The decreasing width, increasing aspect ratio RDL presents significant challenges to design for reliability (DFR) of advanced package. Therefore, this paper proposes a ML based RDL modeling and simulation method. In the method, RDL is divided into blocks and subdivided into pixels of metal percentage, and the RDL is digitalized as tensors. Then, an ANN-based surrogate model is built and trained by a subset of tensors to predict the equivalent material properties of each block. Lastly, all blocks are transformed into elements for simulations. For validation, line bending simulations were conducted on an RDL, with the reaction force as accuracy indicator. The results show that neglecting layout impact causes critical errors as substrate thins. By the method, the reaction force error is 2.81% and the layout impact can accurately be considered with 200×200 elements. For application, the TCT maximum temperature state simulation was conducted on a CPU chip. The simulation indicates that for advanced package the maximum stress more likely occurs in RDL rather than bumps, both RDL and bumps are critical impacted by layouts, and RDL stress is also impacted by vias/bumps. The proposed method precisely concerns layout impacts with little resources, presents an opportunity of efficiency improvement.

As the world endures the coronavirus disease 2019 (COVID-19) pandemic, conditions of 35 million vulnerable individuals struggling with substance use disorders (SUDs) worldwide have not received sufficient attention for their special health and medical needs. Many of these individuals are complicated by underlying health conditions, such as cardiovascular and lung diseases and undermined immune systems. During the pandemic, access to the healthcare systems and support groups is greatly diminished. Current research on COVID-19 has not addressed the unique challenges facing individuals with SUDs, including the heightened vulnerability and susceptibility to the disease. In this systematic review, we will discuss the pathogenesis and pathology of COVID-19, and highlight potential risk factors and complications to these individuals. We will also provide insights and considerations for COVID-19 treatment and prevention in patients with SUDs.

Many neurodegenerative diseases are characterised by impairment of protein quality control mechanisms in neuronal cells. Ineffective clearance of misfolded proteins by the proteasome, autophagy pathways and exocytosis leads to accumulation of toxic protein oligomers and aggregates in neurons. Toxic protein species affect various cellular functions resulting in the development of a spectrum of different neurodegenerative proteinopathies, including Huntington’s disease (HD). Playing an integral role in proteostasis, dysfunction of the ubiquitylation system in HD is progressive and multi-faceted with numerous biochemical pathways affected, in particular the ubiquitin proteasome system and autophagy routes for protein aggregate degradation. Unravelling the molecular mechanisms involved in HD pathogenesis of proteostasis provides insight in disease progression in HD as well as possible therapeutic avenues. Recent developments of potential therapeutics are discussed in this review.

Next-generation sequencing (NGS) has actualized human papillomavirus (HPV) virome profiling for in-depth investigation of viral evolution and pathogenesis. However, viral computational analysis remains a bottleneck due to semantic discrepancies between computational tools and curated reference genomes. To address this, we developed and tested automated workflows for HPV taxonomic profiling and visualization using a customized Papillomavirus database in CLC Microbial Genomics Module. HPV genomes from Papilloma Virus Episteme were customized and incorporated into CLC “ready-to-use” workflows for stepwise data processing to include: 1) Taxonomic Analysis, 2) Estimate Alpha/Beta Diversities, and 3) Map Reads to Reference. Low-grade (n = 95) and high-grade (n = 60) Pap smears were tested with ensuing collective runtimes: Taxonomic Analysis (36 min); Alpha/Beta Diversities (5 sec); Map Reads (45 min). Tabular output conversion to visualizations entailed 1-2 keystrokes. Biodiversity analysis between low- (LSIL) and high-grade squamous intraepithelial lesions (HSIL) revealed loss of species richness and gain of dominance by HPV-16 in HSIL. Integrating clinically relevant, taxonomized HPV reference genomes within automated workflows proved to be an ultra-fast method of virome profiling. The entire process named “HPV DeepSeq” provides a simple, accurate and practical means of NGS data analysis for a broad range of applications in viral research.

Surface urban heat island (SUHI) depicts the deteriorating thermal environment in high-density cities and local climate zone (LCZ) classification provides a universal protocol for SUHI identification. In this study, taking the central urbanized area of Guangzhou in the humid subtropical region of China as the study area, the maps or images of LCZ, land surface temperature (LST), SUHI and urban design factors were achieved by using Landsat satellite data, GIS database and a series of retrieval and classification algorithms, and the urban design factors influencing SUHI were investigated based on 625 samples of LCZs. The results show that in the summer daytime under the clear sky condition, the LST varied greatly from 26 °C to 40 °C and the SUHI changed in a wide range of -6 °C to 8 °C in the LCZs of the study area. Seven and five urban design factors influencing the summer daytime SUHI were identified for the two dominant LCZ of LCZs 1-5 (LCZ 1 to LCZ 5) and the mixed LCZ (containing at least three types of LCZs), respectively. The summer daytime SUHI prediction models were obtained by using the step-wise multiple linear regression, with the performance of R2 of 0.697, RMSE of 1.21 °C, and the d value of 0.81 for the model of LCZs 1-5, and the values of 0.666, 1.66 °C, and 0.76 for the model of the mixed LCZ, indicating that the models can predict the changes of SUHI with LCZs to a large and satisfactory extent. This study presents a methodology to efficiently achieve a large sample of SUHI and urban design factors of LCZs in the largely urbanized cities, and provides information beneficial to the urban designs and regenerations in the humid subtropical region.

In the context of carbon neutrality and carbon peaking, in order to achieve low carbon emissions and promote the efficient utilization of wind energy, hydrogen energy as an important energy carrier is proposed to mix hydrogen and natural gas to form hydrogen enriched compressed natu-ral gas (HCNG). It is also injected into the natural gas pipeline network to realize the transmission and utilization of hydrogen energy. At the same time, the participation of demand response is considered, the load peak and trough period is adjusted, and large-scale consumption of renewa-ble energy and the reduction of carbon emissions are realized. First of all, a fine model of hydro-gen production and hydrogen use equipment is established to analyze the impact of adding hy-drogen mixing on the economy and low-carbon of the system. With green certificates and demand response, the utilization rate of hydrogen energy is improved to further explore the energy utiliza-tion rate and emission reduction capacity of the system. Secondly, on the basis of modeling, the optimal scheduling strategy is proposed with the sum of energy purchase cost, equipment opera-tion cost, carbon emission cost, wind curtailment cost and green certificate income as the lowest objective function. Considering the constraints such as hydrogen blending ratio and flexible load ratio of the pipeline network, a low-carbon economic scheduling model of hydrogen mixed natu-ral gas was established. The model was linearized and solved by using MATLAB and CPLEX solver. By comparing different scenarios, the superiority of the model and the effectiveness of the strategy are verified.

The field of mitochondrial genomics has advanced rapidly and revolutionized disciplines from molecular anthropology, population genetics, to medical/oncogenetics. However, mtDNA next-generation sequencing (NGS) analysis for matrilineal haplotyping and phylogeographic inference remains hindered by the lack of a consolidated, mitogenome database and efficient bioinformatics pipeline. To address this, we developed a customized human mitogenome database (hMITO DB) embedded in a CLC Genomics workflow for read mapping, variant analysis, haplotyping, and geo-mapping. The database was constructed from 4,286 mitogenomes. The macro-haplogroup (A to Z) distribution and representative phylogenetic tree were found consistent with published literature. The hMITO DB automated workflow was tested using mtDNA-NGS sequences derived from Pap smears and cervical cancer cell lines. The auto-generated read mapping, variants track, and table of haplotypes and geo-origins were completed in 15 min for 47 samples. The mtDNA workflow proved to be a rapid, efficient and accurate means of sequence analysis for translational mitogenomics.

With the development of energy internet, integrated energy system can effectively reduce carbon emissions and improve the utilization of renewable energy. In this paper, a low-carbon optimal scheduling model of integrated energy system considering heat loss of heat network pipeline is proposed. Based on the study of concentrating solar power (CSP) plant and heat storage tank (HS), an optimal scheduling model is established, which takes system operation cost, environmental pollution and penalty cost of abandoning wind and solar energy as objectives. Through the analysis of example results, it is proved that the model proposed in this paper can achieve the goal of reliable, low-carbon and economic operation of the system. At the same time, it shows that CSP unit can reduce the operation cost of system and increase energy coupling and utilization.

This pioneering study presents an in-depth biomechanical examination of soccer's diving header, aiming to quantify its impact on ball speed enhancement (BSE) and effective offensive range (EOR). Despite the diving header's widespread acclaim and historical significance, there remains a dearth of scientific scrutiny into its biomechanical intricacies. Employing an innovative research design featuring a static hanging ball at varied offensive distances and heights, the study replicates diverse header scenarios. The results of 3D motion quantification have shown that a physically excellent player (identified through the maximal standing long jump test) could reach an EOR around 2.64 times his body height. Furthermore, the study unveils that proficient players could attain BSE surpassing 9 m/s, signifying the diving header's heightened efficacy compared to traditional heading techniques, which could only result in 4.5 m/s. Correlation analyses unveil noteworthy relationships, highlighting the pivotal role of head speed at impact and the influence of minimizing speed-drop and temporal disparities for amplified effectiveness. Considerations for optimizing diving header execution are introduced, emphasizing the necessity for targeted training programs. Despite acknowledged limitations inherent to its pilot nature, this exploration furnishes foundational knowledge to guide subsequent research and practical applications, providing valuable insights into soccer training and skill development through a biomechanical lens.

Surimi-based products occupy an important position in the aquatic product processing industry. To enhance the quality and flavor of surimi-based products, the effects of pre-emulsified safflower seed oil on the texture, water-holding capacity (WHC), microstructure, and flavor of Nemipterus virgatus surimi gel was evaluated. The texture and whiteness of gel were improved, and the WHC increased (P < 0.05) as the content of safflower seed oil increased up to 2 mL per 100 g surimi. Furthermore, the drops of pre-emulsified safflower seed oils with an average diameter of less than 0.10 μm were evenly distributed in gel matrix. Microstructure and infrared spectroscopy analyses indicated that low-content pre-emulsified safflower seed oil acted as filler particles to occupy void spaces, resulting in gel exhibiting a dense network structure. Volatile analysis showed the gel containing pre-emulsified oil enriched volatile compounds, mainly resulting from oxidation and decomposition of oils by the activation of lipoxygenase, which synergistically contributes to unique flavors of gel. Consequently, low-content pre-emulsified safflower seed oil can used to enhance the quality and flavor of N. virgatus surimi-based products. These findings are especially relevant to the current growing interest in low-fat and high-protein diets.

To address the requirements of sonar imaging, such as high receiving sensitivity, wide bandwidth, wide receiving angle, an AlN PMUT with an optimized ratio of 0.6 for the piezoelectric layer diameter to backside cavity diameter is proposed in this paper. A sample AlN PMUT is designed and fabricated with SOI substrate-based bulk MEMS process. The characterization test result of the sample demonstrates a -6 dB bandwidth of approximately 500 kHz and a measured receiving sensitivity per unit area of at 1.37 V/μPa/mm2, which significantly surpasses the performance of previously reported PMUTs. The -6 dB horizontal angles of the AlN PMUT at 300 kHz and 500 kHz are measured 68.30° and 54.24°, respectively. To achieve an accurate prediction of its characteristics when being packaged and assembled in a receive array, numerical simulations with the consideration of film stress are conducted. The numerical result shows a maximum deviation of ±7% in the underwater receiving sensitivity across the frequency range of 200 kHz to 1000 kHz and a deviation of about 0.33% in the peak of underwater receiving sensitivity comparing to the experimental data. By such good agreement, the simulation method reveals its capability of providing theoretical foundation for enhancing the uniformity of the AlN PMUTs in future studies.

Federated Distillation (FD) has recently attracted increasing attention for its efficiency in aggregating multiple diverse local models trained from statistically heterogeneous data of distributed clients. Existing FD methods generally treat these models equally by merely computing the average of their output soft predictions for some given input distillation sample, which does not take the diversity across all local models into account, thus leading to degraded performance of the aggregated model, especially when some local models learn little knowledge about the sample. In this paper, we propose a new perspective that treats the local data in each client as a specific domain and design a novel domain knowledge aware federated distillation method, dubbed DaFKD, that can discern the importance of each model to the distillation sample, and thus is able to optimize the ensemble of soft predictions from diverse models. Specifically, we employ a domain discriminator for each client, which is trained to identify the correlation factor between the sample and the corresponding domain. Then, to facilitate the training of the domain discriminator while saving communication costs, we propose sharing its partial parameters with the classification model. Extensive experiments on various datasets and settings show that the proposed method can improve the model accuracy by up to $6.02\%$ compared to state-of-the-art baselines.

Genome-scale metabolic model (GEM) is a powerful tool for interpreting and predicting cellular phenotypes under various environmental and genetic perturbations. However, GEM only consid-ers stoichiometric constraints, and the simulated growth and product yield values will show a monotonic linear increase with increasing substrate uptake rate, which deviates from the experi-mentally measured values. Recently, the integration of enzymatic constraints into stoichiometry-based GEMs was proven to be effective in making novel discoveries and predicting new engineer-ing targets. Here we present the first genome-scale enzyme-constrained model (eciCW773) for Corynebacterium glutamicum reconstructed by integrating enzyme kinetic data from various sources using ECMpy workflow based on the high-quality GEM of C. glutamicum (obtained by modifying the iCW773 model). The enzyme-constrained model improved the prediction of pheno-types and simulated overflow metabolism, while also recapitulating the trade-off between biomass yield and enzyme usage efficiency. Finally, we used eciCW773 to identify several gene modifica-tion targets for L-lysine production, most of which agree with previously reported genes. This study shows that incorporating enzyme kinetic information into the GEM enhances the cellular phenotypes prediction of C. glutamicum, which can help identify key enzymes and thus provide reliable guidance for metabolic engineering.

In recent years, the AHRS has become an important research area. In order to improve the orientation measurement accuracy of AHRS, this paper first expounds the algorithm principle of the AHRS. Then, aiming at the problem of poor stability of the traditional gradient descent method under high dynamics or large magnetic field interference, a gain-scheduled anti-interference AHRS orientation algorithm is designed. By using the switching architecture designed with this algorithm for gain scheduling, it can ensure stable performance while being subjected to apparent acceleration and ferromagnetic interference. Finally, experimental verification is conducted, and the experimental results show that: in the presence of interference, the roll angle error is 0.0350°, the pitch angle error is 0.0277°, and the yaw angle error is 0.9611°, thereby verifying the strong anti-interference performance of the gain-scheduled AHRS orientation algorithm proposed in this paper.

To mitigate the interference of waves on offshore operation vessels, heave compensation systems find widespread application. The performance of heave compensation systems significantly influences the efficiency and safety of maritime operations. This paper establishes a mathematical model for winch-based active heave compensation system. It introduces a three-loop active disturbance rejection control (ADRC) strategy encompassing piston position control, winch speed control, and load displacement control, enabling real-time estimation and compensation of system disturbances, thereby enhancing the performance of the heave compensation system. To assess the effectiveness of this control strategy, the study employs Matlab/Simulink and AME Sim to construct a co-simulation model and conducts a comparative analysis with traditional PID control systems. The research findings indicate that the three-loop ADRC position control strategy consistently delivers superior compensation performance across various operational scenarios.

The radar sensor described realizes healthcare monitoring capable of detecting subject chest-wall movement caused by cardiopulmonary activities, and wirelessly estimating the respiration and heartbeat rates of the subject without attaching any devices to the body. Conventional single-tone Doppler radar can only capture Doppler signatures because of a lack of bandwidth information with noncontact sensors. In contrast, we take full advantage of impulse radio ultra-wideband (IR-UWB) radar to achieve low power consumption and convenient portability, with a flexible detection range and desirable accuracy. A noise reduction method based on improved ensemble empirical mode decomposition (EEMD) and a vital sign separation method based on the continuous-wavelet transform (CWT) are proposed jointly to improve the signal-to-noise ratio (SNR) in order to acquire accurate respiration and heartbeat rates. Experimental results illustrate that respiration and heartbeat signals can be extracted accurately under different conditions. This noncontact healthcare sensor system proves the commercial feasibility and considerable accessibility of using compact IR-UWB radar for emerging biomedical applications.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A probabilistic description is essential for understanding the dynamics of stochastic systems far from equilibrium. To compare different Probability Density Functions (PDFs), it is extremely useful to quantify the difference among different PDFs by assigning an appropriate metric to probability such that the distance increases with the difference between the two PDFs. This metric structure then provides a key link between stochastic processes and geometry. For a non-equilibrium process, we define an infinitesimal distance at any time by comparing two PDFs at times infinitesimally apart and sum these distances in time. The total distance along the trajectory of the system quantifies the total number of different states that the system undergoes in time and is called the information length. By using this concept, we investigate classical and quantum systems and demonstrate the utility of the information length as a unique Lagrangian diagnostic to quantify the information change as a system continuously evolves in time and to map out attractor structure. We further elucidate quantum effects (uncertainty relation) and the dual role of the width of PDF in quantum systems.

The plant Allium hookeri, belonging to the Allium genus, has a history of being used both as a common food ingredient and in herbal medicine. It has recently been reported to have anti-oxidant and anti-inflammatory effects. A. hookeri has been also shown to exhibit neuroprotective and anti-neuroinflammatory activities, but the active compounds responsible for these effects have not been identified in previous studies. This study aimed to perform a metabolite profiling using an HRESI-qTOF MS/MS-based molecular networking approach and identify the active compounds from A. hookeri that target senescent cell-associated secretory phenotype (SASP) inhibitory effects, which contribute to neuroprotective activities. As a result, ten compounds, including one new flavonoid (2) and nine known compounds (1 and 3–10), were identified, and their biological activity was tested. The most potent compound was N-trans-feruloyltyramine (7), which inhibited SASP markers and contributed to the senomorphic activities of A. hookeri. These findings suggest that the phenolamides from A. hookeri could be a promising source of bioactive compounds for preventing senescence-associated diseases.

In recent decades, porous scaffolds for bone tissue engineering (BTE) have gained significant attention. Considerable research efforts have been dedicated to investigating the impact of scaffold pore size on a diverse array of biological processes, including cell-scaffold interactions, substance transportation, and vascularization. However, the multi-scale hierarchical porosity, a key structural characteristic of natural bone, has rarely been replicated in BTE scaffolds due to the challenges of controlling the scaffold structure across multiple length scales. With the advancement of manufacturing technology, there has been increasing research on biomimetic multi-scale hierarchical materials, which are also gaining favor in the field of BTE. Therefore, there is an urgent need to review multi-scale hierarchical porous BTE scaffolds. This paper aims to review the role and fabrication methods of multi-scale porous BTE scaffolds at different length scales, the design and manufacturing of new BTE scaffolds for bone regeneration.

Functional connectivity (FC) is a potential candidate that can increase the performance of brain-computer interfaces (BCIs) in the elderly because of its compensatory role in neural circuits. However, it is difficult to decode FC by current machine learning techniques because of a lack of its physiological understanding. To investigate the suitability of FC in BCI for the elderly, we propose the decoding of lower- and higher-order FCs using a convolutional neural network (CNN) in six cognitive-motor tasks. The layer-wise relevance propagation (LRP) method describes how age-related changes in FCs impact BCI applications for the elderly compared to younger adults. Seventeen younger (24.5±2.7 years) and twelve older (72.5±3.2 years) adults were recruited to perform tasks related to hand-force control with or without mental calculation. CNN yielded a six-class classification accuracy of 75.3% in the elderly, exceeding the 70.7% accuracy for the younger adults. In the elderly, the proposed method increases the classification accuracy by 88.3% compared to the filter-bank common spatial pattern (FBCSP). LRP results revealed that both lower- and higher-order FCs were dominantly overactivated in the prefrontal lobe depending on task type. These findings suggest a promising application of multi-order FC with deep learning on BCI systems for the elderly.

The new regulation was introduced to the franchise market of South Korea in that an applicant who wants to be a franchiser must set up direct retail stores and run them for at least one year before recruiting franchisees. Considering the purpose of the regulation, it is inferred that once franchisers run their own stores, their franchisees would be better off than otherwise. This paper addresses one reason that the Korea Fair Trade Commission has no choice but to introduce the regulation. Along the line, this paper investigates whether franchisees would have the more likelihood to make profit in the case of that franchisers operate their own stores. The result demonstrates that this case could be true since the operation of franchiser owned stores could be helpful in reducing cost of franchisees.

The NF-κB (nuclear factor K-light-chain-enhancer of activated B cells) transcription factor family is critical for modulating the immune proinflammatory response throughout the body. During the resting state, inactive NF-κB is sequestered by IκB in the cytoplasm. Proteasomal degradation of IκB activates NF-κB, mediating its translocation into the nucleus to act as a nuclear transcription factor in the upregulation of proinflammatory genes. Stimuli that initiate NF-κB activation are diverse, but are canonically attributed to proinflammatory cytokines and chemokines. Downstream effects of NF-κB are cell type specific and, in the majority of cases, result in activation of pro-inflammatory cascades. Acting as the primary immune responders of the central nervous system, microglia exhibit upregulation of NF-κB upon activation in response to pathological conditions. Under such circumstances, microglial crosstalk with other cell types in the central nervous system can induce cell death, further exacerbating the disease pathology. In this review, we will emphasize the role of NF-κB in triggering neuroinflammation mediated by microglia.

In order to understand the effect of Pb-CuI co-doping on the thermoelectric performance of Bi₂Te₃, n-type Bi₂Te₃ co-doped with x at% CuI and 1/2x at% Pb (x = 0, 0.01, 0.03, 0.05, 0.07, and 0.10) were prepared via high temperature solid state reaction and consolidated using spark plasma sintering. Electron and thermal transport properties, i.e., electrical conductivity, carrier concentration, Hall mobility, Seebeck coefficient, and thermal conductivity, of CuI-Pb co-doped Bi₂Te₃ were measured in the temperature range from 300 K to 523 K and compared to corresponding x% of CuI-doped Bi₂Te₃ and undoped Bi₂Te₃. The addition of a small amount of Pb significantly decreased the carrier concentration, which could be attributed to the holes from Pb atoms, thus the CuI-Pb co-doped samples show a lower electrical conductivity and a higher Seebeck coefficient compared to CuI-doped samples with similar x values. The incorporation of Pb into CuI-doped Bi₂Te₃ rarely changed the power factor because of the trade-off relationship between the electrical conductivity and the Seebeck coefficient. The total thermal conductivity(κ_tot) of co-doped samples (κ_tot ~1.4 W/m∙K at 300 K) is slightly lower than that of 1% CuI-doped Bi₂Te₃ (κ_tot~1.5 W/m∙K at 300 K) and undoped Bi₂Te₃ (κ_tot ~1.6 W/m∙K at 300 K) due to the alloy scattering. The 1% CuI-Pb co-doped Bi₂Te₃ sample shows the highest ZT value of 0.96 at 370 K. All data on electrical and thermal transport properties suggest that the thermoelectric properties of Bi₂Te₃ and its operating temperature can be controlled by co-doping.

Precision metagenomic approaches using Oxford Nanopore Technology (ONT) sequencing has been shown to allow recovery of complete genomes of Escherichia coli O157:H7 from overnight enrichments of agricultural waters. This study tests the applicability of a similar approach for Cronobacter genome recovery from powdered infant formula (PIF) overnight enrichments, where Cronobacter typically dominates the overall microbiome (>90%). In this study, we aimed to test whether using ONT sequencing of overnight PIF enrichments could recover a completely closed Cronobacter genome for further genomic characterization. Ten PIF samples, each inoculated with different Cronobacter strains, covering Cronobacter sakazakii, C. muytjensii, C. dublinensis, C. turicensis, and C. universalis, were processed according to the Bacteriological Analytical Manual (BAM) protocol. qPCR was used for initial screening (detection and quantification) of the overnight enrichments and confirmed that the spiked PIF samples after the overnight enrichment have high levels of Cronobacter (107 to 109 CFU/mL). DNA from overnight PIF enrichments was extracted from the enrichment broth and sequenced using ONT. Results showed that ONT sequencing could accurately identify, characterize, and close the genomes of Cronobacter strains from overnight PIF enrichments in 3 days, much faster than the nearly two weeks required by the current BAM method. Complete genome recovery and species differentiation were achieved. This suggests that combining qPCR with ONT sequencing provides a rapid, cost-effective alternative for detecting and characterizing Cronobacter in PIF, enabling timely corrective actions during outbreaks.

The protein extract of Ulva australis hydrolyzed with alcalase and flavourzyme investigated multi-functional properties, including total antioxidant capacity (TAC), collagenase inhibitory and antibacterial activities. The #5 fraction (SP5) and #7 fraction (SP7) of U. australis hydrolysate from cation-exchange chromatography showed significantly high TAC, collagenase inhibitory and antibacterial effects against Propionibacterium acnes, and only Q3 fraction from anion-exchange chromatography showed high multi-functional activities. The eight peptides among 42 peptides identified by MALDI-TOF/MS and Q-TOF/MS/MS were selected from the results to screen molecular docking on target proteins, and were synthesized. Thr-Gly-Thr-Trp (TGTW) showed ABTS [2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] radical scavenging activity. Effect TAC as Trolox equivalence was dependent on the concentration of TGTW. The Asn-Arg-Asp-Tyr (NRDY) and Arg-Asp-Arg-Phe (RDRF) possessing collagenase inhibitory activity increased according to the increase of concentration and the IC50 values of them were 0.95 mM and 0.84 mM, respectively. Peptides, RDRF and His-Ala-Val-Tyr (HAVY) showed anti-P. acnes effects with IC50 values of 8.57 mM and 13.23 mM, respectively. These results suggest that the U. australis hydrolysate could be a resource for the application of effective nutraceuticals and cosmetics.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

The attitude dynamics and orbit dynamics of large rigid space structures are coupled with each other under gravity gradient, which may affect the stability of the large rigid space structures. In this paper, the gravity gradient stability of a large rigid space structure is studied under both small and large disturbances. Based on the rigid body dynamics and orbit dynamics, an accurate dynamic model without any linearization of the large rigid space structure is established via the natural coordinate formulation (NCF), which is able to describe the large overall motions of the structures. By using the generalized-α algorithm, the gravity gradient stability of the large rigid space structure is simulated and analyzed via various examples, including the influence of large disturbance angles, the positions at the stabilization and unstabilization regions. Finally, the relationship between spinning stability and gravity gradient stability is also investigated via a large spinning space structure.

We explored the dynamics of the two interacting information systems. We show that for the Markovian marginal systems the driving force for information dynamics is determined by both the information landscape and information flux. While the information landscape can be used to construct the driving force to describe the equilibrium time reversible information system dynamics, the information flux can be used to describe the nonequilibrium time-irreversible behaviours of the information system dynamics. The information flux explicitly breaks the detailed balance and is a direct measure of the degree of the nonequilibriumness or time irreversibility. We further demonstrate that the mutual information rate between the two subsystems can be decomposed into the equilibrium time-reversible and nonequilibrium time-irreversible parts respectively. This decomposition of the mutual information rate (MIR) corresponds to the information landscape-flux decomposition explicitly when the two subsystems behave as Markov chains. Finally, we uncover the intimate relationship between the nonequilibrium thermodynamics in terms of the entropy production rates and the time-irreversible part of the mutual information rate. We found that this relationship and MIR decomposition still hold for the more general stationary and ergodic cases. We demonstrate the above features with two examples of the bivariate Markov chains.

This paper proposed a triangular inequality-based rewiring method for the Rapidly exploring Random Tree (RRT)-Connect robot path-planning algorithm that guarantees the planning time compared to the RRT algorithm, to bring it closer to the optimum. To check the proposed algorithm’s performance, this paper compared the RRT and RRT-Connect algorithms in various environments through simulation. From these experimental results, the proposed algorithm shows both quicker planning time and shorter path length than the RRT algorithm and shorter path length than the RRT-Connect algorithm with a similar number of samples and planning time.

Muscle fatigue caused by using staplers affects the surgical procedures of surgeons. Compared to manual staplers, electric staplers decrease the muscle fatigue by replacing repeated gripping and releasing with automatic model. Still powered by the battery, the electric staplers are confronted with new operation fatigue due to the extra weight of the battery. The weight and manual operation of the electric stapler can cause user's muscle fatigue. To tackle the unsettled fatigue issue, the study is to propose a new design method to offset the influence of extra weight of the battery attached to the electrical stapler by changing the opening and closing of the stapler end clamp to electric control. The purpose of this study is to verify whether the design of this electric stapler can offset the impact of weight. Experiments are set up to test the feasibility of the design on 12 male Chinese surgeons. The muscle fatigue is indicated by measuring the EMG (electromyography) signal, and the stapler's working effect is indicated by measuring the end movement of the stapler. The result shows the new-designed stapler reduce the operation fatigue, counteracting the impact of the battery weight.

Urbanization is considered as a main indicator of regional economic development due to its positive effect on promoting industrial development; however, many regions, especially developing countries, are troubled by its negative effect — the aggravating environmental pollution. Many researchers have indicated that rapid urbanization stimulated the expansion of industrial production scale and increased industrial pollutant emissions. However, this judgement contains a grave deficiency in that urbanization not only expands industrial production scales but can also increase industrial labour productivity and change the industrial structure. To modify this deficiency, we first decompose the influence which urbanization impacts on industrial pollutant emissions into the scale effect, the intensive effect and the structure effect by using the Kaya Identity and the LMDI Method; second, we perform an empirical study of the three effects’ impacts by applying the spatial panel model with data from 282 Chinese cities between 2003 and 2013. Our results indicate that (1) there are significant reverse U-shapes between Chinese urbanization rate and its industrial pollutant emissions; (2) the scale effect and the structure effect have aggravated Chinese industrial waste water discharge, sulphur dioxide emissions and soot (dust) emissions, while the intensive effect has generated a decreasing and ameliorative impact on that aggravated trend. The definite relationship between urbanization and industrial pollutant emissions depends on the combined influence of the scale effect, the intensive effect and the structure effect; (3) there are significant spatial autocorrelations of industrial pollutant emissions between Chinese cities, but the spatial spillover effect from other cities does not aggravate local urban industrial pollutant emissions, we offer an explanation to this contradiction that the vast rural areas surrounding Chinese cities have served as sponge belts and have absorbed the spatial spillover of cities’ industrial pollutant emissions. According to the results, we argue that this type of decomposition of the influence into three effects is necessary and meaningful, it establishes a solid foundation for understanding the relationship between urbanization and industrial pollutant emissions, and effectively helps to meet relative policy making.

The calmodulin-binding transcription activators (CAMTAs) mediate transcriptional regulation of development, growth, and responses to various environmental stresses in plants. To characterize the biological processes of soybean CAMTA (GmCAMTA) family members in response to abiotic stress, we identified 15 GmCAMTA genes from soybean (Glycine max L.) and investigated their roles in the abiotic stress response. The transcriptions of GmCAMTAs exhibited distinct circadian regulation patterns and were expressed differently in response to salt, drought, and cold stresses, except ABA. Interestingly, the expression levels of GmCAMTA2, GmCAMTA8, and GmCAMTA12 were higher in stem tissue than in other soybean tissues. To determine the roles of GmCAMTAs in the regulation of developmental processes and stress responses, we isolated GmCAMTA2 and GmCAMTA8 cDNAs from soybean and generated Arabidopsis overexpressing transgenic plants. The GmCAMTA2-OX and GmCAMTA8-OX plants showed hypersensitivity to drought stress. The water in the leaves of GmCAMTA2-OX and GmCAMTA8-OX plants was lost faster than that in WT plants under drought stress conditions. In addition, stress-responsive genes in the GmCAMTA2-OX and GmCAMTA8-OX plants were down-regulated under drought stress conditions. Our results suggest that GmCAMTA2 and GmCAMTA8 genes are regulated by circadian rhythms and function as negative regulators in development and drought stress responses.

Effects of oxygen content on microstructure and creep property of FGH96 superalloy were investigated. When oxygen content increased from 135ppm to 341ppm, prior particle boundary (PPB) rose from degree 2 to degree 3, and the size of γ′ phase on PPB enlarged from 1.07μm to 1.27μm, and MC carbide size grew from 77.4nm to 104.0nm. Meanwhile, the steady creep rate accelerated form 4.34×10-3 h-1 to 1.87×10-2 h-1, and the creep rupture life shortened from 176h to 94h, and the creep rupture mode transferred from intergranular and transgranular mixed fracture to along PPB fracture. During creep, the micro-twins formation and gliding will be restrained by ∑3 boundaries. FGH96 superalloy with higher oxygen content contains less ∑3 boundaries and its micro-twins cross slipped instead of single direction slip in lower oxygen content superalloy. Consequently, specimen with higher oxygen content creeped faster and raptured earlier.

This essay critically discusses the integration of queer theory into human geography while emphasizing its ties to the principles of traditional geography. The need for a separate sub-discipline called queer geography is questioned. At the same time, legitimate concerns about possible departures from the fundamental goals of geography and the risks of anachronistic interpretations in applying modern concepts to historical landscapes are acknowledged. In this discourse, we strongly advocate for values such as freedom of speech, freedom of expression, and international human rights. It is important to emphasize that it is not the intent of this essay to denigrate campaigns for feminism or equality or to disparage the scholarship that emerges from the application of queer theory. On the contrary, we recognize the emergence of gender theories out of a need to advance social justice approaches. We believe that traditional human geography, itself, is capable of comprehensively examining space, time, and the complexity of human experience and offering workable solutions within its established framework. We therefore believe that the inclusion of queer theory can be harmoniously integrated into the contours of human geography, eliminating the need for a separate sub-discipline while preserving the integrity and purpose of the discipline.

To solve the problem that sampling-based Rapidly-exploring Random Tree (RRT) method is difficult to guarantee optimality. This paper proposed the Post Triangular Processing of Midpoint Interpolation method minimized the planning time and shorter path length of the sampling-based algorithm. The proposed Post Triangular Processing of Midpoint Interpolation method makes a closer to the optimal path and somewhat solves the sharp path problem through the interpolation process. The experiments were conducted to verify the performance of the proposed method. Applying the method proposed in this paper to the RRT algorithm increases the efficiency of optimization compared to the planning time.

In this paper, we propose an adaptive duty-cycled hybrid X-MAC (ADX-MAC) protocol for energy-efficient forest fire prediction. The X-MAC protocol acquires the additional environmental status collected by each forest fire monitoring sensor for a certain period. And, based on these values, the length of sleep interval of duty-cycle is changed to efficiently calculate the risk of occurrence of forest fire according to the mountain environment. The performance of the proposed ADX-MAC protocol was verified through experiments the proposed ADX-MAC protocol improves throughput by 19% and was more energy-efficient by 24% compared to X-MAC protocol. As the probability of forest fires increases, the length of the duty cycle is shortened, confirming that the forest fires are detected at a faster cycle.

This essay discusses the complicated relationship between ideology and faith, focusing on the importance of faith. It endeavors to enrich the critical examination of religion by providing a platform to analyze the multifaceted nature of ideologies and their profound influence on human geography. This study is particularly distinctive for its focus on the complex interplay of Marxism, religion, and modernity, deepening our understanding of how these dynamics shape contemporary societies.

Social, environmental and economic problems are the concern in the agroecological communities. To address these issues, it is important to understand how communities think and act towards existing sustainable practices. There are various agriculture practices which are aboriginal to particular region, and have the knowledge of environment in deep sense thus, locals utilize it for coexisting with nature, by preserving environment and fulfilling the human needs for food alongside protecting the disappearing practices. At present, India has only three designated GIAHS sites and no proposed sites at present, despite having a diverse physical environment and area. Therefore, this paper acknowledges the need to recognize potential indigenous agricultural heritage site as GIAHS and its multidimensional Sustainability and vulnerability by climate change, Traditional value, ecological value, socio cultural values and value-added behavior which can increase the economic value and appeal towards agricultural commodities in later phase. Therefore, this paper aims to investigate the potential AHS site in the north east region of India, which is known as Zabö or Ruza and changes in the LULC of the area. Alongside assessing the present agricultural Heritage systems and changes GIAHS recognition brought to it.

Accurate evaluation of thermo-fluid dynamic characteristics in tank are critically important for designing liquid hydrogen tank of small-scale hydrogen liquefier to minimize heat in-leak into the liquid and ullage. Due to the huge cost, most future liquid hydrogen storage tank designs will have to rely on predictive computational models for storage tank pressurization and heat-leak minimization. Thus, reliable on predictive numerical models to aid design process of tank design have been required. Therefore, in this study, in order to improve the storage efficiency of the small-scale hydrogen liquefier, a three-dimensional CFD model that can predict the boil-off rate and the thermo-fluid characteristics due to heat penetration has been developed. The prediction performance and accuracy of the CFD model is validated on the basis of the comparisons between its results and previous experimental data and a good agreement is obtained. To evaluate insulation performance of polyurethane foam according to thickness, the pressure change and thermo-fluid characteristics in a partially liquid hydrogen tank, subject to fixed ambient temperature and wind velocity, has been investigated numerically. Three different insulation thickness were considered to investigate not only interfacial characteristics between liquid and ullage but thermo-fluid dynamics in hydrogen storage tank for various heat-leak situation. The results indicate that as the insulation thickness becomes thinner and more heat penetration exists, natural convection by buoyancy develops stronger, so strong vortices are created near the interfacial zone by upward flow driven by buoyancy. In particular, as the amount of heat in-leak increased, wider and stronger heat accumulation was found in the top dished head area of the ullage area. In addition, it was confirmed that the CFD model developed in this study could well describe the phenomenon in which the temperature of the tank wall and the insulation mat increased at a faster rate due to faster heat transfer from the vapor and interface. In the future, the numerical model developed in this study will be used for optimizing insulation system of storage tank for small-scale hydrogen which is cost-effective and highly efficient.

In this paper, we investigate a new $q$-analogue of the higher order degenerate Changhee polynomials and numbers, which are called the Witt-type formula for the $q$-analogue of degenerate Changhee polynomials of order $r$. We can derive some new interesting identities related to the degenerate $(h,q)$-Changhee polynomials and numbers.

In traditional oriental medicine, carrots (Daucus carota L.) are considered effective medicinal herbs; however, the use of D. carota leaves (DGL) as therapeutic agents has not been explored in depth. Therefore, we aimed to demonstrate the value of DGL, generally treated as waste while developing plants for wide industrial availability. Six flavone glycosides were isolated and identified from DGL, and their constituents were identified and quantitated using an NMR and HPLC/UV method, which was optimized and validated. The structure of chrysoeriol-7-rutinoside from DGL was elucidated for the first time. The method exhibited adequate relative standard deviation (<1.89%) and recovery (94.89–105.97%). The deglycosylation of DGL flavone glycosides by Viscozyme L and Pectinex was assessed. Upon converting the reaction contents to percentages, the luteolin, apigenin, and chrysoeriol groups showed values of 85.8, 33.1, and 88.7%, respectively. The enzyme-treated DGL had a higher inhibitory effect on TNF-α and IL-2 expression than that of the carrot roots or carrot leaves without enzyme treatments. These results highlight the importance of carrot leaves and could be used as baseline standardization data for commercial development.

This study examines the geopolitical dynamics of water conflicts in Central Asia, with a specific focus on Uzbekistan and its neighbors. Drawing upon a mixed methods approach within the framework of political geography, the research investigates the interactions among regional nations and the implications of population growth, agricultural industrialization, and economic competition, which heavily rely on shared irrigation systems and watersheds. The study establishes clear research objectives aimed at evaluating the water crisis in the region, addressing challenges in water management, and analyzing contentious issues. By uncovering historical and contemporary factors influencing water conflicts, regional power dynamics, and the complexities of water governance, the study highlights the potential for conflict, regional instability, and disruptions to peace resulting from population growth and economic competition within shared watersheds. The study concludes by providing recommendations to enhance regional cooperation, promote sustainable water management, and foster peacebuilding efforts. These recommendations draw on “soft power theory” and advocate for collaborative approaches. The findings of this research offer valuable insights for policymakers, researchers, and stakeholders involved in water management and regional cooperation amid evolving geopolitical challenges. By contributing to informed decision-making and promoting strategies for sustainable development in the region, this study aims to support efforts toward effective water resource management and long-term stability in Central Asia. The implications of this research extend beyond the immediate region, serving as a reference for other areas facing similar water-related conflicts and providing a foundation for future studies in the field of geography.

In this research, we investigate the healthcare expenditure patterns in Uzbekistan, analyze their economic implications, and provide policy recommendations. The study focuses on the time frame from 2000 to 2019, employing quantitative data analysis, theoretical frameworks such as Wagner’s Law, and an economic geography perspective. Our objective is to gain insights into the relationship between economic development and healthcare spending, identify spatial disparities, and forecast future trends. The findings reveal fluctuations in per capita healthcare spending, emphasizing the necessity for sustainable financing mechanisms and preventive measures. Ultimately, our study underscores the significance of aligning healthcare expenditure decisions with economic objectives while prioritizing the well-being of the population.

Mango (Mangifera indica L.) is an allotetraploid (2n = 4X= 40) drupe fruit and has high nutritional value belongs to genus Mangifera and family Anacardiaceae. Mango cultivars are used with worldwide acceptance to pharmacological, ethnomedical, and phytochemical industries. Assessment of the genetic distinctiveness of a cultivar through morphological descriptors is an important tool for both the registration and the protection. New mango genotypes have been improved using valuable diverse germplasm resources to ensure food security. DNA fingerprinting based simple sequence repeats (SSR)-markers have been the most broadly used, effective and accurate in evaluation of genetic characterization of a cultivar. Molecular breeding is an effective source of genetic gain after improvement of fruit trees using marker assisted genomic selection. Total genomic DNA (gDNA) was generated using CTAB method from each cultivar. The most effective 50 hyper-variable SSR markers were selected. Highly specific DNA fingerprints were identified in the candidate line ‘Azeem Chaunsa’ compared with three standard cultivars using SSR-PCR. An agglomerative hierarchical clustering method was used to construct dendrogram based on the UPGMA clustering method. Cultivar identification diagram (CID) was constructed to evaluate association among standard cultivars and Azeem Chaunsa. Our results showed that SSR markers could efficiently assess genetic diversity in mango. The genetic similarity coefficients were recorded between the cultivars of mango ranged from 0.49 to 0.67. CID results concluded that cultivar ‘Azeem Chaunsa’ varied significantly from the check cultivar, Sindhri (46.2%), S.B Chaunsa (45%) and Sufaid Chaunsa (46.7%). The results obtained in this study will orient cultivar identification strategies for a successful future.

Amid the deepening imbalance in the supply and demand of allogeneic organs, xenotransplanta-tion can be a practical alternative because it makes an unlimited supply of organs possible. How-ever, to perform xenotransplantation on patients, the source animals to be used must be free from infectious agents. This requires breeding of animals using assisted reproductive techniques, such as somatic cell nuclear transfer, embryo transfer, and cesarean-section, without colostrum de-rived in designated pathogen-free (DPF) facilities. Most infectious agents can be removed from animals produced by these methods, but several viruses known to pass through the placenta are not easy to remove, even with these methods. Therefore, in this review, we look at the characteris-tics of several viruses known to cross the placenta and determine how they can be detected. This review is intended to help maintain DPF facilities by preventing animals infected with the virus from entering DPF facilities and to help select pigs suitable for xenotransplantation.

In France, the regional airport’s demand for services is facing challenges due to the continuous expansion of the high-speed train, high-speed line, and highway networks. This study focuses on the viability of regional airports in France through technical efficiency using data envelopment, principle component analysis, Malmquist productivity index, and regression analysis using bootstrapping. To face the current competitive environment, the regional airports in France adopted strategies, such as the construction of low-cost carrier (LCC) dedicated terminals (LCCTs) with lower expenses to attract more LCCs, increasing non-aeronautical revenue, and hosting regional hubs of LCCs. This is the first study that analyzes all of the French regional airports. The findings indicate that the existence of LCCTs positively affects technical efficiency on the airport’s performance, and share of LCCs at a regional airport leads to neither the efficiency nor the profit level.

We developed an ovarian cancer-targeted drug delivery system based on a follicle-stimulating hormone receptor (FSHR) peptide. The lipophilic chemotherapeutic drug SN38 and the photosensitizer IR820 were loaded into the phospholipid bilayer of liposomes. Near-infrared laser irradiation stimulated the generation of reactive oxygen species, causing short-term reactive molecular species and spatial-temporal restricted photodamage to the biological targets. The reactive molecular species and spatial-temporal restricted photodamage enhanced the release and uptake of chemotherapy drugs and increased the sensitivity to chemotherapy drugs in ovarian cancer cells. FSH liposomes loaded with SN38 and IR820 (SN38/IR820-Lipo@FSH) were prepared using thin-film hydration-sonication. FSH peptide binding was analyzed using 1H NMR spectrum and Maldi-Tof. The average size and zeta potential of SN38/IR820-Lipo@FSH were 105.1 ± 1.15 nm (PDI: 0.204 ± 0.03) and −27.8 ± 0.42 mV, respectively. SN38/IR820-Lipo@FSH exhibited good drug-loading properties and the in vitro release was slow. FSH significantly increased the uptake of liposomes, inhibited cell proliferation, and induced apoptosis in A2780 cells. Moreover, SN38/IR820-Lipo@FSH exhibited good tumor-targeting ability and anti-ovarian cancer activity in vivo. The SN38/IR820-Lipo@FSH exhibited specific targeting to A2780 ovarian cancer cells. The combination of chemotherapy and photodynamic treatment based on an FSH peptide-targeted delivery system may be an effective approach to treating ovarian cancer.

Ag+ pollution is great of harm to the human body and the biology. Therefore, it is an urgent need to develop inexpensive and accurate detection methods. Herein, lignin-derived structural memory carbon nanodots (CSM-dots) with outstanding fluorescence property were fabricated via a green method, which reserve functional and structural units of the precursor molecules. The CSM-dots could specifically bind Ag+, accompanied with a remarkable fluorescence quenching response. This “turn-off” fluorescence behavior was used for Ag+ determination in a linear range of 5-290 μM with the detection limit as low as 500 nM. Furthermore, the finding showed that this sensing nano-platform was successfully used for Ag+ determination in real samples and intracellular imaging, showing great potential in biological and environmental monitoring applications.

The molecular dynamics simulation has been used to investigate the structural and transport properties of (Ba_0.5-xSr_x)La_0.5InO_3-δ (x=0, 0.1, 0.2) oxygen-ion conductor. The previous studies reported that the ionic conductivity of Ba-doped LaInO3 decreases because Ba dopant forms narrow oxygen path in the lattice, which could hinder the diffusion of oxygen ion. In this study, we reveal the mechanism to improve the ionic conductivity by Ba and Sr co-doping on La site in LaInO3 perovskite oxide. The results show that the ionic conductivity of (Ba_0.5-xSr_x)La_0.5InO_3-δ increases with increasing numbers of Sr ions, which oxygen diffusion paths including Sr ion have larger critical radius than Ba ions. The RDF calculations showed the heights of peak in composition including Sr ions is lower and broaden, so oxygen ions moved easily into other oxygen sites.

Over recent years, the swine industry has witnessed the withdrawal of antibiotics and continuous regulation of zinc and copper oxides in the early-life nutrition of piglets. Due to this development, alternative ingredients or additives from plant sources have been tremendously explored. Therefore, this study's objective was to evaluate the effect of dietary supplementation with tannins on weaned piglets’ growth performance, serum antioxidant capacity, and immune status using a meta-analysis approach. With only the inclusion of non-challenged weaned piglets, a total of 16 studies with parameters of interest were deemed eligible after a two-step screening process following a comprehensive literature search in the scientific databases of Web of Science, Scopus, ScienceDirect, PubMed, and Google Scholar. Two main categories of data, including the study’s characteristics and response variables (growth performance, serum antioxidant, and immune indices), were extracted. Applying the random-effects models, Hedges’ g effect size of supplementation with tannins was calculated using the R software to determine the standardized mean difference (SMD) at a 95% confidence interval. Sub-group analysis and meta-regression further explored heterogeneity (PSMD 0.05, I2 50%, n ≥10). Supplementation with tannin reduced average daily gain (p = 0.20) and feed conversion ratio (p 0.01); however, it increased average daily feed intake (p = 0.07) and final body weight (p 0.01). Meta-regression models indicated that tannin dosage and supplementation duration were directly associated with tannins' effectiveness on productive performance. In the serum, the concentration of glutathione peroxidase, superoxide dismutase, and total antioxidant capacity were elevated (p 0.01) in response to tannins supplementation, while malondialdehydes was reduced (p 0.01). Likewise, decreased immunoglobin A (p = 0.47) and increased immunoglobin M and G levels (p 0.01) were detected. In conclusion, dietary supplementation with tannins, particularly with chestnut and grape seed proanthocyanidins, increases the productivity of weaned piglets. At the same time, it is a possible nutritional strategy to mitigate oxidative stress and stimulate gut health. Thus, supplementing chestnut and grape seed proanthocyanidin tannins in the early phase of swine production could be used to alleviate the incidence of diarrhea.

This book review addresses the contribution of Tim Marshall’s “The Power of Geography”. The purpose of this essay is to highlight the significant role of geography in shaping political landscapes, alliances, and global affairs through the book review. What is new about this essay is its accessible presentation of complex geopolitical concepts, making it a valuable resource for students of geography and readers interested in global politics. Through the analysis of case studies and historical background, the book illuminates the interplay between physical landscapes, territoriality, and power dynamics. The findings highlight the continuing influence of geography on nations, regional identities, and the evolving global order.

The monitoring of lake waterbody area in the Qinghai Tibet Plateau (QTP) is of great significance to deal with global climate change. As the latest generation of Landsat series satellites, Landsat-9 data not only have higher radiometric resolution, but also cooperate with other Landsat satellites to greatly improve the temporal resolution. It has great application potential in lake waterbody area monitoring. In order to explore the performance of different algorithms for extracting waterbody and lake waterbody area in Landsat-9 data under large-scale QTP regions, this study relies on Google Earth Engine (GEE) platform and selects 10 waterbody extraction algorithms as the basis to realize the quantitative evaluation of QTP lake waterbody area extraction results. The results show that the Random Forest (RF) algorithm performs best in all models. The overall accuracy of waterbody extraction is 95.84%, and the average error of lake waterbody area extraction is 1.505%. Among the traditional threshold segmentation waterbody extraction algorithms, the overall accuracy of the NDWI waterbody extraction method is 89.89%, and the average error of lake waterbody area extraction is 3.501%, which is the highest performance model in this kind of algorithms. This study proves that Landsat-9 data can effectively classify QTP waterbodies. With the development of cloud computing technologies such as Gee, more complex models such as RF can be selected to improve the extraction accuracy of water body and Lake area in large-scale research.

Psoriatic arthritis (PsA) is a persistent, inflammatory disease that affects individuals with psoriasis, arthritis, and enthesitis. Research has demonstrated that inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-23 (IL-23), and interleukin-17 (IL-17) play a pivotal role in both the onset and progression of PsA. These cytokines are generated by activated immune cells and stimulate the attraction of inflammatory cells to the synovium and joint tissues, resulting in the deterioration of cartilage and bone. The blocking of these cytokines has become a successful treatment strategy for PsA, as biological drugs that inhibit TNF-α, IL-23, and IL-17 have demonstrated notable clinical benefits. The association between PsA and other types of inflammatory cytokines or chemokines, excluding TNF-α, IL-23, and IL-17, has been extensively investigated in numerous studies. These findings may provide a chance for the discovery of novel therapeutic agents targeting other molecules, distinct from the currently approved biologics and targeted synthetic disease-modifying antirheumatic drugs. In this review, we discuss the current understanding of the role of inflammatory cytokines in PsA pathogenesis and clinical implications of targeting these cytokines for PsA treatment.

When a railway vehicle moves on a curved rail, sliding contact occurs between the rail head side and wheel flange, which wears the wheel flange down. The thinned flange needs to be restored above the required minimum thickness for structural safety. In this study, a new process and welding wire for restoring worn-out railway wheels by submerged arc welding was developed. To characterize the properties of the restored wheel, dilatometric analysis of phase transformation, SEM/EDX analyses, hardness measurement, and residual stress measurement using the X-ray diffraction method were performed. Finally, wear tests with full-size wheel/rail specimens were carried out. It was confirmed that the weld metal was composed of bainitic microstructures as intended, and welding defects were not observed. The wear amount of the restored wheel was greater than that of the base material, but it was less than half of the wear depth of the weld-repaired wheel with ferritic–pearlitic microstructures. The developed process seems applicable to industry.

In this paper, we investigate the new degenerate Daehee polynomials and numbers which are called the degenerate Daehee polynomials of the second kind, and derive some new and interesting identities and properties of those polynomials.

This retrospective study aimed to assess coronary artery calcium (CAC) progression in serial computed tomography measurements according to risk factor changes. In 448 asymptomatic adults who underwent CAC measurements with more than one-year intervals, CAC progression was assessed according to age, sex, variable traditional risk factors (diabetes mellitus, hypertension, hyperlipidemia, and smoking), and initial CAC score (0, 0.1–100, and >100). Univariate and multivariate logistic regression analyses were assessed for independent predictors of rapid CAC progression (△CAC/year>20). During the 3.5-year follow-up, coronary artery calcifications occurred in 43 (12.8%) of 336 individuals with an initial CAC score of zero. Of 112 individuals with initial CAC presence, 60 (53.6%) had △CAC/year>20. Age, male sex, body mass index, and all risk factors were significantly associated with △CAC/year>20, but recently diagnosed hypertension (odds ratio [OR], 11.3) and initial CAC score (OR, 1.05) were significant independent predictors in multivariate regression analyses. CAC progression was affected by demographic and traditional risk factors, but adjusting for these factors, recently diagnosed hypertension and initial CAC score were the most influential factors for rapid CAC progression. These findings suggest that patients with higher initial CAC scores may benefit from more frequent follow-up scans and checks regarding risk factor changes.

Polypyrrole (PPy)-capped caped silver nanowire (Ag NW) nanomaterials (core–shell rod-shaped Ag NW@PPy) were synthesized suing a one–port suspension polymerization technique. The thickness of PPy layer on the 50-nm-thickness/15-μm-length Ag NW was effectively controlled to 10, 40, 50, and 60 nm. Thin films cast from one-dimensional conductive Ag NW@PPy formed a three-dimensional (3-D) conductive porous network structure and provided excellent electrochemical performance. The 3-D Ag NW@PPy network can significantly reduce the internal resistance of the electrode and maintain structural stability. As a result, a high specific capacitance of 625 F/g at a scan rate of 1 mV/s was obtained from the 3-D porous Ag NW@PPy composite film. The cycling performance over a long period exceeding 10,000 cycles was also evaluated. We expect that our core–shell-structured Ag NW@PPy composites and their 3-D porous structure network films can be applied as electrochemical materials for the design and manufacture of supercapacitors and other energy storage devices.

Goal-conditioned reinforcement learning (RL) holds promise for addressing intricate control challenges by enabling agents to learn and execute desired skills through separate decision modules. However, the irregular occurrence of required skills poses a significant challenge to effective learning. In this paper, we demonstrate the detrimental effects of this imbalanced skill(sub-goal) distribution and propose a novel training approach, Classified Experience Replay (CER), designed to mitigate this challenge. We demonstrate that adapting our method to conventional RL methods significantly enhances the performance of the RL agent. Considering the challenges inherent in tasks such as driving, characterized by biased occurrences of required sub-goals, our study demonstrates the improvement in trained outcomes facilitated by the proposed method. In addition, we introduce a specialized framework tailored for self-driving tasks on highways, integrating Model Predictive Control (MPC) into our RL trajectory optimization training paradigm. Our approach, utilizing CER with the suggested framework, yields remarkable advancements in trajectory optimization for RL agents operating in highway environments.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

Reinforcement Learning (RL) has demonstrated considerable potential in solving challenges across various domains, notably in autonomous driving. Nevertheless, implementing RL in autonomous driving comes with its own set of difficulties, such as the overestimation phenomenon, extensive learning time, and sparse reward problems. Although solutions like Hindsight Experience Replay (HER) have been proposed to alleviate these issues, the direct utilization of RL in autonomous vehicles remains constrained due to the intricate fusion of information and the possibility of system failures during the learning process. In this paper, we present a novel RL-based autonomous driving system technology that combines Obstacle Dependent Gaussian (ODG) RL, Soft Actor-Critic (SAC), and meta-learning algorithms. Our approach addresses key issues in RL, including the overestimation phenomenon and sparse reward problems, by incorporating prior knowledge derived from the ODG algorithm. We evaluated our proposed algorithm on official F1 circuits, using high-fidelity racing simulations with complex dynamics. The results demonstrate exceptional performance, with our method achieving up to 89% faster learning speed compared to existing algorithms in these environments.

Dragon fruit (Hylocereus polyrhizus) constitutes an important economic industry in Guizhou Province, China; however, in recent years, stem rot in this region has become increasingly severe. Moreover, the pathogens responsible for stem rot in Guizhou and their sensitivity to fungicides remain elusive. Therefore, in this study, we aimed to determine the causative pathogens of stem rot in this region and analyze their sensitivity to fungicides. Twenty-four isolates were obtained from diseased tissues, from which H-4 and H-5 were selected and confirmed as pathogens. Based on the morphological characteristics of macroconidia, microconidia, and colony morphology, the polygenic phylogenetic tree constructed using internal transcribed spacer, elongation factor 1-alpha, and retinol-binding protein-2 gene fragments, along with carbon source metabolism using FF microplates, the two pathogens were identified as Fusarium oxysporum and F. concentricum respectively. In addition, the in vitro toxicity of eight fungicides against both pathogens were measured based on mycelium growth rate. The results showed that 75% trifloxystrobin·tebuconazole exhibited the strongest inhibitory effect on both isolates, with concentration for 50% of maximum effect values of 0.1262 µg/mL and 0.1385 µg/mL, respectively. This study identified two Fusarium spp. as the causative pathogens of stem rot in dragon fruit, with F. concentricum being reported for the first time, and demonstrated the best fungicide for them. These findings hold significant potential for guiding the effective treatment of stem rot in dragon fruit in Guizhou, China.

The Android-based IoT platform just like the existing Android provides an environment that makes it easy to utilize Google's infrastructure services including development tools and APIs through which it helps to control the sensors of IoT devices. Applications running on the Android-based IoT platform are often UI free and are used without the user’s consent to registered permissions. It is difficult to respond to the misuse of permissions as well as to check them when they are registered indiscriminately while updating applications. This paper analyzes the versions of before and after an application the update running on the Android-based IoT platform and the collected permission lists. It aims to identify the same permissions before and after the update, and deleted and newly added permissions after the update were identified, and thereby respond to security threats that can arise from the permissions that is not needed for IoT devices to perform certain functions.

Longitudinal cutting is a most common process in steel structure manufacturing, and the man-hours of the process provide an important basis for enterprises to generate production schedules.However, currently the man-hours in factories are mainly estimated by experts, and the accuracy of this method is relatively low.In this study,we propose a system that predicts man-hours with history data in the manufacturing process and that can be applied in practical structural steel fabrication.The system addresses the data inconsistency problem by one-hot encoding and data normalization techniques,Pearson correlation coefficient for feature selection,and the Random Forest Regression(RFR) for prediction.Compared with the other three Machine Learning(ML) algorithms, the Random Forest algorithm has the best performance.The results demonstrate that the proposed system outperforms the conventional approach and has better forecast accuracy, so that it is suitable for man-hours prediction.

As human activities of the countries in the East Asia have been remarkably expanding over recent decades, various problems in relation to ships, such as oil spill and many other coastal marine pollution, are continuously occurring in the coastal region. In order to conserve marine resources and prepare for possible ship accidents in advance, the need for efficient ship management is increasing over time. Multi-satellite, multi-sensor, multi-wavelength or multi-frequency observations make it possible to monitor a variety of vessels in the coastal region. This study presents the results of ship detection methodology applied to multi-spectral satellite images in the seas around Korean Peninsula based on optical, hyperspectral, and microwave remote sensing. To detect ships from hyperspectral images with a few hundreds of spectral channels, spectral matching algorithms are used to investigate similarity between the spectra and in-situ measurements. In the case of SAR (Synthetic Aperture Radar) images, the Constant False Alarm Rate (CFAR) algorithm is used to discriminate the vessels from backscattering coefficients of Sentinel-1 SAR and ALOS-2 PALSAR2 images. The present ship detection methods can be extensively utilized for optical, hyperspectral, and SAR images for comprehensive coastal management purposes toward perpetual sustainability in the future.

In recent years, demand has been increasing for target detection and tracking from aerial imagery via drones using onboard powered sensors and devices. We propose a very effective method for this application based on a deep learning framework. A state-of-art embedded hardware system empowers small flying robots to carry out the real-time onboard computation necessary for object tracking. Two types of embedded modules were developed: one is designed using a Jetson TX or AGX Xavier, and the other is based on an Intel Neural Compute Stick. These are suitable for real-time onboard computing power on small flying drones with limited space. A comparative analysis of current state-of-art deep-learning-based multi-object detection algorithms was carried out utilizing the designated GPU-based embedded computing modules to obtain detailed metric data about frame rates as well as the computation power. We also introduce an effective target tracking approach for moving objects. The algorithm for tracking moving objects is based on the extension of simple online and real-time tracking. It was developed by integrating a deep-learning-based association metric approach (Deep SORT), which uses a hypothesis tracking methodology with Kalman filtering and a deep-learning-based association metric. In addition, a guidance system that tracks the target position using a GPU-based algorithm is introduced. Finally, we demonstrate the effectiveness of the proposed algorithms by real-time experiments with a small multi-rotor drone.

In order to foster a more sustainable and eco-friendly trajectory for the construction industry, while concurrently mitigating environmental pollution and energy inefficiency, it is imperative to cultivate an environmentally conscious building and urban environment. Under the background of carbon peak and carbon neutrality, green building evaluation system (GBRS) has become a research hotspot in the field of green building. This paper systematically summarizes the current research progress based on GBRS, focuses on the current weight and indicators setting, analyzes it with Cite Space software, and puts forward its future development direction. The results show that the weight setting method of green building evaluation system is determined by multidimensional and multi-method. From the perspective of environment, society and economy, the scope of indicators setting is expanding. The green building evaluation system will play a guiding role in green building design, and the evaluation process will continue to be optimized and developed in the direction of intelligence and automation.

Diatomite (DME) consists of natural ordered porous structures that are excellent candidates as microcontainers. However, to the best of our knowledge, the application of DME loaded with corrosion inhibitors in anti-corrosion coatings has not hitherto been reported. In this study, DME has been used as a source of microcontainers to load benzotriazole (BTA) inhibitor by an immersion method. In order to prevent unwanted early release of the small molecule BTA inhibitor from the DME microcontainers, inspired by the adhesion characteristics of catechol and amine in mussel adhesion protein, polydopamine (PDA) was coated on their surfaces to generate BTA@DME/PDA microcapsules. Because of the depolymerization characteristics of PDA at low pH, the synthesize microcapsules showed a controllable release function. The SEM morphology, chemical structure, and loading capacity of the synthesized BTA@DME/PDA microcapsules were characterized. The corrosion resistances of epoxy coatings with different contents of BTA@DME/PDA microcapsules were compared by saline immersion and electrochemical impedance tests. A scratched coating with 5wt.% BTA@DME/PDA microcapsules showed the best anti-corrosion effect.

Arabinoxylans (AXs) are non-starch polysaccharides with complex structures naturally occurring in grains (i.e., barley, corn, and others) providing many health benefits, especially as prebiotics. AXs can be classified as water-extractable (WEAX) and water-unextractable (WUAX) based on their solubility, with properties influenced by grain sources and extraction methods. A large body of evidence shows that AXs exert an im-portant health impact, including glucose and lipid metabolism regulation and immune system enhancement, which is induced by the interactions between AXs and the gut microbiota. Recent research underscores the dependence of AX physiological effects on structure, advocating for a deeper understanding of struc-ture-activity relationships. While systematic studies on WEAX are prevalent, knowledge gaps persist re-garding WUAX, despite its higher grain abundance. Thus, this review reports recent data on WUAX struc-tural properties (chemical structure, branching, MW) in cereals under different treatments. It discusses WUAX applications in baking and its benefits deriving from gut fermentation.

Objective: To explore the hot spots and development trends of community public health research. Methods: The literature related to this topic was searched in CNKI and PubMed databases, and the trend map of the number of articles was drawn according to the obtained data. The included literature were analyzed with Vosviewer software for keyword and author co-occurrence, and CiteSpace 6.3.R1 Basic software was used for mechanism co-occurrence, key emergence and clustering analysis, and timeline distribution map drawing. Results: 189 Chinese literature and 77 English literature were selected. The Chinese literature focused on “community public health service, emergency management, and community governance”, and the research trend was “community public health emergency management and community governance”; English literature focuses on “nursing education, health education, human qualitative research”. Conclusion: Although the Chinese and English literature shows that scholars in this field have different emphases, the primary community health is the key and difficult point to realize the national public health service project, and improving the basic public health service in the primary community is related to the health of all the people, so it is very important.

In Korea, the underground silo structure for low- and intermediate-level radioactive waste disposal facilities has been constructed and operated since 2014. Large-scale earthquakes occurred in 2016 and 2017, respectively, in Gyeongju and Pohang areas near the underground silo structures, and interest in the stability of the underground silo increased significantly. In this paper, one-dimensional free field analyses have been carried out before the three-dimensional silo dynamic analyses subjected to earthquake loadings. As an additional study, a new form of finite element equilibrium equation is derived in terms of relative motions, which is essentially the same equation as that expressed in terms of total motions where the base shear force is applied for earthquake load. The accuracy of conventional finite element solutions is evaluated by directly comparing them with closed-form solutions by frequency domain analysis such as SHAKE91.

In order to accurately identify the external economic situation in China and analyze the situation of economic development in Northeast China, based on the Strengths, Weaknesses, Opportunities and Threats (SWOT) analysis framework, this article analyses the economy in Northeast China from the four factors of SWOT. To solve the lack of quantitative analysis in SWOT analysis, this article applies Analytic Hierarchy Process (AHP) to the analysis, and finally forms a complete system framework with the combination of qualitative and quantitative factors, through the analysis of the important degree of various factors and the consistency test, the key factors influencing the economic development in Northeast China are analyzed, and constructive countermeasures are proposed.

A new design scheme is proposed for twisting the walls of a microchannel, and its performance is demonstrated numerically. The numerical study was carried out for a T-shaped microchannel with twist angles in the range of 0 to 34π. The Reynolds number range was 0.15 to 6. The T-shaped microchannel consists of two inlet branches and an outlet branch. The mixing performance was analyzed in terms of the degree of mixing and relative mixing cost. All numerical results show that the twisting scheme is an effective way to enhance the mixing in a T-shaped microchannel. The mixing enhancement is realized by the swirling of two fluids in the cross section and is more prominent as the Reynolds number decreases. The twist angle was optimized to maximize the DOM, which increases with the length of the outlet branch. The twist angle was also optimized in terms of the relative mixing. The two optimum twisting angles are generally not coincident. The optimum twist angle shows a dependence on the length of the outlet branch but it is not affected much by the Reynolds number.

This study examines the negative impacts of dark stores on the urban environment from three perspectives: land use, transportation, and streetscape. It is conducted on B-Mart, a representative dark store in South Korea. First, in terms of land use, we find that dark stores that function as logistics facilities conflict with the surrounding land use. Second, by analyzing the location of dark stores and the hourly traffic volume of delivery vehicles, we find that the impact on the surrounding transportation infrastructure and pedestrian traffic is not as significant as previously claimed. However, during the transportation and loading process of the dark store, several problems such as traffic violations, illegal parking, and illegal loading were observed, posing a risk to nearby vehicles and pedestrians. Third, in terms of streetscapes, the location of dark stores on the ground floor of buildings can harm streetscapes. The current urban planning system in South Korea does not clearly define the status and function of dark stores, making it unclear how to manage them. Therefore, it is necessary to clarify their legal definition and introduce urban planning and design guidelines that are consistent with their appropriate location and appearance.

Our previous studies demonstrated that quercetin (Q) could be ingested and metabolized by macrophages and exerted prophylactic immuno-stimulatory activity and therapeutic anti-inflammatory effects on lipopolysaccharide (LPS)-treated macrophages ex vivo. To further clarify its possible anti-inflammatory mechanism, Q was selected to treat mouse peritoneal macrophages that obtained from female BALB/c mice exposed to LPS i.p. for 12 h. Relative gene expression of pro-/anti-inflammatory (TNF-α/IL-10) cytokines and components of inflammation-related intracellular signaling pathways (TLR2, TLR4, NF-κB, JAK2 and STAT3) was analyzed using two-step reverse transcription (RT) and real-time quantitative polymerase chain reaction (qPCR). STAT3 protein phosphorylation was determined using an in-cell ELISA method. As a result, Q and its metabolite quercetin-3-O-β-D-glucuronide (Q3G) decreased TNF-α gene expression amounts and ratios of pro-/anti-inflammatory (TNF-α/IL-10) cytokine gene expressions, but increased IL-10 gene expression amounts in activated inflammatory macrophages, supporting a substantial anti-inflammatory potential of Q and Q3G treatments. However, Q3G had lower effects than those of Q. Importantly, Q inhibited TLR2 gene expression and phosphorylation of STAT3 protein in the inflamed cells. Our results are the first report to suggest that Q inhibits LPS-induced inflammation ex vivo through suppressing TLR2 gene expression and STAT3 protein phosphorylation in activated inflammatory macrophages. Q has potential to further apply for treating inflammation-associated diseases.

In the past decade, it has been discovered that intestinal flora can influence various organ-specific cancers by altering the body's energy balance, increasing obesity, synthesizing genetic toxins and small signaling molecules, initiating and modulating immune responses, and metabolizing indigestible dietary components, exogenous substances, and drugs. In this review, we will focus on elucidating the role of gut flora based on its molecular mechanisms and its potential therapeutic implications in head and neck tumors in the near future.

The number of patients with bone metabolic disorders including osteoporosis is increasing worldwide. These disorders often facilitate bone fractures, which seriously impact the patient’s quality of life and could lead to further health complications. Bone homeostasis is tightly regulated to balance bone resorption and formation. However, many anti-osteoporotic agents are broadly categorized as either bone forming or anti-resorptive, and their therapeutic use is often limited due to unwanted side effects. Therefore, safe and effective therapeutic agents are needed for osteoporosis. This study aims to clarify the bone protecting effects of oat bran water extract (OBWE) and its mode of action. OBWE inhibited RANKL-induced osteoclast differentiation by blocking c-Fos/NFATc1 through the alteration of I-κB. Furthermore, we found that OBWE enhanced BMP-2-stimulated osteoblast differentiation by the induction of Runx2 via Smad signaling molecules. In addition, the anti-osteoporotic activity of OBWE was also evaluated using an in vivo model. OBWE significantly restored ovariectomy-induced bone loss. These in vitro and in vivo results showed that OBWE has the potential to combat bone metabolic disorders including osteoporosis

The collaboration of multimodal transport documents is the foundation for conducting multimodal transport operations. Blockchain technology can effectively address trust issues and information sharing difficulties in current multimodal transport document collaboration. However, in current blockchain-based electronic document research, the bottleneck problem lies in the collaboration of multiparty in multimodal transport under the "one-bill coverage system". We design a blockchain platform architecture for multimodal transport, reshaping collaboration processes for different modes of transport based on the blockchain platform. It proposes a collaboration model for multimodal transport under the "one-bill coverage system" and performs model solving and case analysis. The obtained collaboration strategies are embedded into the platform's application layer. Finally, using Solidity language, it writes smart contracts related to multimodal transport under the "one-bill coverage system " and deploys and executes them on the Remix platform.

Dynamic thermogravimetric (TG) analysis under nitrogen environment was used to understand the thermal decomposition process of 3D printing filaments made of wood-filled polylactic acid (PLA)/starch blend. The characteristic temperatures and apparent activation energy (AAE) of the filaments with various starch contents were calculated with well-known kinetic models by Friedman, Flynn-Wall-Ozawa, Coats-Redfern and Kissinger. With the increased starch content in the filament, the onset thermal decomposition temperatures of the filaments decreased gradually from 272.4 to 155.1°C. The thermal degradation degree became smaller, and the transitional temperature interval became larger with increased starch proportion. The AAE values of the three types of filaments with different starch ratios varied between 97 kJ/mol and 114 kJ/mol, depending on material composition and method of calculation. The improved understanding of thermal decomposition behavior of PLA-starch-wood composites can help develop more biodegradable PLA/starch-based filaments for 3D printing.

Intestinal epithelial cell activities during homeostasis and regeneration are well described, but their potential interactions with stromal cells remain unresolved. Exploring the functions of these heterogeneous intestinal mesenchymal stromal cells (iMSCs) remains challenging due to the lack of specific markers for most functionally homogenous subpopulations. In recent years, however, novel clustering techniques such as single-cell RNA sequencing (scRNA-seq), fluorescence-activated cell sorting (FACS), confocal microscope, and computational remodeling of intestinal anatomy have helped identify and characterize some specific iMSC subsets. These methods help researchers learn more about the localization and functions of iMSC populations during intestinal morphogenic and homeostatic conditions. Furthermore, it is imperative to understand their cellular pathways for activation and how they interact with surrounding cellular components, particularly during intestinal epithelial regeneration that follows mucosal injury. This review provides insights into the spatial distribution and functions of some identified iMSC subtypes in intestinal morphogenesis, homeostasis, and regeneration. We reviewed related signaling mechanisms implicated during epithelial and subepithelial stromal cell crosstalk. Future research should focus on elucidating the molecular intermediates of these regulatory pathways to open a new frontier for potential therapeutic targets that can alleviate intestinal mucosa-related injuries.

Transcription factors (TFs) are crucial in modulating gene expression and sculpting cellular and organismal phenotypes. The identification of TF-target gene interactions is pivotal for comprehending molecular pathways and disease etiologies but has been hindered by the demanding nature of traditional experimental approaches. This paper introduces a novel web application, utilizing the R programming language, which predicts TF-target gene relationships and vice versa. Our application integrates the predictive power of various bioinformatic tools, leveraging their combined strengths to provide robust predictions. It merges databases for enhanced precision, incorporates gene expression correlation for accuracy, and employs pan-tissue correlation analysis for context-specific insights. The application also enables the integration of user data with established resources to analyze TF-target gene networks. Despite its current limitation to human data, it provides a platform for exploring gene regulatory mechanisms comprehensively. This integrated, systematic approach offers researchers an invaluable tool for dissecting the complexities of gene regulation, with the potential for future expansions to include a broader range of species.

Spatial crowdsourcing emerges as a new computing paradigm that enables mobile users to accomplish spatio- temporal tasks in order to solve human-intrinsic problems. Existing crowdsourcing systems critically use centralized servers for interacting with workers and making task assignment decisions. These systems are hence susceptible to issues such as the single point of failure and the lack of operational transparency. Prior work, therefore, turns to blockchain-based decentralized crowdsourcing systems, yet still suffers from problems of lacking efficient task assignment scheme, requiring a deposit to an untrusted system, low block generation speed, and high transaction fees. To address these issues, we design a blockchain-based decentralized framework for spatial crowdsourcing, which we call SC-EOS. Our system does not rely on any trusted servers, while providing efficient and user-customizable task assignment, low monetary cost, and fast block generation. More importantly, it frees users from making a deposit into an untrusted system. Our framework can also be extended and applied to generic crowdsourcing systems. We implemented the proposed system on the EOS blockchain. Trace-driven evaluations involving real users show that our system attains the comparable task assignment performance against a clairvoyant scheme. It also achieves 10× cost savings than an Ethereum-based implementation.

Nickel-based Superalloy Inconel 718 is widely used in the aerospace industry for its excellent high-temperature strength and thermal stability. However, milling Inconel 718 presents challenges due to significantly increased cutting force and vibration, which is a typical difficult-to-machine material. This paper focuses on the milling process of Inconel 718, establishing a milling force model to analyze the force trends under various processing parameters. Finite element analysis is employed to study the stress and temperature fields during milling. Dynamic equations for milling Inconel 718 are developed, and stability lobe diagrams are generated based on modal experiments. Milling experiments on Inconel 718 validate the milling force model and finite element analysis results. The fmincon optimization algorithm is utilized to identify the optimal machining parameters for Inconel 718. Through this research, valuable insights into enhancing the efficiency and quality of Inconel 718 machining are provided. This study contributes to a deeper understanding of Inconel 718 milling behavior, offering crucial guidance for more efficient machining processes.

Cardiovascular disease is the leading cause of death worldwide. A key factor in assessing the risk of cardiovascular disease is left ventricular functional evaluation. Left ventricular (LV) systolic function is evaluated by measuring the left ventricular ejection fraction (LVEF) using echocardiography data. Therefore, quick and accurate left ventricle segmentation is important for estimating the LVEF. However, it is difficult to accurately segment the left ventricle due to changes in the shape and area of the left ventricle during cardiac cycles. In this study, we proposed a framework that considers changes in the shape and area of the left ventricle during the cardiac cycle by applying the convolutional long short-term memory (CLSTM) approach. In addition, we evaluated the left ventricular segmentation and multidimensional quantification of the proposed system in comparison to manual and automated segmentation methods. In addition, to assess the validity of CLSTM, the values of multi-dimensional quantification metrics were compared and analyzed using graphs and Bland–Altman plots on a frame-by-frame basis. We demonstrated that the CLSTM method effectively segments the left ventricle by considering the LV activity. In conclusion, we demonstrated that LV segmentation based on our framework may be utilized to accurately estimate LVEF values.

This study investigated the impact of boron and copper on the microstructure and mechanical properties of Spheroidal graphite Cast Iron (SCI). The addition of boron increased the ferrite content, while copper increased the stability of pearlite. The interaction between boron and copper significantly increased the ferrite content. Differential Scanning Calorimetry (DSC) revealed that boron decreased the enthalpy change of the α + Fe3C -> γ transformation and increased the enthalpy change of the α -> γ transformation. The addition of boron and copper reduced the tensile and yield strength but increased elongation and impact energy. The findings provide valuable insights into the effect of boron and copper on SCI, facilitating the design and development of high-performance SCI materials.

To protect skin from harmful ultraviolet (UV), zinc oxide (ZnO) with tannin from gallnuts was treated on cotton and polyester fabrics in this study. Before the treatments, the fabrics were dyed with shikonin and xanthophyll from Gromwell and Cape Jasmine. First, this study found that xanthophyll was more effective at preventing light fade or discoloration than shikonin. Despite the highest K/S, the untreated cotton in violet faded the most intensely when exposed to UV. The color variation of untreated polyester was narrow, with little change in L, a*, and K/S. Due to the non-photochemical xanthophyll, the yellow-dyed samples treated with ZnO/polyphenol did not vary yellowness (b*: 28.838) significantly, while the violet fabrics displayed a significant decrease in K/S and an increase in b*. The combination of ZnO and polyphenol treatment improved UV absorption at 350 to 250 nm. Cu-mordanting after ZnO/polyphenols treatment caused the violet cotton to turn reddish from blueish (negative to positive b*), with a hue change of 316° to 59° and the highest ΔE (25.90±4.34) after UV exposure. In this study, the combination of ZnO/polyphenol with Cu-mordants contributed the xanthophyll-dyed polyester to achieve a minimum ΔE and keep chroma and hue after UV exposure.

Sharding shows great potential for extending the blockchain. The current challenge facing sharded blockchain technology lies in addressing the extended transaction confirmation times caused by isolated states between shards and unbalanced transaction allocation strategies. These factors contribute to an increase in cross-shard transactions and disproportionate shard workload, ultimately resulting in indefinite confirmation delays for cross-shard transactions. A critical priority for sharded blockchain systems is to conduct a comprehensive qualitative analysis to better understand and mitigate the prolonged transaction confirmation times. We introduce a Product-Form Queue Network (PFQN) model to address the transaction confirmation time problem in sharded blockchains and incorporate a new confirmation queue to more accurately simulate the actual transaction confirmation process in the blockchain. In addition, we provide a detailed quantitative analysis of the relationship between network load, consensus efficiency, and security in sharded blockchains, laying a theoretical foundation for achieving robustness and efficiency in sharded blockchains. This research not only contributes to addressing the scalability issues in sharded blockchains but also offers a new perspective for future research directions.

The construction of reinforced concrete (RC) structures inevitably consumes an excessive number of rebars, leading to significant cutting waste and carbon emissions. Extensive research has been conducted to minimize this issue and its consequences; however, these methods consistently consume a substantial number of rebars. This includes a previous study that utilizes the lap splice position optimization and special-length rebar concept without considering the lapping zone regulation. Moreover, conventional lap splices pose inherent drawbacks that could jeopardize the structural integrity of RC members. In contrast, mechanical couplers eliminate the need for rebar lapping, effectively reducing rebar consumption. This research aims to evaluate the impact of an integrated mechanical coupler and special-length-priority minimization algorithm on the reduction in rebar consumption and cutting waste in RC columns, achieving near-zero cutting waste. To validate the effectiveness of the proposed algorithm, it was applied to the column rebars of an RC building. The results revealed a significant reduction in ordered rebar consumption by 18.25%, accompanied by substantial reductions in cutting waste (8.93%), carbon emissions (12.99%), and total costs (10.81%) compared with a previous study. The outcomes provide the industry with insights into further reducing rebar consumption and its related consequences. Applying the proposed algorithm to various construction projects will further amplify the corresponding benefits.

Acoustic emission (AE) is caused by the sudden release of energy by a material as a result of material degradation related to deformation, crack, or fault within a solid. The same situation also occurs in leaks caused by turbulence in the fluid around the leak. In this study, analytical modeling for AE due to leakage through a circular pinhole in a gas storage cylinder was performed. The displacement fields responsible for AE, excited by the concentrated force (CF) associated with the turbulent flow though the pinhole, were derived by solving the Navier-Lamé equation. The CF as an excitation source was formulated in terms of a fluctuating Reynolds stress (FRS) and spatial Green’s function. In particular, a series of experiments were conducted under different operating conditions to explore the characteristics of the AE signals due to leak in a gas cylinder. Finally, the simulation and experimental results were compared to verify the accuracy of the simulation results.

This study aims to investigate the effects of chest mobilization and breathing exercises on respiratory function, trunk stability, and endurance in chronic stroke patients who have contracted coronavirus disease (COVID-19). Thirty inpatients of a tertiary hospital in South Korea, who had a history of COVID-19 and were diagnosed with stroke within the last 6 months were randomly assigned to either the Chest Mobilization Exercise with Breathing Exercise (CMEBE) or Conservative Physical Therapy with Breathing Exercise (CPTBE) groups. The respiratory function, trunk stability, and endurance were measured at baseline and 6 weeks after the interventions. Both CMEBE and CPTBE groups showed improvements in respiratory function, trunk stability, and endurance after the intervention (p<0.05). However, the CMEBE group showed significantly greater improvements in forced expiratory volume in 1 second (p<0.05), trunk stability (p<0.05), and endurance (p<0.05) than the CPTBE group. No significant intergroup difference was observed in forced vital capacity and peak expiratory flow. Conclusion: The combination of chest mobilization and breathing exercises improved respiratory muscle mobility and endurance, stabilized the trunk, and enhanced balance and transfer of weight. The findings suggest that this intervention could be beneficial in improving respiratory function and endurance in stroke patients.

This article explores the behavioral geography of the Hajj pilgrimage, focusing on the impact of the physical environment on pilgrims' behavior. Using qualitative research and analyzing religious literature and online publications, the study reveals significant findings. The spatial arrangement of the Grand Mosque, including the central courtyard and pillars, influences pilgrims' behavior during the Tawaf ritual. Environmental factors such as crowds and noise affect pilgrims' experiences, evoking anxiety while enhancing the ceremony's spiritual significance. Cultural and religious beliefs also shape pilgrims' behavior during the circumambulation. This study provides valuable insights into the multifaceted factors shaping pilgrims' behavior during the Hajj, including spatial organization, cultural influences, and social interactions. The findings can inform improvements in infrastructure, crowd management, and services to enhance the overall pilgrimage experience.

The association between the choice of general anesthetic agents and the risk of acute kidney injury (AKI) and long-term renal function after nephrectomy has not yet been evaluated. We reviewed 1087 cases of partial or radical nephrectomy. The incidence of postoperative AKI, new-onset chronic kidney disease (CKD) stage 3a and CKD upstaging were compared between different general anesthetic agent groups: propofol, sevoflurane, and desflurane. Four different propensity score analyses were performed to minimize confounding for each pair of comparison (propofol vs sevoflurane; propofol vs desflurane; sevoflurane vs desflurane; propofol vs volatile agents). Study outcomes were compared before and after matching. Kaplan-Meier survival curve analysis was performed to compare renal survival determined by the development of CKD stage 3a between groups up to 36 months after nephrectomy before and after matching. Propofol was associated with a lower incidence of AKI, CKD upstaging and a higher three-year renal survival after nephrectomy compared to sevoflurane or desflurane group after matching (AKI: propofol 23.2% vs. sevoflurane 39.5%, P=0.004, vs. desflurane 34.3%, P=0.031; CKD upstaging: propofol 27.2% vs. sevoflurane 58.4%, P<0.001, vs. desflurane 48.6%, P=0.017; Log-rank test propofol vs. sevoflurane P<0.001, vs. desflurane P=0.015). Propofol was also associated with a lower incidence of new-onset CKD after nephrectomy compared to sevoflurane after matching (P<0.001). However, there were no significant differences between sevoflurane and desflurane. In conclusion, propofol, compared to volatile agents, may be the reasonable choice of general anesthetic agent for nephrectomy to attenuate postoperative renal dysfunction. Randomized prospective trials are warranted to test this hypothesis.

In the paper, a fully discrete compact difference scheme with $O(\tau^{2}+h^{4})$ precision is established by considering the numerical approximation of the one-dimensional Allen-Cahn equation. The numerical solutions satisfy discrete maximum principle under reasonable step ratio and time step constraint is proved. And the energy stability for the fully discrete scheme is investigated. An example is finally presented to show the effectiveness of scheme.

The substitution of chemical fertilizers by organic manure plays a critical role in sustainable crop production. Nevertheless, organic amendments promote the global warming potential (GWP) in rice paddies due to increased methane (CH4) emissions. Increasing evidence shows that lime application can reduce CH4 emissions from acidic paddy soils, while it is still not clear whether liming can reduce the GWP in rice fields under organic manure substitution. A two-year field experiment was conducted to investigate the impacts of pig manure substitution and lime application on grain yield, CH4 and nitrous oxide (N2O) emissions in a subtropical double-cropped rice field in China. The experiment consisted of three treatments: chemical fertilization (CF, 100% N from urea), 50% of chemical N substituted by pig manure (1/2N + M), and the 1/2N + M treatment plus lime amendment (1/2N + M + L). On average, 1/2N + M reduced rice yield by 5.65% compared to CF, while lime application had no effect on rice yield. Mean cumulative CH4 emissions were 218.8% higher in 1/2N + M than in CF, whereas 1/2N + M + L reduced CH4 emissions by 36.6% compared to 1/2N + M. Neither pig manure substitution nor lime application affected N2O emissions. Consequently, 1/2N + M increased the GWP and greenhouse gas intensity (GHGI) by 214.6% and 228.3%, respectively, compared to CF. In contrast, 1/2N + M + L reduced the GWP and GHGI by 36.4% and 36.5% compared to 1/2N + M. Lime application can mitigate CH4 emissions and GWP induced by pig manure amendment in double-cropped rice fields.

Assessment of the genetic distinctiveness of a cultivar through morphological descriptors is an important tool for both the registration and the protection. New mango genotypes have been improved using valuable diverse germplasm resources to ensure food security. DNA fingerprinting based simple sequence repeats (SSR)-markers have been the most broadly used, effective and accurate in evaluation of genetic characterization of a cultivar. Molecular breeding is an effective source of genetic gain after improvement of fruit trees using marker assisted genomic selection. Mango (Mangifera indica L.) is an allotetraploid (2n = 4X= 40) drupe fruit and has high nutritional value belongs to genus Mangifera and family Anacardiaceae. Mango cultivars are used with worldwide acceptance to pharmacological, ethnomedical, and phytochemical industries. This study investigated the molecular evaluation of a new mango cultivar ‘Azeem Chaunsa’ using a set of the most effective 50 hyper-variable polymorphic SSR markers. Highly specific DNA fingerprints were identified in the genome of this mango cultivar, ‘Azeem Chaunsa’ compared with three standard cultivars such as Sindhri, Samar Bahisht (S.B) Chaunsa and Sufaid Chaunsa. Our results showed that SSR markers could efficiently assess genetic diversity in mango. An agglomerative hierarchical clustering method was used to construct dendrogram based on the ‘Unweighted Pair- Group Method with Arithmetic Mean’ (UPGMA). The genetic similarity coefficients were recorded between the mangos cultivars ranged from 0.49 to 0.67. Cultivar identification (CID) evaluates association among standard cultivars and Azeem Chaunsa and further concludes significant variations. CID results concluded that cultivar ‘Azeem Chaunsa’ varied significantly from the check cultivar, Sindhri (46.2%), S.B Chaunsa (45%) and Sufaid Chaunsa (46.7%). The results obtained in this study will orient cultivar identification strategies for a successful future mango breeding programmes in the context of climate change.

A series of water diversion projects to address the uneven distribution of water resources in China involve the construction of a large number of hydraulic tunnels. As the lining structure that maintains the stability and durability of the tunnels, it is prone to durability damage during the operation process, which in turn affects the water transmission safety and water supply capacity. Therefore, it is important to evaluate the durability of hydraulic tunnel lining structure. Considering the randomness and fuzziness of the factors affecting the durability of hydraulic tunnel lining structure, this paper proposes a comprehensive evaluation model based on the coupling of set-pair analysis and extension. The G1 method and the simple correlation function method are used to determine the subjective and objective weights of the evaluation indexes respectively, and the combination weight is assigned based on the principle of minimum entropy; the set-pair analysis principle is used to establish the linkage affiliation function, calculate the comprehensive linkage affiliation of the object to be evaluated, and the maximum affiliation principle is used to judge the durability level of the hydraulic tunnel lining structure. Finally, taking a section of hydraulic tunnel as an example, the model proposed in this paper is used to calculate its durability grade as Class III, with the set-pair potential SHI(H) = 7.5856, which is consistent with the actual engineering practice, and a comparative study is done in combination with the AHP-Extenics method. It is verified that the evaluation model can scientifically and reasonably evaluate the durability of hydraulic tunnel lining structure, providing a basis for subsequent maintenance and reinforcement.

Genome-scale metabolic models (GEMs) play an important role in the phenotype prediction of microorganisms, and their accuracy can be further improved by integrating other types of biological data such as enzyme concentrations and kinetic coefficients. Enzyme-constrained models (ecModels) have been constructed for several species and were successfully applied to increase the production of commodity chemicals. However, there was still no genome-scale ecModel for the important model organism Bacillus subtilis prior to this study. Here, we integrated enzyme kinetic and proteomic data to construct the first genome-scale ecModel of B. subtilis (ecBSU1) using the ECMpy workflow. We first used ecBSU1 to simulate overflow metabolism and explore the trade-off between biomass yield and enzyme usage efficiency. Then, we simulated the growth rate on eight previously published substrates and found that the simulation results of ecBSU1 were in good agreement with the literature. Finally, we identified target genes that enhance the yield of commodity chemicals using ecBSU1, most of which were consistent with the experimental data, and some of which may be potential novel targets for metabolic engineering. This work demonstrates that the integration of enzymatic constraints is an effective method to improve the performance of GEMs. The ecModel can predict overflow metabolism more precisely and can be used for the identification of target genes to guide the rational design of microbial cell factories.

In this study, we analyzed the microbial community of traditional fermented foods in Jeju Island to identify the distribution of useful microorganisms and confirm their anti-inflammatory and anti-melanogenic effects to determine their potential use as cosmetic ingredients. Firstly, we examined the microbial communities of Omphalius rusticus Jeotgal (OR), Spratelloides gracilis Jeotgal (SG), Chromis notata Jeotgal (CN), Turbo cornutus Jeotgal (TC), Trichiurus lepturus intestine Jeotgal (TL), Branchiostegus japonicus Sweet Rice Punch (BJ), Salted Anchovy Sauce (SA), Jeju Soy Sauce (JSS), and Jeju Soybean Paste (JSP). We found that Latilactobacillus sakei (87.2%), Tetragenococcus halophilus (37.7%), T. halophilus (96.8%), Bacillus subtilis (23.4%), T. halophilus (71.3%), L. sakei (53.7%), Lentibacillus sp. (42.9%), Enterococcus durans (14.6%), and E. durans (32.8%) were the dominant species. Secondly, to study the nine Jeju fermented foods’ anti-inflammatory and anti-melanogenic effects, we employed RAW 264.7 and B16F10 cells, classic cell models for inflammation and melanogenesis studies. Ethyl acetate extracts of the nine Jeju fermented foods all inhibited nitric oxide (NO) and melanin production in a concentration-dependent manner. Thirdly, to test the applicability of the nine Jeju fermented foods to human skin, we used the MTT assay to assess their cytotoxic effects on human keratinocytes (HaCaT cells). Finally, the topical applicability of the nine Jeju fermented foods was tested through primary skin irritation, and it was found that they did not cause any adverse effects. Therefore, extracts from the nine Jeju fermented foods have potential applications as ingredients in anti-inflammatory and anti-melanogenic products and can be used in the cosmetic industry.

A lead zirconate titanate [PZT;Pb(Zr_0.52Ti_0.48)O₃] layer embedded infrared (IR) detector decorated with wavelength-selective plasmonic crystals has been investigated for high-performance non-dispersive infrared (NDIR) spectroscopy. A plasmonic IR detector with an enhanced IR absorption band has been designed based on numerical simulations, fabricated by conventional microfabrication techniques, and characterized with a broadly tunable quantum cascade laser. The enhanced responsivity of the plasmonic IR detector at specific wavelength band has improved the performance of NDIR spectroscopy and pushed the limit of detection (LOD) by an order of magnitude. In this paper, a 13 fold enhancement in the LOD of a methane gas sensing using NDIR spectroscopy is demonstrated with the plasmonic IR detector.

Achieving eco-efficiency in agriculture production at low environmental costs is key to sustainable agriculture. Using the DEA-SBM model, this study evaluated the agricultural eco-efficiency of the 77 counties and districts in China’s Jiangsu province from 1999 to 2018 and analyzed its spatio-temporal evolution pattern and influencing factors. The mains conclusions were as follows: (1) The overall agricultural eco-efficiency and its decomposition terms, pure technology efficiency and scale efficiency, exhibited a fluctuating downward trend. The regional inequality in agricultural eco-efficiency had been widening and exhibited a strong positive spatial association. (2) The agricultural eco-efficiency in Jiangsu province presented a “high south and low north” spatial pattern. High-level agricultural eco-efficiency areas were in the Taihu Plain in Sunan, while low-level agricultural eco-efficiency zones are distributed across Subei City. The High-High-type spatial association pattern is concentrated in the Suzhou-Wuxi-Changzhou region, while the Low-Low areas are mainly in the coastal regions of Subei and Suzhong. (3) The spatial pattern of PTE and SE generally exhibited a “high south and low north” distribution. Areas with positive growth in agricultural eco-efficiency, PTE, and SE, were situated in Xuzhou, Nanjing city, and the bordering regions between Yangzhou and Huai’an, and Changzhou and Wuxi. (4) The excessive redundant use and application of pesticides, chemical fertilizer, agricultural diesel, labor, land, and agricultural carbon emission have been the primary factor affecting Jiangsu's agricultural eco-efficiency. Irrigation had also signficantly impacted agricultural eco-efficiency, while mechanical power and agricultural film had minimal effect. The majority of counties and districts in Subei, Suzhong, and Ningzhen Yang Hilly region have issues regarding their excessive usage of chemical fertilizer, pesticide, chemical fertilizer, agricultural diesel, labor, and land. The findings of this study can contribute towards a better understanding of agricultural eco-efficiency and spatial association effect and can help policymakers increase agricultural eco-efficiency.