sesterterpene synthases and PKS_NRPS clusters were discovered and analysed. This work is the first to systematically analyze the distribution of related mycotoxin biosynthesis in pathogenic Fusarium species. These findings enhance the knowledge of mycotoxin production and provide a theoretical grounding for the prevention of fungal toxin production us-ing biotechnological approaches.

Echinococcus granulosus is a harmful cestode parasite which could cause Cystic Echinococcosis in humans, various livestock species and wild animals. Calmodulin (CaM), a Ca²⁺ sensor protein, is widely expressed in eukaryotes and mediates a variety of cellular signaling activities. In our study, the CaM in Echinococcus granulosus (rEgCaM) was successfully cloned and the molecular and biochemical characterizations of rEgCaM were identified. The results showed that rEgCaM was a highly conserved calcium-binding protein, consisting of 149 amino acids. Immunoblot analysis revealed that rEgCaM could be identified using E. granulosus infected sheep serum. The usage of rEgCaM as antigen was evaluated by indirect ELISA which exhibited a high sensitivity of 90.3% but low specificity (47.1%). rEgCaM was mainly located in the tegument tissues and parenchymal region of protoscoleces, the tegument and inner body of adult worm and predominantly expressed in the germinal layer. The mRNA expression of rEgCaM in PSCs were gradually decreased with the increase death of PSCs. In electrophoretic mobility tests and ANS assays, rEgCaM showed a typical calcium-binding protein characteristics. This is the first report on CaM from E. granulosus and rEgCaM is considered to be involved in some important biological function of E. granulosus as a calcium-binding protein.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

Ultrasonic feedback energy is affected by the variety, planting and growth state of crops, it is difficult to fine application in precision agriculture systems. To this end, an ultrasonic sensor was mounted in a spray boom height detection system. Winter wheat was used as the test object to obtain feedback energy values for the spray boom height from the top of the wheat in the field during six critical growth stages: the standing stage, jointing stage, booting stage, heading stage, filling stage and maturity stage. The relationship between the actual value of the height from the spray boom to the top of wheat (Habw) and the detected value of the height from the spray boom to the top of wheat (Hdbw) was analyzed. A spray boom height detection model based on the ultrasonic sensor during the full growth cycle of wheat was determined. Field validation tests showed that the applicability of the spray boom height detection distance (Dd) of the spray boom height detection model proposed in the present study was 450 mm~950 mm. Within the applicable Dd range, the detection error of the detection model was ≤5 cm during the full growth cycle. This study provides an ultrasonic detection model construction method, which improves the reliability and accuracy of ultrasonic boom height detection for different wheat growth stages.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

The unknown timing of appropriate initiation of administration has led to controversy over the use of hydrocortisone in the treatment of neonatal sepsis. This study sought to compare the survival rate and NF-κB pathway expression level in newborn mice treated with hydrocortisone at different initiation times after sepsis to find the appropriate administration time window for clinical neonatal sepsis patients. Before building the sepsis model, 36 newborn C57BL/6 mice were randomly divided into six groups with six mice, using quasi-randomization: five treatment subgroups(1 h, 6 h, 12 h, 24 h and 48 h based on the initiation of hydrocortisone therapy) and 1 control group. The survival rate of mice in each group was compared. The expression levels of the NF-κB pathway and inflammatory factors were analyzed and compared among groups. Initiation of hydrocortisone therapy within 12 h of sepsis onset improved the survival of LPS-induced newborn septic mice. Treatment with hydrocortisone over 12 hours reduced the expression level of NF-κB and lowered serum IL-6 and TNF-α levels in cardiopulmonary tissues of mice. Administration of hydrocortisone early in sepsis (within 12 hours) promotes neonatal mouse survival by inhibiting the NF-κB pathway.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (&lt;1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

Tilapia lake virus (TiLV) is the main tilapia-infecting virus worldwide, causing serious economic losses. However, there is no vaccine for this viral disease. Here, TiLV ORF10 (TiLV-ORF10) encoding a protein with abundant epitopes was constructed into the eukaryotic expression vector pcDNA3.1, and used to evaluate the immune protective effects in Nile tilapia (Oreochromis niloticus). RT-PCR and western blot analyses confirmed vaccine plasmid expression in tilapia muscle tissues. Moreover, the transcription levels of immunoglobulin M, toll-like receptor 2, myeloid differentiation factor 88, interleukin 8, tumor necrosis factor alpha, gamma-IFN, and nuclear factor κB immune-related genes were statistically significantly upregulated in the spleen, liver, and kidney of vaccinated tilapias (P < 0.05). TiLV challenge experiments showed that relative percent survival (RPS) was significantly enhanced in fish by this DNA vaccine. Moreover, RPS was enhanced further when using a higher amount of the DNA vaccine (85.72% RPS at a DNA dose of 45 μg pcDNA3.1–ORF10). Vaccination with pcDNA3.1–ORF10 significantly reduced virus replication, as evidenced by the low amount of virus in the spleen, liver, and kidney of vaccinated tilapias after TiLV challenge. Thus, pcDNA3.1–ORF10 could induce protective immunity in tilapia and may be a potential vaccine candidate for controlling diseases caused by TiLV.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

This work aimed to identify chemical compounds of Cinnamomum burmannii leaf essential oil (CBLEO) and to unravel antibacterial mechanism of CBLEO at molecular level for developing antimicrobial. CBLEO had 37 volatile profiling with abundant borneol (28.40 %), and showed good potential to control foodborne pathogens, of which Staphylococcus aureus had the greatest inhibition zone diameter (28.72 nm) with the lowest values of minimum inhibitory concentration (1.0 μg/mL) and bactericidal concentration (2.0 μg/mL). To unravel antibacterial action of CBLEO on S. aureus, a dynamic exploration of antibacterial growth, material leakage, ROS formation, protein oxidation, cell morphology and interaction with genome DNA were conducted on S. aureus exposed to CBLEO at different doses (1/2-2×MIC) and times (0-24 h), indicating that CBLEO acts as inducer for ROS production and oxidative stress of S. aureus. To highlight antibacterial action of CBLEO on S. aureus at molecular level, a comparative association of ROS accumulation with some key virulence-related gene (sigB/agrA/sarA/icaA/cidA/rsbU) transcription, protease production and biofilm formation in S. aureus subjected to CBLEO at different levels and times, revealing that CBLEO-induced oxidative stress caused transcript suppression of virulence regulators (RsbU and SigB) and its targeted genes, causing protease level increase destined for biofilm formation and growth inhibition of S. aureus, which may be as key bactericidal action. Our findings provide valuable information for studying the antibacterial mechanism of essential oil against pathogens.

To the best of the author’s knowledge, studies of mature plasmacytoid dendritic cell proliferation associated with T lymphoblastic lymphoma were extremely rare in the literature. Here, we report a patient who underwent both mature plasmacytoid dendritic cell proliferation and T lymphoblastic lymphoma. With the findings of lymph node biopsy taken from the right cervical and inguinal regions, we identified eye-catching mature plasmacytoid dendritic cells that were considered to be responsible for this lesion at the beginning, until the immunostaining of Ki67 and TDT showed a small group of positive cells hiding in these plasmacytoid dendritic cells. Bone marrow biopsy was also performed in this patient. Microscopically, the hematopoietic tissue was almost completely replaced by lymphoblastoid cells with condensed chromatin, inconspicuous nucleoli and scanty cytoplasm, which were basically the same as those seen in the lymph nodes in morphology. However, there was no sign of plasmacytoid dendritic cells or Langerhans cells in the bone marrow biopsy. With the help of bone marrow biopsy, our final diagnosis of the lymph node was T lymphoblastic lymphoma coexisting with mature plasmacytoid dendritic cell proliferation . Although accumulations of plasmacytoid dendritic cells may occur in some infections or reactive lymphadenopathy, the presence of extensive nodules or infiltration of plasmacytoid dendritic cells strongly reminds the pathologist to carefully evaluate the bone marrow or peripheral blood status of the patient to exclude a hidden myeloid or other neoplasm.

This retrospective study aimed to assess coronary artery calcium (CAC) progression in serial computed tomography measurements according to risk factor changes. In 448 asymptomatic adults who underwent CAC measurements with more than one-year intervals, CAC progression was assessed according to age, sex, variable traditional risk factors (diabetes mellitus, hypertension, hyperlipidemia, and smoking), and initial CAC score (0, 0.1–100, and &gt;100). Univariate and multivariate logistic regression analyses were assessed for independent predictors of rapid CAC progression (△CAC/year&gt;20). During the 3.5-year follow-up, coronary artery calcifications occurred in 43 (12.8%) of 336 individuals with an initial CAC score of zero. Of 112 individuals with initial CAC presence, 60 (53.6%) had △CAC/year&gt;20. Age, male sex, body mass index, and all risk factors were significantly associated with △CAC/year&gt;20, but recently diagnosed hypertension (odds ratio [OR], 11.3) and initial CAC score (OR, 1.05) were significant independent predictors in multivariate regression analyses. CAC progression was affected by demographic and traditional risk factors, but adjusting for these factors, recently diagnosed hypertension and initial CAC score were the most influential factors for rapid CAC progression. These findings suggest that patients with higher initial CAC scores may benefit from more frequent follow-up scans and checks regarding risk factor changes.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

In this paper, we investigate the new degenerate Daehee polynomials and numbers which are called the degenerate Daehee polynomials of the second kind, and derive some new and interesting identities and properties of those polynomials.

Goal-conditioned reinforcement learning (RL) holds promise for addressing intricate control challenges by enabling agents to learn and execute desired skills through separate decision modules. However, the irregular occurrence of required skills poses a significant challenge to effective learning. In this paper, we demonstrate the detrimental effects of this imbalanced skill(sub-goal) distribution and propose a novel training approach, Classified Experience Replay (CER), designed to mitigate this challenge. We demonstrate that adapting our method to conventional RL methods significantly enhances the performance of the RL agent. Considering the challenges inherent in tasks such as driving, characterized by biased occurrences of required sub-goals, our study demonstrates the improvement in trained outcomes facilitated by the proposed method. In addition, we introduce a specialized framework tailored for self-driving tasks on highways, integrating Model Predictive Control (MPC) into our RL trajectory optimization training paradigm. Our approach, utilizing CER with the suggested framework, yields remarkable advancements in trajectory optimization for RL agents operating in highway environments.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

Reinforcement Learning (RL) has demonstrated considerable potential in solving challenges across various domains, notably in autonomous driving. Nevertheless, implementing RL in autonomous driving comes with its own set of difficulties, such as the overestimation phenomenon, extensive learning time, and sparse reward problems. Although solutions like Hindsight Experience Replay (HER) have been proposed to alleviate these issues, the direct utilization of RL in autonomous vehicles remains constrained due to the intricate fusion of information and the possibility of system failures during the learning process. In this paper, we present a novel RL-based autonomous driving system technology that combines Obstacle Dependent Gaussian (ODG) RL, Soft Actor-Critic (SAC), and meta-learning algorithms. Our approach addresses key issues in RL, including the overestimation phenomenon and sparse reward problems, by incorporating prior knowledge derived from the ODG algorithm. We evaluated our proposed algorithm on official F1 circuits, using high-fidelity racing simulations with complex dynamics. The results demonstrate exceptional performance, with our method achieving up to 89% faster learning speed compared to existing algorithms in these environments.

Longitudinal cutting is a most common process in steel structure manufacturing, and the man-hours of the process provide an important basis for enterprises to generate production schedules.However, currently the man-hours in factories are mainly estimated by experts, and the accuracy of this method is relatively low.In this study,we propose a system that predicts man-hours with history data in the manufacturing process and that can be applied in practical structural steel fabrication.The system addresses the data inconsistency problem by one-hot encoding and data normalization techniques,Pearson correlation coefficient for feature selection,and the Random Forest Regression(RFR) for prediction.Compared with the other three Machine Learning(ML) algorithms, the Random Forest algorithm has the best performance.The results demonstrate that the proposed system outperforms the conventional approach and has better forecast accuracy, so that it is suitable for man-hours prediction.

Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

The Android-based IoT platform just like the existing Android provides an environment that makes it easy to utilize Google's infrastructure services including development tools and APIs through which it helps to control the sensors of IoT devices. Applications running on the Android-based IoT platform are often UI free and are used without the user’s consent to registered permissions. It is difficult to respond to the misuse of permissions as well as to check them when they are registered indiscriminately while updating applications. This paper analyzes the versions of before and after an application the update running on the Android-based IoT platform and the collected permission lists. It aims to identify the same permissions before and after the update, and deleted and newly added permissions after the update were identified, and thereby respond to security threats that can arise from the permissions that is not needed for IoT devices to perform certain functions.

As human activities of the countries in the East Asia have been remarkably expanding over recent decades, various problems in relation to ships, such as oil spill and many other coastal marine pollution, are continuously occurring in the coastal region. In order to conserve marine resources and prepare for possible ship accidents in advance, the need for efficient ship management is increasing over time. Multi-satellite, multi-sensor, multi-wavelength or multi-frequency observations make it possible to monitor a variety of vessels in the coastal region. This study presents the results of ship detection methodology applied to multi-spectral satellite images in the seas around Korean Peninsula based on optical, hyperspectral, and microwave remote sensing. To detect ships from hyperspectral images with a few hundreds of spectral channels, spectral matching algorithms are used to investigate similarity between the spectra and in-situ measurements. In the case of SAR (Synthetic Aperture Radar) images, the Constant False Alarm Rate (CFAR) algorithm is used to discriminate the vessels from backscattering coefficients of Sentinel-1 SAR and ALOS-2 PALSAR2 images. The present ship detection methods can be extensively utilized for optical, hyperspectral, and SAR images for comprehensive coastal management purposes toward perpetual sustainability in the future.

In recent years, demand has been increasing for target detection and tracking from aerial imagery via drones using onboard powered sensors and devices. We propose a very effective method for this application based on a deep learning framework. A state-of-art embedded hardware system empowers small flying robots to carry out the real-time onboard computation necessary for object tracking. Two types of embedded modules were developed: one is designed using a Jetson TX or AGX Xavier, and the other is based on an Intel Neural Compute Stick. These are suitable for real-time onboard computing power on small flying drones with limited space. A comparative analysis of current state-of-art deep-learning-based multi-object detection algorithms was carried out utilizing the designated GPU-based embedded computing modules to obtain detailed metric data about frame rates as well as the computation power. We also introduce an effective target tracking approach for moving objects. The algorithm for tracking moving objects is based on the extension of simple online and real-time tracking. It was developed by integrating a deep-learning-based association metric approach (Deep SORT), which uses a hypothesis tracking methodology with Kalman filtering and a deep-learning-based association metric. In addition, a guidance system that tracks the target position using a GPU-based algorithm is introduced. Finally, we demonstrate the effectiveness of the proposed algorithms by real-time experiments with a small multi-rotor drone.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

Diatomite (DME) consists of natural ordered porous structures that are excellent candidates as microcontainers. However, to the best of our knowledge, the application of DME loaded with corrosion inhibitors in anti-corrosion coatings has not hitherto been reported. In this study, DME has been used as a source of microcontainers to load benzotriazole (BTA) inhibitor by an immersion method. In order to prevent unwanted early release of the small molecule BTA inhibitor from the DME microcontainers, inspired by the adhesion characteristics of catechol and amine in mussel adhesion protein, polydopamine (PDA) was coated on their surfaces to generate BTA@DME/PDA microcapsules. Because of the depolymerization characteristics of PDA at low pH, the synthesize microcapsules showed a controllable release function. The SEM morphology, chemical structure, and loading capacity of the synthesized BTA@DME/PDA microcapsules were characterized. The corrosion resistances of epoxy coatings with different contents of BTA@DME/PDA microcapsules were compared by saline immersion and electrochemical impedance tests. A scratched coating with 5wt.% BTA@DME/PDA microcapsules showed the best anti-corrosion effect.

Objective: To explore the hot spots and development trends of community public health research. Methods: The literature related to this topic was searched in CNKI and PubMed databases, and the trend map of the number of articles was drawn according to the obtained data. The included literature were analyzed with Vosviewer software for keyword and author co-occurrence, and CiteSpace 6.3.R1 Basic software was used for mechanism co-occurrence, key emergence and clustering analysis, and timeline distribution map drawing. Results: 189 Chinese literature and 77 English literature were selected. The Chinese literature focused on “community public health service, emergency management, and community governance”, and the research trend was “community public health emergency management and community governance”; English literature focuses on “nursing education, health education, human qualitative research”. Conclusion: Although the Chinese and English literature shows that scholars in this field have different emphases, the primary community health is the key and difficult point to realize the national public health service project, and improving the basic public health service in the primary community is related to the health of all the people, so it is very important.

In Korea, the underground silo structure for low- and intermediate-level radioactive waste disposal facilities has been constructed and operated since 2014. Large-scale earthquakes occurred in 2016 and 2017, respectively, in Gyeongju and Pohang areas near the underground silo structures, and interest in the stability of the underground silo increased significantly. In this paper, one-dimensional free field analyses have been carried out before the three-dimensional silo dynamic analyses subjected to earthquake loadings. As an additional study, a new form of finite element equilibrium equation is derived in terms of relative motions, which is essentially the same equation as that expressed in terms of total motions where the base shear force is applied for earthquake load. The accuracy of conventional finite element solutions is evaluated by directly comparing them with closed-form solutions by frequency domain analysis such as SHAKE91.

In order to accurately identify the external economic situation in China and analyze the situation of economic development in Northeast China, based on the Strengths, Weaknesses, Opportunities and Threats (SWOT) analysis framework, this article analyses the economy in Northeast China from the four factors of SWOT. To solve the lack of quantitative analysis in SWOT analysis, this article applies Analytic Hierarchy Process (AHP) to the analysis, and finally forms a complete system framework with the combination of qualitative and quantitative factors, through the analysis of the important degree of various factors and the consistency test, the key factors influencing the economic development in Northeast China are analyzed, and constructive countermeasures are proposed.

A new design scheme is proposed for twisting the walls of a microchannel, and its performance is demonstrated numerically. The numerical study was carried out for a T-shaped microchannel with twist angles in the range of 0 to 34π. The Reynolds number range was 0.15 to 6. The T-shaped microchannel consists of two inlet branches and an outlet branch. The mixing performance was analyzed in terms of the degree of mixing and relative mixing cost. All numerical results show that the twisting scheme is an effective way to enhance the mixing in a T-shaped microchannel. The mixing enhancement is realized by the swirling of two fluids in the cross section and is more prominent as the Reynolds number decreases. The twist angle was optimized to maximize the DOM, which increases with the length of the outlet branch. The twist angle was also optimized in terms of the relative mixing. The two optimum twisting angles are generally not coincident. The optimum twist angle shows a dependence on the length of the outlet branch but it is not affected much by the Reynolds number.

This study examines the negative impacts of dark stores on the urban environment from three perspectives: land use, transportation, and streetscape. It is conducted on B-Mart, a representative dark store in South Korea. First, in terms of land use, we find that dark stores that function as logistics facilities conflict with the surrounding land use. Second, by analyzing the location of dark stores and the hourly traffic volume of delivery vehicles, we find that the impact on the surrounding transportation infrastructure and pedestrian traffic is not as significant as previously claimed. However, during the transportation and loading process of the dark store, several problems such as traffic violations, illegal parking, and illegal loading were observed, posing a risk to nearby vehicles and pedestrians. Third, in terms of streetscapes, the location of dark stores on the ground floor of buildings can harm streetscapes. The current urban planning system in South Korea does not clearly define the status and function of dark stores, making it unclear how to manage them. Therefore, it is necessary to clarify their legal definition and introduce urban planning and design guidelines that are consistent with their appropriate location and appearance.

Our previous studies demonstrated that quercetin (Q) could be ingested and metabolized by macrophages and exerted prophylactic immuno-stimulatory activity and therapeutic anti-inflammatory effects on lipopolysaccharide (LPS)-treated macrophages ex vivo. To further clarify its possible anti-inflammatory mechanism, Q was selected to treat mouse peritoneal macrophages that obtained from female BALB/c mice exposed to LPS i.p. for 12 h. Relative gene expression of pro-/anti-inflammatory (TNF-α/IL-10) cytokines and components of inflammation-related intracellular signaling pathways (TLR2, TLR4, NF-κB, JAK2 and STAT3) was analyzed using two-step reverse transcription (RT) and real-time quantitative polymerase chain reaction (qPCR). STAT3 protein phosphorylation was determined using an in-cell ELISA method. As a result, Q and its metabolite quercetin-3-O-β-D-glucuronide (Q3G) decreased TNF-α gene expression amounts and ratios of pro-/anti-inflammatory (TNF-α/IL-10) cytokine gene expressions, but increased IL-10 gene expression amounts in activated inflammatory macrophages, supporting a substantial anti-inflammatory potential of Q and Q3G treatments. However, Q3G had lower effects than those of Q. Importantly, Q inhibited TLR2 gene expression and phosphorylation of STAT3 protein in the inflamed cells. Our results are the first report to suggest that Q inhibits LPS-induced inflammation ex vivo through suppressing TLR2 gene expression and STAT3 protein phosphorylation in activated inflammatory macrophages. Q has potential to further apply for treating inflammation-associated diseases.

In the past decade, it has been discovered that intestinal flora can influence various organ-specific cancers by altering the body's energy balance, increasing obesity, synthesizing genetic toxins and small signaling molecules, initiating and modulating immune responses, and metabolizing indigestible dietary components, exogenous substances, and drugs. In this review, we will focus on elucidating the role of gut flora based on its molecular mechanisms and its potential therapeutic implications in head and neck tumors in the near future.

The collaboration of multimodal transport documents is the foundation for conducting multimodal transport operations. Blockchain technology can effectively address trust issues and information sharing difficulties in current multimodal transport document collaboration. However, in current blockchain-based electronic document research, the bottleneck problem lies in the collaboration of multiparty in multimodal transport under the "one-bill coverage system". We design a blockchain platform architecture for multimodal transport, reshaping collaboration processes for different modes of transport based on the blockchain platform. It proposes a collaboration model for multimodal transport under the "one-bill coverage system" and performs model solving and case analysis. The obtained collaboration strategies are embedded into the platform's application layer. Finally, using Solidity language, it writes smart contracts related to multimodal transport under the "one-bill coverage system " and deploys and executes them on the Remix platform.

The number of patients with bone metabolic disorders including osteoporosis is increasing worldwide. These disorders often facilitate bone fractures, which seriously impact the patient’s quality of life and could lead to further health complications. Bone homeostasis is tightly regulated to balance bone resorption and formation. However, many anti-osteoporotic agents are broadly categorized as either bone forming or anti-resorptive, and their therapeutic use is often limited due to unwanted side effects. Therefore, safe and effective therapeutic agents are needed for osteoporosis. This study aims to clarify the bone protecting effects of oat bran water extract (OBWE) and its mode of action. OBWE inhibited RANKL-induced osteoclast differentiation by blocking c-Fos/NFATc1 through the alteration of I-κB. Furthermore, we found that OBWE enhanced BMP-2-stimulated osteoblast differentiation by the induction of Runx2 via Smad signaling molecules. In addition, the anti-osteoporotic activity of OBWE was also evaluated using an in vivo model. OBWE significantly restored ovariectomy-induced bone loss. These in vitro and in vivo results showed that OBWE has the potential to combat bone metabolic disorders including osteoporosis

Intestinal epithelial cell activities during homeostasis and regeneration are well described, but their potential interactions with stromal cells remain unresolved. Exploring the functions of these heterogeneous intestinal mesenchymal stromal cells (iMSCs) remains challenging due to the lack of specific markers for most functionally homogenous subpopulations. In recent years, however, novel clustering techniques such as single-cell RNA sequencing (scRNA-seq), fluorescence-activated cell sorting (FACS), confocal microscope, and computational remodeling of intestinal anatomy have helped identify and characterize some specific iMSC subsets. These methods help researchers learn more about the localization and functions of iMSC populations during intestinal morphogenic and homeostatic conditions. Furthermore, it is imperative to understand their cellular pathways for activation and how they interact with surrounding cellular components, particularly during intestinal epithelial regeneration that follows mucosal injury. This review provides insights into the spatial distribution and functions of some identified iMSC subtypes in intestinal morphogenesis, homeostasis, and regeneration. We reviewed related signaling mechanisms implicated during epithelial and subepithelial stromal cell crosstalk. Future research should focus on elucidating the molecular intermediates of these regulatory pathways to open a new frontier for potential therapeutic targets that can alleviate intestinal mucosa-related injuries.

Transcription factors (TFs) are crucial in modulating gene expression and sculpting cellular and organismal phenotypes. The identification of TF-target gene interactions is pivotal for comprehending molecular pathways and disease etiologies but has been hindered by the demanding nature of traditional experimental approaches. This paper introduces a novel web application, utilizing the R programming language, which predicts TF-target gene relationships and vice versa. Our application integrates the predictive power of various bioinformatic tools, leveraging their combined strengths to provide robust predictions. It merges databases for enhanced precision, incorporates gene expression correlation for accuracy, and employs pan-tissue correlation analysis for context-specific insights. The application also enables the integration of user data with established resources to analyze TF-target gene networks. Despite its current limitation to human data, it provides a platform for exploring gene regulatory mechanisms comprehensively. This integrated, systematic approach offers researchers an invaluable tool for dissecting the complexities of gene regulation, with the potential for future expansions to include a broader range of species.

Hand, foot and mouth disease (HFMD) is a childhood disease caused by enterovirus A71 (EV-A71) and coxsackievirus A16 (CV-A16). We hypothesize that capsid loops are important epitopes for EV-A71 and CV-A16. Seven chimeric EV-A71 (ChiE71) involving VP1 BC, DE, EF, GH and HI loops, VP2 EF loop, and VP3 GH loop were substituted with corresponding CV-A16 loops. VP3 GH loop is the most conserved (91.3%) while VP1 BC loop has only 45.5% similarity. Only ChiE71-1-BC, ChiE71-1-EF, ChiE71-1-GH and ChiE71-3-GH were viable. EV-A71 and CV-A16 antiserum neutralized ChiE71-1-BC and ChiE71-1-EF. Mice immunized with inactivated ChiE71 elicited high IgG, IFN-γ, IL-2, IL-4 and IL-10. Neonatal mice receiving passive transfer of WT EV-A71, ChiE71-1-EF and ChiE71-1-BC immune sera had 100%, 80.0% and no survival, respectively, against lethal challenges with EV-A71, suggesting that the substituted CV-A16 loops disrupted EV-A71 immunogenicity. Passive transfer of CV-A16, ChiE71-1-EF and ChiE71-1-BC immune sera provided 40.0%, 20.0% and 42.9% survival, respectively, against CV-A16. One-day-old neonatal mice actively immunized with WT EV-A71, ChiE71-1-BC, ChiE71-1-EF and CV-A16 achieved 62.5%, 60.0%, 57.1% and no survival respectively, after the EV-A71 challenge. Active immunization using CV-A16 provided full protection while WT EV-A71, ChiE71-1-BC, ChiE71-1-EF immunization showed partial cross-protection in CV-A16 lethal challenge with survival rates of 50.0%, 20.0%, and 40%, respectively. Taken together, the EV-A71 VP1 BC loop is essential in immunogenicity of EV-A71 and substitution with CV-A16 VP1 BC loop was insufficient to confer protection against CV-A16. The EF loop maintains the cross-protective immune responses. Disruption of a capsid loop could affect virus immunogenicity, and future vaccine design should include conservation of the enterovirus capsid loops.

Spatial crowdsourcing emerges as a new computing paradigm that enables mobile users to accomplish spatio- temporal tasks in order to solve human-intrinsic problems. Existing crowdsourcing systems critically use centralized servers for interacting with workers and making task assignment decisions. These systems are hence susceptible to issues such as the single point of failure and the lack of operational transparency. Prior work, therefore, turns to blockchain-based decentralized crowdsourcing systems, yet still suffers from problems of lacking efficient task assignment scheme, requiring a deposit to an untrusted system, low block generation speed, and high transaction fees. To address these issues, we design a blockchain-based decentralized framework for spatial crowdsourcing, which we call SC-EOS. Our system does not rely on any trusted servers, while providing efficient and user-customizable task assignment, low monetary cost, and fast block generation. More importantly, it frees users from making a deposit into an untrusted system. Our framework can also be extended and applied to generic crowdsourcing systems. We implemented the proposed system on the EOS blockchain. Trace-driven evaluations involving real users show that our system attains the comparable task assignment performance against a clairvoyant scheme. It also achieves 10× cost savings than an Ethereum-based implementation.

Nickel-based Superalloy Inconel 718 is widely used in the aerospace industry for its excellent high-temperature strength and thermal stability. However, milling Inconel 718 presents challenges due to significantly increased cutting force and vibration, which is a typical difficult-to-machine material. This paper focuses on the milling process of Inconel 718, establishing a milling force model to analyze the force trends under various processing parameters. Finite element analysis is employed to study the stress and temperature fields during milling. Dynamic equations for milling Inconel 718 are developed, and stability lobe diagrams are generated based on modal experiments. Milling experiments on Inconel 718 validate the milling force model and finite element analysis results. The fmincon optimization algorithm is utilized to identify the optimal machining parameters for Inconel 718. Through this research, valuable insights into enhancing the efficiency and quality of Inconel 718 machining are provided. This study contributes to a deeper understanding of Inconel 718 milling behavior, offering crucial guidance for more efficient machining processes.

Cardiovascular disease is the leading cause of death worldwide. A key factor in assessing the risk of cardiovascular disease is left ventricular functional evaluation. Left ventricular (LV) systolic function is evaluated by measuring the left ventricular ejection fraction (LVEF) using echocardiography data. Therefore, quick and accurate left ventricle segmentation is important for estimating the LVEF. However, it is difficult to accurately segment the left ventricle due to changes in the shape and area of the left ventricle during cardiac cycles. In this study, we proposed a framework that considers changes in the shape and area of the left ventricle during the cardiac cycle by applying the convolutional long short-term memory (CLSTM) approach. In addition, we evaluated the left ventricular segmentation and multidimensional quantification of the proposed system in comparison to manual and automated segmentation methods. In addition, to assess the validity of CLSTM, the values of multi-dimensional quantification metrics were compared and analyzed using graphs and Bland–Altman plots on a frame-by-frame basis. We demonstrated that the CLSTM method effectively segments the left ventricle by considering the LV activity. In conclusion, we demonstrated that LV segmentation based on our framework may be utilized to accurately estimate LVEF values.

This study investigated the impact of boron and copper on the microstructure and mechanical properties of Spheroidal graphite Cast Iron (SCI). The addition of boron increased the ferrite content, while copper increased the stability of pearlite. The interaction between boron and copper significantly increased the ferrite content. Differential Scanning Calorimetry (DSC) revealed that boron decreased the enthalpy change of the α + Fe3C -> γ transformation and increased the enthalpy change of the α -> γ transformation. The addition of boron and copper reduced the tensile and yield strength but increased elongation and impact energy. The findings provide valuable insights into the effect of boron and copper on SCI, facilitating the design and development of high-performance SCI materials.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

The construction of reinforced concrete (RC) structures inevitably consumes an excessive number of rebars, leading to significant cutting waste and carbon emissions. Extensive research has been conducted to minimize this issue and its consequences; however, these methods consistently consume a substantial number of rebars. This includes a previous study that utilizes the lap splice position optimization and special-length rebar concept without considering the lapping zone regulation. Moreover, conventional lap splices pose inherent drawbacks that could jeopardize the structural integrity of RC members. In contrast, mechanical couplers eliminate the need for rebar lapping, effectively reducing rebar consumption. This research aims to evaluate the impact of an integrated mechanical coupler and special-length-priority minimization algorithm on the reduction in rebar consumption and cutting waste in RC columns, achieving near-zero cutting waste. To validate the effectiveness of the proposed algorithm, it was applied to the column rebars of an RC building. The results revealed a significant reduction in ordered rebar consumption by 18.25%, accompanied by substantial reductions in cutting waste (8.93%), carbon emissions (12.99%), and total costs (10.81%) compared with a previous study. The outcomes provide the industry with insights into further reducing rebar consumption and its related consequences. Applying the proposed algorithm to various construction projects will further amplify the corresponding benefits.

Acoustic emission (AE) is caused by the sudden release of energy by a material as a result of material degradation related to deformation, crack, or fault within a solid. The same situation also occurs in leaks caused by turbulence in the fluid around the leak. In this study, analytical modeling for AE due to leakage through a circular pinhole in a gas storage cylinder was performed. The displacement fields responsible for AE, excited by the concentrated force (CF) associated with the turbulent flow though the pinhole, were derived by solving the Navier-Lamé equation. The CF as an excitation source was formulated in terms of a fluctuating Reynolds stress (FRS) and spatial Green’s function. In particular, a series of experiments were conducted under different operating conditions to explore the characteristics of the AE signals due to leak in a gas cylinder. Finally, the simulation and experimental results were compared to verify the accuracy of the simulation results.