Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

Tryptanthrin has not been widely applied in clinical practice due to its poor solubility and low bioavailability in spite of possessing several biological and pharmacological activities. Here, to improve the solubility of tryptanthrin, two types of novel tryptanthrin-loaded micelles were prepared. One was tryptanthrin physically encapsulated by distearoyl phosphatidylethanolamine polyethylene glycol (DSPE-PEG) and the other was pegylated tryptanthrin synthesized by acid-sensitive hydrazone bond and further prepared as micelles. Molecular imprinting technology was used to separate pegylated tryptanthrin and free mPEG-COOH in the preparation of PEGylated tryptanthrin micelles with considerably high separation efficiency. The solubility of tryptanthrin-loaded DSPE-PEG micelles (TDMs) and PEGylated tryptanthrin micelles (PTMs) was increased by 300 and 1493 fold compared with that of tryptanthrin, respectively. The PTMs increased the solubility of tryptanthrin more effectively and 95% of tryptanthrin was released from PTMs at pH 5.5 in 12 h. The cytotoxicity of PTMs decreased under physiological conditions compared with that of tryptanthrin, whereas at pH 5.5, the PTMs showed comparable cytotoxicity with that of tryptanthrin, indicating successful drug release from the carrier in response to tumor cell pH. Overall, we elucidated an efficient method to improve water solubility of tryptanthrin and indicated pegylated tryptanthrin is a promising prodrug.

Three monoruthenium complexes 1(PF6)23(PF6)2 bearing a N(CH3)-bridged ligand have been synthesized and characterized. These complexes have a general formula of [Ru(bpy)2(L)](PF6)2, where L is a 2,5-di(N-methyl-N-(pyrid-2-yl)amino)pyrazine (dapz) derivative with various substituents and bpy is 2,2′-bipyridine. The photophyscial and electrochemical properties of these compounds have been examined. The solid-state structure of complex 3(PF6)2 is studied by single crystal X-ray analysis. These complexes show two well-separated emission bands centered at 451 and 646 nm (max = 195 nm) for 1(PF6)2, 465 and 627 nm (max = 162 nm) for 2(PF6)2, and 455 and 608 nm (max = 153 nm) for 3(PF6)2 in dilute acetonitrile solution, respectively. The emission maxima of the higher-energy emission bands of these complexes are similar, while the lower-energy emission bands are dependent on the electronic nature of substituents. These complexes display two consecutive redox couples owing to the stepwise oxidation of the N(CH3)-bridged ligand and ruthenium component. In addition, density functional theory (DFT) and time-dependent density functional theory (TD-DFT) calculations are carried out to elucidate these experimental findings.

Traditional potential transformers have problems of large volume, difficulty in insulation, iron core saturation, ferroresonance overvoltage and poor transient response characteristics. The voltage sensor based on the principle of electric field coupling and differential input structure does not need to contact the measured object or ground, and can avoid the above problems. However, it requires a sufficiently high capacitance between the differential electrodes to obtain sufficient accuracy and a high voltage division ratio. The existing method of using mutual capacitance between the differential electrodes will cause many problems and fail to meet the practical needs. To solve the above problems, this paper innovatively uses multi-layer ceramic capacitor to replace the mutual capacitance and designs a new type of voltage sensor. In addition, by using single bypass small resistance grounding method to increase the input impedance of the differential signal processing circuit, error of the sensor is further reduced. The experimental results show that the sensor has excellent accuracy and great transient response characteristics. The ratio error under power frequency is within ±0.5% and the phase error is within 1. The ratio error in the range of 500 Hz∼30 kHz is within ±5% and the phase error is within 5. Moreover, it has the advantages of low cost, miniaturization, flexible shape and easy to adjust the voltage division ratio. These characteristics indicate that the sensor has good voltage measurement and sensor network potential.

We report an all-optical radio-frequency (RF) spectrum analyzer with a bandwidth greater than 5 terahertz (THz), based on a 50-cm long spiral waveguide in a CMOS-compatible high-index doped silica platform. By carefully mapping out the dispersion profile of the waveguides for different thicknesses, we identify the optimal design to achieve near zero dispersion in the C-band. To demonstrate the capability of the RF spectrum analyzer, we measure the optical output of a femtosecond fiber laser with an ultrafast optical RF spectrum in the terahertz regime.

Time-modulated sparse circular array (TMSCA) with elements uniformly excited is designed and synthesized in this paper. By utilizing rotationally symmetric structure, the array geometry and the time modulation of the TMSCA is presented, and the radiation patterns in frequency domain are formulated. In order to achieve the desired radiation pattern at the operating frequency and suppress the sideband radiation, the synthesis problem is established and solved by the proposed harmony search-convex programming (HS-CP) algorithm in two dependent optimizations. Two designs are presented, and the numerical results indicate that the TMSCA with rotationally symmetric structure has the advantages of designing time-modulated sparse arrays with superior performance.

Sracocystis cruzi in cattle (Bos taurus) and Sarcocystis poephagicanis in yaks (Bos grunniens) are morphologically indistinguishable. However, the relationship of the two parasites is still un-clear. Here, muscular tissues of the two domestic animals collected from abattoirs in China were examined for sarcocysts of S. cruzi and S. poephagicanis. The sarcocysts isolated from the samples were processed for light microscopy (LM), transmission electron microscopy (TEM), and DNA analysis. Sarcocysts of S. cruzi and S. poephagicanis were found in 405 of 950 (42.6%) cattle and 304 of 320 (95.0%) yaks, respectively. By LM and TEM, the sarcocysts of the two parasites showed similar morphologically characteristics. The thin-walled sarcocysts had hair-like protrusions on the surface. Ultrastructures exhibited the primary cyst wall contained irregularly folded, hirsute or bone-like protrusions. Four genetic markers, 18S rDNA, 28S rDNA, mitochondrial cox1, and apicoplast rpl6 of the two parasites were sequenced and analyzed. The sequences of the four loci presented an interspecific identity of 97.9−98.6%, 97.2−98.1%, 89.5−90.4%, and 96.9−97.2%, respec-tively. Phylogenetic analysis using 28S rDNA and cox1 sequences indicated that both species were placed into a group encompassing Sarcocystis spp. in ruminants with canid as known or putative definitive hosts. Sarcocystis cruzi and S. poephagicanis should represent separated species, and cox1 and rpl6 was suitable for distinguishing between them.

The coastal zone, situated at the sensitive interface between land and sea, serves as a pivotal area of extensive human economic activities. As one of China's economic special zones, Xiamen exemplifies the comprehensive trajectory of coastal governance in China. This research adopts an interdisciplinary approach grounded in historical geography and political ecology, employing data collection methods encompassing historical literature, field surveys, and interviews. The research findings indicate that:(1) The year 1994 witnessed the pivotal role played by the United Nations Convention on the Law of the Sea (UNCLOS) in connecting Jimei Peninsula from a local context to the international arena, thus signifying a momentous turning point in the process of scale reconstruction. However, the subsequent implementation of the Coastal Exclusion Policy in 2002 had detrimental consequences, leading to the disintegration of the local scale, the erosion of maritime culture, and the disregard for the livelihood security of displaced coastal populations.(2)The Coastal Exclusion Policy serves as an instrumental tool for implementing scale politics, while its functional realignment has had profound implications for the coastal zone, encompassing economic transformation, ecological degradation, and the marginalization of the socio-cultural fabric that intertwines humans and the coastal environment.

It is important for researchers in material domain to reconstruct and visualize the microstructure of alloy, which helps discover morphologies and properties that can only be found in three dimensional and microscopic space. However, because of the limitation of state-of-the-art sensors, the internal microstructure of the material is not easy to obtain. In this paper, a novel automatic 3D reconstruction method is proposed using diffraction contrast tomography technology to capture the 3D microstructure of Al-La alloy. The pipeline of the proposed method starts from the imaging of Al-La alloy with the LabDCT technique from Carl Zeiss AG, which produces a sequence of 2D microstructure sections. Then, a segmentation algorithm based on superpixel and lifted multicut is proposed to extract the 2D microstructure in an image section. Finally, 2D segmentations are joined together to reconstruct and visulize the 3D microstructure. As a result, a novel morphology of Al-La alloy is recovered with both dendrite and lamellar morphologies. The proposed method has the advantage of the ability to losslessly recover the internal microstructure.

In this paper a high-power and propellant-free electromagnetic propulsion is proposed based on the General Relativity and nuclear fusion technology. We find that Riemann curvature vanish and geodesic motion is free from gravitational field locally in a special space-time, which demonstrates the feasibility of propellant-free electromagnetic propulsion. To achieve high-power propulsion in Schwarzschild background, we choose current loop as axisymmetric field source and obtain exact solution of Einstein-Maxwell field equation using Killing symmetry and Ernst generation technique. An implementation with superconductor shield is given according to the Meissner effect, calculation implies that the device can be sufficiently free from gravitational field with the aid of existing nuclear fusion engineering.

In the present work, a predictive modelling and optimization with the adaptive network based fuzzy inference system(ANFIS) modelling of mechanical properties of laser-coated NB/SiC/Ni welds was studied based on Taguchi design by laser cladding. An ANFIS model based on a Sugeno type fuzzy inference system was developed for predicting the hardness properties of SiC/BN/Ni welds by laser cladding with experimental data required for network training and prediction. Based on analysis of variance, three important factors were taken as inputs for the fuzzy logic inferences, while the hardness properties was taken as the output of the ANFIS. The microstructure of welds were analysed using scanning electron microscopy with an energy dispersive X-Ray spectrometer. Highly developed leaf-like dendrites and eutectic crystals were found in some areas of the melting zone for the BN/SiC/Ni weld, which was significantly hardened. The ANFIS model based on Taguchi's design provides a better pattern of response because the predicted and experimental values were highly similar. As a result, a satisfactory result was achieved between the predicted and experimental values of hardness in laser-coated NB/SiC/Ni welds, whereby the success and validity of the method was verified.

The accompanying mechanical behavior during the flow of ore-rock dispersion is an important factor leading to the instability and failure of the orepass in the ore storage section. It is of great significance to accurately understand the instability characteristics of the well wall in the ore section, during the ore drawing process by understanding the flow characteristics and internal mechanical transfer mechanism of ore-rock dispersion. Using the discrete element method to analyze the flow characteristics, contact compactness, stress distribution characteristics and contact force probability distribution of the ore-rock dispersion, it realizes the quantitative characterization of the damage degree of ore-rock flow, and reveals the damage mechanism of mine storage wall. The results show that: (1) The friction between ore-rock particles, between ore-rock and well wall is an important reason for the change of the macroscopic flow form of ore-rock from “one” to “V” type. (2) The compactness and stress concentration of ores are increasing with the increase of storage depth, which is shown that with the increase of storage depth, the greater the probability of well wall instability. (3) The probability distribution of contact force strength between particles decreases exponentially in the whole process of ore drawing, in which the strong chain plays a major role in the stability of the dispersion system. (4) The number of overpressure and the overpressure coefficient can be used to quantitatively characterize the wall damage degree under the action of ore-rock flow. The dynamic side pressure decreases periodically in the form of exponential fluctuations, and the dynamic load formed by the ore-rock flow mainly played a role in the lower area of the ore storage section.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

This article investigates the impact of the foreign background of women directors on a firm’s corporate social responsibility (CSR) disclosure and performance. Using a dataset on listed firms on Shanghai and Shenzhen stock exchange from 2010 to 2019, we find that corporate boards with a higher proportion of women directors with foreign education experience tend to disclose more CSR information. CSR performance is also improved when there is a greater proportion of women directors with foreign education and work experience on a board. This study provides new insights into integrating stakeholder, social role, and neo-institutional theories to advance the understanding of CSR engagement in emerging economies.

We demonstrate high quality (intrinsic Q factor ~2.8×106) racetrack microresonators fabricated on lithium niobate (LN) thin film with a free spectral range (FSR) of ~86.38 pm. By integrating microelectrodes alongside the two straight arms of the racetrack resonator, the resonance wavelength around the 1550 nm can be red shifted by 92 pm when the electric voltage is raised from -100 V to 100 V. The microresonators of the tuning range spanning over a full FSR is fabricated using photolithography assisted chemo-mechanical etching (photolithography assisted chemo-mechanical etching, PLACE).

For underwater vehicles navigating in Arctic Sea ice-covered waters, fatigue damage is a crucial issue. Many scholars have conducted low-temperature fatigue analysis on low-temperature ma-terials and substrate platforms for ships, and the results show that low-temperature is beneficial for improving the mechanical properties of materials. However, they mainly focus on low-temperature performance experiments and simulation analysis of standard components of materials, and there are very few fatigue life experimental studies on underwater vehicle me-chanical structures. This paper conducts experimental investigations on a scaled model of an underwater vehicle rudder mechanism in a polar environment laboratory. Using a comparative analysis method involving simulations and experiments, the low-temperature fatigue test data of the scaled underwater vehicle rudder mechanism are analyzed, and the quantified analysis be-tween fatigue and different low-temperature loading cycles, as well as the influence of icing on the fatigue life, is explored. It is indicated that the arctic environment can decrease the fatigue life of the underwater vehicle rudder mechanism by deteriorating its material properties. The paper builds the foundation for the fatigue life of an underwater vehicle rudder mechanism in arctic low-temperature environments.

Polypropylene (PP) foam has a great deal of application since it normally exhibits non-uniform cell size distribution, low cell density, and cracked cells. In this study, a small amount of fluoroelastomer (FKM) was used as a nucleating agent to prepare well-defined microporous PP foam by supercritical CO₂. It was observed that solid FKM was present as the nanoscale independent phase in PP matrix and the FKM could induce a mass of CO₂ aggregation, which significantly enhanced the diffusion rate of CO₂ in PP. The resultant PP/FKM foams exhibited much smaller cell size (～24 μm), and more than 16 times cell density (3.2×10⁸ cells/cm³) as well as a much more uniform cell size distribution than that of the neat PP foam. PP/FKM foams possessed major concurrent enhancement in their tensile stress and compressive stress compared to neat PP foam. We believed that the added FKM played a key role in enhancing the heterogeneous nucleation, combined with the local strain field variation in the multiple-phase system, which was responsible for the considerably improved cell morphology of PP foaming. This paper provides a deep understanding of the scCO₂ foaming behavior of PP in the presence of FKM.

In this study, the multi-relaxation-time lattice Boltzmann method is applied to investigate the oscillatory instability of lid-driven flows in two-dimensional semi-elliptical cavities with different vertical to horizontal aspect ratios K in the range of 1.0--3.0. The program implemented in this study is parallelized using CUDA (compute unified device architecture), a parallel computing platform, and computations are carried out on NVIDIA Tesla K40c GPU. To carry out precise calculations, the CUDA algorithm is extensively investigated, and its parallel efficiency indicates that the maximum speedup is 47.6 times faster. Furthermore, the steady--oscillatory Reynolds numbers are predicted by implementing the CUDA-based programs. The amplitude coefficient is defined to quantify the time-dependent oscillation of the velocity magnitude at the monitoring point. The simulation results indicate that the transition Reynolds numbers correlate negatively with the aspect ratio of the semi-elliptical cavity, and are smaller than those of the rectangular cavity at the same aspect ratio. In addition, the detailed vortex structures of the semi-elliptical cavity within a single period are also investigated when the Reynolds number is larger than the steady--oscillatory value to determine the effects of periodic oscillation of the velocity magnitude.

The 2015 Dietary Guidelines for Americans recommends that individuals should eat as little dietary cholesterol as possible. However, current dietary cholesterol intake and its food sources have not been well-characterized. We examined dietary cholesterol intake by age, sex, race, and food sources using 24-hour dietary recall data from a nationally representative sample of 5047 adults aged 20 years or older who participated in NHANES (2013–2014 survey cycle). We also reported trends in cholesterol intake across the past 7 NHANES surveys. Mean dietary cholesterol intake was 293 mg/day (348 mg/day for males and 242 mg/day for females) in the 2013–2014 survey cycle; 39% of adults had dietary cholesterol intake above 300 mg/day (46% for males and 28% for females). Meat, eggs, grain products, and milk were the highest four food sources of cholesterol, contributing to 96% of the total consumption. Both average cholesterol intake and food source varied by age, sex, and race (each p < 0.05). Mean cholesterol intake of the overall population had been relatively constant at ~290 mg/day from 2001–2002 to 2013–2014 (p-trend = 0.98). These results should inform public health efforts in implementing dietary guidelines and tailoring dietary recommendations.

Background: Iron chelation medications (desferoxamine, desferasirox, desferiprone) are used to manage iron overload. These medications are partially excreted via the kidneys, desferoxamine and desferiprone excretes primarily in the urine, and desferasirox had about 8% excreted in the urine. Their use in severe kidney disease and dialysis patients is caution as “avoided” concerning adverse effects; however, there are reports safe use. This manuscript reviews the literature in this population. Data Sources: Pubmed: desferasirox, deferiprone, deferoxamine, kidney disease, ESKD, Dialysis. Case reports and case series that described experiences with using iron chelation medications in ESKD patients are included. Data also gathered from reading-related sources. Results: This is a review of desferoxamine, desferasirox, and deferiprone use in kidney disease from 1976 to the present time. Table 1 provides a summary of findings. These are mostly reports and brief descriptions of the experiences used in severe kidney disease and dialysis, but lack of randomized control trials and small number of participants. Conclusions: Iron chelation medications are important for treating iron overload but concerns with adverse effects. Due to limited medications available to treat iron overload in patients with severe kidney disease, their safe use has been reporting in the literature. This is an area that warrants further research.

The harmful nature of high concentrations of antibiotics to humans and animals requires urgent development of novel materials and techniques for their absorption. In this work, CTAB (Cetyltrimethyl Ammonium Bromide)-assisted synthesis of ZIF-8 (zeolitic imidazolate framework) derived hollow carbon (ZHC) was designed, prepared and used as a high-performance adsorbent, further evaluated by Langmuir and Freundlich isothermal adsorption experiments, dynamic analysis as well as theoretical calculation. The maximum capacities of ZHC on adsorbing tetracycline (TC), norfloxacin (NFO) and levofloxacin (OFO) are 267.3, 125.6 and 227.8 mg g^-1, respectively, which delivers superior adsorptive performance when compared to widely studied inorganic adsorbates. The design concept of ZIFs-derived hollow carbon material provides guidance and insights for the efficient adsorbent of environmental antibiotics.

Biomimetic delivery systems (BDSs), inspired by the intricate designs of biological systems, have emerged as a groundbreaking paradigm in nanomedicine, offering unparalleled advantages in therapeutic delivery. These systems, encompassing platforms such as liposomes, protein-based nanoparticles, extracellular vesicles, and polysaccharides, are lauded for their targeted delivery, minimized side effects, and enhanced therapeutic outcomes. However, the translation of BDSs from research settings to clinical applications is fraught with challenges, including reproducibility concerns, physiological stability, and rigorous efficacy and safety evaluations. Furthermore, the innovative nature of BDSs demands a reevaluation and evolution of existing regulatory and ethical frameworks. This review provides an overview of BDSs, delve into the multifaceted translational challenges and present emerging solutions, underscored by real-world case studies. Emphasizing the potential of BDSs to redefine healthcare, we advocate for sustained interdisciplinary collaboration and research. As our understanding of biological systems deepens, the future of BDSs in clinical translation appears promising, with a focus on personalized medicine and refined patient-specific delivery systems.

In this paper, a new method by combining cold drawing and martensitic transformation was proposed to produce ultrahigh-strength steel wire, and the effect of austenitizing heating rate on microstructure and mechanical properties was studied. Compared with Muffle furnace heating, salt bath heating has a much higher austenitizing heating rate, which is beneficial to obtain ultrafine-grained martensite for steel wire with a larger section. By salt bath hardening and low-temperature tempering, an ultrahigh strong (strength of 2.48 GPa) and tough (elongation of 6.0%) steel wire was produced. Moreover, to explore whether is it possible to replace long-time low-temperature tempering with short-time tempering at elevated temperatures to improve the tempering efficiency, the effect of tempering time on the evolution of microstructure and mechanical properties of the steel wires tempered at 350 °C was systematically studied. The results demonstrate that tempering at 350 °C for 30 s can endow the steel wire with comparable mechanical properties to that of the one tempered at 250 °C for 2 h. With tempering time prolonging, the strength decreases gradually with the precipitated phase transition from χ-Fe5C2 carbide into θ-Fe3C carbide and coarsening, which plays a major role in the strength decrease.

In order to solve the problem of feature extraction of underwater acoustic signals in complex ocean environment, a new method for feature extraction from ship radiated noise is presented based on empirical mode decomposition theory and permutation entropy. It analyzes the separability for permutation entropies of the intrinsic mode functions of three types of ship radiated noise signals, and discusses the permutation entropy of the intrinsic mode function with the highest energy. In this study, ship radiated noise signals measured from three types of ships are decomposed into a set of intrinsic mode functions with empirical mode decomposition method. Then, the permutation entropies of all intrinsic mode functions are calculated with appropriate parameters. The permutation entropies are obviously different in the intrinsic mode functions with the highest energy, thus, the permutation entropy of the intrinsic mode function with the highest energy is regarded as a new characteristic parameter to extract the feature of ship radiated noise. After that, the characteristic parameters, namely, the energy difference between high and low frequency, permutation entropy, and multi-scale permutation entropy, are compared with the permutation entropy of the intrinsic mode function with the highest energy. It is discovered that the four characteristic parameters are at the same level for similar ships, however, there are differences in the parameters for different types of ships. The results demonstrate that the permutation entropy of the intrinsic mode function with the highest energy is better in separability as the characteristic parameter than the other three parameters by comparing their fluctuation ranges and the average values of the four characteristic parameters. Hence, the feature of ship radiated noise can be extracted efficiently with the method.

Public participation is crucial in the process of urban governance in smart-city initiatives to enable urban planners and policy makers to take account of the real public needs. Our study aims to develop an analytical framework using citizen-centred qualitative data to analyse urban problems and identify the areas most needed for urban governance. Taking a Chinese megacity as the study area, we first utilise a web-crawling tool to retrieve public comments from an online comment board and employ the Baidu Application Programming Interfaces and a qualitative content analysis for data reclassification. We then analyse the urban problems reflected by negative comments in terms of their statistical and spatial distribution, and the associative factors to explain their formation. Our findings show that urban problems are dominantly related to construction and housing, and most frequently appear in industry-oriented areas and newly-developed economic development zones on the urban fringe, where the reconciling of government-centered governance and private governance by real estate developers and property management companies are most needed. Areas with higher land price and a higher proportion of aged population tend to have less urban problems, while various types of civil facilities affect the prevalence of urban problems differently.

The traditional receiver employs scalar tracking loops, resulting in degraded navigation performance in weak signal and high dynamic scenarios. An innovative design of a vector tracking receiver based on nonlinear Kalman filter (KF) tracking loops is proposed in this paper, which combines the strengths of both vector tracking and KF tracking loops. Firstly, a comprehensive description of the vector tracking receiver model is presented, and unscented Kalman filter (UKF) is applied to nonlinear tracking loop. Secondly, to enhance the stability and robustness of the KF tracking loop, we introduce square root filtering and an adaptive mechanism. The tracking loop based on square root UKF (SRUKF) can dynamically adjust its filtering parameters based on signal noise and feedback Doppler error. Finally, the proposed method is implemented on a software-defined receiver (SDR), and the field vehicle experiment demonstrates the superiority of this method over other receivers in complex dynamic environments.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

This study explores the relationship between mental and physical therapeutic through three dimensions: man-environment relationships; a sense of place and symbolic landscapes. The study used a combination of qualitative and quantitative research methods. Local residents living in the coastal area of Xinglin Bay are the research objects. Quantitative data analysis revealed that the frequency of residents' visits was an important variable affecting their physical and treatment perceptions. In addition, the significance is higher for females than for males. The text analysis shows that the environment, especially the ecological restoration of water quality and migratory birds, is of great significance to the identity of local residents. Daily activities contribute to a sense of place and are what make the coast a place of therapeutic landscape function.

In this paper, we consider the fourth-order parabolic equations with integer and fractional order time derivatives with Neumann boundary conditions. The integer order time derivatives are approximated by backward Euler difference quotients, and the fractional order time derivatives are approximated by L1 interpolation. We propose the block-centered finite difference scheme for fourth-order parabolic equations of integer and fractional order time derivatives. We prove the stability of the block-centered finite difference scheme and the second-order convergence of the discrete L2 norms of the approximate solution and its derivatives of every order. Numerical examples are given to verify the effectiveness of the block-centered finite difference scheme.

This paper focuses on processing low oversampling echo data of staggered synthetic aperture radar (SAR). In staggered mode, the non-uniformly sampling and irregular loss of echo data cause azimuth ambiguity which severely degrades the imaging quality. To solve this problem, we propose a compressed sensing (CS) method in which the non-uniform fast Fourier transform (NUFFT) technique is adopted to obtain uniform azimuth spectrum, and the fast iterative shrinkage thresholding algorithm (FISTA) is utilized to efficiently reconstruct the ambiguity-free image from in-complete echo data. Simulation results demonstrate the proposed method can effectively suppress the azimuth ambiguity in the vicinity of targets.

Here, we present a series of novel block copolymers (BCP) from bio-derived monomers, poly(lactic acid)-block-poly(2,5-furandimethylene succinate) (PLA-b-PFS), in which the furan groups from PFS block can be crosslinked with bis(maleimido) triethylene glycol (M2) through a Diels-Alder reaction. This dynamic crosslinking reaction leads to a network structure for enhancing the mechanical properties compared to their linear BCP analogous. Decreasing the crosslinking density leads to a decrease of glass transition temperature of BCPs and a transition from glassy to rubbery-like behavior at room temperature. This allows a wide tunablity of both elastic moduli and yields of the materials. For the lowest crosslinking density. the material exhibits an over 50% self-healing efficiency at room temperature after five days, attributed to the low Tg (15.2 C) from the introduction of PFS block, allowing sufficient chain mobility for structure re-organization. Moreover, with the appropriate selection of crosslinking density (PLA-b-PFS/M2 (6/1)), it also shows an excellent shape memory property with a high recovery rate of 96.3% and a fixity rate of 97.3%. The permanent shape can be rewriteable due to the reversibility of Diels-Alder reaction. With these advanced functionalities and ease in large-scale fabrication, the PLA-b-PFS/M2 shows great promises for self-healing coatings or films with shape memory properties in a wide variety of applications such as packaging materials

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

The outbreak of recently identified 2019 novel coronavirus (2019-nCOV) infection has become a world-wide health threat. Currently, more information is needed for further understanding the transmission, clinical characteristics, and infection control procedures of 2019-nCOV. Recently, the role of the eye in transmitting 2019-nCOV has been intensively discussed. Previous investigations about other high infectious human COVs, that is, severe acute respiratory syndrome coronavirus (SARS-CoV) and the Middle East respiratory syndrome coronavirus (MERS-CoV), may provide helpful information. In this review, we describe the genomics and morphology of human CoVs, the epidemiology, systemic and ophthalmic manifestations, mechanisms of human CoVs infection, and infection control procedures. The role of the eye in the transmission of SARS-CoV and 2019-nCOV is discussed. Although the conjunctiva is directly exposed to extraocular pathogens, and the mucosa of ocular surface and upper respiratory tract is connected by nasolacrimal duct and share same entry receptors for some respiratory viruses. The eye is rarely involved in human CoVs infection, conjunctivitis is quite rare in patients with SARS-CoV and 2019-nCoV infection, and COV RNA positive rate by RT-PCR test in tears and conjunctival secretions from patients with SARS-CoV and 2019-nCoV infection is also very low, which imply that the eye is neither a preferred organ of human COVs infection, nor is a preferred gateway of entry for human COVs to infect respiratory tract. However, pathogens exposed to the ocular surface might be transported to nasal and nasopharyngeal mucosa by constant tear rinsing through lacrimal duct, and then cause respiratory tract infection. Considering close doctor-patient contact is quite common in ophthalmic practice which are apt to transmit human COVs by droplets and fomites, hand hygiene and personal protection are still highly recommended for health care workers to avoid hospital-related viral transmission during ophthalmic practice.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

In order to coordinate the damping performance and energy regenerative performance of energy regenerative suspension, this paper proposes a structure of vehicle semi-active energy regenerative suspension with electro-hydraulic actuator (EHA). In light of the proposed concept, a specific energy regenerative scheme is designed and the mechanical properties test is carried out. Based on the test results, the parameter identification for the system model is conducted using recursive least squares algorithm. On the basis of system principle, the nonlinear model of the semi-active energy regenerative suspension with EHA is built. Meanwhile, LQG control strategy of the system is designed. And then the influence of the main parameters of EHA on the damping performance and energy regenerative performance of suspension is analyzed. Finally, the main parameters of EHA actuator are optimized via genetic algorithm. The test results show that when sinusoidal is input at the frequency of 2Hz and the amplitude of 30mm, the spring mass acceleration RMS value of optimized EHA semi-active energy regenerative suspension is reduced by 22.23% and energy regenerative power RMS value is increased by 40.51%, which means while meeting the requirements of certain vehicle ride comfort and driving safety, energy regenerative performance is improved significantly.

Nanopowders are continuously under investigation as they open new perspectives in numerous fields. There are two main challenges to stimulate their development: sufficient low-cost high throughput synthesis methods leading to a production with well-defined and reproducible properties, and for ceramics, conservation of their nanostructure after sintering. In this context, this paper presents the synthesis of a pure nanosized powder of ZnO (dv₅₀ ~ 60 nm, easily redispersable) by using a continuous Segmented Flow Tubular Reactor (SFTR), which has previously shown its versatility and its robustness, ensuring a high powder quality and reproducibility over time. A higher scale of production can be achieved based on a “scale-out” concept by replicating the tubular reactors. The sinterability of ZnO nanopowders synthesized by the SFTR was studied, by natural sintering at 900 °C and 1100 °C, and Spark Plasma Sintering (SPS) at 900 °C. The performances of the synthesized nanopowder were compared to a commercial ZnO nanopowder of high quality. The samples obtained from the synthesized nanopowder could not be densified at low temperature by traditional sintering, whereas SPS led to a fully dense material after only 5 minutes at 900 °C, while limiting the grain growth and thus leading to a nanostructured material.

Leaf variegation pale yellowing is observed in the Calcineurin B-Like-Interacting Protein Kinase14 (CIPK14) overexpression line (oeCIPK14) and double knockout WHIRLY1/WHIRLY3 (why1/3) lines of Arabidopsis, the distribution of WHIRLY1 (WHY1) protein between plastids and the nucleus are affected by the phosphorylation of WHY1 by CIPK14. To elucidate the coregulation of CIPK14 and WHIRLY1/WHIRLY3 mediated leaf pale yellowing, a differential proteomic analysis is conducted between the oeCIPK14 variegated (oeCIPK14-var) line, why1/3 variegated (why1/3-var) line and wild type (WT). More than 800 protein spots are distinguished on each gel, 67 differential abundance proteins (DAPs) are identified by matrix-assisted laser desorption ionization-time of flight/time of flight mass spectrometry (MALDI-TOF/TOF-MS), of which, 34 DAPs are in the oeCIPK14-var, 33 DAPs are in the why1/3-var compared to WT. Five overlapping proteins differentially change both in the oeCIPK14-var and in the why1/3-var. They are ATP-dependent Clp protease proteolytic subunit-related protein 3 (ClpR3), Ribulose bisphosphate carboxylase large chain (RBL), Beta-amylase 3 (BAM3), Ribosome-recycling factor (RRF), Ribulose bisphosphate carboxylase small chain (RBS). Bioinformatics analysis show that most of DAPs are involved in photosynthesis, defense and antioxidation pathway, protein metabolism, amino acid metabolism, energy metabolism, malate biosynthesis, lipid metabolism and transcription. Thus, the photosystem parameters are measured that the content of chlorophyll, the photochemical efficiency of PSⅡ (Fv/Fm), and electron transport rates (ETR) decrease in the why1/3-var and oeCIPK14-var, but the non-photochemical quenching (NPQ) increases. Both mutants show high sensitivity to strong light. Based on the annotation of DAPs from both why1/3-var and oeCIPK14-var lines, we conclude that CIPK14 phosphorylation mediated WHY1 deficiency in plastids is related to impairment of protein metabolism leading to chloroplast dysfunction.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

In addition to provide an extremely clean environment for primary loop of high-temperature gas-cooled reactor (HTR), the primary helium circulator (PHC) using electromagnetic levitation technology also provides an effective means for vibration control. Besides synchronous vibration produced by mass imbalance and sensor runout, double-frequency vibration produced by unbalanced magnetic pull (UMP) is serious in PHC engineering prototype (PHC-EP). In this paper, we firstly analyzed the mechanism of UMP and the multi-frequency vibration characteristics in combination with the PHC-EP. Then we put forward a distributed iterative learning control (ILC) algorithm and a parallel control scheme to suppress the periodic vibrations. Finally, we verified the methods by carrying out experimental researches on the active magnetic bearing (AMB) bench of PHC-EP. The results show that the methods put forward in this paper have significant control effect on the double-frequency vibration generated by UMP of the PHC-EP, and provide theoretical and practical references for the PHC safe operation in HTR.

The positional deviation of the Automatic Emergency Call System (AECS) under collision conditions brings difficulties for post-rescue operations. Currently, there is a lack of analysis on the system operating conditions during collisions in the reliability assessment methods for the Global Navigation Satellite System (GNSS) deployed in AECS. Therefore, this paper establishes an in-vehicle collision environment simulation model for emergency calls to explore the influence of parameters such as temperature and vibration on the data deviation of the simulated GNSS system. We also propose environmental limits applicable to comprehensive AECS tests, which can objec-tively evaluate the reliability of AECS and provide data support for AECS bench test. Through the satellite signal-based semi-physical simulation, AECS is subjected to bench test under different operating conditions. The findings of this study demonstrate that the occurrence of random vibra-tion and impact stress, induced by vibration, exerts considerable disruptive effects on positional signal data during collisions. Consequently, it leads to substantial interference with the accurate detection of post-collision satellite positioning information. When the simulation operates under a 2.4gRMS vibration condition, the maximum phase noise error in the positioning system is 8.95%, which does not meet the AECS test accuracy requirements. On the other hand, the semi-simulation system is less affected by temperature changes, and at the maximum allowable temperature dif-ference of the equipment, the maximum phase noise error in the simulated signal is 2.12%. Therefore, based on the influence of phase noise variation on the accuracy of satellite signal simulation, nec-essary environmental conditions for AECS test are obtained, including the temperature consistent with the maximum operating temperature of the vector generator and the vibration Power Spectral Density (PSD) lower than 1.2gRMS.

Both bacteria product flagellin and macrophages are implicated in HIV infection/disease progression. However, the impact of their interaction on HIV infection and the associated mechanisms remain to be determined. We thus examined the effect of the flagellins on HIV infection of primary human macrophages. We observed that the pretreatment of macrophages with the flagellins from the different bacteria significantly inhibited HIV infection. The mechanistic investigation showed that the flagellin treatment of macrophages downregulated the major HIV entry receptors (CD4 and CCR5) and upregulated the CC chemokines (MIP-1α, MIP-1β, and RANTES), the ligands of CCR5. These effects of the flagellin could be compromised by a toll like receptor 5 (TLR5) antagonist. Given the important role of flagellin as a vaccine adjuvant in TLR5 activation-mediated immune regulation and in HIV infection of macrophages, future investigations are necessary to determine the in vivo impact of flagellin-TLR5 interaction on macrophage-mediated innate immunity against HIV infection and the effectiveness of flagellin adjuvant-based vaccines studies.

Normal function of placental extravillous trophoblasts (EVTs), which are responsible for uteroplacental vascular remodeling, is critical for adequate delivery of oxygen and nutrients to the developing fetus and normal fetal programming. Proliferation and invasion of spiral arteries by EVTs depends upon adequate levels of folate. Multidrug resistance-associated protein 1 (MRP1), which is an efflux transporter, is known to remove folate from these cells. We hypothesized that palmitic acid increases MRP1-mediated folate removal from EVTs, thereby interfering with EVTs’ role in early placental vascular remodeling. HTR-8/SVneo and Swan-71 cells, first trimester human EVTs, were grown in the absence or presence of 0.5 mM and 0.7 mM palmitic acid, respectively, for 72 h. Palmitic acid increased ABCC1 gene expression and MRP1 protein expression in both cell lines. The rate of folate efflux from the cells into the media increased with a decrease in migration and invasion functions in the cultured cells. Treatment with N-acetyl cysteine (NAC) prevented the palmitic acid mediated upregulation of MRP1 and restored invasion and migration in the EVTs. Finally, in an ABCC1 knockout subline of Swan-71 cells, there was a significant increase in invasion and migration functions. The novel finding in this study that palmitic acid increases MRP1-mediated folate efflux provides a missing link that helps to explain how maternal consumption of saturated fatty acids compromises the in-utero environment.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Studies on human mobility have a long history with increasingly strong connections to multi-disciplines across social science, environmental science, information and technology, computer science, engineering, and health science. However, what is lacking in the current research is a summary of studies on human mobility to identify the evolutional pathway and future research directions. To address this gap, we conduct a systematic review of human mobility-related studies published from 1990 to 2020. Drawing on the selected publications retrieved from the Web of Science, we conduct a bibliometric analysis and network visualisation by CiteSpace and VOSviewer on publication years and numbers, authors and their countries and afflictions, citations, topics, abstracts, keyword, and journals. Our findings show that human mobility-related studies have become increasingly interdisciplinary and multi-dimensional, enhanced by the involvement of multi-source big data, the development of technologies, the innovation of modelling approaches, and the novel applications in various areas. We also summarise four future research directions proposed by top cited authors and mobility studies, in terms of data sources, modelling methods, applications, and technologies. We advocate in-depth research on human mobility to address real-world problems and contribute to social good as promising future orientations through integrating multi-source big data and advanced modelling methods facilitated by artificial intelligence, and machine and deep learning.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

A simple solid acid catalyst γ-AlOOH was employed to synthesize 5-hydroxymethylfurfural (HMF) from glucose in the dimethyl sulfoxide. Various reaction parameters, such as catalyst loading, temperature, reaction duration and solvent, were investigated. A high HMF yield of 61.24 % was obtained at the mild reaction condition of 130 °C for 3 h. More importantly, the catalyst γ-AlOOH could be reused for several times without the loss of its significant catalytic activities. After five reaction runs, a HMF yield about 57.23 % was obtained. In addition, the results demonstrated that the γ-AlOOH also had high catalytic activities on the degradation of other polysaccharides, like Maltose, Sucrose and Cellulose, into HMF using ionic liquid 1-butyl-3-methylimidazolium chloride, DMSO and a small amount of water as the reaction solvents. For instance, a high HMF yield of 50.26 % was obtained at 170 °C for 2.5 h on the decomposition of Cellulose.

Flexible and stretchable conductive materials have received significant attention in several applications such as flexible displays and sensors. In this paper, we report a highly dispersed porous Ag nanoflakes with clean surfaces were fabricated through an explosive growth process. The evolution process from silver nanoflakes to nanomeshes occurred by the novel “dissolution–recrystallization” solvothermal process. The as-obtained Ag meshes have the dual nature of nanoflakes and nanoparticles, which could create an intercross and interpenetration conductive network structures between silver and polymer in the printed elastic conductor, therefore, the silver meshes as conductive fillers used in elastic conductor simultaneously exhibit high conductivity and mechanical durability.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

With the spread of compulsory education emerged school management problems continued, and the quality of school management in compulsory education has attracted a great deal of attention in China. However, the application of information technology in the field is not yet detailed and wide, resulting in problems of heavy workload and high difficulty in the whole evaluation process. Accordingly, we use big data technologies such as Apache Spark, Apache Hive, and SPSS to carry out data cleaning, correlation analysis, dynamic factor analysis, principal component analysis, and visual display on 1760 sample data from 40 primary and secondary schools in Q Province in China, and constructs a model school management of quality evaluation in the compulsory education stage, which reduces the 22 management tasks required for previous evaluation to 5, greatly reducing the workload and difficulty of evaluation. It has improved the efficiency and accuracy of evaluation, and further promoted the simultaneous development of education of five domains and education equity in the compulsory education stage.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

Schizophrenia (SCZ) is a severe mental disorder that may result in hallucinations, delusions, and extremely disordered thinking. How each cell type in the brain contributes to SCZ occurrence is still unclear. Here, we leveraged the human dorsolateral prefrontal cortex bulk RNA-seq data, then used the RNA-seq deconvolution algorithm CIBERSORTx to generate SCZ brain single-cell RNA-seq data for a comprehensive analysis to understand SCZ-associated brain cell types and gene expression changes. Firstly, we observed that the proportions of brain cell types in SCZ differed from normal samples. Among these cell types, astrocyte, pericyte, and PAX6 cells were found to have a higher proportion in SCZ patients (astrocyte: SCZ = 0.163, Control = 0.145, P.adj = 4.9×10-4; pericyte: SCZ = 0.057, Control = 0.066, P.adj = 1.1×10-4; PAX6 : SCZ = 0.014, Control = 0.011, P.adj = 0.014), while the L5/6_IT_CAR3 cells and LAMP5 cells are the exact opposite (L5/6_IT_Car3 : SCZ = 0.102, Control = 0.108, P.adj = 0.016; LAMP5 : SCZ = 0.057, Control = 0.066, P.adj = 2.2×10-6). Next, we investigated gene expression in cell types and functional pathways in SCZ. We observed chemical synaptic transmission dysregulation in two types of GABAergic neurons (PVALB and LAMP5), and immune reaction involvement in GABAergic neurons (SST) and non-neuronal cell types (endothelial and oligodendrocyte). Furthermore, we observed that some differential expression genes from bulk RNA-seq displayed cell-type-specific abnormal in the expression of molecules in SCZ. Finally, the cell types with the SCZ-related transcriptomic changes could be considered to belong to the same module since we observed two major similar coordinated transcriptomic changes across these cell types. Together, our results offer novel insights into cellular heterogeneity and the molecular mechanisms underlying SCZ.

In order to analyze the spatial distribution characteristics of the cultural landscape of the Yangtze River (Nanjing section) and show the role of the Yangtze River culture in promoting regional economic development and cultural radiation, Based on the Knowledge graph technology and 3S technology, this paper conducts geographical positioning and spatial analysis of the Yangtze River cultural landscape in Nanjing, and analyzes the surrounding environment by combining remote sensing images and topographic data. Researches show that: The Yangtze River cultural landscape in Nanjing includes 74 landscape points of seven landscape types, and the distribution of landscape points shows a clustering trend, but the spatial distribution and aggregation degree of different types of cultural landscapes are different. Due to the influence of climate environment and water resources distribution, the surrounding cultural landscape has a low altitude and high vegetation coverage, showing obvious distribution characteristics along the river. This study is helpful to improve the coordination degree between cultural landscape protection and planning management, and can provide useful reference for the protection of cultural landscape of the Yangtze River.

In high-traffic harbor waters, marine radar frequently encounters signal interference stemming from various obstructive elements, thereby presenting formidable obstacles in the precise identification of ships. To achieve precise pixel-level ship identification in the complex environments, a customized neural network-based ship segmentation algorithm named MrisNet is proposed. MrisNet employs a lightweight and efficient FasterYOLO network to extract features from radar images at different levels, capturing fine-grained edge information and deep semantic features of ship pixels. To address the limitation of deep features in the backbone network lacking detailed shape and structured information, an adaptive attention mechanism is introduced after the FasterYOLO network to enhance crucial ship features. To fully utilize the multi-dimensional feature outputs, MrisNet incorporates a Transformer structure to reconstruct the PANet feature fusion network, allowing for the fusion of contextual information and capturing more essential ship information and semantic correlations. In the prediction stage, MrisNet optimizes the target position loss using the EIoU function, enabling the algorithm to adapt to ship position deviations and size variations, thereby improving segmentation accuracy and convergence speed. Experimental results demonstrate that MrisNet achieves high recall and precision rates of 94.8% and 95.2%, respectively, in ship instance segmentation, outperforming various YOLO and other single-stage algorithms. Moreover, MrisNet has a model parameter size of 13.8M and real-time computational cost of 23.5G, demonstrating notable advantages in terms of convolutional efficiency. In conclusion, MrisNet accurately segments ships with different spot features and under diverse environmental conditions in marine radar images. It exhibits outstanding performance, particularly in extreme scenarios and challenging interference conditions, showcasing robustness and applicability.

NiFe alloy nanoparticles/graphene oxide hybrid (NiFe/GO) was prepared for electrochemical glucose sensing. The as-prepared NiFe/GO hybrid was characterized by transmission electron microscopy (TEM) and X-ray diffraction (XRD). The results indicated that NiFe alloy nanoparticles can be successfully deposited on GO. The electrochemical glucose sensing performance of the as-prepared NiFe/GO was studied by cyclic voltammetry and amperometric measurement. Results showed that NiFe/GO modified glassy carbon electrode had sensitivity of 173 μA mM⁻¹cm⁻² for glucose sensing with a linear range up to 5 mM, which was superior to commonly used Ni nanoparticles. Furthermore, high selectivity for glucose detection can be achieved by NiFe/GO. All the results demonstrated that NiFe/GO hybrid was promising for using in electrochemical glucose sensing.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

Predators are dependent on the capture of prey to meet their energetic and nutritive requirements, imposing a regime of predation risk. Consequently, prey experience both consumptive and non-consumptive effects. Non-consumptive effects may manifest through altered growth and ontogenetic trajectories of prey species, a dynamic modulated by olfactory or other sensory cues from predators. Bactrocera dorsalis Hendel represents a great invasive threat to global horticulture. While earlier research has primarily centered on the consumptive interactions between B. dorsalis and its natural enemies, the potential consequences of non-consumptive interactions on the development of B. dorsalis have been overlooked. In this study, we investigated the impact of predation risk effects, induced by both visual exposure to the predatory mantis Hierodula patellifera Serville and its associated odor, on the life history traits of B. dorsalis. Female B. dorsalis demonstrated reduced development time in the presence of isolated H. patellifera or H. patellifera odor, yet evidenced significantly increased fecundity. Conversely, males displayed no significant change in development time. Additionally, neither female nor male body weight at death was significantly influenced by predation risk from isolated predators or predator odor. These results indicated adaptive developmental strategies of B. dorsalis when faced with risks from predators and highlight the important role of predator odor, which has the potential to lay the groundwork for improving biological control efforts and innovative approaches within pest control.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

In this paper we study a class of impulsive delayed neural networks with parameter uncertainties and reaction-diffusion terms. Using the properties of M-matrices and some inequality techniques, some sufficient conditions are derived to guarantee the global exponential stability of the given system. The results obtained are presented by simple algebraic inequalities, which are certainly more concise than previous methods. Finally, the validity and usefulness of our results are illustrated by arithmetic examples.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

Unmanned agricultural tractor (UAT) represents the advanced stage of autonomous navigation and serves as a core technology in agricultural production. It reduces the operator’s workload, and improves operational accuracy and efficiency. This article reviews three aspects of key autonomous navigation technologies for UATs: perception, path planning and tracking, and motion control. The advantages, and shortages of these key technologies on UATs are clarified by analyzing technical principles and the current research status. We conducted summaries and analyses of existing unmanned navigation solutions for different application scenarios in order to identify current bottleneck issues. Based on the analysis of the applicability of key autonomous navigation technologies on UATs, it can be seen that fruitful research progresses have been achieved. The review also summarizes the common problems in current technologies. The application research on sharing and integrating multi-source data for autonomous navigation are relatively weak. There is an urgent need of high-precision, and high-stability sensing equipment. The universality of path planning methods, and the efficiency and precision of path tracking need to be improved. It is necessary to develop high reliability electrical control modules to enhance motion control performance. Overall, advanced sensors, high-performance intelligent algorithms, and reliable electrical control hardware are key factors in promoting the development of UAT technology.

Natural alkaloids of actinomycetes origin and synthetic derivatives have always been among the important suppliers of small-molecule drugs. Among their biological sources, Streptomyces is the highest and most extensively researched genus. Marine-derived Streptomyces strains harbor unconventional metabolic pathways and have been demonstrated to be efficient producers of biologically active alkaloids since more than 60% of these compounds exhibit valuable activity such as antibacterial, antitumor, anti-inflammatory activity, etc. This review comprehensively summarizes novel alkaloids produced by marine Streptomyces discovered in the past decade, focusing on their structural features, biological activity and pharmacological mechanisms. Future perspectives on the discovery and development of novel alkaloids from marine Streptomyces are also provided.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

Background: Plasma levels of von Willebrand factor (VWF) are significantly elevated in patients with COVID-19. However, the dynamic changes and prognostic value of this biomarker in hospitalized patients with COVID-19 are not determined. Methods: 124 patients infected with SARS-CoV2 were prospectively recruited for the study. Serial blood samples were obtained at the time of admission (D1), 3-4 days following standard of care treatments (D2), and 1-2 days prior to discharge or death (D3). Plasma VWF antigen, ADAMTS13 antigen and activity, as well as the ratio of VWF/ADAMTS13 were determined, followed by statistical analyses. Results:While admission plasma levels of VWF in COVID-19 patients were significantly elevated, no statistical significance was detected among patients of different disease severity. Plasma ADAMTS13 activity, but not its antigen levels, were significantly lower in patients with severe or critical COVID-19 compared with other groups. Interestingly, the ratios of plasma VWF antigen to ADAMTS13 antigen were significantly higher in patients with severe or critical COVID-19 than in those with mild to moderate disease. More importantly, plasma levels of VWF and VWF/ADAMTS13 ratios were persistently elevated in patients with COVID-19 during hospitalization. Kaplan-Meier and Cox proportional hazard regression analysis revealed that an increased plasma VWF or ratio of VWF/ADAMTS13 at D2 and D3 associated with an increased mortality rate. Conclusions: Persistent endotheliopathy, marked by an elevated level of plasma VWF or an increased VWF/ADAMTS13 ratio, is present in all hospitalized patients following SARS-CoV2 infection and strongly associated with mortality.

The integration of deep neural networks into sparse Synthetic Aperture Radar (SAR) imaging has been explored to enhance SAR imaging performance and reduce the system’s sampling rate. However, the scarcity of training samples and mismatches between the training data and the SAR system pose significant challenges to the method’s further development. In this paper, we propose a novel SAR imaging approach based on Deep Image Prior Powered by RED (DeepRED), enabling unsupervised SAR imaging without the need for additional training data. Initially, DeepRED is introduced as the regularization technique within the sparse SAR imaging model. Subsequently, variable splitting and the Alternating Direction Method of Multipliers (ADMM) are employed to solve the imaging model, alternately updating the magnitude and phase of the SAR image. Additionally, the SAR echo simulation operator is utilized as an observation model to enhance computational efficiency. Through simulations and real data experiments, we demonstrate that our method maintains imaging quality and system downsampling rate on par with deep neural network-based sparse SAR imaging, but without the requirement for training data.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.

This paper proposed emotion recognition methods for consecutive facial images, and implements the inference of neural network model on a field-programmable gate array (FPGA). The proposed emotion recognition methods are based on a neural network model architecture that combines convolution neural networks (CNNs), long short-term memory (LSTM), and fully connected neural networks (FCNNs), called CLDNN or ConvLSTM-FCN. This type of neural network mod-el can analyze the local feature sequences obtained through convolution of data, making it suita-ble for processing time-series data such as consecutive facial images. In this paper, sequences of facial images are sampled from videos corresponding to various emotional state of subjects. The sampled images are then pre-processed with the processes includes facial detection, greyscale conversion, resize, and data augmentation if necessary. The 2-D CNN in ConvLSTM-FCN is used for feature extraction for these pre-processed facial images. These sequences of facial im-age features are time sequences with dependent properties between the elements within them. The LSTM is then used to model these time sequences followed by fully connected neural net-works (FCNNs) for classification. The proposed consecutive facial emotion recognition method achieves an average recognition rate of 99.51% on RAVDESS dataset, 87.80% on BAUM-1s dataset and 96.82% on eNTERFACE’05 data set, using 10-fold cross-validation on the PC. Some com-parisons of recognition accuracies between the proposed method and the other existing related works are conducted in this paper. According to the comparisons, the proposed emotion recog-nition methods outperform the existing related researches. The proposed emotion recognition methods are then implemented on an FPGA chip using the neural network model inference algo-rithms in this paper, and the accuracies of the experiments conducted on the FPGA chip are iden-tical to those obtained on the PC. This verifies that the proposed neural network model imple-mented on the FPGA chip performs well.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Fractures of the talar neck and body are associated with spine fractures and scoliosis deformity, which affect cosmetic appearance and cause difficulty in ambulation. The implant design for talus surgery is thriving as a functional alternative in case of severe talar destruction, focusing on segmentation and reconstruction of the talus’s shape. However, manual segmentation of the talus is time-consuming and subjective. In this study we exploited the automatic segmentation framework to efficiently train a deep learning-based model to accurately segment the talus based on computed tomography imaging. We developed three model configurations with nnU-Net and investigated their Dice similarity coefficients (DSC) and 95% Hausdorff distances (HD95) for talus segmentation on a CT image dataset. The three configurations performed well (DSC > 0.95, HD95 < 0.6). When tested on the same samples, one of the configurations was more efficient while ensuring higher accuracy. We propose to focus on talus anatomic variations with increasing age based on this framework and apply it to clinical trials at the next stage.

Macroalgae and macroalgae-associated bacteria together constitute the most efficient metabolic cycling system in the ocean. Their interactions, especially the responses of macroalgae-associated bacteria communities to algae in different geographical locations, is mostly unknown. In this study, metagenomics was used to analyze the microbial diversity and associated algal polysaccharide-degrading enzymes on the surface of red algae among three remote regions. There were significant differences in the macroalgae-associated bacteria community composition and diversity among the different regions. At the phylum level, Proteobacteria, Bacteroidetes, and Actinobacteria had a significantly high relative abundance among the regions. From the perspective of species diversity, samples from China had the highest macroalgae-associated bacteria diversity, followed by those from Antarctica and Indonesia. In addition, in the functional prediction of the bacterial community, genes associated with amino acid metabolism, carbohydrate metabolism, energy metabolism, metabolism of cofactors and vitamins, and membrane transport had a high relative abundance. Canonical correspondence analysis and redundancy analysis of environmental factors showed that, without considering algae species and composition, pH and temperature were the main environmental factors affecting bacterial community structure. Furthermore, there were significant differences in algal polysaccharide-degrading enzymes among the regions. Samples from China and Antarctica had high abundances of algal polysaccharide-degrading enzymes, while those from Indonesia had extremely low abundances. The environmental differences between these three regions may impose a strong geographic differentiation regarding the biodiversity of algal microbiomes and their expressed enzyme genes. This work expands our knowledge of algal microbial ecology, and contributes to an in-depth study of their metabolic characteristics, ecological functions, and applications.

Microwave radiation diagnosis technology can detect thermal changes in skin tissue earlier than anatomical changes, but its detection accuracy is limited by non-target radiation interference in the measurement environment, additional measurement errors of system units, and energy scattering and transmission between skin tissues. This paper aims to address the scientific challenges of analyzing the forward and inversion modelling detection mechanism of layered accurate temperature measurement of human skin tissue based on multi-band. The study focuses on the construction of a pencil beam antenna optimization system, the optimization strategy of high-sensitivity correlated radiometer architecture, and the high-precision multi-band forward and inversion modelling detection algorithm. The key technologies include: (1) A new method of integrated modeling and multi-index optimization of antenna with high directivity and small aperture is proposed, and a priori knowledge-guided neural network of pencil beam distribution is constructed to realize the inversion model of antenna structural parameters; (2) The influence mechanism of high sensitivity correlated radiometer architecture error is analyzed, and a periodic phase shift error correction algorithm based on uniform polar circle is designed; (3) Combining deep learning theory and hyperparameter optimization framework, an iterative model is established, and the objective function modified by the penalty factor is defined to realize a new detection method combining forward and inversion. This paper presents a theoretical foundation for the industrialization of microwave radiation diagnostic technology.

Dye/salt separation has gained increasing attention in recent years, prompting the quest for cost-effective and environmentally-friendly raw materials for synthesis high performance nanofiltration (NF) membrane for effective dye/salt separation. Herein, a high-performance loose structured NF membrane was fabricated by via a simple vacuum filtration method using a green nanomaterial, 2,2,6,6-tetramethylpiperidine-1-oxide radical (TEMPO)-oxidized cellulose nanofiber (TOCNF), by sequentially filtrating larger-size and finer-size TOCNFs on a microporous substrate, followed by cross-linked with trimesoyl chloride. The resultant TCM membrane possesses a separating layer composed entirely of pure TOCNF, eliminating the need for other polymer or nanomaterials additives. TCM membranes exhibits high performance and effective dye/salt selectivity. Scanning Electron Microscope (SEM) analysis shows that the TCM membrane with Fine-TOCNF layer has a tight layered structure. Further characterizations via Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD) confirm the presence of functional groups and chemical bonds of the crosslinked membrane. Notably, the optimized TCM-5 membrane exhibits a rejection rate of over 99% for various dyes (Congo red, orange yellow) and 14.2% for NaCl, showcasing a potential candidate for efficient dye wastewater treatment.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

Maritime search and rescue is a crucial component of the national emergency response system, which currently mainly relies on Unmanned Aerial Vehicles (UAVs) to detect the objects. Most traditional object detection methods focus on boosting the detection accuracy while neglecting the detection speed of the heavy model. However, it is also essential to improve the detection speed which can provide timely maritime search and rescue. To address the issues, we propose a lightweight object detector named Shuffle-GhostNet-based detector (SG-Det). First, we construct a lightweight backbone, named Shuffle-GhostNet, which enhances the information flow between channel groups by redesigning the correlation group convolution and introducing the channel shuffle operation. Second, we propose an improved feature pyramid model, namely BiFPN-tiny, which has a lighter structure while being capable of reinforcing small object features. Furthermore, we incorporate the atrous spatial pyramid pooling module (ASPP) to the network, which employs atrous convolution with different sampling rates to obtain multi-scale information. Finally, we generate three sets of bounding boxes at different scales – large, medium, and small – to detect objects of different sizes. Compared with other lightweight detectors, SG-Det achieves better tradeoffs across performance metrics, and enables real-time detection with an accuracy rate of over 90% for maritime objects, which shows that it can be better meet the actual requirements of maritime search and rescue.

Antisense oligonucleotides (ASONs) have proven potential for the treatment of various diseases. However, their limited bioavailability restricts their clinical application. New structures with improved enzyme resistance stability and efficient drug delivery are needed. In this work, we propose a novel category of ASONs bearing anisamide conjugation at phosphorothioate sites for oncotherapy. ASONs can be conjugated with the ligand anisamide very efficiently and flexibly in solution. The conjugation sites and ligand amount both influence anti-enzymatic stability and cellular uptake, resulting in changes in antitumor activity that are detectable by cytotoxicity assay. T6 (with double end AA-conjugation) was identified as the optimal conjugate, and its antitumor activity and the underlying mechanism were examined further in vitro and in vivo. This paper presents a new strategy for the design of nucleic acid–based therapeutics with improved drug delivery and biophysical and biological efficacy.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

Based on a constant volume combustion chamber, the initial ambient pressure effect on combustion performance and flame propagation of the active and passive pre-chamber ignition systems were studied. Compared with the passive pre-chamber, the active pre-chamber can significantly expand the lean combustion limit, enhance the ignition and combustion performance, and speed up the combustion of the main combustion chamber. At slightly lean combustion conditions, the heat release performance has a positive correlation with the initial ambient pressure. As the premixed λ increases, the heat release performance and the initial ambient pressure begin to become negatively correlated. Ignition delay can be minimized by controlling the excess air coefficient in the pre-chamber close to the stoichiometric ratio. The high ambient pressure in the constant volume chamber greatly reduces the mixture entrainment ability of the jet flame at lean combustion conditions, thereby reducing the combustion speed and peak heat release rate.

Public safety and intelligent surveillance systems critically depend on anomaly behavior detection for effective monitoring. In real-world pedestrian detection scenarios, prevalent challenges such as missed detections, complex background interference, and small target sizes hinder accurate anomaly identification. To address these issues, this study introduces YOLO-ABD, a lightweight method for anomaly behavior detection that integrates small target detection and channel shuffling. This method employs YOLOv8n as the baseline model, incorporating a small target detection mechanism in the Head part and utilizing GSConv convolution in the Backbone to enhance perceptual capability. Additionally, the SimAM attention mechanism is integrated to mitigate complex background interference, thereby improving target detection performance. Evaluation on the IITB-Corridor dataset demonstrated mAP50 and mAP50-95 scores of 89.3% and 60.6%, respectively. Generalization testing on the street-view-gdogo dataset further highlighted the superiority of YOLO-ABD over advanced detection algorithms, underscoring its effectiveness and generalizability. With a relatively small parameter count, YOLO-ABD presents an excellent lightweight solution for pedestrian anomaly behavior detection.

Antibiotic resistance (ABR) is concerning issue due to its direct and indirect repercusions on public health, since decreased therapeutic effect of certain antibiotic to treatment complications that can cause death. There are several mechanism as to how ABR can be transferred from one microoorganisms to another, and many of them are dependant many environmental factors. The food supply chain is a environment in which ABR gene transfer can occur is multiple pathways, which generate concerns regarding food safety. Here, we summarize relevant mechanisms which are implied in ABR in food supply chain but also we are addressing routes of transmission and prevalence of ABR, implications on public health, and the application of new alternatives to antibiotics such as antimicrobial peptides, mainly bacteriocins, in order to countermeasure ABR.

The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.

Abstract：This paper uses the balanced panel data from 29 provinces (autonomous regions and municipalities) in China for a total of 17 years from 2000 to 2016 as a research sample, and establishes an empirical model to examine the impact of environmental regulations and technological innovation on the quality of economic growth. Then this paper test technological innovation as a threshold variable, in which play a regulatory role. Taking the provincial balanced panel data as a research sample, a fixed effect model, a system GMM model, and a panel threshold model were established for empirical testing and the robustness test. Based on the empirical results, this article draws the following conclusions: from a national perspective, environmental regulations and technological innovation can significantly promote the quality of economic growth; from a regional perspective, there are regional differences in impact effects. Under the constraints of environmental regulations, the promotion effect of technological innovation on the quality of economic growth will be reduced; the impact of environmental regulation on the quality of economic growth will have a "threshold effect", and environmental regulation can significantly promote the quality of economic growth only after crossing the threshold and the threshold of technological innovation.

The temperature-assisted laser shock process has shown promising prospects in the fields of forming manufacturing and surface strengthening. However, large-scale application of this process is limited by the instability and failure of confinement medium at high temperatures (≥300 ℃). Aiming at this problem, we propose a novel laser shock strategy based on Leidenfrost effect, where the suspended droplets are utilized as the confinement medium. According to the sequence of images acquired by time delay system and high-speed camera, the droplet dynamics behavior is studied. The focusing enhancement effect of the droplet is comprehensively explored. And the correlations between droplet size, ambient temperature, vapor layer thickness and focusing effect are investigated. Combining the dynamics and focusing enhancement effect of droplets, a theoretical model of laser shock pressure under droplet confinement is established. Finally, the effectiveness and feasibility of the droplet-based laser shock strategy in high temperature processing environments are verified by typical applications in laser shock forming and laser shock peening fields. The results show that the droplet-based laser shock process presents better forming effect. And the mechanical property tests demonstrate that this process can obtain the simultaneous improvement of the strength (~51%) and ductility (~6.4%) of annealed Cu. The multiscale plasticity mechanisms of the strengthened material are comprehensively investigated. We believe that this low-energy, low-cost and high-quality process can provide a new solution for the industrial application of laser shock at high temperatures.

Atopic dermatitis (AD) is a chronic inflammatory skin disease, which can cause skin barrier function damaged. Although co-incubation with docosahexaenoic acid (DHA) exerts a positive effect in deficient skin model, there is no study to investigate the effects of topical treatment with DHA in inflammatory reconstructed human epidermis (RHE) model. The effects of DHA on monolayer normal human epidermal keratinocyte (NHEK) cells were evaluated via CCK-8, qPCR and ELISA. The skin related barrier function was assessed by hematoxylin-eosin (HE) staining, western blot (WB), Immunohistofluorescence (IF) and ELISA in normal and inflammatory RHE models. DHA upregulated filaggrin and loricrin expression at mRNA levels in addition to suppress overexpression of TNF-α，IL-1α and IL-6 stimulated by poly I:C plus LPS (stimulation cocktail) in cultured NHEK cells. After topical treatment with DHA, cocktail induced inflammatory characteristics of skin diseases including barrier morphological, differentiation proteins and TSLP secretion, which were alleviated in RHE models. Supplementation with DHA can improved related barrier function and have anti-inflammation effects in monolayer keratinocytes and RHE models, which indicated that DHA may have a potential value for the treatment of inflammation-associate skin diseases.

Chinese texts often feature a substantial volume of normative content, and their analysis has increasingly become a focal point in recent semantic analysis endeavors. Enhancing the effectiveness of text classification and clustering is pivotal in unveiling the intricate semantics within extensive textual data. Empirical research within the realm of computational social science has underscored the need for improved explanatory power when it comes to general text clustering methods applied to normative texts. This study introduces an innovative hierarchical clustering method that incorporates part-of-speech (POS) features and pioneers a novel semantic network model. It achieves this by amalgamating a POS-based feature weight calculation method with hierarchical clustering techniques. To assess its efficacy, the method is rigorously evaluated across three diverse text datasets, encompassing normative reports, news articles, and social media content. The experimental results unequivocally demonstrate the superior performance of the POS-HC method, surpassing the traditional TF and TF-IDF feature extraction methods in terms of clustering accuracy, and surpassing some existing clustering methods. Furthermore, its classification effectiveness exhibits notable advantages, particularly in the semantic classification of normative texts.

Trichothecene mycotoxin T-2 toxin is an important environmental pollutant and poses a global threat to human and animal health. T-2 toxin could induce nephrotoxicity, however, the precise molecular mechanism remains unclear. In this study, the mice were intraperitoneally administrated with a single dose of 2 mg/kg T-2 toxin. The kidney function and ultrastructural observation were also assessed and found T-2 toxin exposure could cause kidney damage. Transmission electron microscopy showed a significant swelling and vacuolization of the mitochondria of renal cell. A total of 1122, 58, and 391 differential expression genes (DEGs) that were predominantly expressed in kidney tissues at 1 d, 3 d, and 7 d after T-2 toxin exposure, respectively. Early transcriptomic changes at 1 d after exposure were down-regulation of DEGs involved in the cell cycle, p53 signaling pathway, and cellular senescence, while up-regulation of DEGs referred to the ribosome pathway. The temporal variations in gene expression pattern in T-2 toxin exposure in mice kidney were presented and cellular metabolism was disturbed at the exposure recovery period with 7 d. In conclusion, this study, for the first time, provided a comprehensive comparative transcriptomic analysis of gene regulation in T-2 toxin exposure-induced nephrotoxicity at different temporal periods and explored the nephrotoxicity mechanism of T-2 toxin at the mRNA level.

Elongate loach (Leptobotia elongata) is an endemic fish in China. Previous studies have provided some insights into the mitochondrial genome composition, and the phylogenetic relationships of L. elongata inferred using protein-coding genes (PCGs). However, the detailed information about is limited. Therefore, in this study, we sequenced the complete mitochondrial genome of L. elongata and analyzed its structural characteristics. The PCGs and mitochondrial genome were used for selective stress analysis and genomic comparative analysis respectively. The complete mitochondrial genome of the L. elongata, together with those of 36 Cyprinidae species, was used to infer the phylogenetic relationships of the Cobitidae family through maximum likelihood (ML) reconstruction. The results showed that the genome sequence has a full length of 16,591 bp, which includes 13 PCGs, 22 transfer RNA genes (tRNA), two ribosomal RNA genes (rRNA), and two non-coding regions (CR D-loop and light chain sub-chain replication origin OL). Overall, L. elongata shared the same gene arrangement and composition of the mitochondrial genes with other teleost fishes. The Ka/Ks ratios of all mitochondrial PCGs were less than 1, indicating that all the PCGs were evolving under purifying selection. Genome comparison analyses showed a significant sequence homology of species of Leptobotia. A significant identity between L. elongata and the other 5 Leptobotia species was observed in the visualization result, except for L. mantschurica, which lacked the tRNA-Arg gene and had a shorter tRNA-Asp gene. The phylogenetic tree revealed that the Cobitidae species examined here can be grouped into two clades, with L. elongata forming a sister relationship with L. microphthalma. This study could provide additional inferences for a better understanding of the phylogenetic relationships among Cobititdae species.

The research fills the policy research gap for the women entrepreneurship and sustainability performance for examining key successful factors. Previous women entrepreneurship research fails to offer policy recommendations. The research purpose is to investigate these factors affect women entrepreneurship capabilities and sustainability performance by using SEM analysis and making policy recommendation. This research employs online and mail survey and obtains 175 women entrepreneur sample. The study finds that family support and motivation have positive effect on women entrepreneurship capabilities and sustainability performance. Barriers have no effect on performance. Hopefully, the research can provide the guidance to contribute to women’s entrepreneurship opportunities for achieving SDGs. Policy recommendation and managerial implication are discussed in the article.

Epitranscriptomic RNA modifications play a crucial role in the posttranscriptional regulation of gene expression. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic RNA and plays a pivotal role in RNA fate. RNA m6A modification is regulated by a group of cellular proteins, methyltransferases (writers) and demethylases (erasers), which add and remove the methyl group from adenosine, respectively. m6A modification is recognized by a group of cellular RNA-binding proteins (readers) that specifically bind to m6A-modified RNA, mediating effects on RNA stability, splicing, transport, and translation. The functional significance of m6A modification of viral and cellular RNA is an active area of virology research. In this review, we summarize and analyze current literature on m6A modification of HIV-1 RNA, the multifaceted functions of m6A in regulating HIV-1 replication, and the role of viral RNA m6A modification in evading the innate immune responses to infection. Furthermore, we briefly discuss future directions and therapeutic implications of mechanistic studies of HIV-1 epitranscriptomic modifications.

Threshing device is the core component of grain combine harvester, and its working performance determines the working quality and production efficiency of the harvester to a great extent. The straw guide plate plays an important role in the threshing device to dredge the threshing matter and control the threshing time of the combine harvester matter in the threshing chamber. In the past, the guiding structure of threshing device could not optimize the working performance of the machine by adjusting the spiral angle, that is, most cereal combine harvester may not be fed smoothly or even clogged when operating under different crop types, yield differences and operating environments, a kind of threshing device with adjustable guide straw board was studied. In this study, the movement model of the straw on the straw guide plate was analyzed, and it was found that the spiral angle “α”of the straw guide was 0<α<58°.Three-factor and three-level response surface method was used to carry out field experiment on drum speed, working speed and guide grass plate spiral angle, and the experimental data were analyzed by quadratic polynomial regression.The results show that the drum speed, working speed and the spiral angle of the guide grass plate have significant effects on the loss rate (PLR) , impurity content (PIR) and breakage rate (PBR) , the drum speed and working speed have an interactive effect on the impurity ratio (PIR) , and the working speed and the helical angle of the guide grass plate have an interactive effect on the loss ratio (PLR) and breakage ratio (PBR) , there is an interaction between the rotary speed of the roller and the helical angle of the guide grass plate on the crushing rate (PBR) .Further optimization analysis showed that the predicted value was PLR = 1.18% , PIR = 0.72% , PBR = 0.53% , the experimental verification value was PLR = 1.26% , PIR = 0.73% , PBR = 0.61% . The absolute error between the experimental value and the predicted value was very small, however, the optimized field test verified value decreased by 8.31% , 50.04% and 60.30% respectively, which indicated that the optimized harvester had better operation quality, in particular, PIR, PBR and other two indicators have a greater increase in the effect.

Economic development and advancements in information technology contributed to the shift on accounting objective from commission responsibility view to decision-making useful view. The decision-making useful view claims that the accounting measurement methods should be changed to improve the usefulness of accounting information, to enable information users to make correct decisions. In addition, the development of financial instruments leads to the birth of fair value accounting. In recent years, fair value has been one of the most important measurement methods in the International Accounting Standard and US Generally Accepted Accounting Principles. However, China has been quite cautious when it comes to applying fair value full time, especially after the global financial crisis happened in 2008, wherein fair value accounting was exposed to strong suspicion. Hence, studying the value relevance of fair value is of great significance to exploring the accounting profession and reforming accounting standards. This paper attempts to investigate the value-relevance of fair value based on the data of listed financial companies and manufacturing companies in China. The results indicate that the fair value information in the financial industry has a strong explanatory influence to corporate share price. In contrast, the fair value information shows limited relevance in the manufacturing industry. Finally, consulting with the results of normative analysis and empirical study, this paper suggests several rational advices for the application of fair value in China.

The exploitation of bio-based foams implies an increase in the use of renewable biological resources to reduce the rapid consumption of petroleum-derived resources. Both tannins and furfuryl alcohol are derived from forestry resources and are therefore considered as attractive precursors for the preparation of tannin-furanic foams. In addition, toughening modification of tannin-furanic foams using polyvinyl alcohol (PVOH) resulted in a more flexible network-like structure, which imparts excellent flexibility to the foams with acquirement of relative properties that are even close to those of polyurethane foams, which are the most used polymers for fabrication of insoles for athletes. In addition, the addition of PVOH did not affect the thermal insulation of the foams, resilience and elongation at break, while reducing the brittleness of the samples and improving the mechanical properties. Also the observation of the morphology of the foam indicated that the compatibility between PVOH and tannin-furanic resin is good, and the cured foam does not show fragmentation or collapse, while the bubble pore structure is uniform. The developed flexible foam derived from biomass resources endowed the foam good thermal insulation properties and high mechanical properties, and the samples exhibited suitable physical parameters to be used as flexible insoles for athletes.

Technology can be seen everywhere and has been integrated into our lives.We are always using technology and enjoying the convenience brought by technology. However, physical retailers and e-commerce companies are also gradually adopting advanced technologies. Technology improves the purchasing environment and purchasing experience. Virtual reality and augmented reality have been hotly discussed in recent years. Technology, although virtual reality and augmented reality technology have not yet matured, it can be said that they will in the future It has great development potential. Virtual reality and augmented reality are also beginning to sprout in the retail industry. However, research on the acceptance of the use of virtual reality and augmented reality in the apparel shopping process is still lacking because This study explores how usefulness, ease of use, hedonicity, customer experience, customer engagement and satisfaction. To influence customer loyalty, this study adopted questionnaire survey and convenience sampling methods, and collected a total of 308 valid questionnaires. The analysis method used confirmatory factor analysis and structural equation model to verify the research hypothesis relationship. The results of this study found. Hedonic has a significant impact on customer loyalty, while usefulness, ease of use, customer experience, customer engagement and satisfaction Satisfaction does not have a significant impact on customer loyalty. This study explains the academic contribution of the research results. The practical implications in marketing are put forward, and specific suggestions and directions for future research are given.