The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Colorectal cancer (CRC) is the third most commonly diagnosed cancer worldwide, and despite advances in treatment, survival rates are still low; therefore, the development of novel drugs is imperative. Acetylcorynoline (ACN) is derived from Corydalis ambigua. The effect of ACN on colon cancer is still unknown. Therefore, we investigated its potential effects. Our data showed that ACN inhibited cell viability and proliferation. Moreover, ACN induced apoptosis and cell cycle arrest by inhibiting cell growth. In the present study, we hypothesized that ACN regulates c-Myc through CNOT2 or MID1IP1. ACN reduced the protein expression of oncogenic genes, decreased c-Myc half-life, and rapidly inhibited the serum stimulation response. Moreover, knockdown of CNOT2 and MID1IP1 with ACN increased apoptosis and further reduced the expression of oncogenes. In addition, ACN exhibited a synergistic effect with low-dose of 5-fluorouracil (5-FU) and doxorubicin (Dox). Collectively, our data demonstrates that ACN inhibited c-Myc expression through CNOT2 and MID1IP1 and induced apoptosis. These findings indicate the potential of ACN as a therapeutic agent against colon cancer.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

The study is to identify motivational factors that lead to collective intelligence and to understand how these factors relate to each other and to innovation capabilities in enterprises. The relationships between each of the sub-factors of the collective intelligence construct with the sub-factor of incremental innovation were examined. The study used the convenience sampling of corporate employees who use collective intelligence from corporate panel members (n=1500). Collective intelligence was found to affect work process, operations, and service innovation. This suggests that as work processes are made more innovative, the more actively collective intelligence is pursued, the greater the improvement in the performance of work processes, work procedures, work efficiency, customer satisfaction, and services. This study provides significant implications for corporations operating collective intelligence services such as online communities. First, such corporations vitalize their services by raising the quality of information and knowledge shared in their communities. Additionally, contribution motivations that take the characteristics of knowledge and information contributors into consideration require further development.The sample for this study was identified through convenience sampling of corporate employees who use collective intelligence from corporate panel members (n=1500). Collective intelligence was found to affect work process, operations, and service innovation. This suggests that as work processes are made more innovative, the more actively collective intelligence is pursued, the greater the improvement in the performance of work processes, work procedures, work efficiency, customer satisfaction, and services. This study provides significant implications for corporations operating collective intelligence services such as online communities. First, such corporations vitalize their services by raising the quality of information and knowledge shared in their communities. Additionally, contribution motivations that take the characteristics of knowledge and information contributors into consideration require further development.

(1) Background: Gamma-aminobutyric acid (GABA) is one of the inhibitory neurotransmitters with beneficial effects including sedative property. However, despite various clinical trials, scientific evidence regarding the impact of orally ingested GABA, whether natural or synthesized through biological pathways, on sleep is not clear.; (2) Methods: The present study work evaluated GABA-A biding affinity of GABALAGEN(GBL), a low-molecular-weight collagen infused with GABA, through receptor binding assays. The sedative effects of GBL were investigated through electroencephalography (EEG) analysis in the electro foot shock (EFS) stress-induced sleep animal model and then we examined the expression orexin, GABAA receptor in the brain region using immunohistochemistry.; (3) Results: We found that on the binding assay, GBL displayed high affinity to GABAA receptor (IC50 value, 31.5µg/mL)). Also, after treatment of GBL, percent of total time of REM and NREM were significantly and dose-dependently increased compared to the Con group. Consistent with behavioral results, the GBL-treated groups showed that the expression of GABAA receptor immune-positive cells in the VLPO were markedly and dose-dependently increased compared to the Con group. Also, the GBL-treated groups showed that the expression of orexin immune-reactive cells in the LH were significantly decreased compared to the Con group.; (4) Conclusions: In conclusion, GBL showed efficacy and potential to be used as an anti-stress therapy to treat sleep deprivation through antagonism of GABA receptors and consequent inhibition of orexin activity.

Background: Autonomic neuropathy commonly arises as a long-term complication in end stage kidney disease (ESKD) and can be diagnosed from heart rate variability (HRV), calculated from electrocardiogram (ECG) recordings. There is limited data about HRV using real-time ECG to predict HD efficiency in patients with ESKD who are routinely doing HD in real-world practice. Methods: Total of 50 patients (62.1 ± 10.7 years) with ESKD underwent continuous real-time ECG monitor (237.4 ± 15.3 min) during HD for HRV using remote monitoring system and checked electrolyte levels before/after HD. And we compared HRV according to electrolyte levels. Results: During the monitor, we checked total 2374 times of ECG and electrolyte level simultaneously of all patients. Both time and frequency domain HRV were higher when the patients had lower K+ level (<0.5 mEq/L) and P+ level change (<2 mEq/L) before/after HD as compared with those with higher K+ level (≥0.5 mEq/L) and P+ level (≥2 mEq/L) change respectively. In addition, there were higher incidence of arrhythmic events including atrial/ventricular premature complexes, even though no difference of mean heart rate in patients with lower K+ and P+ level change group (p < 0.001). Conclusions: Higher HRV was independently associated with poor controlled K+ and P+ level during hemodialysis in patients with ESKD. This is further substantiated by independent continuous associations between real-time measures of higher HRV and K+ and P+ level. These data strongly suggest that cardiac autonomic dysfunction can be caused by lower change of electrolytes before/after hemodialysis alone.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

This study delves into the atmospheric corrosion behavior of chromium-free complex-phase steel (CP), specifically investigating the influence of wet/dry frequency and ratio in cyclic corrosion tests (CCT). The study employs a modified ISO 14993 standard CCT method, which involves salt spray, dry, and wet stages. After 15 and 30 CCT cycles, mass loss, maximum corrosion depth, and corrosion products were analyzed to gain insights into corrosion mechanisms. In general, increasing the frequency and wet/dry stage ratio in CCT extends the time for autocatalytic reactions to occur, leading to accelerated localized CP corrosion and increased pitting factors. However, as the rust layer thickens, uniform corrosion may also intensify, so careful considerations are necessary. This study underscores the importance of controlling the frequency and ratio of wet/dry stages in CCT for effectively analyzing localized corrosion behavior in specimens.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (<1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This study is focused on the development of criteria for night and visual line of sight (VLOS) flights, especially in the context of beyond visual line of sight (BVLOS) drone applications. While BVLOS technology is advancing globally, regulatory restrictions and conservative legal regulations often prohibit these flights. The goal is to provide experimental guidelines for operational procedures in night and BVLOS flights. The study aims to establish empirical criteria for physical distances in night and VLOS flights, using a test team composed of a pilot, recorder, and observers. The observers are tasked with assessing the identification and recognition distances, which are crucial for safe drone operations. The criteria established are based on different variables such as aircraft size, altitude, and visual acuity. This research involves extensive flight tests at varying altitudes using different types of drones and observers with differing visual acuities (20/20, 20/13.3, and 20/10). The study also examines the effect of communication equipment limitations on recognition distance and the use of lighting devices to minimize abnormal conditions during nighttime flights. Overall, the study's findings aim to contribute to the safe and efficient planning of BVLOS and night drone flights, especially considering the ever-evolving technology and regulatory landscape in this field.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Taiwan’s auditors have suffered from processing excessive audit data, including drawing audit evidence. This study advances sampling techniques by integrating machine learning with sampling. This machine learning integration helps avoid sampling bias, keep randomness and variability, and target the risker samples. We first apply a Naive Bayes classifier to classify data into some classes. Next, a user-based, item-based, or hybrid approach is employed to draw audit evidence. The representativeness index is the primary metric for measuring the representativeness of audit evidence. The user-based approach denotes the selection of samples between two percentiles in a class as audit evidence. It may be equivalent to a combination of monetary and variable sampling methods. The item-based approach represents the choice of risky samples as audit evidence. It may be identical to a combination of non-statistical and monetary sampling methods. Auditors can hybridize those user-based and item-based approaches to balance representativeness and riskiness in selecting audit evidence. Three experiments show that sampling using machine learning integration has the benefits of drawing unbiased samples, handling complex patterns, correlations, and unstructured data, and improving efficiency in sampling big data. However, the limitations are the classification accuracy output by machine learning algorithms and the range of prior probabilities.

The number of patients with bone metabolic disorders including osteoporosis is increasing worldwide. These disorders often facilitate bone fractures, which seriously impact the patient’s quality of life and could lead to further health complications. Bone homeostasis is tightly regulated to balance bone resorption and formation. However, many anti-osteoporotic agents are broadly categorized as either bone forming or anti-resorptive, and their therapeutic use is often limited due to unwanted side effects. Therefore, safe and effective therapeutic agents are needed for osteoporosis. This study aims to clarify the bone protecting effects of oat bran water extract (OBWE) and its mode of action. OBWE inhibited RANKL-induced osteoclast differentiation by blocking c-Fos/NFATc1 through the alteration of I-κB. Furthermore, we found that OBWE enhanced BMP-2-stimulated osteoblast differentiation by the induction of Runx2 via Smad signaling molecules. In addition, the anti-osteoporotic activity of OBWE was also evaluated using an in vivo model. OBWE significantly restored ovariectomy-induced bone loss. These in vitro and in vivo results showed that OBWE has the potential to combat bone metabolic disorders including osteoporosis

In this study, the potential of whey protein hydrolysate (WPH) containing LDIQK peptide and treadmill exercise to prevent cognitive decline was investigated along with the neuroprotective mechanisms. Cognitive dysfunction was induced in mice by 1 mg/kg scopolamine, followed by administration of WPH at 100 and 200 mg/kg and/or treadmill exercise at 15 m/min for 30 min five days per week. Both WPH administration and treadmill exercise significantly improved memory in mice with scopolamine-induced cognitive impairment, which was attributed to several key mechanisms, including a reduction in oxidative stress based on decreased levels of reactive oxygen species and malondialdehyde in the brain tissue and an increase in acetylcholine by increasing choline acyltransferase and decreasing acetylcholine esterase levels. Exercise and WPH also exerted neuroprotective effects by inhibiting the hyperphosphorylation of tau protein, enhancing the expression of brain-derived neurotrophic factor, and inhibiting apoptosis by reducing the Bax/Bcl2 ratio in conjunction with downregulation of the mitogen-activated protein kinase pathway. Moreover, the impact of WPH and treadmill exercise extended to the gut microbiome, suggesting a potential link with cognitive improvement. These findings suggest that both WPH intake and treadmill exercise are effective strategies for mitigating cognitive impairment, providing promising avenues for treating neurodegenerative diseases.

Anesthetics reduce cardiac functions and lower blood pressure (BP), potentially causing excessive BP reduction in dehydrated patients or those with heart conditions, such as coronary artery disease (CAD). Considering the increased prevalence of cardiovascular disease with age, anesthesiologists must be cautious about BP reduction during general anesthesia in older adults. In the present case, an undiagnosed CAD patient in a hypovolemic state experienced a significant systolic blood pressure drop to the 50s during propofol and sevoflurane anesthesia. Despite the use of vasopressors, excessive hypotension persisted, leading to anesthesia suspension. Subsequent cardiac examinations, including computed tomography heart angio and calcium score, and coronary angiogram, revealed a near total occlusion of the left main coronary artery and the formation of collateral circulation. After 5 days of hydration and anticoagulation medications and confirmation of normovolemic state, general anesthesia was attempted again and successfully induced; a normal BP was maintained throughout the surgery. Thus, it is important to conduct a thorough cardiac evaluation and maintain normovolemia for general anesthesia in older adults.

SMARCA4-deficient non-small cell lung cancer (NSCLC) is a more recently recognized subset of NSCLC. We describe the 18F-fluorodeoxyglucose (FDG) PET/CT findings in a rare case of SMARCA4-deficient NSCLC and response to therapy. A 45-year-old male patient with a history of heavy smoking (10 years) underwent an 18F-fluorodeoxyglucose (FDG) PET/CT dynamic (chest) + static (whole-body) scan for diagnosis and pre-treatment staging. 18F-FDG PET/CT showed an FDG-avid mass in the upper lobe of the left lung (SUVmax of 22.4) and FDG-avid lymph nodes (LN) in the left pulmonary hilar region (SUVmax of 5.7). In addition, there are multiple metastases throughout the body, including distant LNs, adrenal glands, bone, and brain. Pathological findings confirmed SMARCA-4 deficient NSCLC. After 4 cycles of chemotherapy and immune checkpoint inhibitors（ICI）, the patient underwent again an 18F-FDG PET/CT scan (including dynamic scan) for efficacy evaluation. We report cases that deepen the understanding of the 18F-FDG PET/CT presentation of SMARCA4-deficient NSCLC as well as dynamic imaging features and parametric characteristics.

Background: Gastric cancer (GC) is the second most prevalent cancer in Korea, significantly impacting morbidity and mortality. While advancements in early detection and treatment have improved survival rates, managing post-surgical recovery remains vital. Herbal medicine (HM) has emerged as a potential adjunct therapy to enhance recovery and quality of life (QoL) in patients post-GC surgery. Methods: This systematic review and meta-analysis evaluated the efficacy and safety of HM in the post-surgical recovery of GC patients. We searched both Korean and international databases, identifying 16 randomized controlled trials (RCTs) meeting our criteria. We assessed study quality using the Cochrane Risk of Bias tool and analyzed data with Review Manager Software (RevMan). Results: Our analysis included 1,546 patients from the selected studies, demonstrating that HM significantly improved gastrointestinal recovery times, including time to first flatus, bowel movement, and return of bowel sounds. Significant improvements were also seen in nutritional markers such as albumin and prealbumin, alongside beneficial effects on immune markers like CD3+ and CD4+ levels. QoL assessments using WHOQOL-BREF and QLQ-C30 scores indicated substantial improvements. HM had a favorable safety profile, showing a reduced incidence of adverse effects compared to controls. Conclusion: The findings suggest that HM can significantly enhance recovery and improve the quality of life following gastric cancer surgery, with a favorable safety profile. However, due to considerable heterogeneity in study results, extended clinical trials and rigorous follow-ups are recommended to assess long-term effects and side effects comprehensively.

Although the number of unwed mothers have mental health problems and intellectual disability, little research have focused on their mental and cognitive status. Since there has been public stigma of unwed mother in South Korea, they tend to conceal their status and less likely to seek psychiatric and psychological help. In this context, this study aims to assess current status of their mental health and intellectual characteristics. A total 48 unwed mothers from two shelter homes in South Korea were agreed to participate in the study. To compare mental health and intellectual abilities of unwed mothers with the general women population, reference data from national studies was used. Unwed mothers were more likely to have mood disorder, post traumatic stress disorder(PTSD), alcohol and nicotine use disorder, attention-deficit hyperactivity disorder (ADHD) than the general women population. Among 48 participants, 20 (41.7%) were lower than 70 Intelligence Quotient (IQ) and the mean of IQ (78.31) was significantly lower than normalized IQ mean of general women population. In logistic regression analysis, psychiatric disorders were associated intellectual disability. This study confirmed that unwed mothers dwelling in Korean shelter homes have more experience of mental disorders and lower intellectual ability than general women population.

The purpose of this study was to investigate the effect that Glycine max hydrolyzed with enzymes from Bacillus velezensis KMU01 has on dextran sulfate sodium (DSS)-induced colitis in mice. Hydrolysis improves functional health through the bioconversion of raw materials and increase in intestinal absorption rate and antioxidants. Therefore, G. max was hydrolyzed in this study using a food-derived microorganism, and its anti-inflammatory effect observed. Enzymatically hydrolyzed G. max (EHG) was orally administered once daily for four weeks before DSS treatment. Colitis was induced in mice through consumption of 5% (w/v) DSS in drinking water for eight days. Results showed that EHG treatment significantly alleviated DSS-induced body weight loss and decreased the disease activity index and colon length. In addition, EHG markedly reduced tumor necrosis factor-a, interleukin (IL)-1b, and IL-6 production, and increased that of IL-10. EHG improved DSS-induced histological changes and intestinal epithelial barrier integrity in mice. Moreover, we found that the abundance of 15 microorganisms changed significantly; that of Proteobacteria and Escherichia coli, which are upregulated in patients with Crohn’s disease and ulcerative colitis, decreased after EHG treatment. These results suggest that EHG has a protective effect against DSS-induced colitis and is a potential candidate for colitis treatment.

In this study, to reduce the use of cement and sand, porous feldspar with excellent economic efficiency was used as a substitute in heat storage concrete layer. When cement was replaced with porous feldspar, the compressive strength was approximately 16%–63% higher compared with when cement was replaced with silicate minerals. To compensate for the reduction in strength owing to the decreased cement content, mechanical and chemical activation methods were employed. When the specific surface area of porous feldspar was increased, the unit weight was reduced by approximately 30% and the compressive strength was increased by up to 90%. When chemical activation was applied using a solidifying agent, the strength was increased by approximately 30% even though 70% of the cement content was replaced with porous feldspar. When cement and sand were replaced with porous feldspar, the compressive strength was approximately two times that of ordinary cement mortar. When the heat storage concrete layer material was replaced with porous feldspar in a pilot scale experiment, the thermal conductivity and heat storage characteristics were better than those of ordinary cement mortar, and an energy-saving effect of approximately 57% was observed, confirming the excellent applicability of porous feldspar as a building material.

The economic development and infrastructure of a nation are closely interrelated. In addition, public trust in national infrastructure facilities is closely linked to the preservation of the advantages provided by these facilities to the public. Since the 1970s, Korea has achieved exponential economic growth over a short period of time and the number of infrastructure facilities has increased correspondingly. This compressed economic development has been underpinned by the national infrastructure, whose safety and usability have been excluded from the scope of the development. However, after around 30 years, structural deterioration coupled with general insensitivity to safety in today’s society has considerably reduced public trust in using the infrastructure. Realistically, policies that mainly focus on developing new technologies related to infrastructure construction have led to practical limitations that discourage the development of technologies for maintenance or inspection. Furthermore, current maintenance works face certain limitations caused by various reasons: insufficient budget, increasing number of infrastructure facilities requiring maintenance, shortage of manpower, and rapidly increasing number of aging infrastructure facilities. To overcome these limitations, a new approach is required that is different from general inspection methods under the existing rules and regulations. In this context, this study aimed to explore the efficiency of bridge inspection and maintenance by unmanned aerial vehicles (UAVs) that could observe inaccessible areas, could be conveniently and easily controlled, and could offer high economic benefits. To this end, various tests were performed on elevated bridges, and suitable UAV images were obtained. The obtained UAV images were inspected by using machine vision technology, thereby excluding subjective evaluations by humans. Methods for enhancing the objectivity of the inspection were also discussed. The test results showed that both the efficiency and objectivity of the proposed method were better than those of the existing bridge maintenance and inspection methods.

Background Telomere shortening is related to aging and unfavourable health outcomes. Obesity and metabolic diseases are important factors for accelerating aging. This study aimed to find out the association between obesity, metabolic disease, and telomere length in metabolically healthy adults. Methods 237 adults were enrolled with written consents at a health promotion centre of a tertiary hospital from February 2014 to March 2015. After excluding 99 subjects who met the exclusion criterion, a total of 130 metabolically healthy subjects were selected for final analysis. The subjects were divided into quartile groups according to the telomere lengths of their oral mucosal cells. Results The subjects consisted of 66 (50.8%) males with a mean age of 58.59 years. The body mass index (BMI, kg/m2) increased significantly along with the quartile groups (Q1, 23.00; Q2, 23.96; Q3, 23.70; Q4, 25.20; P-for trend=0.008). Waist circumference (WC, P-for trend=0.022), waist-to-hip ratio (WHR, P-for trend=0.005), and waist-to-height ratio (WHtR, P=0.001) also increased along with the quartile groups. Obesity prevalence (BMI ≥25 kg/m2), abdominal obesity (WC ≥90 cm for men, ≥85 cm for women), WHR 〉1.0 for men or 〉0.85 for women, and WHtR ≥0.5 increased significantly as the telomere length increased (P-for trend <0.05). After adjusting for covariates, the ORs for each obesity markers increased as the telomere length increased (P-for trend <0.05); and the ORs of WHtR were especially meaningful (Q1, 1.00; Q2, 2.53; Q3, 2.97; Q4, 7.81; P-for trend = 0.001). There were no significant trends for metabolic syndrome and its components along with the prevalence of fatty liver disease. Conclusion Obesity markers and telomere length had significant positive correlation despite the established theory. The obesity paradox may exist in metabolically healthy adults with regard to telomere length, However, further studies with larger sample sizes for the association between obesity and telomere length are needed.

We reveal the significance of plasmonic nanoparticle’s (NP) shape and its surface morphology en route to an efficient self-assembled plasmonic nanoparticle cluster. A simplified model is simulated in the form of free-space dimer and trimer nanostructures (NPs in shape of sphere, cube, and disk). A ~ 200 % to ~ 125% raise in near field strength (gap mode enhancement) is observed for spherical NPs in comparison with cubical NPs (from 2 nm to 8 nm gap sizes). Full-width three-quarter maximum reveals better broad-spectral optical performance in a range of ~ 100 nm (dimer) and ~ 170 nm (trimer) from spherical NPs as compared to a cube (~ 60 nm for dimer and trimer). These excellent properties for sphere-based nanostructures are merited from its dipole mode characteristics.

Licochalcone H (LCH), a regioisomer of licochalcone C derived from the root of Glycyrrhiza inflata. CRC treatment has always been challenged by the development of resistance. We investigated the antiproliferative activity of LCH in oxaliplatin (Ox)-sensitive and -resistant CRC cells. LCH significantly inhibited cell viability and colony growth in both Ox-sensitive and Ox-resistant CRC cells. We found that LCH decreased epidermal growth factor receptor (EGFR) and AKT kinase activities and related activating signaling proteins including phospho (p)-EGFR and pAKT. A computational docking model indicated that LCH may interact with EGFR, AKT1, and AKT2 at the ATP-binding sites. LCH induced ROS generation, as verified by N-acetyl-L-cysteine (NAC) treatment, and increased the expression of the ER stress markers. LCH treatment of CRC cells induced depolarization of MMP and increased. Multi-caspase activity was induced by LCH treatment and confirmed by Z-VAD-FMK treatment. LCH increased the number of subG1 cells and arrested the cell cycle at the G1 phase. LCH inhibits the growth of Ox-sensitive and Ox-resistant CRC cells by targeting EGFR and AKT, and inducing ROS generation and ER stress-mediated apoptosis. Therefore, LCH could be a potential therapeutic agent for improving not only Ox-sensitive but also Ox-resistant CRC treatment.

Achievement of solid fusion of the lumbosacral junction (L5-S1 level) is an important factor in adult spinal deformity (ASD) surgery. The purpose of this study is to explore the effectiveness and feasibility of injectable rhBMP-2 (a combination of Eschericia coli-derived rhBMP-2 and hydrogel type β-TCP carrier; NOVOSIS Inject) as a bone substitute for the fusion of lumbosacral junction. 20 patients (average age 69.1 years) diagnosed with ASD with sagittal imbalance who underwent surgical treatment including anterior lumbar interbody fusion (ALIF) in the L5-S1 level were evaluated. Injectable rhBMP-2 was applied in L5-S1 ALIF and followed-up for 1-year. Solid fusion rates and changes of clinical outcomes (Oswestry Disability Index [ODI], Visual Analog Scale [VAS] of back and leg) were measured and analyzed at 6 and 12 months after surgery. All postoperative adverse events were evaluated about the association with injectable rhBMP-2. Fusion rates were 68.4% and 100% at 6 and 12 months after surgery. Compared to baseline, ODI were improved to 45.8% and 63.7%, VAS(back) were improved to 69.2% and 72.8%, and VAS(leg) were improved to 49.2% and 64.8% at 6 and 12 months after surgery (p&lt;0.001, respectively). There were no adverse events associated with injectable rhBMP-2. Thus, injectable rhBMP-2 may be a suitable choice of a bone graft substitute when achieving solid interbody fusion in the lumbosacral junction.

This paper proposes an algorithm for transmitting and reconstructing the estimated point cloud using temporally estimating a dynamic point cloud sequence. When a non-rigid 3D point cloud sequence (PCS) is input, the sequence is divided into groups of point cloud frames (PCF), and a key PCF is selected. After the 3D skeleton is predicted through 3D pose estimation, the motion of the skeleton is estimated by analyzing the joints and bones of the 3D skeleton. For the deformation of the non-rigid human PC, the 3D PC model is transformed into a mesh model, and the key PCF is rigged using the 3D skeleton. After deforming the key PCF into the target PCF utilizing the motion vector of the estimated skeleton, the residual PC between the motion compensation PCF and the target PCF is generated. If there is a key PCF, the motion vector of the target PCF, and a residual PC, the target PCF can be reconstructed. Just as compression is performed using pixel correlation between frames in a 2D video, this paper compresses 3D PCF by estimating the non-rigid 3D motion of a 3D object in a 3D PC. The proposed algorithm can be regarded as an extension of the 2D motion estimation of a rigid local region in a 2D plane to the 3D motion estimation of a non-rigid object (human) in 3D space. Experimental results show that the proposed method can successfully compress 3D PC sequences. If it is used together with a PC compression technique such as MPEG PCC (point cloud compression) in the future, a system with high compression efficiency may be configured.

Numerous innovative advancements in dressing technology for wound healing have emerged. Among the various types of wound dressings available, hydrogel dressings, structured with a three-dimensional network and composed of predominantly hydrophilic components, are widely used for wound care due to their remarkable capacity to absorb abundant wound exudate, maintain a moisture environment, provide soothing and cooling effects, and mimic the extracellular matrix. Composite hydrogel dressings, one of the evolved dressings, address the limitations of traditional hydrogel dressings by incorporating additional components, including particles, fibers, fabrics, or foams, within the hydrogels, effectively promoting wound treatment and healing. The added elements enhance the features or add specific functionalities of the dressings, such as sensitivity to external factors, adhesiveness, mechanical strength, control over the release of therapeutic agents, antioxidant and antimicrobial properties, and tissue regeneration behavior. They can be categorized as natural or synthetic based on the origin of the main components of the hydrogel network. This review focuses on recent research on developing natural polysaccharide-based composite hydrogel wound dressings. Their preparation and composition, the reinforcement materials integrated into hydrogels, and therapeutic agents are also explored. Furthermore, their features and the specific types of wounds where applied are discussed as well.

Based on the cloud platform of Google Earth Engine (GEE), this study selected Landsat 5/8 and Sentinel-2 remote sensing images and used Support Vector Machine (SVM) classification method to classify the 35 years of intertidal salt marshes in China, and verified the classification results in combination with field survey. Finally, combining with various driving factors, the reasons and laws affecting the changes of salt marshes species and area were discussed and analyzed. The main results of the study are as follows:The main types of salt marshes plants in China include Phragmites australis, Spartina alterniflora, Suaeda salsa, Scirpus mariquete, Tamarix chinensis, Cyperus malaccensis and Sesuvium portulacastrum. The results salt marshes classification indicated that 166999.32 ha in 1985, 172893.87 ha in 1990, 174952.29 ha in 1995, 125567.51 ha in 2000, 93257.97 ha in 2005, 102539.04 ha in 2010, 96302.92 ha in 2015, and 115722.75 ha in 2019. The main driving factors of salt marsh change from 1985 to 2015 are reclamation, mudflat aquaculture, climate change, coastal zone erosion, invasion of alien species, and natural competition and succession among salt marshes species. The results can be used to quantitatively analyze the salt marshes carbon storage in space and time, and provide data support for the protection of salt marsh wetlands, the restoration of ecological functions and the implementation of "carbon neutral".

Mumps is the second-most reported infectious disease in South Korea; however, due to the low pathogen confirmation rate in laboratory diagnoses, we proposed a method for reevaluating the high incidence rate via the laboratory verification of other viral diseases. In 2021, 63 cases of pharyngeal or cheek mucosal swabs of suspected mumps cases in Gwangju, South Korea, were assessed for causative pathogens using massive simultaneous pathogen testing (TaqManTM Array Cards). More than one respiratory virus was detected in 60 cases (95.2%), 44 (73.3%) of which were co-detected. Human rhinovirus was detected in 47 cases, followed by human herpesvirus (HHV)6 in 30; HHV4 (17), human bocavirus (17), HHV5 (10), and human parainfluenza virus 3 (6) were also detected. Our findings suggest the need for further investigations on the pathogenesis of diseases mimicking mumps, which are considered to aid with appropriate public health responses, treatment, and the prevention of infectious disease outbreaks.

In this study, dextran sulfate sodium (DSS)-induced in vivo model and LPS-stimulated in vitro model were used to confirm whether ethanol extract of Cnidii Rhizoma (EtCR) could ameliorate UC. EtCR improved symptoms of UC, including body weight loss, colon length shortening, disease activity index (DAI), and colon mucosal damage. In addition, EtCR decreased inflammatory mediators, including cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS), in colon tissue. To further confirm the UC improving mechanism, RAW 264.7 cells and HT29 human epithelial cells were used. EtCR reduced expression of inflammatory cytokines (IL-1β, TNF-α, and IL-6) and inflammatory mediators (nitric oxide and prostaglandin E₂) via JNK and NF-κB signaling pathway in RAW 264.7 cells. In addition, EtCR increased expression of trefoil factor 3 (TFF3), which is an epithelial cell protective factor, in HT29 cells. Taken together, our study suggests that EtCR has treatment effect on UC and can be a therapeutic agent.

Background: Gastric cancer (GC) is one of the leading malignancy diseases worldwide, especially in Asian. CAST is a potential oncogene in GC carcinogenesis process. The character of macrophage infiltration in GC microenvironment was also unaddressed. Methods: We first applied machine searching in gene candidate evaluation of GC. CAST expression was analyzed via the Human Protein Atlas (HPA) and Gene Expression Profiling Interactive Analysis 2 (GEPIA2) database. Protein-protein interaction (PPI) network was downloaded from STRING. We investigated the impact of CAST on clinical prognosis using Kaplan-Meier plotter. The correlations between CAST and Lgr5 and macrophage infiltration in GC was surveyed via TIMER 2.0. Finally, GeneMANIA was also used to evaluate the possible functional linkage between genes. Results: After machine-assisted searching, CAST expression was found signicant difference in the overall survival of GC patients. STRING revealed CAST related proteomics and transcriptomics associations, mainly about CAPN family. Moreover, CAST significantly impacts the prognosis of GC from other datasets validation. Notably, high CAST expression was correlated with worse overall survival in GC patients (hazard ratio = 1.59; logrank P = 9.4 x 10-8). CAST and Lgr5 expressions were both positively correlated with WNT 2 and WNT 2B. Among GC patients in several datasets, CAST and macrophage infiltration evaluated together showed no obvious trend toward poor clinical overall survival. Conclusion: CAST plays an important role in GC clinical prognosis and is associated with WNT 2/WNT 2B/Lgr5. Our study denmostrated that CAST in GC overall survival is regulated by macrophage infiltration.

In Taiwan, mountainous areas account for approximately two-thirds of the total area. The steep terrain and concentrated rainfall during typhoons cause landslides, which pose a considerable threat to mountain settlements. Therefore, models for analyzing rainfall-induced landslide hazards are urgently required to ensure adequate land use in mountainous areas. In this study, focusing on Pingtung County in southern Taiwan, we developed a landslide hazard index (IRL) to land use. Using FORMOSA-2 and SPOT-5 satellite images, data were collected before and after four typhoons (one in 2009 and three in 2013). The ArcGIS random tree classifier was used for interpreting satellite images to explore surface changes and disasters, which were used to analyze slope disturbances. The product of the maximum 3-h rolling rainfall intensity and effective accumulated rainfall was used as a rainfall trigger index (IRT). Considering environmental and slope disturbance factors, an index of slope environmental strength potential (ISESP) was developed through logistic regression (LR). Landslide hazard to land use was estimated using IRT and ISESP. The average coefficient of agreement (Kappa) was approximately 0.71 (medium to high accuracy); the overall accuracy of slope environmental strength potential analysis was approximately 80.4%. At a constant ISESP, IRT increased with the increasing hazard potential of rainfall-induced landslides. Furthermore, IRT and ISESP were positively correlated with landslide occurrence. When large ISESP values occur (e.g., fragile environment and high land development intensity), small IRT values may induce landslides.

Antibiotics’ effect on Mycoplasma pneumoniae (MP) infection still remains controversial. A prospective study of 257 children with MP pneumonia during a recent epidemic (2015-2016) was conducted. All MP pneumonia patients were treated with corticosteroids within 24-36 h after admission. Initially, oral prednisolone (1 mg/kg) or intravenous methylprednisolone (IVMP) (1-2 mg/kg) was administered for mild pneumonia patients, and IVMP (5 -10 mg/kg/day) for severe pneumonia patients. If patients showed persistent fever for 36-48 hours or disease progression, additive IVMP (5 mg/kg or 10 mg/kg) was given. Eighty-five patients received only a broad-spectrum antibiotic without macrolide. The mean age and the male:female ratio were 5.6 ± 3.1 years, respectively. Seventy-four percent of patients (190/257) showed immediate defervescence within 24 h, and 95.7% (246/257) of patients showed defervescence within 72 h with improvements in clinical symptoms. Eight patients who received additive IVMP also showed clinical improvement within 48 h without adverse reactions. There were no clinical or laboratory differences between patients treated with a macrolide (n = 172) and without (n = 85). Early corticosteroid therapy might reduce disease morbidity and prevent disease progression in MP pneumonia patients without side effects, and antibiotics may have limited effects on MP infection.

Recently, “mature” silkworms (MS) of Bombix mori have been considered as a potential nutraceutical, with a number of health benefits reported for steamed and lyophilized MS powder (SMSP). However, no obesity-related effects have been reported for SMSP. In the present study, anti-obesity effects of SMSP were investigated in adult mice in vivo, aged 12 weeks at the onset of drug administration, fed normal diet (ND) and high-fat diet (HFD), respectively, for 12 weeks. SMSP significantly suppressed body weight gain, intra-abdominal adipose tissue, and food efficiency in both ND-fed and HFD-fed adult mice. In addition, SMSP significantly decreased food intake and liver weight in HFD-fed mice, indicating that SMSP suppressed appetite and simultaneously reduced the conversion of feed into body weight in HFD-fed mice. SMSP also significantly lowered serum levels of glucose, triglyceride, total cholesterol, low-density lipoprotein cholesterol, asparagine transaminase, alanine transaminase, and alkaline phosphatase. However, SMSP had no significant effect on the weights of kidney, spleen, and thymus and serum levels of blood urea nitrogen and creatinine. Taken together, the above results suggest that SMSP has potent anti-obesity effects and is safe for long-term use as a potential therapeutic and/or nutraceutical in both obese patients and non-obese individuals.

This paper first introduces the main classification of brain diseases and the main causes of these diseases. It is followed by wavelet analysis, which is a mathematical function or wave-like pattern used to transform data, which can decompose the signal into different wavelet functions, each of which is related to a specific scale or frequency. Wavelet analysis has been applied in many fields such as image processing, data analysis and engineering. In addition, wavelet is also used in the analysis of biological signals. Wavelet analysis breaks down brain signals, such as EEG or fMRI data, into various frequency components at different scales. Wavelet analysis provides time-frequency localization. Pattern recognition can be enhanced by isolating salient features in the data. Wavelet denoising can effectively separate noise from underlying brain signals. Wavelet denoising usually adopts threshold method. Wavelet analysis can enhance pattern recognition by isolating salient features in the data. Researchers can train machine learning models based on these wavelet-derived features to recognize specific patterns associated with different neurological disorders. Wavelet analysis can track these changes by continuously evaluating the frequency content of the neuroimage data over time. Through continuous efforts, wavelet theory and technology have become valuable tools in the field of neuroscience and brain disease research.

This study was to investigate and assess salivary biomarkers as a means of diagnosing periodontitis. A total of 121 subjects were included: 28 periodontally healthy subjects, 24 with stage I, 24 with stage II, 23 with stage III, and 22 with stage IV periodontitis. Salivary proteins including active matrix metalloproteinase-8 (MMP-8), pro-MMP-8, total MMP-8, C-reactive protein, secretory immunoglobulin A and planktonic bacteria including Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola, Fusobacterium nucleatum, Prevotella intermedia, Porphyromonas nigrescens, Parvimonas micra, Campylobacter rectus, Eubacterium nodatum, Eikenella corrodens, Streptococcus mitis, Streptococcus mutans, Staphylococcus aureus, Enterococcus faecalis, and Actinomyces viscosus were measured from salivary samples. The performance of the diagnostic models was assessed by receiver operating characteristics (ROC) and area under the ROC curve (AUC) analysis. The diagnostic models were constructed based on the subjects’ proteins and/or microbial profiles, resulting in two potential diagnosis models, which achieved better diagnostic powers with an AUC value &gt; 0.750 for the diagnosis of stage II, III, and IV periodontitis (Model PC-I; AUC: 0.796, sensitivity: 0.754, specificity: 0.712) and for the diagnosis of stage III and IV periodontitis (Model PC-II; AUC: 0.796, sensitivity: 0.756, specificity: 0.868). This study can contribute to screening for periodontitis based on salivary biomarkers.

In spite of unique structural, spectroscopic and redox properties, the synthetic variants of the planar, antiaromatic hexaphyrin (1.0.1.0.1.0) derivatives 2, has been limited due to the low yields and difficulty in access to the starting material. A chemical modification of the meso-substituents could be good alternative overcoming the synthetic barrier. Herein, we report a regio-selective nucleophilic aromatic substitution (SNAr) of meso-pentafluorophenyl group in rosarrin 2 with catechol. The reaction afforded benzodioxane fused rosarrin 3 as single product with high yield. The intrinsic antiaromatic character of the starting rosarrin 2 retained throughout the reactions. Clean, two electron reduction was achieved by treatment of 3 with SnCl2•2H2O affording 26pi-electron aromatic rosarrin 4. The synthesized compounds exhibited noticeable changes in photophysical and redox properties compared with starting rosarrin 2. .

Resection of malignant lesions in the oral and maxillofacial area causes functional and morphological defects. To recover from these defects, reconstruction surgery is needed such as a primary closure or a flap. There are advantages and disadvantages to the method of using the primary closure and the flap, and the choice of procedure is entirely up to a surgeon. The purpose of this study is to evaluate availability of primary closure in patients. For 10 years from January 2010 to May 2020, patients who recovered using flaps after removing malignant lesions from the oral cavity and those who closed the lesion using primary closure were investigated. The investigation was conducted by searching the database of the hospital. There were 85 patients who removed malignant lesions in the oral and maxillofacial area, and among them 16 patients closed the soft tissue defects using primary closure. Operation time, histologic types, stages, wound status, and period of hospitalization according to the patients' medical records were investigated retrospectively. Between the staging and the primary closure, statistically significant differences were observed between stage I and stage II patients in 13 patients using the primary closure. (P=0.046). Statistically significant differences were identified between operation time and primary closure, with an average of 4.02 hours (P=0.015). The average period of hospitality for patients who underwent primary closure was 13.4 days, compared to 26.7 days for those who underwent flap surgery. This difference was statistically significant (P=0.0003). This study evaluated the use of primary closure in patients who underwent resection of malignant lesions in the oral and maxillofacial area. Although the majority of patients underwent reconstruction with flaps, our results showed that primary closure can be a viable option for certain patients with early-stage lesions. Therefore, oral and maxillofacial surgeons should carefully consider various evaluation criteria and select appropriate reconstruction methods to optimize functional and aesthetic outcomes for each patient.

Objectives: To assess clinical implications of increased nuchal translucency (INT) in twin pregnancies based on the chorionicity. Methods: This was a retrospective review of the twin pregnancies who underwent first trimester ultrasound with nuchal translucency (NT) measurement at 11-13 weeks of gestation from January 2006 to December 2014. Data were collected using the OB database and the chart review. Pregnancy outcomes including gestational weeks at the delivery, abnormal fetal karyotypes, fetal structural anomalies, twin specific complications were analyzed. Results: A total of 1,622 twin pregnancies with INT≥95th percentile in one or both fetuses were identified. In all twin pregnancies with INT, abnormal fetal karyotypes were identified in 17 (8.6%) patients (odds ratio=13.28, CI=5.990-29.447, P=0.000) and twin-specific complications were identified in 23 (11.6%) patients (odds ratio=2.398, CI=1.463-3.928, P=0.001) compared to those with normal NT. Among the INT group, when the groups were subdivided into monochorionic (MC) and dichorionic (DC) pregnancies, 14.8% and 29.6% of the MC pregnancies had structural anomalies in one or both fetuses (odds ratio=5.774, 95% CI=1.445-23.071, P=0.01) and twin-specific complications (odds ratio=4.379, 95% CI=1.641-11.684, P=0.03), respectively, compared to DC pregnancies. The prevalence of abnormal fetal karyotypes was not statistically different in patients with INT when compared between MC and DC pregnancies (P=0.329). Conclusions: INT was associated with a higher rate of twin-specific complications and fetal structural anomalies in MC twin pregnancies rather than abnormal fetal karyotype. Therefore, NT measurement in MC twin pregnancies can be a useful tool for prediction of adverse pregnancy outcomes. Appropriate counseling and surveillance based on the chorionicity is imperative in prenatal care of twin pregnancies.

The chemopreventive effects of various mixed cereal grain (MCG) samples on azoxymethane (AOM, 10 mg/kg) and dextran sulfate sodium (DSS, 2% w/v)-induced colorectal cancer (CRC) in C57BL/6J mice were studied. The main MCG preparation consisted of fermented brown rice (FBR), glutinous brown rice, glutinous Sorghum bicolor, glutinous Panicum miliaceum, Coix lacryma-jobi and black soybean at an appropriate mixing ratio. Other MCG preparations contained rice coated with 5% Phellinus linteus and 5% Curcuma longa (MGR-PC), or 10% Phellinus linteus (MCG-P), or 10% Curcuma longa (MCG-C). Consumption of dietary MCG-PC by CRC mice significantly increased colon length, decreased the ratio of colon weight to length, and reduced the number of colon tumors. Similar effects, although to a lower extent, were observed in CRC mice fed with MCG-P, followed by those fed with MCG-C, MCG, FBR or white rice (WR). MCG-PC significantly suppressed colonic neoplasia, and decreased the levels of various cytokines (tumor necrosis factor: Tnf, interleukin 1 beta: Il1b, interleukin 6: Il6, and interferon gamma: Ifng) in serum and colon tissue of the CRC mice. In addition, MCG-PC increased the mRNA expressions of tumor protein p53(Tp53) and cyclin-dependent kinase inhibitor 1A(Cdkn1a), activated pro-apoptotic caspase 3(Casp3), and reduced expression of both mRNA and protein of inducible inducible nitric oxide synthase 2 (Nos2), prostaglandin-endoperoxide synthase 2 (Ptgs2), and cyclin D1(Ccnd1) in colon tissue. These findings suggest that than compared with other cereal grain preparations, MCG-PC had a greater activity against AOM/DSS-induced CRC by reducing intestinal inflammation, and modulating the expression of certain carcinogenesis related factors (Nos2, Ptgs2, Tp53, Cdkn1a, Ccnd1 and Casp3) in colon tissue of CRC mice.

In recent decades, with the ever-growing scale of video data, near-duplicate videos continue to emerge. Data quality issue caused by near-duplicate videos is becoming more and more prominent, which has affected the application of normal videos. Although current studies on near-duplicate video detection can be helpful to uncover data quality issues for videos, they still lack a process of automatic merging for the video data represented by high-dimensional features, which are difficult to automatically clean the near-duplicate videos to improve data quality for video datasets. At present, there are few studies on near-duplicate video data cleaning. The existing studies have the sensitive problems of video data orderliness and clustering initial center under a condition that prior distribution is unknown, which seriously affect the accuracy of near-duplicate video data cleaning. To address the above issues, an automatic near-duplicate video data cleaning method based on a consistent feature hash ring is proposed in this paper. First, a residual network with convolutional block attention modules, a long short-term memory deep network, and an attention model are integrated to construct an RCLA deep network with the multi-headed attention mechanism to extract spatiotemporal features of video data. Then, a consistent feature hash ring is constructed, which can effectively alleviate the sensitivity of video data orderliness while providing a condition of near-duplicate video merging. To reduce the sensitivity of the initial cluster centers to results of near-duplicate video cleansing, an optimized feature distance-means clustering algorithm is constructed by utilizing a mountain peak function on a consistent feature hash ring, which can implement automatic cleaning of near-duplicate video data. Finally, experiments are conducted based on a commonly used dataset named CC_WEB_VIDEO and a coal mining video dataset. Compared with some existing works, simulation results demonstrate that the performance of the proposed method.

Green products have excellent potential for discovering and producing new medicinal products. In recent years, there is a growing interest towards the green synthesis of metal nanoparticles, particularly from plants sources. This eco-friendly approach was used in the recent research to biosynthesize zinc oxide nanoparticles (ZnO NPs) from Cissus antractica plant. The present study aims to examine the cell cytotoxicity, cell death, and pathways of apoptosis in lung cancer cells (A549) and inflammation properties treated with biosynthesized ZnO NPs. Additionally, synthe-sized ZnO nanoparticles were characterized using UV–vis spectroscopy, X-ray diffraction (XRD), Transmission electron microscopy (TEM), Fourier-transform infrared spectroscopy (FT-IR), and Energy-dispersive X-ray spectroscopy (EDS). The XRD and TEM analyses exhibited 31 nm as the size of synthesized nanoparticles, the pure crystal form of ZnO NPs, and the shape of the NPs as nearly spherical and hexagonal quartzite. The MTT assay used for cytotoxicity evaluation de-picted the significant toxic effect of CA-ZnONPs against the A549 lung cancer cells at concentra-tions up to 20 µg/mL than non-cancerous cells. Furthermore, we observed an elevated ROS level in cancer cells. These NPs also demonstrated dose-dependent ability to suppress colony for-mation and cell migration, which increases their potential as a lung cancer treatment. Further-more, The NPs formulation's ability to induce apoptosis in cancer cells was further supported by Hoechst and propidium iodide dye. Further, CA ZnO NPs increased the gene expression of BAX, Cyto-c, Caspase 3 and 9, but decreased the expression of Bcl-2, indicating that the nanoformulation triggered mitochondrial-mediated apoptosis. Besides, this study showed that NPs suppressed in-flammatory responses by subsequently decreasing reactive oxygen species (ROS) generation, downregulating the expression of the pro-inflammatory cytokines TNF-α, iNOS, COX-2, IL-6, IL-8, and NO. Moreover, the study's findings imply that Cissus antractica are a potential source with biosynthesize nanoparticles that can might be further investigated for the progress of an-ti-inflammatory and anti-cancer drugs with further study.

As climate changes, our daily life has been much influenced by abnormal meteorological phenomena such as heavy rainfall, heat wave, heavy snowfall, and fine dust. Atmospheric air quality is worsening day by day and indoor air quality is also affected by interconnected daily activities throughout the inside and outside of buildings and houses. Nowadays, pollutants from various sources are emitted, transformed by sunlight, vapor, and ozone and transported into the city from country to country. Due to these reasons, there have been high demands to monitor the transportation of particulate matters and improve air quality. Monitoring of pollutants and identification of type and its concentration enables us to track and control its generation and consequently find out the solution. However, monitoring of pollutants, especially, particulate matter generation and its transportation is still not fully operated in atmospheric air due to its open nature and meteorological factors. Even though indoor air is relatively easy to monitor and control than outdoor in the aspect of specific volume and contaminant source, but it still needs to consider the meteorological parameters because indoor air is not fully separated from the outdoor air flow and contaminants transportation. In this study, optical approach using spectral sensor was attempted to reveal the feasibility of wavelength and chromaticity values of reflected light from specific particles. From the analysis of reflected light of various particulate matters according to different liquid additives, parameter studies were performed to investigate which experimental conditions can contribute to the enhanced selective sensing of particulate matters. Five different particulate matters such as household dust, soil, talc powder, gypsum powder and yellow pine tree pollen were utilized and observed to elucidate the relationship between property of particulate matter and detected light spectrum. Applicable approaches to assist current particle matter sensors and improve the selective sensing were suggested.

Background: Angelica gigas Nakai, Korean dang-gui, has long been widely used in traditional treatment methods. There have been a number of studies of the health effects of A. gigas and related compounds, but studies addressing effects on blood triglycerides (TG) are lacking. To investigate the effects of A. gigas Nakai extract (AGNE) on TG in Korean subjects, we carried out a 12-week, randomized, double-blind, placebo-controlled clinical trial. Methods: Subjects who met the inclusion criterion (130 mg/dL ≤ fasting blood TG ≤ 200 mg/dL) were recruited for this study. One hundred subjects were assigned to the AGNE group (n=50) or the placebo group (n=50), who were given 1g/day of AGNE (as a gigas Nakai extract 200mg/d) in capsules, and the control group for 12 weeks. Outcomes were efficacy TG, lipid profiles, atherogenic index, and safety parameters were assessed initially for a baseline measurement and after 12 weeks. Results: After 12 weeks of supplementation, TG and very low-density lipoprotein cholesterol (VLDL-C) concentration and TG/HDL-C ratio in the AGNE group were significantly reduced compared to the placebo group (p <0.05). No significant changes in any safety parameter were observed. Conclusions: These results suggest that ingestion of AGNE may improve TG and be useful to manage or prevent hypertriglyceridemia.

Regulated autophagy is involved in the repair of renal ischemia-reperfusion injury (IRI). ω3-Polyunsaturated fatty acids (ω3-PUFAs) show protective effects against various renal injuries. It was recently reported that ω3-PUFAs regulate autophagy. We assessed whether ω3-PUFAs attenuated IR-induced acute kidney injury (AKI) and evaluated associated mechanisms. C57Bl/6 background fat-1 mice and wild-type mice (wt) were divided into four groups: wt sham (n = 10), fat-1 sham (n = 10), wt IRI (reperfusion 35 min after clamping both the renal artery and vein; n = 15), and fat-1 IRI (n = 15). Kidneys and blood were harvested 24 h after IRI. Renal histological and molecular data were collected. The kidneys of fat-1 mice showed better renal cell survival, renal function, and pathological damage than those of wt mice after IRI. In addition, fat-1 mice showed less oxidative stress and autophagy impairment; greater amounts of LC3, Beclin-1, and Atg7; lower amounts of p62; and higher levels of renal cathepsin D and ATP6E than wt kidneys. They also showed more AMPK activation, which resulted in the inhibition of phosphorylation of the mammalian target of rapamycin (mTOR). Collectively, ω3-PUFAs in fat-1 mice contributed to AMPK mediated autophagy activation, leading to a renoprotective response.

SARS-CoV-2, the newly identified human coronavirus causing severe pneumonia epidemic, was probably originated from Chinese horseshoe bats. However, direct transmission of the virus from bats to humans is unlikely due to lack of direct contact, implying the existence of unknown intermediate hosts. Angiotensin converting enzyme 2 (ACE2) is the receptor of SARS-CoV-2, but only ACE2s of certain species can be utilized by SARS-CoV-2. Here, we evaluated and ranked the receptor-utilizing capability of ACE2s from various species by phylogenetic clustering and sequence alignment with the currently known ACE2s utilized by SARS-CoV-2, predicting potential intermediate hosts of SARS-CoV-2.

An elevated level of endoplasmic reticulum (ER) stress is considered an aggravating factor for inflammatory bowel disease (IBD). To develop an ER stress attenuator that is effective against colitis, 4-phenylbutyric acid (4-PBA), a chemical chaperone that alleviates ER stress, was conjugated with acidic amino acids to yield a 4-PBA-glutamic acid conjugate (PBA-GA) and a 4-PBA-aspartic acid conjugate (PBA-AA). The PBA derivatives were converted to 4-PBA in the cecal contents, where the conversion was greater with PBA-GA. After oral administration of PBA-GA (oral PBA-GA), millimolar levels of PBA were accumulated in the cecum, whereas 4-PBA was not detected in the blood, indicating the targeting of PBA-GA to the large intestine. At concentrations in the cecum achievable by oral PBA-GA, 4-PBA effectively attenuated ER stress in human colon epithelial cells. In 2,4-dinitrobenzenesulfonic acid-induced colitis in rats, oral PBA-GA alleviated the damage and inflammation in the colon. Moreover, oral PBA-GA substantially reduced the elevated levels of ER stress marker proteins in the inflamed colon. Moreover, PBA-GA was as effective as the currently used anti-IBD drug, sulfasalazine. In conclusion, PBA-GA is a colon-targeted prodrug of 4-PBA and is effective against rat colitis probably through the attenuation of ER stress in the inflamed colon.

Objective: The purpose of this study was to determine if Porphyra tenera extract (PTE) has immune-enhancing effects and is safe in healthy adults. Methods: Subjects (3x10³ ≤ peripheral blood leukocyte levels < 8x10³ cells/μl) who met the inclusion criteria were recruited for this study. Enrolled subjects (n=120) were randomly assigned to either the PTE group (n=60) who were given 2.5 g/day of PTE (as Porphyra tenera extract) in capsule form or the placebo group (n=60) who were given crystal cellulose capsules with the identical appearance, weight, and flavor as the PTE capsules for 8 weeks. Outcomes were assessed by measuring natural killer cell (NK-cell) activity, cytokines, and upper respiratory infection (URI), and safety parameters were assessed at baseline and 8 weeks. Results: Compared to baseline, NK cell activity (%) increased for all effector cell to target cell ratios in the PTE group after 8 weeks, but there were no changes in the placebo group (p<0.1). Subgroup analysis of 101 subjects without an URI revealed that NK-cell activity in the PTE group tended to be increased for all E:T ratios (E:T=12.5:1 p=0.068; E:T=25:1 p=0.036; E:T=50:1 p=0.081) compared to the placebo group. There was a significant difference between these two groups for the E:T=25:1 ratio, which increased from 20.3±12.0% at baseline to 23.2±12.4% after 8 weeks in the PTE group (p=0.036). There was no significant difference in levels of cytokines between these two groups. Conclusions: PTE supplementation appears to enhance immune function by improving NK-cell activity without adverse effects in healthy adults.

The objective of this study was to evaluate the effects of dietary supplementation with bacteriophage and β-mannanase on health and growth performance in calves. Thirty-six pre-weaning male Holstein calves were randomly allocated to one of four dietary treatments: no supplementation, 0.1% β-mannanase, 0.1% bacteriophage, and both 0.1% bacteriophage and β-mannanase supplementation in a starter. The experiment lasted from 2 weeks before weaning to 8 weeks after weaning. Twenty-two calves survived to the end of the experiment. No interaction was observed between the two methods of supplementation. A 1-kg increase in initial BW resulted in a 1.41-fold increase in the odds ratio of survival (p < 0.01). The bacteriophage supplementation tended to increase the odds ratio of survival (p = 0.09). The number of Escherichia coli in feces significantly decreased one week after weaning. β-mannanase supplementation increased the concentrates intake (p < 0.01) and tended to increase the final BW (p = 0.08). Analysis of repeated measures indicated β-mannanase supplementation increased weekly body weight gain (p = 0.018). We conclude that bacteriophage supplementation may have a positive effect on calf survival rate, while β-mannanase supplementation may increase the growth rate and intake of a starter in calves.

As renewable energy generation prediction systems have been introduced into the energy trading market, accurate prediction of solar photovoltaic (PV) energy generation has become a crucial challenge for ensuring stable trade of variable energy. Therefore, it is essential to quantitatively investigate and analyze current prediction technology and develop more advanced prediction systems. In this study, three models for predicting PV energy generation were investigated. Multiple regression, random forest, and gradient boosting machine (GBM) models were con-structed for 15 utility-scale power plants throughout South Korea. Model performance was evaluated in terms of root mean square error (RMSE) and mean absolute error (MAE). The multiple regression-based model had an RMSE of 12.00% and MAE of 9.06%. The random forest model had an RMSE of 11.69% and MAE of 8.61%. The GBM model had an RMSE of 11.34% and MAE of 8.18%, indicating its superior accuracy among the three models in predicting PV energy generation. These findings provide valuable insights that may contribute to the development of advanced PV energy generation models and their application in grid operations.

As lung cancer shows the highest mortality in cancer related death, serum biomarkers are demanded for the lung cancer diagnosis and its treatment. To discover lung cancer protein biomarkers, secreted proteins from primary cultured lung cancer and adjacent normal tissues from patients were subjected to LC/MS-MS proteomic analysis. Quescin sulfhydryl oxidase(QSOX1) was selected as a biomarker candidate from the proteins enriched in the secretion of lung cancer cells. QSOX1levels were higher in 82% (51 of 62 tissues) of lung cancer tissues compared to adjacent normal tissues. Importantly, QSOX1 serum levels were significantly higher in cancer patients (p<0.05, AUC=0.89), when measured by multiple reaction monitoring(MRM). Higher levels of QSOX1 are also uniquely detected in lung cancer tissues among several other solid cancers by immunohistochemistry. QSOX1 knock-downed Lewis lung cancer (LLC) cells was less viable from oxidative stress and had reduced migration and invasion. In addition, LLC mouse models with QSOX1 knock-down also proved that QSOX1 functions in promoting cancer metastasis. In conclusion, QSOX1 might be a lung cancer tissue-derived biomarker and involved in the promotion of lung cancers, and thus can be a therapeutic target for lung cancers.

Introduction: This study explored the structural relationship between peer relations, exercise participation satisfaction, exercise commitment, and adherence to intention to exercise among Korean sports club participants. The objective was to offer insights that can enhance intentions for continuous exercise participation. Methods: To fulfill this objective, data were gathered using snowball sampling from teenagers at middle schools in Seoul and Gyeonggi, South Korea, who either currently participate in school sports clubs or have participated in the past. A total of 261 responses were analyzed using frequency, technical statistics, and confirmatory factor, reliability, correlation, and structural equation model analyses. Results: Through these analyses, this study found that peer relationships, exercise participation satisfaction, and exercise commitment were significant as both direct and indirect influences on exercise adherence intentions. Discussion: Intervention strategies should focus on fostering the positive emotions that stem from peer relationships.

Porcine epidemic diarrhea (PED) is a swine wasting disease caused by coronavirus infection. It causes great economic damage to the swine industry worldwide. Despite the continued use of vaccines, PED outbreaks continue, highlighting the need to review the effectiveness of current vaccines and develop additional vaccines based on new platforms. Here, we review existing vaccine technologies for preventing PED and highlight promising technologies that may help control PED virus in the future.

In recent years, Chinese manufacturing enterprises compete to chase the wave of "digital revolution", digital empowerment has become an important strategic path of technological reform for many manufacturing enterprises. Based on the micro data of listed companies, this paper investigates the impact of digital transformation of Chinese listed companies on the quality of their export products. It is found that digital transformation can significantly improve the quality of enterprises' export products. After a series of robustness tests, this conclusion is still valid, and there are two ways to improve innovation performance and total factor productivity. The export product quality enhancement effect of enterprise digital transformation also has the heterogeneity of ownership, region and industry. In the further study, this paper also examines the impact of digital transformation on the internal salary gap of enterprises, and finds that digital transformation may increase the internal salary gap of enterprises, and form a "masking effect" on the quality of export products. To a certain extent, this paper deepens the understanding of the study of enterprise digital transformation on the quality of export products and its differences, and provides certain guidance for enterprises to implement the strategy of digital transformation.

In wireless sensor networks (WSNs), each sensor node can estimate the global parameter from the local data in distributed manner. This paper proposed a robust diffusion estimation algorithm based on minimum error entropy criterion with self-adjusting step-size, which are referred to as diffusion MEE-SAS (DMEE-SAS) algorithm. The DMEE-SAS algorithm has fast speed of convergence and is robust against non-Gaussian noise in the measurements. The detailed performance analysis of the DMEE-SAS algorithm is performed. By combining the DMEE-SAS with diffusion minimum error entropy (DMEE) algorithms, an Improving DMEE-SAS algorithm is proposed, in non-stationary environment where tracking is very important. The Improving DMEE-SAS algorithm can avoid insensitivity of the DMEE-SAS algorithm due to the small effective step-size near the optimal estimator, and obtain a fast convergence speed. Numerical simulations are given to verify the effectiveness and advantages of these proposed algorithms.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

The phenolics concentrations of rapeseed are important because they are antinutritional com-pound or directly positive related to antioxidant actives. In this study, single nucleotide poly-morphisms (SNPs) identified from genotyping-by-sequencing (GBS), and genome-wide associa-tion study of phenolic contents were investigated in 95 rapeseed mutant lines derived from gamma rays and their original cultivar. A total of 3,196,318 SNPs were detected, identifying a set of 70,208 union SNPs used to perform association studies. Six phenolics and glucosinolate (pro-goitrin) were identified, sinapine was the major phenolic compound (91.2–99.2%) in all geno-types. The association study was conducted for six phenolic compounds, progoitrin, total sinap-ine content (TSC), total phenolic content (TPC) and seed yield. The association study identified 241 SNPs that were significantly associated with six phenolic compounds, progoitrin, TSC and TPC. Based on the detected SNP markers, BnaA06g31740D, a gene associated progoitrin, BnaC-nng39930D, a gene associated trans-sinapine 1, BnaA07g31720D, a gene associated trans-sinapine 2, BnaC03g31950D and BnaA06g09180D, a gene associated TSC, and BnaAnng27700D, a gene associ-ated TPC, were selected as candidate genes. The SNP makers associated major phenolic com-pounds identified and could be used as targets for breeding programs aimed at improving anti-oxidant contents and reducing antinutritional components.

Pancreatic cancer has a poor prognosis with its five-year survival rate lower than that of any other cancer type because it is difficult to detect in the early stages. Gemcitabine, a standard treatment for pancreatic cancer, often has poor outcomes for patients as a result of chemoresistance. Therefore, novel therapeutic targets must be identified to overcome gemcitabine-resistance. Here, we found that SLC38A5, a glutamine transporter, is more highly overexpressed in gemcitabine-resistant patients than in gemcitabine-sensitive patients. Furthermore, the deletion of SLC38A5 decreased the proliferation and migration of gemcitabine-resistant PDAC cells. We also found that the inhibition of SLC38A5 triggered the ferroptosis signaling pathway via RNA sequencing. Also, silencing SLC38A5 induced mitochondrial dysfunction and reduced glutamine uptake and glutathione (GSH) levels, and downregulated the expressions of GSH-related genes NRF2 and GPX4. The blockade of glutamine uptake negatively modulated the mTOR-SREBP1-SCD1 signaling pathway. Therefore, suppression of SLC38A5 triggers ferroptosis via two pathways that regulate lipid ROS levels. Similarly, we observed knockdown of SLC38A5 restored gemcitabine sensitivity by hindering tumor growth and metastasis in the orthotopic mouse model. Altogether, our results demonstrated that SLC38A5 could be a novel therapeutic target to overcome gemcitabine-resistance in PDAC therapy.

Background The purpose of this study was to evaluate the prevalence of velamentous cord insertion (VCI) and the actual association between pathologically confirmed VCI and perinatal outcomes in twins based on the chorionicity. Methods All twin pregnancies who received prenatal care at a specialty clinic for multiple pregnancies, from less than 12weeks of gestation until delivery in a single institution between 2015 and 2018 were included in this retrospective cohort study. Results A total of the 941 twins were included in the study. The prevalence of VCI in dichorionic (DC) twins and monochorionic diamniotic (MCDA) twins was 5.8% and 7.8%, respectively (p=0.251). In all study population, the prevalence of vasa previa and placenta accreta were higher in VCI group compared to that of non-VCI group (p=0.008 and 0.022). In MCDA twins with VCI, birth weight, 1 and 5-minute Apgar score were lower compared to DC twins with VCI (p=0.010, 0.002 and 0.000). There was no significant association between VCI and selective fetal growth restriction (p=0.708), twin-to-twin transfusion syndrome (p=0.400) and birth-weight discordance (>20% and >25%) (p= 0.378 and 0.161) in MCDA twins. Conclusion VCI in twins was not a risk factor for adverse perinatal outcomes and twin-specific complications.

Proteomics research has become one of the most important topics in the fields of life science and natural science. At present, research on protein–protein interaction networks (PPINs) mainly focuses on detecting protein complexes or function modules. However, existing approaches are either ineffective or incomplete. In this paper, we investigate function module detection mechanisms in PPIN, including open databases, existing detection algorithms and recent solutions. After that, we describe the proposed solution based on simplified swarm optimization (SSO) algorithm and gene ontology knowledge. The proposed solution implements SSO algorithm for clustering proteins with similar function, and imports biological gene ontology knowledge for further identifying function complexes and improving detection accuracy. Furthermore, we use four different categories of species dataset for experiment: Fruitfly, Mouse, Scere, and Human. The testing and analysis result show that the proposed solution is feasible, efficient and could achieve a higher accuracy of prediction than existing approaches.

To estimate the degree of quantum entanglement, it is important to understand the statistical behavior of functions of spectrum of density matrices such as von Neumann entropy, quantum purity, and entanglement capacity. These entangle- ment metrics over different generic state ensembles have been studied intensively in the literature. As an alternative metric, in this work we study sum of square root spectrum of density matrices, which is relevant to negativity and fidelity in quantum information processing. In particular, we derive the exact mean and vari- ance of sum of square root spectrum over the Bures-Hall generic state ensemble extending known results obtained recently over the Hilbert-Schmidt ensemble.

The KcsA is a prokaryotic potassium-oriented channel, which is sourced from the Streptomyces lividans soil bacteria. From extensive studies that have been carried over the KcsA potassium channel, it has been proved that various factors enable the gating and shuttling of the potassium ions into and out of the cells. Some of the factors include the different concentration of protons in the inside and outside membrane. The other factor is the existence of the selectivity filter equipped in the exit of channel pore, which enables the movement of the K⁺ ions. Not only are potassium ions present in the channel but also sodium ions. Potassium and sodium ions are the ions that are essential in the conductivity of a cell because of their charge. An intuitive idea about why K⁺ ions are at least 10,000 times more permeant than Na⁺ ions is presented in various entities. The hypothesis is that the selectivity ratio is probably related to the successive entry of Na⁺ ions, based on the premise that the ratio seems to be relevant to unpredictable quantities caused by Brownian corrosion of ions.

The article focuses on breast cancer, mammography, and artificial intelligence. First, breast cancer is a widespread health problem that affects millions of people worldwide, and mammography is a widely adopted screening method. Then it introduced the advantages of mammography after AI participation, and introduced the importance of early detection of breast cancer and the application of artificial intelligence in breast cancer detection and treatment. From these aspects extend to the entire medical field of artificial intelligence issues. Several times throughout the paper, ethical issues that could arise from applying AI to healthcare are highlighted. At the end of the article, the paper describes the continued development of AI-based mammography analysis over the next period of time.

Phosphatase and tensin homolog (PTEN) is a negative regulator of the phosphoinositide 3-kinases/protein kinase B (PI3K/AKT) signaling pathway. Notably, its active site harbors a cysteine residue that is susceptible to oxidation by hydrogen peroxide (H2O2). This oxidation inhibits the phosphatase function of PTEN, critically contributing to the activation of the PI3K/AKT pathway. Upon stimulation of cell surface receptors, the activity of NADPH oxidase 2 (NOX2) generates a transient amount of H2O2, serving as a mediator in this pathway by oxidizing PTEN. The mechanism underlying this oxidation, occurring despite the presence of highly efficient and abundant cellular oxidant-protecting and reducing systems, continues to pose a perplexing conundrum. Here, we demonstrate that the presence of bicarbonate (HCO3-) promoted the rate of H2O2-mediated PTEN oxidation, probably through the formation of peroxymonocarbonate (HCO4-), consequently potentiated the phosphorylation of AKT. In essence, our findings consolidate the crucial role of HCO3- in the redox regulation of PTEN by H2O2, lead to the presumption regarding HCO4- as a signaling molecule during cellular physiological processes.

We introduce a novel microscopic image dataset augmented with segmentation and detection labels specifically designed for microplastic analysis in sewage environments. Recognizing the increasing concern over microplastics — particles of synthetic polymers smaller than 5mm — and their detrimental effects on marine ecosystems and human health, our research focuses on enhancing detection and analytical methodologies through advanced computer vision and deep learning techniques. The dataset comprises high-resolution microscopic images of microplastics collected from sewage, meticulously labeled for both segmentation and detection tasks, aiming to facilitate accurate and efficient identification and quantification of microplastic pollution. In addition to dataset development, we present example deep learning models optimized for segmentation and detection of microplastics within complex sewage samples. The models demonstrate significant potential in automating the analysis of microplastic contamination, offering a scalable solution to environmental monitoring challenges. Furthermore, we ensure the accessibility and reproducibility of our research by making the dataset and model codes publicly available, accompanied by detailed documentation on GitHub and LabelBox. The dataset and example deep learning models are publicly available at the following GitHub link. https://anonymous.4open.science/r/Microplastics-in-Sewage-1BEF

The two-scale method (TSM) is an effective approach to simulate electromagnetic (EM) scattering from rough sea surface, to interpret physical interaction of EM wave with rough sea surfaces. The sea surface roughness spectrum and the cutoff wavenumber are two key factors affecting the accuracy of TSM simulation. This paper takes the geophysical model functions (GMFs) of different band as reference, and quantitatively studies the two factors based on the numerical simulation of different polarization backscattering coefficients. The numerical simulation demonstrates that Apel spectrum is more suitable for the backscattering simulation in C/X/Ku-band, and the optimal cutoff wavenumbers are also derived for TSM simulation of EM scattering in C/X/Ku-band. Then an empirical model function of optimal cutoff wavenumbers with respect to frequency, incident angle and wind speed are obtained with regression method. Finally, the simulation results with the new model function of cutoff wavenumber are compared with the GMF and measured data in different bands and they are all consistent. Moreover, a physical explanation for the optimal cutoff wavenumber is also given.

This paper studies a model of dynamic compensation and capital structure with managerial traits. We show that Optimistic manager perceives equity as more undervalued than debt, while, confident manager perceives debt as more undervalued than equity. Managerial risk aversion mitigates manager’s bias. The risk aversion of the optimistic manager has a convex effect on the optimal coupon. There exists the level of risk aversion eliminating the bias on the leverage. The managerial optimist has an ambiguous effect on the owner’s bankruptcy level. The risk aversion has a convex effect on the owner’s bankruptcy level. The optimistic/confident manager underestimates the credit spread. The risk aversion has convex effect on the credit spread. In contrast to rational manager, the optimistic/confident manger has higher level of effort. The risk aversion has a negative effect on the effort.

Bearings are widely used in various types of electrical machinery and equipment. As their core components, failures will often cause serious consequences . At present, most methods of parameter adjustment are still manual adjustment of parameters. This adjustment method is susceptible to prior knowledge and easy to fall into the local optimal solution, failing to obtain the global optimal solution and requires a lot of resources.Therefore, this paper proposes a new method of bearing fault diagnosis based on wavelet packet transform and convolutional neural network optimized by simulated annealing algorithm.The experimental results show that the method proposed in this paper has a more accurate effect in feature extraction and fault classification compared with traditional bearing fault diagnosis methods. At the same time, compared with the traditional artificial neural network parameter adjustment, this paper introduces the simulated annealing algorithm to automatically adjust the parameters of the neural network, thereby obtaining an adaptive bearing fault diagnosis method. To verify the effectiveness of the method, the Case Western Reserve University bearing database was used for testing, and the traditional intelligent bearing fault diagnosis method was compared. The results show that the method proposed in this paper has good results in bearing fault diagnosis. Provides a new way of thinking in the field of bearing fault diagnosis in parameter adjustment and fault classification algorithms

Chronic obstructive pulmonary disease (COPD) is associated with high morbidity and mortality globally. Studies show that airway mucus hypersecretion strongly compromises lung function, leading to frequent hospitalization and mortality, highlighting an urgent need for effective COPD treatments. MUC5AC is known to contribute to severe muco-obstructive lung diseases, worsening COPD pathogenesis. Various pathways are implicated in the aberrant MUC5AC production and secretion MUC5AC. These include signaling pathways associated with mucus-secreting cell differentiation [ nuclear factor-κB (NF-кB)and IL-13-STAT6- SAM pointed domain containing E26 transformation-specific transcription factor (SPDEF), as well as epithelial sodium channel (ENaC) and cystic fibrosis transmembrane conductance regulator (CFTR)], and signaling pathways related to mucus transport and excretion-ciliary beat frequency (CBF). Various inhibitors of mucus hypersecretion are in clinical use but have had limited benefits against COPD. Thus, novel therapies targeting airway mucus hypersecretion should be developed for effective management of muco-obstructive lung disease. Here, we systematically review the mechanisms and pathogenesis of airway mucus hypersecretion, with emphasis on multi-target and multi-link intervention strategies for the elucidation of novel inhibitors of airway mucus hypersecretion.

Perinatal brain injury is a major public health problem burdened with high morbidity, mortality and severe neurological sequelae. Despite advances in neonatal life-saving technologies, neonatal encephalopathy lacks specific and effective treatment. Therefore, mechanisms of central nervous system changes associated with perinatal brain injury have been a hot topic of neonatology research. In recent years, researchers have shifted more focus from neurons themselves to perineuronal cells and intercellular interactions. As a member of the nervous system network, astrocytes are one of the dominant glial cells that regulate ion homeostasis, blood flow, and antioxidant function in the brain. Their changes in molecular mechanisms (e.g., alterations in RNA regulatory networks) during brain injury storms deserve further attention. Non-coding RNAs participate in and promote reactive pathophysiologic changes in astrocytes. The review summarizes and discusses the role of non-coding RNAs in astrocytes in recent years in studies of neonatal brain injury. It focuses on the most studied disease-related ncRNAs: miRNAs, lncRNAs and circRNAs, and hopes to provide possible directions for pathophysiological studies and therapeutic approaches of neonatal brain injury.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

Perilla frutense var. acuta (Lamiaceae) has been used to treat indigestion, asthma, and allergies in traditional medicine. In this study, luteolin 7-O-diglucuronide (1), apigenin 7-O-diglucuronide (2), and rosmarinic acid (3) were isolated from the leaves of P. frutescens var. acuta. Various approaches were performed to investigate the anti-inflammatory activity of the isolated compounds (1-3) and their working mechanisms. In silico docking simulation demonstrated that 1-3 would work as a PPAR-α/δ/γ agonist, and in vitro PPAR-α/δ/γ transcriptional assay showed that the Perilla extract and 3 increased PPAR-α luciferase activity [1.71 and 1.61 times of the control (PPAR-α + PPRE, p < 0.001)]. In the NF-κB luciferase assay, 1 suppressed NF-κB activity the most (56.83 % at 5 µM; 74.96 % at 10 µM; 79.86 % at 50 µM). In addition, 1 and 2 inhibited the mRNA expression of NF-κB target genes, including Il6, Mcp1, and Tnfa, at 50 µM, and 3 suppressed the genes at the mRNA level in a dose-dependent manner. We report that 1 and 2 exert anti-inflammatory effects through NF-κB inhibition, and PPAR-α/NF-κB signaling pathway is related to the anti-inflammatory activity of 3.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

Fe-(9, 19, 28, 37)wt.% Cr alloys were corroded at 700 and 800 ^oC for 70 h under 1 atm of N₂, 1 atm of N₂/3.2%H₂O-mixed gas, and 1 atm of N₂/3.1%H₂O/2.42%H₂S-mixed gas. The corrosion rate of Fe-9Cr alloy increased with the addition of H₂O, and furthermore with the addition of H₂S in N₂ gas. Fe-9Cr alloy was always nonprotective. In contrast, Fe-(19, 28, 37) wt.%Cr alloys were protective in N₂ and N₂/H₂O-mixed gas because of formation of the Cr₂O₃ layer. They were, however, nonprotective in N₂/H₂O/H₂S-mixed gas because sulfidation dominated to form the outer FeS layer and the inner Cr₂S₃ layer containing some FeCr₂S₄.

Pseudolysimachion nakaianum (Ohwi) T.Yamaz. is an endemic species that is an important species in the forest ecosystems of South Korea. This study aimed to develop an in vitro propagation system for P. nakaianum, to enhance the availability of this rare and endemic plant for commercial horticulture and restoration efforts. We utilized cotyledon explants from in vitro germinated seeds and two types of explants (petiole and leaf) from in vitro seedlings to assess the impact of five different cytokinins on adventitious shoot organogenesis in P. nakaianum. The half-strength Murashige and Skoog (MS) medium, supplemented with 10 µM thidiazuron (TDZ) for both cotyledon and petiole explants, yielded the highest shoot induction rates (61.1 ± 9.6% and 26.7 ± 8.8%, respectively) and the greatest number of shoots (3 ± 0.6 and 4.4 ± 0.5, respectively). Responses from leaf explants were variable, with none showing in vitro regeneration. Successfully acclimatized P. nakaianum plantlets in a greenhouse demonstrated normal growth. This protocol outlines an effective method for the direct in vitro regeneration from cotyledon and petiole explants of P. nakaianum, providing valuable information for the conservation of this species.

The study addresses the urgent environmental issue of climate change, focusing specifically on the role of local food, which is produced and consumed locally, helps reduce carbon emissions by eliminating the need for long-distance transportation. Through quantitative analysis, this study elucidates the potential benefits in environmental impact achieved through the consumption of local food: the significant reduction in carbon emissions. Specifically, the consumption of local food is found to yield an annual decrease of 2,421,296 tCO2 emissions, representing 2.5% of South Korea’s total greenhouse gas emissions from the transportation sector. This reduction further translates into an estimated economic value of USD 54.23 million (KRW 70.5 billion). This study underscores the potential of local food consumption as a tangible strategy to overcome environmental problems. Moreover, its academic contribution lies in its comprehensive analysis of the economic and empirical impacts of local food consumption on environment. Moving forward, we propose policies such as supporting local food distribution networks, providing public education on local food, fostering the local food industry, and providing incentives to revitalize local food consumption.

Autonomous vehicles (AVs) may not only reduce parking demand, but also free up on-street parking spaces. From the perspective of bus priority, converting on-street parking lots into dedicated bus lanes can both ensure bus priority and accommodate non-bus traffic, helping to reduce congestion and pollution. In order to study the impact of conversion of on-street parking lots to bus lanes on traffic flow, a microscopic simulation framework based on VISSIM is proposed in this paper. Data was collected using the floating car method and video recording method to quantify the factors affecting traffic flow due to the conversion of on-street parking. The VISSIM simulation model was then calibrated. According to the proportion of the on-street parking lots into a bus lane, the on-street parking lots conversion simulation model of different scenarios was established, and the influence of different on-street parking lots conversion ratio on traffic efficiency and pollution emission was quantitatively analyzed. Finally, the optimization method based on bus lane network connectivity is discussed. The results indicate that: When the on-street parking lots conversion ratio is approximately 100%, bus speed increases by 21.03%, bus delays decrease by 14.27%, and bus parking instances decrease by 11.31%. Total emissions are negatively correlated with vehicle speed. As the conversion rate of on-street parking increases, the emissions of road segments and the entire road network gradually decrease. At a conversion ratio of 100%, the average total emissions for road segments have the highest reduction rate, decreasing by 4.12%. At a conversion ratio of 50%, the average emission total for the road network shows the largest reduction, falling by 2.88%.

In urban areas, deep excavation-induced ground deformation may damage adjacent existing structures and is conventionally evaluated by levelling at installed settlement points. However, a small number of measurements cannot represent the total change in ground deformation adjacent to excavation sites. Furthermore, significant local subsidence may occur in places where settlement points have not been installed and only noticed after an accident. For deep excavation sites located in urban areas, paved pedestrian sidewalks are often located adjacent to sites, and construction activity can cause these paving blocks to displace. This study introduces a method to detect paving block displacement adjacent to deep excavation sites using terrestrial photogrammetry. A digital camera creating point cloud data (PCD) and an acquisition method satisfying the frontal and side overlap requirements were demonstrated. To investigate the displacement detection and measurement capabilities by PCD analysis, an experimental program was conducted, including a PCD comparison containing the uplift, settlement, and horizontal paving block displacement and reference data. The cloud-to-cloud distance computation algorithm was adopted for PCD comparison. Paving block displacement was detected for displacements of 5, 7.5, and 10 mm in the uplift, settlement, and horizontal directions; however, the horizontal displacements were less clear. PCD analysis enabled satisfactory measurements between 0.024 and 0.881 mm for the vertical-displacement cases, but a significant error was observed for the horizontal-displacement cases owing to the cloud-comparison algorithm. The measurement blind spot of limited settlement points was overcome by the proposed method that detected and measured paving block displacement adjacent to excavation sites.

In this work, the Ni/Ti/Nb multilayer composite was successfully manufactured by accumulative pack-roll bonding. The microstructure evolution and mechanical properties of the composite during the accumulative roll bonding (ARB) process were investigated by scanning electron microscopy(SEM), energy dispersive spectrometer(EDS), transmission electron microscopy (TEM), micro-hardness and tensile tests. The results showed that after 5 passes of the ARB process, the deformations of layers were relatively uniform, and no large number of interlayer fractures occurred. The microstructures of Ni and Ti were both equiaxed grains with a grain size of 200 nm and 150 nm, respectively, and finer equiaxed grains of the Ni layer were observed at the interface. The laminar structure of Nb layer was observed. The tensile strength and micro-hardness increased significantly as the number of ARB increased. After 5 passes of the ARB process, the tensile strength of the composite reached 792.3 MPa, and the micro-hardness of Ni, Ti, and Nb were increased to 270.2, 307.4, and 243.4 HV, respectively.

Rapeseed (Brassica napus L.) is one of the most oil crop, and its commercial value is contingent upon its agronomic characteristics and oil quality. In this study, 73,226 single nucleotide polymorphisms (SNPs) across 95 rapeseed mutant lines derived from gamma rays and their original cultivar (‘Tamra’) obtained from genotyping-by-sequencing (GBS) was investigated gene ontology (GO) analysis and genome-wide association study (GWAS). GWAS was conducted on agronomic (plant height, ear length, thousand seed weight and seed yield) and oil (fatty acid and crude fat) traits. GO analysis showed that many genes displaying SNPs were involved in cellular processes, intracellular anatomical structures and organic cyclic compound binding. A total of 149 significant SNPs were associated with the agronomic traits (76 SNPs) and oil traits (73 SNPs). Bna.A05p02350D (SFGH) and Bna.C02p22490D (MDN1) were selected as novel candid genes for thousand seed weight. In addition, Bna.C03p14350D (EXO70) and Bna.A09p05630D (PI4Kα1) were selected as novel candidate genes for the erucic acid and crude fat content, respectively. These findings could facilitate the identification of optimal genotypes for breeding new cultivars, and association studies represent an economically efficient tool for mutant screening and the selection of elite rapeseed-breeding lines.

Strawberry root rot caused by Neopestalotiopsis clavispora is one of the main diseases of strawberry and significantly impacts the yield and quality of strawberry fruit. There are now no effective control techniques available except for fungicide sprays, which may directly impact consumers. Biological control is becoming an alternative method for the control of plant diseases to replace or decrease the application of traditional synthetic chemical fungicides. Trichoderma is widely used as a biological agent for controlling strawberry root rot. In order to provide resources for screening the highly effective biocontrol fungus for controlling strawberry root rot caused by Neopestalotiopsis clavispora, the biocontrol mechanism,the control effects of Trichoderma asperellum CMT10 against strawberry root rot and growth-promoting effects on strawberry seedlings were investigated by plate culture, microscopy observation and root drenching methods.The results showed that CMT10 had obvious competitive, antibiotic and hyperparasitism effects on Neopestalotiopsis clavispora CMGF3. The CMT10 could quickly occupy nutritional space, and the inhibition rates of CMT10 against CMGF3 in confrontation culture on 7 d was 65.49%. The inhibition rates of volatile metabolite and fermentation metabolite produced by CMT10 against CMGF3 were 79.67% and 69.84%, respectively. The mycelium of strain CMT10 can act as hyperparasites by making contacting, winding and penetrating hyphae of CMGF3. Pot experiment showed that the biocontrol efficacy of CMT10 on strawberry root rot caused by Neopestalotiopsis clavispora was 63.00%. CMT10 had obvious promotion effect on strawberry growth, the plant height, root length, total fresh weight, root fresh weight, stem fresh weight and root dry weight, with the promotion rates were 20.09%, 22.39%, 87.11%, 101.58%, 79.82% and 72.33%, respectively. Overall, this study showed the ability of Trichoderma asperellum CMT10 to control strawberry root rot and their potential to develop as novel biocontrol agents to replace chemical fungicides for eco-friendly, sustainable agriculture.

Aim The use of prophylactic antibiotics prior to colorectal surgery reduces surgical site infections. Cefazolin and metronidazole is a standard regimen. Ampicillin-sulbactam may be an alternative, but the data are limited. We compared the efficacy of ampicillin-sulbactam with cefazolin and metronidazole as prophylactic antibiotics. Methods Patients who underwent colorectal surgery at Inha University Hospital between 2010 and 2020 were treated prophylactically with cefazolin and metronidazole or ampicillin-sulbactam, and observed for 30 days following surgery. The primary outcome was surgical site infections. Secondary outcomes were deep/organ infections and the need for drainage. Results SSIs occurred in 2.6% (17/646) of the ampicillin-sulbactam group and was not inferior to the occurrence in the cefazolin and metronidazole group (3.8%, 21/556). There was no significant difference between the two groups in the secondary outcomes. Conclusion Compared with the cefazolin and metronidazole combination, the ampicillin-sulbactam group is non-inferior as a preoperative prophylactic antibiotic regimen for colorectal surgery.

Roses are one of the most important floricultural crops, and their essential oils have long been used for cosmetics and aromatherapy. We investigated the volatile compound compositions of 12 flower-color mutant variants and their original cultivars. Twelve rose mutant genotypes were developed by treatment with 70 Gy of 60Co gamma irradiation of six commercial rose cultivars. Essential oils from the flowers of the 18 genotypes were analyzed by gas chromatography–mass spectrometry. Seventy-seven volatile compounds were detected, which were categorized into five classes: hydrocarbons, terpenoids, alcohols, esters, and others. Hydrocarbons, alcohols, and esters were major components in all rose flowers. The mutant genotypes CR-S8 and CR-S9 showed higher contents of hydrocarbons than the original cultivar. In addition, CR-S1, CR-S3, and CR-S4 mutant genotypes showed higher ester contents than their original cultivar. Nonacosane, 2-methylhexacosane, and 2-methyltricosane were major volatile compounds among all genotypes. Hierarchical cluster analysis of the rose genotypes gave four groups according to grouping among the 77 volatile compounds. These findings will be useful for the selection of rose genotypes with improved volatile compounds.

Hepatic fibrosis is the wound-healing process of chronic hepatic disease that leads to end-stage of hepatocellular carcinoma and demolition of hepatic structures. EMT has been identified to phenotypic conversion of the epithelium to mesenchymal phenotype that occurred during fibrosis. Smad decoy oligodeoxynucleotide (ODN) is a synthetic DNA fragment containing complementary sequence of Smad transcription factor. Thus, this study evaluated the anti-fibrotic effects of Smad decoy ODN on carbon tetrachloride (CCl₄)-induced hepatic fibrosis in mice. As shown in histological results, CCl₄ treatment triggered hepatic fibrosis and increased Smad expression. On the contrary, Smad decoy ODN administration suppressed fibrogenesis and EMT process. The expression of Smad signaling and EMT-associated protein was markedly decreased in Smad decoy ODN treatment mice compared with CCl₄-injuried mice. In conclusion, these data indicate the practicability of Smad decoy ODN administration for preventing hepatic fibrosis and EMT processes.

The hospital indoor environment plays a significant role in shaping the microbial exposures that humans encounter. Resistance to antibiotics is one of the mechanisms employed by bacteria to develop resilience against stress in indoor environments. The extensive usage of antibiotics has been a key factor in driving changes in the ecological function of antibiotic resistance genes (ARGs) and their acquisition by pathogenic bacteria. By integrating the 16S rRNA Illumina sequencing and high throughput-qPCR approaches with water and air dust samples across seven departments at Peking University Shenzhen Hospital, China, this study yielded intriguing findings regarding the department-specific variation, transmission, and correlation of bacteria, ARGs and MGEs within the hospital indoor environment. One notable observation was that the seasonal variation played a vital role in shaping the bacterial composition in the overall hospital indoor environment across seven studied departments. Nevertheless, a similar significant seasonal impact was only observed in the blood test room and emergency departments, rather than in the other five departments. Another intriguing finding was the correlation between ARGs and MGEs abundance. This correlation was evident in the overall hospital indoor environment, which was conversely not found in the emergency, pneumology and gynecology departments. Additionally, while there was no significant relationship that occurred between bacterial communities and ARGs/MGEs within the hospital, the gynecology department demonstrated a close link between bacterial communities and the presence of ARGs/MGEs. Notably, the gynecology department also stood out as an important source of bacteria and ARGs/MGEs for other departments. This study underscores the need for careful surveillance and monitoring of antibiotic resistance, particularly in Legionella spp. in man-made water systems. The findings also show the importance of monitoring and understanding the genetic elements such as Tp614 involved in gene transfer and recombination, as well as their impact on antimicrobial treatment efficacy.

Recently, two respiratory syncytial virus (RSV) vaccines based on the prefusion F (pre-F) antigen were approved in the United States. We developed and validated an enzyme-linked immunosorbent assay (ELISA)-based protocol for the practical and large-scale evaluation of RSV vaccines. Two modified pre-F proteins (DS-Cav1 and SC-TM) were produced by genetic recombination and replication using an adenoviral vector. The protocol was established by optimizing the concentrations of the coating antigen (pre-F proteins), secondary antibodies, and choice of blocking buffer. To validate the protocol, we examined its accuracy, precision, and specificity using serum samples from 150 participants across various age groups and the standard serum provided by the National Institute of Health. In the linear correlation analysis, coating concentrations of 5 and 2.5 μg/mL of DS-Cav1 and SC-TM, respectively, showed high coefficients of determination (r2 = 0.90). Concentrations of secondary antibodies (alkaline phosphatase-conjugated anti-human immunoglobulin G, diluted 1:2000) and blocking reagents (5% skim milk/PBS-T) were optimized to minimize non-specific reactions. High accuracy was observed for DS-Cav1 (r2 = 0.90) and SC-TM (r2 = 0.86). Further, both antigens showed high precision (coefficient of variation &lt; 15%). Inhibition ELISA revealed cross-reactivity of antibodies against DS-Cav1 and SC-TM but not with the attachment protein.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

Focused microwave breast hyperthermia (FMBH) employs a phased antenna array to perform beamforming that can focus microwave energy at targeted breast tumors. Selective heating of the tumor endows the hyperthermia treatment with high accuracy and low side effects. The effect of FMBH is highly dependent on the applied phased antenna array. This work investigates the effect of polarizations of antenna elements on the microwave focusing results by simulations. We explore two kinds of antenna arrays with the same number of elements using different digital realistic human breast phantoms. The first array has all the elements’ polarization in the vertical plane of the breast while the second array has half elements’ polarization in the vertical plane and the other half in the transverse plane, i.e., cross polarization. In total 96 sets of different simulations are performed, and the results show that the second array leads to a better focusing effect in dense breasts than the first array. This work is very meaningful for the potential improvement of the antenna array for FMBH, which is of great significance for the future clinical applications of FMBH. The antenna array with cross polarization can also be applied in micro-wave imaging and sensing for biomedical applications.

According to statistics from the Food and Agriculture Organization, the world population will increase to about 91 million (Asia 51 million, Africa 19 million). A rise in the world’s population means an increased need for food. However, climate change has caused desertification and unpredictable weather, creating problems in the supply and demand of food. Sweet potato (Ipomoea batatas) is an alternative to solving the food problem, as it is one of the world’s most important food crops, especially in developing countries. The tuberous roots of sweet potato are usually used as staple food, animal feed, industrial material, or raw material for alcohol production. In the future, more variations of sweet potato will be needed for breeding this crop. Recently, molecular markers developed for sweet potato have demonstrated good potential for use in genetic selection. In this study, a cDNA library was constructed from the total RNA of sweet potato leaves. A total of 789 copies of the cDNA were cloned in Escherichia coli by employing the pGEM-T Easy vector. Sequencing was carried out by Solgent Co. (Korea). As many as 579 expressed sequence tag–simple sequence repeat (EST-SSR) markers were designed (73.38%) from the known cDNA nucleotide base sequences. The lengths of the developed EST-SSR markers ranged from 100 to 499 bp (average length 238 bp). Their motif sequence types were varied, with most being dinucleotides and pentanucleotides, and the most commonly found motifs were CAGAAT (29.0%) and TCT (2.8%). Based on these SSR-containing sequences, 619 pairs of high-quality SSR primers were designed using WebSat and Primer3web. The total number of primers designed was 144. Polymorphism was evident in 82 EST-SSR markers among 20 Korean sweet potato cultivars tested and in 90 EST-SSR markers in the two parents of a mapping population, Yeseumi and Annobeny. In this study, the hexaploid sweet potato (2n = 6x = 90) EST-SSR markers were developed in the absence of full-sequence data. Moreover, by acting as a molecular tag for particular traits, the EST-SSR marker can also simultaneously identify information about the corresponding gene. These EST-SSR markers will allow the molecular analysis of sweet potato to be done more efficiently. Thus, we can develop high-quality sweet potato while overcoming the challenges from climate change and other unfavorable conditions.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

'Huangguan' pear has significant social and economic value, and phosphorus, as one of the three main mineral elements of plants, has an irreplaceable effect on the normal growth of 'Huangguan' pear trees. The objective of this study was to predict the content of phosphorus in the pulp and peel of ‘Huangguan’ pears nondestructively and conveniently by using near-infrared spectroscopy (900–1700 nm) technology. First, twelve algorithms are used to preprocess the original spectral data, and the partial least squares regression algorithm and the gradient boosting regression tree algorithm are used to build a full-band prediction model based on the original spectral data and the processed spectral data. The characteristic wavelengths were extracted using genetic algorithms, followed by establishing a characteristic wavelength prediction model. The prediction accuracy of the models was evaluated according to the coefficient of determination R² and the relative analysis error RPD. The study found that the best prediction model for predicting phosphorus content in the pulp of 'Huangguan' pear was MSC-GA-PLSR, which had R²=0.843 and RPD=1.857 in the modelling set and R²=0.989 and RPD=7.041 in the prediction set. The best prediction model for predicting phosphorus content in the peel of ‘Huangguan’ pear was SG+SNV+FD-GA-PLSR, which had R²=0.991 and RPD=7.470 in the modelling set and R²=0.974 and RPD=4.414 in the prediction set, and the effect was good and met expectations. The results demonstrated that near-infrared spectroscopy could successfully achieve nondestructive detection of phosphorus content in the pulp and peel of 'Huangguan' pears.

Atherosclerosis (AS) is a chronic progressive disease caused by various factors, and causes various cerebrovascular and cardiovascular diseases (CVDs). Reducing the plasma levels of low-density lipoprotein-cholesterol (LDL-C) is the primary goal in preventing and treating AS. Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) plays a crucial role in regulating LDL-C metabolism. Panax notoginseng has potent lipid-reducing effects and protects against CVDs, and its saponins induce vascular dilatation, inhibit thrombus formation, and are used in treating CVDs. However, the anti-AS effect of the secondary metabolite, 20(S) -protopanaxatriol (20(S)-PPT), remains unclear. In this study, the anti-AS effect and molecular mechanism of 20(S)-PPT were investigated in vivo and in vitro by western blotting, real time-polymerase chain reaction (RT-PCR), Enzyme-linked Immunosorbent Assay (ELISA), immunofluorescence staining, and other assays. The in vitro experiments revealed that 20(S)-PPT reduced the levels of PCSK9 in the supernatant of HepG2 cells, upregulated low density lipoprotein receptor (LDLR) protein levels, promoted LDL uptake by HepG2 cells, and reduced PCSK9 mRNA transcription by upregulating the levels of FoxO3 protein and mRNA and decreasing the levels of HNF1α protein and mRNA. The in vivo experiments revealed that 20(S)-PPT upregulated aortic αSMA expression, increased the stability of atherosclerotic plaques, and reduced aortic plaque formation induced by a high-cholesterol fed in ApoE-/- mice (HCF group). Additionally, 20(S)-PPT reduced the aortic expression of CD68, reduced inflammation in the aortic root, and alleviated the hepatic lesions in the HCF group. The study revealed that 20(S)-PPT inhibited LDLR degradation via PCSK9 to alleviate AS.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

Phosphatase and tensin homolog (PTEN) is a tumor suppressor due to its ability to regulate cell survival, growth and proliferation by down-regulating PI3K/AKT signaling pathway. In addition, PTEN plays an essential role in other physiological events associated with cell growth demands, such as ischemia-reperfusion, nerve injury and immune response. Therefore, recently PTEN inhibition has emerged as a potential therapeutic intervention in these situations. Increasing evidence demonstrates that reactive oxygen species (ROS), especially hydrogen peroxide (H2O2), are produced and required for the signaling in many important cellular processes under such physiological conditions. ROS have been shown to oxidize PTEN at the cysteine residue of its active site, consequently inhibiting its function. Here we provide an overview of studies that highlight the role of oxidative inhibition of PTEN in physiological processes.

As renewable energy generation prediction system has been introduced into the energy trading market, making a model to accurately predict the quantity of solar photovoltaic (PV) energy generation has become a significant problem. Moreover, to encourage an accurate prediction of the quantity of energy generation, an incentive system has been implemented for those who predict the quantity of solar PV energy under the error rate of 8%. Therefore, it has become more important to investigate and analyze current prediction technology numerically and develop more advanced prediction system. In this study, we tried to develop a better model to improve the accuracy of solar PV energy generation quantity by comparing three models made with gradient boosting machine (GBM), Model 1, Model 2, Model 3 respectively. Model 1 was built with the whole training data set without any additional preprocessing. After conducting some additional preprocessing procedure to predict solar energy generation more accurately, we made Model 2 with the whole training data set and Model 3 with only upper 10% of energy generation capacity. To compare the accuracy of three models, normalized mean absolute error (nMAE) was used as an evaluation index. The nMAE of Model 1 was 9.64% while the Model 2 showed 8.41%. Also, Model 3, which was constructed with the training set of upper 10% energy generation capacity, outperformed with the nMAE of 8.08%. For further study, to check the effectiveness of models constructed with GBM, a time series model, autoregressive integrated moving average (ARIMA), was also built and the nMAE was compared.

Rice is an important cereal crop worldwide, the growth of which is affected by rice blast disease, caused by the fungal pathogen Magnaporthe oryzae. As climate change increases the diversity of pathogens, the disease-resistance genes (R genes) in plants must be identified. The major blast-resistance genes have been identified in indica rice varieties; therefore, japonica rice varieties with R genes now need to be identified. Because leucine-rich repeat (LRR) domain proteins possess R-gene properties, we used bioinformatics analysis to identify the rice candidate LRR domain receptor-like proteins (OsLRR-RLPs). OsLRR-RLP2, which contains six LRR domains, showed differences in the DNA sequence, containing 43 single-nucleotide polymorphisms (SNPs) in indica and japonica subpopulations. The results of M. oryzae inoculation analysis indicated that indica varieties with partial deletion of OsLRR-RLP2 showed susceptibility, whereas japonica varieties with intact OsLRR-RLP2 showed resistance. oslrr-rlp2 mutant generated using clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) showed increased pathogen susceptibility, whereas plants overexpressing this gene showed pathogen resistance. These results indicate that OsLRR-RLP2 confers resistance to rice, and OsLRR-RLP2 may be useful for breeding resistant cultivars.

Excessive alcohol consumption is one of the significant causes of morbidity and mortality worldwide. Alcohol is oxidized to toxic and carcinogenic acetaldehyde by alcohol dehydrogenase (ADH) and further oxidized to a non-toxic acetate by aldehyde dehydrogenase (ALDH). Emerging evidence shows that Lactobacillus and Bifidobacterium species encode alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH) mediate alcohol and acetaldehyde metabolism, respectively. This study involves supplementation of Lactobacillus and Bifidobacterium probiotic mixture in humans and assessed their effects on alcohol and acetaldehyde metabolism. Here, twenty-seven wild types (ALDH2*1/*1) and the same number ofheterozygotes (ALDH2*2/*1) were recruited for the study. The enrolled participants were randomly divided into either the probiotic (Duolac ProAP4) or the placebo group. Each group received a probiotic or placebo capsule for 15 days with subsequent crossover. Primary outcomes were measurement of alcohol and acetaldehyde in the blood after the alcohol intake. Blood levels of alcohol and acetaldehyde in the ALDH2 heterozygote group were significantly downregulated in the probiotic-supplemented group with no changes in hangover score symptoms than the placebo group. No clinically significant changes were observed in safety parameters. These results suggest that probiotic has a potential to downregulate the alcohol and acetaldehyde concentrations, and their effects depend on the presence or absence of polymorphism on the ALDH2 gene.

There are several causes of hypoxia during and after surgery, and atelectasis is a common symptom that occurs during surgery. In particular, elderly patients are more vulnerable to hypoxia due to their existing lung diseases or respiratory muscle weakness. This study presents the cases of two elderly patients who developed hypoxia during total hip arthroplasty under general anesthesia. Positive end expiratory pressure, recruitment maneuver, and increased fraction of inspired oxygen improved hypoxia only temporarily, and patients’ oxygen saturation level again dropped to 79%–80%. We suspected that hypoxia was caused by atelectasis and, therefore, re-sumed spontaneous respiration. Thereafter, both the patients showed an improvement in hypoxia. Intraopera-tive hypoxia that is suspected to be caused by atelectasis can be improved by securing sufficient lung volume for respiration through increased muscle tone with spontaneous respiration