Methylmercury (MeHg) intoxication is a global health concern. Although MeHg neurotoxicity is well-recognized, less is known about MeHg's effects on metabolism. In this study, we evaluated MeHg intoxication (20mg/L in drinking water for 20 days) effects on liver and epididymal white fat (EWF) in young ApoE knockout (ko) and wild-type mice. The former is well-known to show spontaneous dyslipidemia. Hg levels in hair, liver, and EWF were measured to assess the degree of MeHg exposure. We also evaluated body weight gain, plasma triglycerides, total cholesterol levels, and liver injury by assessing steatosis score, AST, ALT, SOD, and TBAR levels. To evaluate EWF, we analyzed mean wet weight and adipocyte diameter, plasma leptin levels and metabolomics. Hg levels were markedly higher among intoxicated mice. ApoE ko mice showed higher Hg in the hair but lower levels in the liver and EWF than wild-type controls. Among wild-type mice, MeHg compromised weight gain and increased liver TBAR levels compared to non-challenged controls. Among non-intoxicated mice, ApoE deficiency significantly increased triglyceride, total cholesterol, and liver transaminases with reduced EWF wet weight, hepatic SOD, and plasma leptin levels. MeHg accumulation together with ApoE deficiency elevated total cholesterol, triglycerides, hepatic transaminases, and TBARS. We found distinct EWF metabolite activity in different scenarios of ApoE deficiency and MeHg intoxication, highlighting increased cardiovascular risk especially when both challenges occur. Further studies are required to elucidate the underlying mechanisms involved in these effects and the target nutritional interventions in most need to ameliorate them.

The APOE locus has garnered significant clinical interest because of its association with Alzheimer's disease (AD) and longevity. This genetic association appears across multiple genes in the APOE locus. Despite the apparent differences between AD and longevity, both conditions share a commonality of aging-related changes in mitochondrial function. This commonality is likely due to accumulative biological effects, partly exerted by the APOE locus. In this study, we investigated changes in mitochondrial structure/function-related markers using oxidative stress-induced human cellular models and postmortem brains (PMBs) from individuals with AD and normal controls. Our results reveal a range of expressional alterations, either up- or down-regulated, in these genes in response to oxidative stress. In contrast, we consistently observed an upregulation of multiple APOE locus genes in all cellular models and AD PMBs. Additionally, the effects of AD status on mitochondrial DNA copy number (mtDNA CN) varied depending on APOE genotype. Our findings imply a potential coregulation of APOE locus genes, possibly occurring within the same topologically associating domain (TAD) of the 3D chromosome conformation. The coordinated expression of APOE locus genes could impact mitochondrial function, contributing to the development of AD or longevity. Our study underscores the significant role of the APOE locus in modulating mitochondrial function and provides valuable insights into the underlying mechanisms of AD and aging, emphasizing the importance of this locus in clinical research.

Sporadic Alzheimer’s disease (AD) derives from an interplay among environmental factors and genetic variants, while epigenetic modifications have been expected to affect the onset and progression of its complex etiopathology. Heterozygous carriers of the apolipoprotein E gene (APOE)4 allele have a 4-fold increased risk of developing AD, while APOE 4/4-carriers have a 12-fold increased risk in comparison with the APOE 3-carriers. The main longevity factor is the homozygous APOE ε3/ε3 genotype. In the present narrative review article, we summarized and described the role of APOE epigenetics in aging and AD pathophysiology. It is not fully understood how APOE variants may increase or decrease AD risk, but this gene is known to affect amyloid- and tau-mediated neurodegeneration directly or indirectly, also by affecting lipid metabolism and inflammation. For sporadic AD, epigenetic regulatory mechanisms may control and influence APOE expression in response to external insults. Diet, a major environmental factor, has been significant associated with physical exercise, cognitive function, and the methylation level of several cytosine-phosphate-guanine (CpG) dinucleotides sites of APOE.

Background: In response to inflammation, the absorption of nutritional iron is restricted. Multiple inflammation-related signaling pathways can lead to ferroptosis, an iron-dependent mechanism of programmed cell death. Since the pathophysiological significance of the presence and uptake of iron in chronic inflammation is still unknown, we tested the effect of a low iron diet on the clinical course of arthritis in the mouse model of collagen-induced arthritis (CIA). Methods: Six- to eight-week-old male DBA/1 mice were fed either a normal or a low iron diet starting three weeks before arthritis induction. From day four after the collagen-booster made on day 25, the development of arthritis was regularly monitored until the end of the experiment (day 34), using a standard clinical arthritis score. The complete blood count was determined as well as Fe2+, Fe3+, oxidized and reduced glutathione (GSH and GSSG) and malondialdehyde (MDA) in whole paw tissue by ELISA. Quantitative PCR was performed from whole paw tissue for glutathione peroxidase 4 and other key regulator genes of iron metabolism and ferroptosis. We used nonparametric tests to com-pare markers of iron metabolism and ferroptosis as well as nonlinear regression models for longitu-dinal data for signs of arthritis. Results: Mice fed a low iron diet showed a significantly less severe course of arthritis compared to mice fed a normal iron diet (p

Alzheimer’s disease (AD) poses a significant public health challenge due to its irreversible and progressive nature while lack of a cure. As a potential strategy to combat AD, its prevention becomes increasingly attractive. Mild Cognitive Impairment due to AD (MCI-AD) represents a critical transitional stage between normal age-related cognitive decline and more severe AD conditions, occurring just before dementia onset. Unfortunately, there is currently no established animal model that accurately recapitulates MCI-AD characteristics. While many laboratories have traditionally used normally aged wild-type animals as experimental models, this approach falls short in representing the inherently worse state of MCI-AD compared to normal aging. To address this gap, we introduce an animal model—a transgenic mouse line with genetic inactivation of G protein-coupled receptor kinase-5 (GRK5), commonly known as the GRK5 knockout (GRK5KO) mouse. These GRK5KO mice exhibit amnesia, cognitive deficits, increased β-amyloid levels, neurofibrillary tangle (NFT) immunopositive axonopathy, and hippocampal neurodegenerative changes. Importantly, these pathological alterations predominantly impact the entorhinal, transentorhinal, and hippocampal cortices, aligning with human MCI-AD criteria and Braak stage II of human AD progression. Notably, female GRK5KO mice show approximately 2.5 times more NFT-positive axonopathy than males, mirroring the higher prevalence of AD cases in women. Collectively, existing data strongly supports the GRK5KO mouse as a qualified animal model for studying MCI-AD.

Interferon-gamma (IFN-γ) is an important cytokine in host defense against tuberculosis infection. In some cases, administration of IFN-γ during tuberculosis infection can promote faster cure. In the present work, we have shown that in a mouse model, human interferon-gamma, exhibits some anti-tuberculosis activity, especially in combination with isoniazid.

Genetic variations at the Apolipoprotein E (ApoE) and microtubule-associated protein tau (MAPT) loci have been implicated in multiple neurogenerative diseases, but their exact molecular mechanisms are unclear. In this study we performed transcript level linear modelling using the blood whole transcriptome data and genotypes of the 570 subjects in the Parkinson’s progression markers initiative (PPMI) cohort. ApoE, MAPT haplotypes and two SNPs at the SNCA locus (rs356181, rs3910105) were used to detect expression quantitative trait loci eQTLs associated with the transcriptome and differential usage of transcript isoforms. As a result, we identified 151 genes associated with the genotypic variations, 29 cis and 122 trans eQTL positions. Profound effect with genome-wide significance of ApoE e4 haplotype on the expression of TOMM40 transcripts was identified. This finding potentially explain in part the frequently established genetic association with the APOE e4 haplotypes in neurodegenerative diseases. Moreover, MAPT haplotypes had significant differential impact on 23 transcripts from the 17q21.31 and 17q24.1 loci. MAPT haplotypes had also the largest (256) and smallest (-178) effect sizes measured as beta values on two different transcripts from the same gene (LRRC37A2). Intronic SNP in the SNCA gene, rs3910105, differentially induces expression of three SNCA isoforms. In conclusion, this study established clear association between well-known haplotypic variance and transcript specific regulation in the blood. APOE e4 and MAPT H1/H2 haplotypic variants are associated with the expression of several genes related to the neurodegeneration.

Objective: This research was aimed to estimate the anti-fatigue effects of arecoline and elucidate its underlying mechanisms using a murine model of central fatigue precipitated by sleep deprivation (SD). Methods: Seventy-two male C57BL/6 mice were randomly allocated into six groups: a control group, a SD-induced fatigue model group, a group receiving Rhodiola Rosea capsules (2.5 mg/kg), and arecoline groups administered low, medium, and high doses (10, 20, and 40 mg/kg, respectively). Following 28 days of continuous administrations, the effects of arecoline on the mouse fatigue-related behaviors was assessed by the behavioral tests, including grip strength, rotarod performance, and weight-bearing swimming endurance. Enzyme-linked immunosorbent assays (ELISAs) were utilized to measure the levels of the relevant biochemical markers. Western blotting was employed to quantify the expression of nuclear factor erythroid 2-related factor (Nrf2), Kelch-like ECH-associated protein 1 (Keap1), heme oxygenase 1 (HO-1), sequestosome-1 (p62), and NADPH quinone oxidoreductase 1 (NQO1) in the gastrocnemius muscle. Results: Arecoline administration notably enhanced grip strength, delayed the onset of fatigue as evidenced by extended latencies in rotarod tests, and increased the duration of weight-bearing swimming in mice. In the elevated plus maze, arecoline significantly reduced both the number of entries and the total distance traveled in the open arms. Arecoline markedly decreased serum levels of creatine kinase, blood urea nitrogen, lactate dehydrogenase, triglycerides, and cholesterol, while elevated total testosterone, lactate dehydrogenase, and immunoglobulin G levels. Furthermore, it significantly increased superoxide dismutase(SOD), catalase(CAT), and glutathione peroxidase activity in the gastrocnemius muscle, reduced malondialdehyde levels, augmented hippocampal SOD and CAT activity, and elevated glycogen stores in both liver and muscle tissues. Neurotransmitter levels were significantly increased, cytokine levels were markedly reduced, and the expression of Nrf2, Keap1, NQO1, p62, and HO-1 in brain tissue was significantly upregulated. Conclusion: The current study for the first time demonstrated that arecoline has significant anti-fatigue activity, and its mechanism of action is related to elevate the levels of glucose and lipid metabolism, relieve oxidative stress damage, inhibit neuroinflammatory response, regulate neurotransmitter levels and Keap1/Nrf2/HO-1 signaling pathway. The current study provides a new insight into the potential of arecoline in prevention and improvement of fatigue.

Ulcerative colitis (UC) is a chronic inflammatory disease, the incidence of which is increasing worldwide. However, the etiology and pathogenesis of UC remains unclear. The n-butanol extract of pulsatilla decoction (BEPD) of the traditional Chinese medicine herbal formula has been shown to be effective in treating UC. We aimed to explore the molecular mechanism underlying the effects of BEPD on UC, in particular its effects on neutrophil extracellular trap (NET) formation by neutrophils. High-performance liquid chromatography was used to determine the principal compounds of BEPD. UC was induced in mice using dextran sodium sulfate, and mice were treated with 20, 40, or 80 mg/kg BEPD daily for seven days. Colonic inflammation was determined by assessing the disease activity index, histopathology, colonic mucosal damage index, colonic mucosal permeability, and pro- and anti-inflammatory cytokine levels. The infiltration and activation status of neutrophils in the colon were determined by analyzing the levels of chemokine (C-X-C motif) ligand (CXCL)1 and CXCL2, reactive oxygen species, Ly6G, and numerous NET proteins. Our results showed that BEPD improved the disease activity index, histopathology, and colonic mucosal damage index scores of mice with UC, and restored colonic mucosal permeability compared with untreated mice. The expression levels of the pro-inflammatory cytokines interleukin-1β, interleukin-6, and tumor necrosis factor-α in colon tissues were significantly decreased, while the expression levels of anti-inflammatory cytokines in colon tissues were significantly increased, exceeding those of control mice. In addition, BEPD reduce the expression of the neutrophil chemokines CXCL1 and CXCL2 in the colon tissue of mice with UC, reduced neutrophil infiltration, reduced reactive oxygen species levels, and significantly reduced the expression of NET proteins. BEPD also significantly reduced NET formation. The results of this study suggest that BEPD exerts therapeutic effects in a murine model of UC by inhibiting neutrophil infiltration and activation in the colon, as well as by inhibiting the expression of key proteins involved in NET formation and reducing NET formation, thereby alleviating local tissue damage and disease manifestations.

To elucidate mesenchymal stromal cells (MSC)-tumor intricate and ambiguous interactions, the reliable cell labeling and tracking techniques are imperative. Traditional methods of cell labelling have limitations mostly relevant to need for genetic modification what demands the exploration for alternative strategies. Here, we propose using fluorescent photoconvertible microcapsules containing Rhodamine B (RhB) to study mMSC migration in brain tumors. These 3 μm sized microcapsules are readily internalised by cells and undergo photoconversion under 561 nm laser exposure with fluorescence blue shift on demand. Optimal photoconversion was achieved with a laser irradiation duration of 0.4 ms, which provide a maximal brightness of photoconverted label without an excessive laser exposure on cells. Capsules modified with polyallylamine hydrochloride demonstrated the best potential for intracellular uptake without significantly affecting cell viability, motility, or proliferation. The optimal ratio of 20 capsules per mMSC was determined for labeling. Moreover, migration of individual mMSCs within 2D and 3D glioblastoma cell (EPNT-5) colonies over 2 days and in vivo tumor settings over 7 days was tracked. Our study unveils a robust platform for investigating MSC-tumor dynamics, offering insights into therapeutic strategies. Photoconvertible microcapsules could also become an indispensable tool for studying complex fundamental processes of cell-cell interactions for a wide range of problems in biology and medicine.

Mechanical properties of cardiomyocytes from different transmural regions are heterogeneous in the left ventricular wall. The cardiomyocyte mechanical environment affects this heterogeneity because of mechano-electric feedback mechanisms. In the present study, we investigated the effects of load upon transmural differences in contraction of subendocardial (ENDO) and subepicardial (EPI) single cells isolated from the murine left ventricle. Various loads were applied to the cells using carbon fiber techniques for single myocytes. To simulate experimentally obtained results and to predict mechanisms underlying the cellular response to change in load, our mathematical models of the ENDO and EPI cells were used. Extent of the transmural gradient in the time course of contractions was independent of the loading conditions where unloaded and heavy loaded (isometric) contractions were examined, but the regional gradient of the relaxation time characteristics tended to decrease when the load decreased. Under auxotonic contractions, time to peak contraction (T_max) was significantly longer in ENDO cells than in EPI cells at low preload. An increase in preload (axial stretch) prolonged T_max in both cell types; however, the prolongation was greater in EPI cells, resulting in a decrease in transmural gradient in T_max at high preload. The [Ca²⁺]_i transient decay time constant was consistent with the greater preload dependency in T_max of EPI cells. Our modified mathematical models reproduced experimental results, suggesting that differences in cooperativity of cross bridges and calcium troponin C complex interactions between the ENDO and EPI cardiomyocytes may contribute to the different cellular responses to stretch, which may provide a decrease in transmural dispersion of cellular shortening in the intact heart.

Previously, we described a 19-base pair double-stranded RNA with 3'-trinucleotide overhangs, acting as immunostimulatory RNA (isRNA). This molecule demonstrated notable antiproliferative effects on cancer cells, inhibited tumor growth, and elicited immunostimulatory and antiviral responses by inducing cytokine and interferon production. Within this study, we compared the efficiency of lung fibrosis development, initiated in mice by BLM or LPS using different schemes of induction. Then we compared the effect of isRNA used in a preventive or therapeutic regimen on the development of fibrosis in selected BLM- and LPS-induced mouse models and showed that isRNA can be used in pathological conditions accompanied by the development of inflammation and the risk of fibrosis formation, without adverse side effects. Prophylactic regimen of isRNA application is beneficial for prevention of the development of pulmonary fibrosis.

The enhancement of early diagnosis of lung cancer is mandatory to improve prognosis. We observed the increase cancer stem cells (CSC) and circulating tumor cells (CTC) in blood of mice on d3 after Lewis lung carcinoma (LLC) cell implantation before disease symptom. Besides we have developed an approach to reprogramming immune cells by inhibiting the MAPK/ERK pathway through MEKi and the PD-1/PD-L1 immune checkpoint signaling pathway. We hypothesized that reprogramming of spleen CD8+ T-cells could also create a population of immune cells with high antitumor activity. We reprogrammed CD8+ T-cells derived from the spleen of C57BL/6 mice (rsCD8+T-cells). The rsCD8+T-cells were able to migrate to lung and were more resistant after the exhaustion in vitro in comparison with naïve sCD8+T-cells. In the orthotopic LLC model, the rsCD8+T-cells therapy increased the amount of proliferating CD8+ and CD4+ T-cells in blood and lung from mice. The amount of CSC decreased in the blood and lung of mice treated with rsCD8+ T-cells. A morphological study revealed a decrease in the number of metastases in lung tissue. The antitumor effects of rsCD8+T-cells are based on the activation of the host immune response by increasing the populations of CD8+ and CD4+ T-cells and apoptosis of CSCs.

Background: Atherosclerosis (AS), a key pathological contributor of cardiovascular diseases (CVDs), was characterized by formation of atherosclerotic plaque in aortic wall and caused high mortality and morbidity worldwide. Factors contributing to the initiation and progression of AS included vascular endothelial dysfunction, dyslipidemia, inflammation, and oxidative stress. Shexiang Baoxin Pill (SBP) was a traditional Chinese medicine that had been widely applied in clinic and proved to be effective for patients with CVDs. However, the mechanisms underlying its anti-atherosclerotic effects have not been completely elucidated. The study aimed to investigate the protective effects of SBP on AS and its potential mechanisms. Methods: Different dose of SBP was orally administered in apolipoprotein E-deficient (ApoE-/-) mice treated with a high-fat diet (HFD). Histopathological and immunohistochemical analysis, ELISA, untargeted metabolomics analysis, 16S rRNA sequence analysis, and spearman analysis were applied to identify the protective effects and mechanisms of SBP in HFD-induced AS. Results: SBP significantly alleviated HFD-induced atherosclerotic lesion both in aorta and aortic sinus with a reduction in serum levels of total cholesterol (TC), triglycerides (TG) and low-density lipoprotein cholesterol (LDL-C), as well as interleukin-6 (IL-6) and interleukin-1β (IL-1β), and increased high-density lipoprotein cholesterol (HFD-C) level with no significant change of body weight in HFD-induced ApoE-/- mice. Mechanismly, SBP markedly reshaped the gut microbiota composition and associated metabolomic characteristics. 2 differential intestinal floras at phylum level and 8 differential microbes at genus level, 5 metabolic pathways and 9 differential fecal metabolites related to CVDs were figured out. Besides, intensive correlation between 8 differential microbes and 9 fecal metabolites was observed. Conclusions: Our results showed that SBP could improve HFD-triggered serum lipid disorder, systematic inflammation, and contribute to the alleviation of atherosclerotic lesion. The antiatherogenic properties of SBP might partly result from the reshaping of the gut microbiota and fecal metabolic profile.

Meningitis is a severe disease associated with death in children under five with highest rates of infections under age of one. Vaccines for Neisseria meningitides and Haemophilus influenza are used to prevent the main causative agents of meningitis. Administration of H. influenzae type b (Hib) vaccine is recommended at 2, 4 and 6 months with a booster dose at 18 months. N. meningitidis has two commercially available vaccines, the pure polysaccharide is recommended at 24 months meanwhile the protein-conjugated vaccines at 12 months. We sought in this study to examine if coadministering the vaccines for the two main meningitis causing bacteria might be synergistic as a preliminary step towards the possibility of shuffling immunization schedule. So, we coadministered Hib vaccine with commercially available vaccines either quadrate (ACWY) polysaccharide meningococcal (Men) or conjugated meningococcal (Nim) vaccines in Balb/C mice (n = 6/group) and compared to each vaccine administered separately and controls. Thirty-five days post immunization, we measured specific antibodies titers. Hib vaccine increased Men antibody titers significantly for serotypes Y and W. When Hib vaccine was coadministrated with Nim, antibody titer for Y, W and A significantly increased. For serotype C, there was no significant difference in antibody titers among immunized groups. As for effect of meningococcal vaccines on Hib, Men significantly increased Hib antibody titers while Nim had no effect. Collectively, our data suggested that coadministration of Hib and Men or Nim vaccines was safe and had synergistic effect on immune responses elicited to both vaccines. Further studies are needed before immunization schedule modifications. Such immunization schedule recommendation should provide better protection against this life-threatening disease in young children.

Abstract: Endoglin (ENG) is a causative gene of type 1 hereditary hemorrhagic telangiectasia (HHT1). HHT1 patients have arteriovenous malformations (AVMs) in multiple organs, including the brain. In mice, Eng deletion induced by R26RCreER or SM22aCre leads to AVM development in the brain and other organs. We have reported that the severity of brain AVM in mice with activin receptor-like kinase 1 (Alk1, an HHT2 causative gene) mutation is correlated with the number of Alk1 negative endothelial cells (ECs). We hypothesized that increase of Eng negative ECs will enhance AVM severity. To increase EC Eng deletion, we used a codon improved cre (icre), which is more potent in recombination of floxed alleles than the wild type (WT) cre. R26RCreER;Eng^f/f mice that have Rosa promoter driving and tamoxifen (TM) inducible WT cre expression globally and PdgfbiCreER;Eng^f/f that have Pdgfb promoter driving and TM inducible icre expression in ECs were treated with 3 intra-peritoneal injections of TM (2.5 mg/25g of body weight) to delete Eng globally or in the ECs. AAV-VEGF was stereotactically injected into the brain to induce brain focal angiogenesis and brain AVM. We found that iCre caused more Eng deletion in the brain indicated by lower level of Eng proteins (p<0.001) and fewer Eng positive ECs (p=0.01) than mice with WT cre. Mice with iCre mediated Eng deletion have more abnormal vessels (p=0.02), CD68⁺ macrophages (p=0.002), and hemorrhage (p=0.04), and less vascular pericyte and smooth muscle coverage than mice with WT cre. In addition, arteriovenous shunts were detected in the intestines of icre mice, a phenotype that have not been detected in WT cre mice before. RNAseq analysis showed that 8 out of the 10 top upregulated pathways identified by Gene Ontology (GO) analysis are related to the inflammation. Therefore, increase of Eng deletion in ECs exacerbates AVM severity, which is associated with enhanced inflammation. Strategies that can reduce Eng negative ECs could be used to develop new therapies to reduce AVM severity for HHT1 patients.

Atherosclerosis (AS) is a chronic progressive disease caused by various factors, and causes various cerebrovascular and cardiovascular diseases (CVDs). Reducing the plasma levels of low-density lipoprotein-cholesterol (LDL-C) is the primary goal in preventing and treating AS. Proprotein Convertase Subtilisin/Kexin Type 9 (PCSK9) plays a crucial role in regulating LDL-C metabolism. Panax notoginseng has potent lipid-reducing effects and protects against CVDs, and its saponins induce vascular dilatation, inhibit thrombus formation, and are used in treating CVDs. However, the anti-AS effect of the secondary metabolite, 20(S) -protopanaxatriol (20(S)-PPT), remains unclear. In this study, the anti-AS effect and molecular mechanism of 20(S)-PPT were investigated in vivo and in vitro by western blotting, real time-polymerase chain reaction (RT-PCR), Enzyme-linked Immunosorbent Assay (ELISA), immunofluorescence staining, and other assays. The in vitro experiments revealed that 20(S)-PPT reduced the levels of PCSK9 in the supernatant of HepG2 cells, upregulated low density lipoprotein receptor (LDLR) protein levels, promoted LDL uptake by HepG2 cells, and reduced PCSK9 mRNA transcription by upregulating the levels of FoxO3 protein and mRNA and decreasing the levels of HNF1α protein and mRNA. The in vivo experiments revealed that 20(S)-PPT upregulated aortic αSMA expression, increased the stability of atherosclerotic plaques, and reduced aortic plaque formation induced by a high-cholesterol fed in ApoE-/- mice (HCF group). Additionally, 20(S)-PPT reduced the aortic expression of CD68, reduced inflammation in the aortic root, and alleviated the hepatic lesions in the HCF group. The study revealed that 20(S)-PPT inhibited LDLR degradation via PCSK9 to alleviate AS.

Aim: Complementary effects of dabigatran etexilate (DE), exercise training (ET) and combination (DE+ET) on the development and composition of the atherosclerotic lesions in diabetic apoE knockout (apoE-/-) mice. Methods: In 48 male apoE-/- diabetic mice, streptozotocin (STZ) was induced for 5 consecutive days. Mice received figh-fat diet (HFD) for 8 weeks and were randomized into 4 groups (1.Control/CG, 2.DEG: HFD with DE, 3.ETG: ET on treadmill, 4.DE+ETG: Combination DE and ET treatment). At the end of 8th week, all mice were euthanatized and morphometry of the aortic lesions at the level of aortic valve was obtained. Collagen, elastin, TNF-a, MCP-1, matrix-metalloproteinases (MMP-2,-3,-9), and TIMP-1 concentration within plaques at aortic valve were determined. Results: All active groups had significantly smaller aorta stenosis (DEG:7.9±2.2%, ETG:17.3±5.3%, DE+ETG:7.1±2.7%) compared to CG (23.3±5.5% p&lt;0.05), reduced the relative intra-plaque concentrations of macrophages, MCP-1, MMP-3 and MMP-9, and considerably increased collagen, elastin and TIMP-1 (p&lt;0.05). Group 4 showed the most pronounced results (p&lt;0.05). Both DEG and DE+ETG significantly reduced MMP-2 and TNF-a concentrations compared to ETG and CG (p&lt;0.010). Conclusion: DE and ET treatment in diabetic apoE-/- mice showed complementary amelioration of atherosclerotic lesions development and stability, mediated by the anti-inflammatory modulation of both DE and ET.

Antigen-presenting cells (APCs) are essential for modulating immune responses, and optimizing their differentiation protocols is critical for cell-based immunotherapies. This study compares eight different protocols for differentiating APCs from C57BL/6J mice using GM-CSF and L-929 supernatant. Four groups treated with GM-CSF and four with L-929 supernatant at various concentrations, alongside a control group were evaluated. Flow cytometry was used to analyze the expression of key markers, including MHC II, CD11c, F4/80, and CD11b. Our findings show that GM-CSF resulted in superior differentiation outcomes compared to L-929 supernatant, with higher expression levels of the analyzed markers. This study underscores the importance of considering both cell yield and protein expression quality in selecting differentiation protocols. For researchers developing therapies targeting specific cell populations, these findings demonstrate how different culture conditions influences both the quantity and phenotypic characteristics of differentiated cells. Balancing efficiency and phenotypic fidelity is crucial for optimizing cell-based immunotherapy strategies. Our data provide a valuable reference for future studies and applications involving APC differentiation from bone marrow precursors, ensuring robust foundations for developing advanced immunotherapies. This comprehensive comparison of differentiation protocols offers insights essential for enhancing the effectiveness and cost-efficiency of cell-based therapies.

Background: This study analyzes sex-based differences in renal structure and response to the Angiotensin-Converting Enzyme (ACE) inhibitor enalapril in a mouse model of atherosclerosis. Methods: ApoE-/- mice (8 weeks old) received enalapril (5 mg/kg/day, subcutaneous) or PBS as a control for an additional 14 weeks. Each group consisted of six males and six females. Results: Females exhibited elevated LDL-cholesterol levels, while males presented higher creatinine levels and proteinuria. Enalapril effectively reduced blood pressure in both groups, but proteinuria decreased significantly only in females. Plaque size analysis and assessment of kidney inflammation revealed no significant sex-based differences. However, males displayed more severe glomerular injury, with increased mesangial expansion, mesangiolysis, glomerular foam cells and activated parietal epithelial cells (PECs). Enalapril mitigated mesangial expansion, glomerular inflammation (particularly in females), and the hypertrophy of PECs in males. Conclusion: This study demonstrates sex-based differences in the response to enalapril in a mouse model of atherosclerosis. Males exhibited more severe glomerular injury, while enalapril provided renal protection, particularly in females. These findings suggest potential sex-specific considerations for ACE inhibitor therapy in chronic kidney disease and atherosclerosis cardiovascular disease. Further research is needed to elucidate the underlying mechanism behind these observations.

Polysulfides are endogenously produced in mammals and generally associated with protective functions. Our aim was to investigate the effect of dimethyl trisulfide (DMTS) in a mouse model of acute stress. DMTS activates transient receptor potential ankyrin 1 (TRPA1) channels and leads to neuropeptide release, potentially that of substance P (SP). We hypothesize that DMTS might inhibit the degrading enzymes of endocannabinoids, so this system was also investigated as another possible pathway for mediating the effects of DMTS. Trpa1 gene wild type (WT) and knock out (KO) mice were used to confirm the role of the TRPA1 ion channel in mediating the effects of DMTS. C57BL/6J, NK1 gene KO, and Tac1 gene KO mice were used to evaluate the effect of DMTS on the release and expression of SP. Some C57BL/6J animals were treated with AM251, an inhibitor of the cannabinoid CB1 receptor, to elucidate the role of the endocannabinoid system in these processes. Open field test (OFT) and forced swim test (FST) were performed in each mouse strain. Tail suspension test (TST) was performed in TRPA1 WT and KO animals. C-FOS immunohistochemistry was carried out on TRPA1 WT animals. DMTS treatment increased the number of highly active periods and decreased immobility time in the FST in WT animals, but had no effect on Trpa1 KO mice. DMTS administration induced neuronal activation in stress-related brain areas such as the locus coeruleus, dorsal raphe nucleus, lateral septum, paraventricular nucleus of the thalamus, and paraventricular nucleus of the hypothalamus. DMTS may have a potential role in the regulation of stress-related processes, and the TRPA1 ion channel may also be involved in mediating the effects of DMTS. DMTS can be an ideal candidate for further study as a potential remedy in stress-related disorders.

Decompression sickness (DCS) with neurological disorders is the leading cause of diving accidents. Exposure to high levels of CO2 during diving is a safety concern for occupational , groups at risk of DCS. However, the effects of prior exposure to CO2 have never been evaluated. The purpose of this study was to evaluate the effect of CO2 breathing prior to a provocative dive on the occurrence of DCS in mice. 50 mice were exposed to a maximum CO2 concentration of 70 hPa for one hour at atmospheric pressure. Another 50 mice breathing air under similar conditions served as controls. In the AIR group (controls), 22 out of 50 mice showed post-dive symptoms compared to 44 out of 50 in the CO2 group. We found that CO2 breathing is associated with a decrease in body temperature in mice and that CO2 exposure dramatically increases the incidence of DCS. More unexpectedly, it appears that a lower temperature of the animals even before exposure to the accident-prone protocol leads to an unfavorable prognosis. This study also suggests that the composition of the microbiota may influence thermogenesis and thus accidentology. Depending on prior exposure, some bacteria identified in this work could be perceived as protective or pathogenic.

Background: Biomarkers are essential for identification of individuals at high risk of mild cognitive impairment (MCI) for potential prevention of dementia. We investigated DNA methylation in the ApoE gene and plasmatic apolipoprotein E (ApoE) levels as MCI biomarkers in Colombian subjects with MCI and controls. Methods: 100 participants were included (71% women, average age, 70 yrs., range 43-91). MCI was diagnosed by neuropsychological testing, medical and social history, activities of daily living, cognitive symptoms and neuroimaging. Multivariate logistic regression models adjusted by age and gender were performed to examine the risk association of MCI with plasma ApoE and APOE methylation Results: MCI was diagnosed in 41 subjects (average age, 66.5±9.6 yrs.) and compared with 59 controls. Elevated plasma ApoE and APOE methylation of CpGs 165, 190, and 198 were risk factors for MCI (P<0.05). Higher CpG-227 methylation correlated with lower risk for MCI (P=0.002). Only CpG-227 was significantly correlated with plasmatic ApoE levels (correlation coefficient=-0.665; P=0.008). Conclusion: Differential APOE methylation and increased plasma ApoE levels were correlated with MCI. These epigenetic patterns can be used as potential biomarkers to identify early stages of MCI.

Currently, obesity is a critical global public health burden. Numerous studies have demonstrated the regulation of the pathogenesis of obesity and metabolic abnormalities by the gut microbiota and microbial factors; however, their involvement in the various degrees of obesity is not yet understood well. Previously, obesity has been shown to be associated with decreased levels of vitamin B12. Considering exclusive microbial production of vitamin B12, we hypothesised that a decrease in cobalamin levels in obese individuals may be at least partially caused by its depleted production in the intestinal tract by the commensal microbiota. In the present study, our aim was to estimate the abundance of enzymes and metabolic pathways for vitamin B12 synthesis in the gut microbiota of mouse models of alimentary and genetically determined obesity, to evaluate the contribution of the obesogenic microbiome to vitamin B12 synthesis in the gut. We have defined a significantly lower representation of enzymes and metabolic pathways for vitamin B12 biosynthesis in obese mice compared to non-obese mice, wherein enzyme depletion was more pronounced in lepr(-/-) (db/db) mice, which developed severe obesity. The representation of enzymes involved in cobalamin synthesis is strongly correlated with representation of several microbes in high-fat diet fed mice, whereas there were almost no correlations in db/db mice. Therefore, the degree of obesity and the composition of the correspondent microbiota are the main contributors to the representation of genes and pathways for cobalamin biosynthesis in the mouse gut.

Despite advances in understanding of the molecular pathogenesis of glioma, outcomes remain dismal. Developing successful treatments for glioma requires faithful in vivo disease modeling and rigorous preclinical testing. Murine models, including xenograft, syngeneic, and genetically engineered models, are used to study gliomagenesis, identify methods of tumor progression, and test novel treatment strategies. Since the discovery of highly recurrent isocitrate dehydrogenase (IDH) mutations in lower-grade gliomas, there is increasing emphasis on effective modeling of IDH mutant brain tumors. Improvements in preclinical models that capture the phenotypic and molecular heterogeneity of gliomas are critical for the development of effective new therapies. Herein, we explore the current status, advancements, and challenges with contemporary murine glioma models.

Glycogen storage disease type III (GSDIII) is a hereditary glycogenosis caused by deficiency of the glycogen debranching enzyme (GDE), an enzyme, encoded by Agl, enabling glycogen degradation by catalyzing alpha-1,4-oligosaccharide side chain transfer and alpha-1,6-glucose cleavage. GDE deficiency causes accumulation of phosphorylase-limited dextrin, leading to liver disorder followed by fatal myopathy. We tested here the capacity of the new autophagosomal activator GHF-201 to alleviate disease burden by clearing pathogenic glycogen surcharge in the GSDIII mouse model Agl-/-. We used open field, grip strength and rotarod tests for evaluating GHF-201’s effects on locomotion, biochemistry panel to quantify hematological biomarkers, indirect calorimetry to quantify in vivo metabolism, transmission electron microscopy to quantify glycogen in muscle, and fibroblast image analysis to determine cellular features affected by GHF-201. GHF-201 was able to improve all locomotion parameters and partially reversed hypoglycemia, hyperlipidemia and liver and muscle malfunction in Agl-/- mice. Treated mice burnt carbohydrates more efficiently and showed significant improvement of aberrant ultrastructural muscle features. In GSDIII patient fibroblasts, GHF-201 restored mitochondrial membrane polarization and corrected lysosomal swelling. In conclusion, GHF-201 is a viable candidate for treating GSDIII as it recovered a wide range of its pathologies in vivo, in vitro, and ex vivo.

Glioblastoma (GBM) is the most aggressive brain cancer. To model GBM in research, orthotopic brain tumor models, including syngeneic models like GL261 and genetically engineered mouse models like TRP, are used. In longitudinal studies, tumor growth and treatment response are typ-ically tracked with in vivo imaging, including bioluminescence imaging (BLI), which is quick, cost-effective, and easily quantifiable. However, BLI requires luciferase-tagged cells, and recent studies indicate that the luciferase gene can elicit an immune response, leading to tumor rejection and experimental variation. We sought to optimize the engraftment of two luciferase-expressing GBM models, GL261 Red-FLuc and TRP-mCherry-FLuc, showing differences in tumor take, with GL261 Red-FLuc cells requiring immunocompromised mice for 100% engraftment. Immuno-histochemistry and MRI revealed distinct tumor characteristics: GL261 Red-FLuc tumors were well-demarcated with densely packed cells, high mitotic activity, and vascularization. In con-trast, TRP-mCherry-FLuc tumors were large, invasive, and necrotic, with perivascular invasion. Quantifying tumor volume using the HALO® AI analysis platform yielded results comparable to manual measurements, providing a standardized and efficient approach for reliable high-throughput analysis of luciferase-expressing tumors. Our study highlights the importance of considering tumor engraftment when using luciferase-expressing GBM models, providing in-sights for preclinical research design.

Adult T-cell leukemia (ATL) is an aggressive hematologic disease caused by human T-cell leukemia virus type 1 (HTLV-1) infection. Various animal models of HTLV-1 infection/ATL have been established to elucidate the pathogenesis of ATL and develop appropriate treatments. For analyses employing murine models, transgenic and immunodeficient mice are used because of the low infectivity of HTLV-1 in mice. HTLV-1 Tax and HBZ transgenic mice spontaneously develop tumors, and roles for both Tax and HBZ in cell transformation and tumor growth have been established. Severely immunodeficient mice were able to engraft ATL cell lines and have been used in preclinical studies of candidate molecules for the treatment of ATL. HTLV-1-infected humanized mice with an established human immune system are a suitable model to characterize cells in the early stages of HTLV-1 infection. This review outlines the characteristics of mouse models of HTLV-1 infection/ATL and describes progress made in elucidating the pathogenesis of ATL and developing related therapies using these mice.

Pericentromeric regions of chromosomes enriched in tandemly repeated satellite DNA although representing a significant part of eukaryotic genomes are still understudied mainly due to interdisciplinary knowledge gaps. Recent studies suggest their important role in genome regulation, karyotype stability and evolution. Thus, the idea of satellite DNA as a junk part of the genome was refuted. Integration of data about molecular composition, chromosome behaviour and details of in situ organization of pericentromeric regions is of great interest. The objective of this work was a cytogenetic analysis of the interactions of pericentromeric regions non-homologous chromosomes in mouse spermatocytes using immuno-FISH. We analysed two events: the associations between cerntomeric regions of X chromosome and autosomes, and associations between centromeric regions of autosomal bivalents forming chromocenters. We conclude that X chromosome form temporary synaptic associations with different autosomes in early meiotic prophase I which normally can be found at pachytene-diplotene without signs of pachytene arrest. These associations are formed between the satellite DNA-enriched centomeric regions of X chromosome and different autosomes but not involve the satellite-poor centromeric region of Y-chromosome. We suggest the mechanism of X chromosome competitive replacement from such associations during synaptic correction. We showed that centromeric region of the X chromosome remains free of γH2Ax-dependent chromatin inactivation, while Y chromosome is completely inactivated. This findings highlights the predominant role of associations between satellite DNA-enriched regions of different chromosomes including X. We assume that X-autosome temporary associations is a manifestation of an additional synaptic disorders checkpoint. These associations are normally corrected before the late diplotene. We revealed that the intense spreading conditions applied to the spermatocytes I nuclei did not lead to destruction of stretched chromatin fibers i.e. elongated chromocenters enriched in satellite DNA. Revealed by us tight associations between pericentromeric regions of different autosomal bivalents and X chromosome may represent the basis for repeat stability maintenance in autosomes an X chromosome. The consequences of our findings are discussed. We obtained the preparations of mouse spermatocytes nuclei in the meiotic prophase I using two approaches: standard and extremely intense surface spread techniques. Using immuno-FISH we visualized tandemly repeated mouse Major and Minor satellite DNA located in the pericentromeric regions of chromosomes and performed a morphological comparison of the standard- and intensely spreaded meiotic nuclei. Based on our results, we assume the remarkable strength of the chromocenter-mediated associations, “chromatin “bridges”, between different bivalents at the pachytene and diplotene stages. We have demonstrated that the chromocenter “bridges” between the centromeric ends of meiotic bivalents are enriched in both tandemly repeated Major and Minor satellite DNA. Association of centromeric regions of autosomal bivalents and X-chromosome but not with Y-chromosome correlates with the absence of Major and Minor satellites on Y-chromosome. We suggest that revealed tight associations between pericentromeric regions of bivalents may represent the network-like system providing dynamic stability of chromosomal territories, as well as add new data for the hypothesis of ectopic recombination in these regions which supports sequence homogeneity between non-homologous chromosomes and does not contradict the meiotic restrictions imposed by the crossing-over interference near centromeres. We conclude that nuclear architecture in meio-sis may play an essential role in contacts between the non-homologous chromosomes providing the specific characteristics of pericentromeric DNA.

Methionine 77 in calmodulin can be stereospecifically oxidized to methionine sulfoxide by mammalian methionine sulfoxide reductase A. Whether this has in vivo significance is unknown. We therefore created a mutant mouse in which wild-type calmodulin-1 was replaced by a calmodulin containing a mimic of methionine sulfoxide at residue 77. Total calmodulin levels were unchanged in the homozygous M77Q mutant, which is viable and fertile. No differences were observed on learning tests, including the Morris water maze and associative learning. Cardiac stress test results were also the same for mutant and wild type mice. .However, young male and female mice were 20% smaller than wild type mice, although food intake was normal for their weight. Young M77Q mice were notably more active and exploratory than wild type mice. This behavior difference was objectively documented on the treadmill and open field tests. The mutant mice ran 20% longer on the treadmill than controls, and in the open field test, the mutant mice explored more than controls and exhibited reduced anxiety These phenotypic differences bore a similarity to those observed in mice lacking calcium/calmodulin kinase Iiα (CaMKIIα). We then showed that M77Q calmodulin was less effective in activating CaMKIIα than wild type calmodulin. Thus, characterization of the phenotype of a mouse expressing a constitutively active mimic of calmodulin led to the identification of the first calmodulin target that can be differentially regulated by the oxidation state of Met77. We conclude that reversible oxidation of methionine 77 in calmodulin by MSRA can regulate cellular function.

Aggregation of the protein α-Synuclein (αSyn) is a hallmark of Parkinson's disease (PD), dementia with Lewy bodies (DLB) and multiple systems atrophy, and alleviating the extent of αSyn pathology is an attractive strategy against neurodegeneration. The engineered binding protein β-wrapin AS69 binds monomeric αSyn. AS69 reduces primary and secondary nucleation as well as fibril elongation in vitro. It also mitigates aSyn pathology in a mouse model based on intrastriatal injection of aSyn pre-formed fibrils (PFF). Since the PFF-based model does not represent all aspects of PD, we tested here whether AS69 can reduce neurodegeneration resulting from αSyn overexpression. Human A53T-αSyn was overexpressed in the mouse Substantia nigra (SN) by using recombinant adeno-associated viral vector (rAAV). AS69 was also expressed by rAAV transduction. Behavioral tests and immunofluorescence stainings were used as outcomes.Transduction with rAAV-αSyn resulted in αSyn pathology as reported by phospho-αSyn staining and caused degeneration of dopaminergic neurons in the SN. The co-expression of rAAV-AS69 did not reduce αSyn pathology or degeneration of dopaminergic neurons. We conclude that αSyn monomer binding by rAAV-AS69 was insufficient to protect from aSyn pathology resulting from αSyn overexpression.

1) Background: Impeded resolution of inflammation contributes substantially to the pathogenesis of Alzheimer's disease (AD); consequently, resolving inflammation is pivotal to the amelioration of AD pathology. This can potentially be achieved by the treatment with specialized pro-resolving lipid mediators (SPMs), which should resolve neuroinflammation in brains. 2) Methods: Here, we report the effects of long-term treatment with a SPM, maresin like 1 (MarL1), on AD pathogenesis in a transgenic 5xFAD mouse model. 3) Results: MarL1 treatment reduced Aβ overload, curbed the loss of neurons in brains especially cholinergic neurons associated with cleaved-caspase-3-associated apoptotic degeneration, reduced astrogliosis and microgliosis and the pro-inflammatory M1 polarization of microglia, curbed the AD-associated decline in an-ti-inflammatory Iba1+Arg-1+-M2 microglia, reduced astrogliosis-associated level of neuroin-flammatory TNF-α, inhibited phenotype switching of pro-inflammatory neurotoxic A1 astrocytes and N1 neutrophils, promoted polarization of inflammation-resolving neuroprotective A2 as-trocytes, promoted the blood–brain-barrier-associated tight-junction protein claudin-5 and de-creased neutrophil leakage in 5xFAD brains, and induced the switch of neutrophils toward the inflammation-resolving N2 phenotype. 4) Conclusion: Long-term administration of MarL1 mit-igates AD-related neuropathogenesis in brains by curbing neuroinflammation and neurodegen-eration. These findings provided the preclinical leads and mechanistic insights for the develop-ment of MarL1 into an effective modality to ameliorate AD pathogenesis.

Redox balance is increasingly identified as a major player in cellular signaling. A fundamentally simple reaction of oxidation and reduction of cysteine residues in cellular proteins is the central concept in this complex mode of protein function regulation. Oxidation of key cysteine residues occurs at the physiological levels of reactive oxygen species (ROS) but are reduced by a supply of thiol antioxidant molecules including glutathione, glutaredoxin and thioredoxin. While these molecules show complex compensatory roles in experimental conditions, transgenic animal models provide a comprehensive picture to pinpoint the role of each antioxidant. In this review we have specifically focused on the available literature on Thioredoxin-1 system transgenic models that includes Thioredoxin and Thioredoxin reductase proteins. As identification of Thioredoxin protein targets is technically challenging the true contribution of this system in maintaining cellular balance remains unidentified, including the role of this system in the brain.

This study investigated the effects of silibinin, derived from milk thistle (Silybum marianum), on lipopolysaccharide (LPS)-induced morphological changes in mouse macrophages. Silibinin was treated at various doses and time points to assess its effects on macrophage activation including morphological changes and phagocytosis. Silibinin effectively inhibited LPS-induced pseudopodia formation and size increase, while unstimulated cells remained round. Silibinin's impact on phagocytosis was dose- and time-dependent, showing a decrease. We explored its mechanism of action on kinases using a MAPK array. Among the three MAPK family members tested, silibinin had a limited effect on JNK and p38 but significantly inhibited ERK1/2 and related RSK1/2. Silibinin also inhibited MKK6, AKT3, MSK2, p70S6K, and GSK-3β. These findings highlight silibinin's potent inhibitory effects on phagocytosis and morphological changes in macrophages. We suggest its potential as an anti-inflammatory agent due to its ability to target key inflammatory pathways involving ERK1/2 and related kinases. Overall, this study demonstrates the promising therapeutic properties of silibinin in modulating macrophage function and inflammation.

The circadian clock regulates daily changes in behavioral, endocrine and metabolic activities in mammals. Circadian rhythms in cellular physiology are significantly affected by aging. In particular, we previously found that aging has profound impact on daily rhythms in mitochondrial functions, leading to increased oxidative stress. However, this is unlikely due to malfunction of molecular clocks in the suprachiasmatic nucleus or peripheral tissues, as robust clock oscillations are observed therein in old animals. Nonetheless, aging induces changes in gene expression levels and rhythms in various peripheral and probably central tissues. In this article, we review findings on the roles of the circadian clock and aging in regulating mitochondrial rhythms and redox homeostasis. Chronic sterile inflammation is implicated in mitochondrial dysfunction and increased oxidative stress during aging. In particular, upregulation of CD38 by inflammatory response can disturb mitochondrial functions in multiple ways.

There is evidence that spaceflight poses acute and late risks on the central nervous system. To explore possible mechanisms, the proteomic changes following spaceflight in mouse brain were characterized. Space Shuttle Atlantis (STS-135) was launched at the Kennedy Space Center on a 13-day mission. Within 3–5 hours after landing, brain tissue was collected to evaluate protein expression profiles using quantitative proteomic analysis. Our results showed that there were 26 proteins that were significantly altered after spaceflight in the grey and/or white matter. While there was no overlap between the white and grey matter in terms of individual proteins, there was overlap in terms of function, synaptic plasticity, vesical activity, protein/organelle transport, and metabolism. Our data demonstrate that exposure to the spaceflight environment induces significant changes in protein expression related to neuronal structure and metabolic function. This might lead to a significant impact on brain structural and functional integrity that could affect the outcome of space missions.

The mouse visual system recently became the most popular model to study the cellular and circuit mechanisms of sensory processing. However, the importance of eye movements in mice only started to be appreciated recently. Eye movements provide a basis for active sensing and deliver insights into various brain functions and dysfunctions. A plethora of knowledge on the central control of eye movements and their role in perception and behaviour arose from work on primates. However, an overview of the known eye movement types in mice and a comparison to primates is missing.Here, we review the eye movement types described to date in mice and compare them to those observed in primates. We discuss the central neuronal mechanisms for their generation and control. Furthermore, we review the mounting literature on eye movements in mice during head-fixed and freely moving behaviours. Finally, we highlight gaps in our understanding and suggest future directions for research.

Traumatic brain injury (TBI) can result in persistent sensorimotor and cognitive deficits, which occur through a cascade of deleterious pathophysiological events over time. In this study, we investigated the hypothesis that neurodegeneration caused by TBI leads to impairments in sensorimotor function. TBI induces the activation of the caspase-3 enzyme, which triggers cell apoptosis in an in vivo model of fluid percussion injury (FPI). We analyzed caspase-3 mediated apoptosis by TUNEL staining and PARP and annexin V western blotting. We correlated the neurodegeneration with sensorimotor deficits by conducting the animal behavioral tests including grid walk, balance beam, inverted screen test, and climb test. Our study demonstrated that the excess cell death or neurodegeneration correlated with the neuronal dysfunction and sensorimotor impairments associated with TBI.

Excretory-secretory products (ESPs) are the main research targets for investigating the hosts and helminths interaction. Parasitic worms can migrate to parasitic sites and avoid the host immune response by secreting this product. Angiostrongylus cantonensisis an important food-borne zoonotic parasite that causes severe neuropathological damage and symptoms, including eosinophilic meningitis or meningoencephalitis in humans. Benzaldehydes are organic compounds composed of a benzene ring and formyl substituents. This compound has anti-inflammatory and antioxidation properties. Previous studies showed that 3-hydroxybenzaldehyde (3-HBA) and 4-hydroxybenzaldehyde (4-HBA) can reduce apoptosis in A. cantonensis ESPs treated astrocytes. These results on the protective effect underlying benzaldehyde have primarily focused on cell survival. The study was designed to investigate the molecular mechanisms of endoplasmic reticulum stress (ER stress) and oxidative stress in astrocytes in A. cantonensis ESPs treated astrocytes and to evaluate the therapeutic consequent of 3-HBA and 4-HBA. First, we initially established the RNA-seq dataset in each group, including Normal, ESPs, ESPs+3-HBA, and ESPs+4-HBA. We also found that benzaldehyde (3-HBA and 4-HBA) can stimulate astrocytes to express ER stress-related molecules after ESP treatment. The level of oxidative stress could also be decreased in astrocytes by elevating antioxidant activity and reducing ROS generation. These results suggested that benzaldehyde may be a potential therapeutic compound for human angiostrongyliasis to support brain cell survival by inducing the expression levels of ER stress- and oxidative stress-related pathway.

The severest form of muscular dystrophy (MD) termed Duchenne MD (DMD) remains to this day an incurable disease, hence the continued effort to further develop supportive therapies. Perturbation of autophagy, a degradative yet protective mechanism activated when tissues face severe and persistent stress, is critically involved in DMD, consequently, treatments harnessing autophagic capacities represent an amenable therapeutic strategy. We studied the effects of the protective osmolyte ectoine in the standard mouse model of DMD, the MDX, zooming in on the autophagy-related proteome. From birth, mice were treated with ectoine in the drinking water (150mg/kg) or through daily intraperitoneal injection (177mg/kg) until 5 weeks old. Hind limb muscles were dissected, performing western blotting for protein quantification and immunofluorescence to investigate tissue distribution. We report significant alterations of total levels of autophagy related 5 (ATG5), Ser366 phosphorylated sequestosome 1 (SQSTM1) and heat shock protein 70 (HSP70), and of activated microtubule-associated protein 1A/1B-light chain 3 (LC3 II) in mitochondrial fractions. Ectoine tends to restore the shifted balance between LC3 II and SQSTM1 levels observed in MDX muscle, and LC3 II upregulation was most pronounced on muscle fibers of MDX treated with ectoine in the drinking water. Findings from this explorative study support a possible beneficial effect of ectoine on the autophagic deficit in the MDX, which warrants its further exploration as a therapeutic supplement for DMD.

Malaria comprises a spectrum of disease syndromes and the immune system is a major participant in malarial disease. This is particularly true in relation to the immune responses elicited against blood stages of Plasmodium-parasites that are responsible for the pathogenesis of infection. Mouse models of malaria are commonly used to dissect the immune mechanisms underlying disease. While no one mouse model of Plasmodium infection completely recapitulates all the features of malaria in humans, collectively the existing models are invaluable for defining the events that lead to the immunopathogenesis of malaria. Here we review the different mouse models of Plasmodium infection that are available, and highlight some of the main contributions these models have made with regards to identifying immune mechanisms of parasite control and the immunopathogenesis of malaria.

Sperm DNA integrity and chromatin status serve as pivotal indicators of sperm quality, given their in-tricate link to sperm function, embryo development, and overall fertility. Defects in chromatin com-paction, which are often associated with compromised protamine content, can lead to damaged DNA strands. In this study, chromatin status and possible correlation with DNA damage was assessed in males of three mouse species: Mus musculus, M. spretus and M. spicilegus. We employed various staining methods, including aniline blue, methylene blue (Diff-Quik), toluidine blue and chromomy-cin A3, to assess chromatin compaction in cauda epididymal sperm. Samples were also analyzed by the sperm chromatin structure assay (SCSA) to estimate DNA fragmentation (%tDFI, %HDS). Analyses were carried out on freshly collected sperm and cells incubated for 3 h in a Hepes-buffered modified Tyrode's medium simulating conditions of the female reproductive tract. Notably, the analysis of chromatin status yielded minimal abnormal values across all three species, employing diverse meth-odologies. SCSA analyses revealed distinct variations in %tDFI between species. Following sperm incubation, the percentages of sperm stained with methylene blue exhibited differences among the species and were significantly correlated to the DNA fragmentation index. HDS demonstrated correla-tions with the percentages of sperm stained by aniline blue, methylene blue and chromomycin A3. Overall, chromatin compaction was high across all species, with limited differences among them. The relationship between chromatin status and DNA integrity appeared to be related to levels of sperm competition among species.

Aging is a major risk factor for Alzheimer's disease (AD). AD mouse models are frequently used to assess pathology, behavior, and memory in AD research. While the pathological characteristics of AD are well established, our understanding of the changes in the metabolic phenotypes with age and pathology is limited. In this work, we used the Promethion cage systems® to monitor changes in physiological metabolic and behavioral parameters with age and pathology in wild-type and 5xFAD mouse models. Then, we assessed whether these parameters could be altered by treatment with oleocanthal, a phenolic compound with neuroprotective properties. Findings demonstrated metabolic parameters such as body weight, food and water intake, energy expenditure, dehydration, and respiratory exchange rate, and the behavioral parameters of sleep patterns and anxiety-like behavior are altered by age and pathology. However, the effect of pathology on these parameters was significantly greater than normal aging, which could be linked to amyloid-β deposition and blood-brain barrier (BBB) disruption. In addition, and for the first time, our findings suggest an inverse correlation between sleep hours and BBB breakdown. Treatment with oleocanthal improved the assessed parameters and reduced anxiety-like behavior symptoms and sleep disturbances. In conclusion, aging and AD are associated with metabolism and behavior changes, with the changes being greater with the latter, which were rectified by oleocanthal. In addition, our findings suggest that monitoring changes in metabolic and behavioral phenotypes could provide a valuable tool to assess disease severity and treatment efficacy in AD mouse models.

Gamma-aminobutyric acid (GABA) and glycine act as inhibitory neurotransmitters. Three types of inhibitory neurons and terminals, GABAergic, GABA/glycine co-releasing, and glycinergic, are orchestrated in the spinal cord neural circuits and play key roles in the regulation of pain, locomotive movement, and respiratory rhythms. Herein, we first describe GABAergic and glycinergic transmission and inhibitory networks, which consist of three types of terminals, in the mature mouse spinal cord. Second, we describe the developmental formation of GABAergic and glycinergic networks, with specific focus on the differentiation of neurons, formation of synapses, maturation of removal systems, and changes in their action. GABAergic and glycinergic neurons are derived from the same domains of the ventricular zone. Initially, GABAergic neurons are differentiated and their axons form synapses. Some of these neurons remain GABAergic in lamina I and II. Many of GABAergic neurons convert to co-releasing state. The co-releasing neurons and terminals remain in the dorsal horn, whereas many of co-releasing ones ultimately become glycinergic in the ventral horn. During the development of terminals and the transformation from radial glia to astrocytes, GABA and glycine receptor subunit compositions markedly change, removal systems mature, and GABAergic and glycinergic action shifts from excitatory to inhibitory.

As symbionts of fungi and algae, lichens produce a variety of secondary products which pharmacological activities. This study aimed to investigate the anti-inflammatory activities of Heterodermia hypoleuca and its main compound, atraric acid. The results confirmed that atraric acid could regulating induced pro-inflammatory cytokine, nitric oxide, induced nitric oxide synthase and cyclooxygenase-2 expression by lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Means while, atraric acid down-regulated expression of phosphorylated IκB, ERK and nuclear factor kappa B (NFκB) signaling pathway to exhibit anti-inflammatory effects in LPS-stimulated RAW264.7 cells. Based on these results, the anti-inflammatory effect of atraric acid during LPS-induced endotoxin shock in a mouse model was confirmed. In the atraric acid treated-group, cytokine production was decreased in the peritoneum and serum, and each organ damaged by LPS-stimulation was recovered. These results show that atraric acid has an anti-inflammatory effect and its molecular mechanism may be involved in the inactivation of the ERK/NFκB signaling pathway, demonstrating its value as a potential therapeutic for inflammatory diseases.

Volatile compounds, abundant in breath, can be used to accurately diagnose and monitor a range of medical conditions. This offers a non-invasive, low-cost approach with screening applications; however, uptake of this diagnostic approach has been limited by conflicting published outcomes. Most published reports rely on large scale screening of the public, at single time points and without reference to ambient air. Here, we present a novel approach to volatile sampling from cellular headspace and mouse breath that incorporates multi-time point analysis and ambient air subtraction revealing compound flux as an effective proxy of active metabolism. This approach to investigating breath volatiles offers a new avenue for disease biomarker discovery and diagnosis. Using gas chromatography mass spectrometry (GC/MS), we focus on low molecular weight, metabolic substrate/by-product compounds and demonstrate that this non-invasive technique is sensitive (reproducible at ~1 µg cellular protein, or ~500,000 cells) and capable of precisely determining cell type, status and treatment. Isolated cellular models represent components of larger mammalian systems and we show that stress- and pathology-indicative compounds are detectable in mice, supporting further investigation using this methodology as a tool to identify volatile targets in human patients.

Magnetic resonance elastography (MRE) has revealed sexual dimorphism in brain stiffness in healthy individuals and multiple sclerosis (MS) patients. In the animal model of MS, experimental autoimmune encephalomyelitis (EAE), we showed previously that inflammation-induced brain softening was associated with alterations of the extracellular matrix (ECM). However, it remained unclear whether the brain ECM presents sex-specific properties that can be visualized by MRE. Therefore, we aimed here at quantifying sexual dimorphism in brain viscoelasticity in association with ECM changes in healthy and inflamed brains. Multifrequency MRE was applied to the midbrain of healthy and EAE mice of both sexes to quantitatively map regional stiffness. To define differences in brain ECM composition, gene expression of the key basement membrane components laminin (Lama4, Lama5), collagen (Col4a1, Col1a1) and fibronectin (Fn1) was investigated by RT-qPCR. We showed that the healthy male cortex expressed less Lama4, Lama5, Col4a1 but more Fn1 (all p < 0.05) than the healthy female cortex, which was associated with 9% softer properties (p = 0.044) in that region. At peak EAE, cortical softening was similar in both sexes compared to healthy tissue, with an 8% difference remaining between males and females during EAE (p < 0.001). Cortical Lama4, Lama5 and Col4a1 expression increased 2 to 3-fold in EAE in both sexes while Fn1 decreased only in males (all p < 0.05). No significant sex differences in stiffness were detected in other brain regions. In conclusion, sexual dimorphism in the ECM composition of cortical tissue in the mouse brain is reflected by in vivo stiffness measured with MRE and should be considered in future studies by sex-specific reference values.

Chronic Chagas Cardiomyopathy (CCC) results from infection with the protozoan parasite Trypanosoma cruzi and is a prevalent cause of heart disease in endemic countries. We previously found that cardiac fibrosis can vary widely in C3H/HeN mice chronically infected with T. cruzi JR strain, mirroring the spectrum of heart disease in humans. In this study, we examined functional cardiac abnormalities in this host:parasite combination to determine its potential as an experimental model for CCC. We utilized electrocardiography (ECG) to monitor T. cruzi-infected mice and determine whether ECG markers could be correlated with cardiac function abnormalities. We found that the C3H/HeN:JR combination frequently displayed early onset CCC indicators, such as sinus bradycardia and right bundle branch block, as well as prolonged PQ, PR, RR, ST and QT intervals in the acute stage. Our model exhibited high levels of cardiac inflammation and enhanced iNOS expression in the acute stage, but denervation did not appear to have a role in pathology. These results demonstrate the potential of the C3H/HeN:JR host:parasite combination as a model for CCC that could be used for screening new compounds targeted at cardiac remodeling and for examining the potential of anti-parasitic drugs to prevent or alleviate CCC development and progression.

Coxsackievirus B3 (CVB3) is one of the most common pathogens that cause myocarditis in humans. However, a sufficient therapeutic drug was not developed yet. Caboxamycin, a benzoxazole antibiotic, isolated from the culture broth of the marine strain Streptomyces sp., SC0774, displayed an antiviral effect in the CVB3-infected HeLa cells and CVB3-induced myocarditis mouse model. Caboxamycin significantly inhibited CVB3 VP1 production and cleavage of translation factor eIF4G1 from CVB3-infected HeLa cells at a 100 μg/ml concentration. Moreover, virus RNA amplification was dramatically reduced by caboxamycin treatment in HeLa cells. The caboxamycin cardiac protective effect was observed on the CVB3-mediated myocarditis mice model. The caboxamycin-treated mice survival was significantly increased compared to untreated mice (treated vs untreated, 100 vs 45 %). Heart histologic findings showed that myocardium damage and inflammation were significantly decreased by caboxamycin treatment. Caboxamycin directly inhibited caspase3 activity and cardiac myocytes apoptosis. These results suggested that caboxamycin strongly suppressed cardiac myocyte apoptosis and effectively inhibited the proliferation of CVB3 from in vitro and in vivo conditions. Furthermore, this study proposed that caboxamycin could potentially be applied in developing a new antiviral drug for CVB3-induced myocarditis.

CD8+ cytotoxic T lymphocytes (CTLs) play a crucial role in anti-tumor immunity. In a previous study, we identified a subset of murine effector CTLs expressing the hepatocyte growth factor (HGF) receptor c-Met (c-Met+ CTLs) that are endowed with enhanced cytolytic capacity. HGF directly inhibited the cytolytic function of c-Met+ CTLs, both in 2D in vitro assays and in vivo, leading to reduced T cell responses against metastatic melanoma. To further investigate the role of c-Met+ CTLs in a three-dimensional (3D) setting, we studied their function within B16 melanoma spheroids and examined the impact of cell-cell contact on the modulation of inhibitory checkpoint molecules expression such as KLRG1, PD-1 and CTLA-4. Additionally, we evaluated the cytolytic capacity of human CTLs clones expressing c-Met (c-Met+) and compared it to c-Met− CTLs clones. Our results indicated that, similar to their murine counterparts, c-Met+ human CTLs clones exhibited increased cytolytic activity compared to c-Met− CTLs clones, and this enhanced function was negatively regulated by the presence of HGF. Taken together, our findings highlight the potential of targeting the HGF/c-Met pathway to modulate CTL-mediated anti-tumor immunity. This research holds promises for developing strategies to enhance the effectiveness of CTL-based immunotherapies against cancer.

Ferroptosis is a unique variety of non-apoptotic cell death, driven by massive lipid oxidation in an iron-dependent manner. Since Ferroptosis was introduced as a concept in 2012, it was shown it's essential role in the pathogenesis in neurodegenerative diseases and an important role in therapy-resistant cancer cells. Thus, a detailed molecular understanding of both canonical and alternative ferroptosis pathways are required. There is a set of widely used chemical agents to modulate ferroptosis using different pathway targets: Erastin blocks cystine-glutamate antiporter, system xc-; ML210 directly inactivate GPX4; L-buthionine sulfoximine (BSO) inhibits γ-glutamylcysteine synthetase, an essential enzyme for glutathione synthesis de novo. Most studies were focused on lipidomic profiling of model systems undergoing death in a ferroptotic modality.

Miscarriage due to blastocyst implantation failure occurs in up to two-thirds of all miscarriage cases in human. The calcium ion has been shown to be involved in many cellular signal transduction pathways as well as in the regulation of cell adhesion, which is necessary for the embryo implantation process. Exposure to endocrine-disrupting chemicals (EDs) during early gestation results in disruption of intrauterine implantation and uterine reception, leading to implantation failure. In this study, ovarian estrogen (E2), bisphenol A (BPA), or 4-tert-octylphenol (OP), with or without ICI 182,780 (ICI) were injected subcutaneously from gestation day 1 to gestation day 3 post-coitus. The expression levels of the calcium transport genes were assessed in maternal uteri and implantation sites. The number of implantation sites was significantly low in the OP group, and implantation sites were absent in the E2 and EDs+ICI groups. There were different calcium transient transport channel expression levels in uterus and implantation site samples. The levels of TRPV5 and TRPV6 gene expression were significantly increased by EDs with/without ICI treatment in uterus. Whereas, TRPV5 and TRPV6 gene expression were significantly lower in implantation sites samples. NCX1 and PMCA1 mRNA levels were significantly decreased by OP and BPA in the implantation site samples. Compared to vehicle treatment in uterus, both the MUC1 mRNA and protein levels were markedly high in all but the BPA group. Taken together, these results suggest that both BPA and OP can impair embryo implantation through alteration of calcium transport gene expressions and by affecting uterine receptivity.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Abstract: This study aimed at investigating the effects of Valencia KK4-type peanut skin ethanolic extract (KK4-PSE) in combination with cisplatin or 5-fluorouracil (5-FU) against HeLa cells in vitro and in xenograft models. MTT assay showed that KK4-PSE, cisplatin, and 5-FU suppressed proliferation of HeLa cells in a dose and time dependent manner. Drug interactions by Chou-Talalay method demonstrated that KK4-PSE enhanced antiproliferative activity of 5-FU against HeLa cells with combination index (CI) values of 0.49 (48 h) and 0.60 (72 h), indicating a synergistic effect, while KK4-PSE combined with cisplatin exhibited an additive effect (CI = 1.02) (72 h) and antagonistic effect at 24 and 48 h exposures (CI = 1.12 and 1.18, respectively). In nude mouse xenograft models, the combination of 5-FU and KK4-PSE markedly reduced HeLa tumor weights compared with control and single agent treatments. The combination of KK4-PSE and 5-FU achieved greater tumor growth inhibition than that of the KK4-PSE-cisplatin combination. KK4-PSE mitigated hepatotoxicity induced by both cisplatin and 5-FU in nude mice. The spleen hyaloserositis was significantly reduced in the combination treatment of 5-FU and KK4-PSE. These findings suggest a potential of KK4-PSE to inhibit cervical cancer cell growth while alleviating the toxicities of cisplatin and 5-FU.

Our study investigated the innate immune response to Toxoplasma gondii infection by assessing microglial phenotypic changes and sickness behavior as inflammatory response markers post-ocular tachyzoite instillation. Disease progression in Swiss albino mice was compared with documented outcomes in BALB/c mice using identical ocular route and parasite burden (2x105 tachyzoites), with saline as control. Contrary to expectations, Swiss albino mice displayed rapid, lethal disease progression, marked by pronounced sickness behaviors and mortality within 11-12 days post-infection, while survivors showed no apparent signs of infection. Comparative analysis revealed T. gondii-infected BALB/c mice exhibited reduced avoidance of feline odors, while in-fected Swiss albino mice showed enhanced avoidance responses. There was a significant increase in microglial cells in the dentate gyrus molecular layer of infected Swiss albino mice compared to BALB/c mice and their respective controls. Hierarchical cluster and discriminant analyses iden-tified three microglial morphological clusters, differentially affected by T. gondii infection across strains. BALB/c mice exhibited increased microglial branching and complexity, while Swiss al-bino mice showed reduced shrunk microglial arbors, diminishing morphological complexity. These findings highlight strain-specific differences in disease progression and inflammatory reg-ulation, indicating lineage-specific mechanisms in inflammatory responses, tolerance, and re-sistance. These elements are critical in devising control measures for toxoplasmosis.

Research on microglia in Down syndrome (DS) has shown that microglial activation, increased inflammatory gene expression, and oxidative stress occur at different ages in DS brains. However, most studies resulted in simplistic definitions of microglia as quiescent or active, ignoring potential intermediate states. However, a recent work on microglial cells in young DS brains indicated that those evolve through different intermediate activation phenotypes before reaching a full activated state. Here we used single nucleus RNA sequencing, to examine how trisomy affects microglial states in the Ts65Dn mouse model of DS. Despite no substantial changes in the proportion of glial populations, differential expression analysis revealed cell type-specific gene expression changes, most notably in astroglia, microglia, and oligodendroglia. Focusing on microglia, we identified differential expression of genes associated with different microglial states, including disease-associated microglia (DAMs), activated response microglia (ARMs), and human Alzheimer’s disease microglia (HAMs), in trisomic microglia. Furthermore, pseudotime analysis reveals a unique reactivity profile in Ts65Dn microglia, with fewer in a homeostatic state and more in an intermediate aberrantly reactive state than in euploid microglia. This comprehensive understanding of microglial transcriptional dynamics sheds light on potential pathogenetic mechanisms but also possible avenues for therapy for neurodevelopmental disorders.

A cell-surface ectonucleotidase CD39 mediates the conversion of extracellular ATP into immunosuppressive adenosine with another ectonucleotidase CD73. The elevated adenosine in the tumor microenvironment (TME) attenuates antitumor immunity, which promotes tumor cell immunologic escape and progression. Anti-CD39 monoclonal antibodies (mAbs), which suppress the enzymatic activity, can be applied to antitumor therapy. Therefore, an understanding of the relationship between the inhibitory activity and epitope of mAbs is important. We previously established an anti-mouse CD39 (mCD39) mAb, C₃₉Mab-1 using the Cell-Based Immunization and Screening (CBIS) method. In this study, we determined the critical epitope of C₃₉Mab-1 using flow cytometry. We performed the PA tag (12 amino acids)-substituted analysis (named PA scanning) and RIEDL tag (5 amino acids)-substituted analysis (named RIEDL scanning) to determine the critical epitope of C₃₉Mab-1 using flow cytometry. By the combination of PA scanning and RIEDL scanning, we identified the conformational epitope, spanning three segments of 275^th to 279^th, 282^nd to 291^st, and 306^th to 323^rd amino acids of mCD39. These analyses would contribute to the identification of the conformational epitope of membrane proteins.

Cyclin-dependent kinase-like 5 (CDKL5) deficiency disorder (CDD) is a rare neurodevelopmental disease caused by mutations in the X-linked CDKL5 gene. CDD is characterized by a broad spectrum of clinical manifestations, including early-onset refractory epileptic seizures, intellectual disability, hypotonia, visual disturbances, and autism-like features. The Cdkl5 knockout (KO) mouse recapitulates several features of CDD, including autistic-like behavior, impaired learning and memory, and motor stereotypies. These behavioral alterations are accompanied by diminished neuronal maturation and survival, reduced dendritic branching and spine maturation, and marked microglia activation. There is currently no cure or effective treatment to ameliorate the symptoms of the disease. Aerobic exercise is known to exert multiple beneficial effects in the brain, not only by increasing neurogenesis, but also by improving motor and cognitive tasks. To date, no studies have analyzed the effect of physical exercise on the phenotype of a CDD mouse model. In view of the positive effects of voluntary running on the brain of mouse models of various human neurodevelopmental disorders, we sought to determine whether voluntary daily running, sustained over a month, could improve brain development and behavioral defects in Cdkl5 KO mice. Our study showed that long-term voluntary running improved hyperlocomotion and impulsivity behaviors, and memory performance of Cdkl5 KO mice. This is correlated with increased hippocampal neurogenesis, neuronal survival, spine maturation, and inhibition of microglia activation. These behavioral and structural improvements were associated with increased BDNF levels. Given the positive effects of BDNF on brain development and function, the present findings support the positive benefits of exercise as an adjuvant therapy for CDD.

The vascular endothelium is key target for immune, and thrombotic responses that has to be controlled in successful xenotransplantation. Several genes were identified that if induced or overexpressed help to regulate the inflammatory response and preserve the transplanted organ function and metabolism. However, few studies addressed combined expression of such genes. The aim of this work was to evaluate in vivo the effects of the simultaneous expression of a three human genes in a mouse generated using the multi-cistronic F2A technology. Male 3-month-old mice that express human heme oxygenase 1 (hHO-1), ecto-5’-nucleotidase (hE5NT), and ecto-nucleoside triphosphate diphosphohydrolase 1 (hENTPD1) (Transgenic) were compared to wild-type FVB mice (Control). Background analysis include extracellular nucleotide catabolism enzymes profile on the aortic surface, blood nucleotide concentration and serum L-arginine metabolites. Furthermore, inflammatory stress induced by LPS in transgenic and control mice was used to characterize interleukin 6 (IL-6) and adhesion molecules endothelium permeabil-ity responses. Transgenic mice had significantly higher rates of extracellular adenosine triphosphate and adenosine monophosphate hydrolysis on the aortic surface in comparison to control. Increased levels of blood AMP and adenosine were also noticed in transgenics. Moreover, transgenic ani-mals demonstrated the decrease in serum monomethyl-L-arginine level and a higher L-arginine/ monomethyl-L-arginine ratio. Importantly, significantly decreased serum IL-6, and adhesion mol-ecule levels were observed in transgenic mice in comparison to control after LPS treatment. Fur-thermore, reduced endothelial permeability in the LPS-treated transgenic mice was noted as com-pared to LPS-treated control. The human enzymes (hHO-1, hE5NT, hENTPD1) simultaneously encoded in transgenic mice demonstrated benefits in sev-eral biochemical and functional aspects of endothelium. This is consistent in use of this approach in the context of xenotransplantation.

Non-alcoholic steatohepatitis (NASH), which is the most severe manifestation of non-alcoholic fatty liver disease (NAFLD), has been recognized as a major hepatocellular carcinoma (HCC) catalyst. However, the molecular mechanism of NAFLD-NASH-HCC sequence remains unclear and a specific and effective treatment for NASH has not yet been established. The progress in this field depends on the availability of reliable preclinical models which show the steady progress to NASH, liver cirrhosis, and HCC. However, most of NASH mouse models that have been described to date develop NASH generally for more than 24 weeks and there is an uncertainty of HCC development. To overcome such shortcomings of experimental NASH studies, we established a novel NASH-HCC mouse model with very high reproducibility, generality, and convenience. We treated male C57BL/6J mice with a newly developed choline-deficient and methionine-restricted high-fat diet (CDMRHFD) for 60 weeks. Treatment of CDMRHFD for 3 weeks revealed marked steatosis, lobular inflammation, and fibrosis, histologically diagnosed as NASH. Liver cirrhosis was observed in all mice with 36-week treatment. Liver nodule emerged at 12 weeks of the treatment, and diameter >2 mm liver tumors developed in all mice at 24 weeks of the treatment. In conclusion, our rapidly progressive and highly reproducible NASH-liver cirrhosis-HCC model is helpful for preclinical development and research on the pathogenesis of human NAFLD-NASH-HCC. Our mouse model would be useful for the development of novel chemistry for NASH-HCC-targeted therapies or HCC prevention strategies.

Two putative boar pheromones (Androstenone and Androstenol) were discovered in endangered mouse deer during captive breeding program. This study further examined the molecular characteristics, pheromone synthesis pathway, and the functional role of these pheromones in reproduction of mouse deer. CYP17A1 and CYB5 genes were cloned and expressed in HEK-293, COS-7 cell lines and gonads of mouse deer to investigate CYP17A1 gene’s andien-β-synthase activity towards synthesis of sex pheromones in mouse deer. An enzyme immunoassay was also developed and standardized to measure the fecal androstenone during reproductive cycles of mouse deer. Results showed that mouse deer’s CYP17A1 gene possesses andien-β-synthase activity and could transform pregnenolone into 5,16-androstadien-3β-ol. The expression of CYP17A1 gene upregulated in the testis and ovary, compared to other tissues in mouse deer. Significantly elevated pheromones and estrogens were recorded prior to delivery and postpartum estrus / mating in mouse deer. Further, there were weak correlations between fecal pheromones and estrogens/ androgens in mouse deer during breeding season. The findings suggest that the boar pheromones might play a direct role in the reproductive activities of mouse deer which might be used for breeding of mouse deer elsewhere.

Ketogenic diet (KD) is getting in the focus as auxiliary cancer therapy, since it provides sufficient energy supply for healthy cells, while impairing energy production in tumor cells underlying the Warburg effect. Thereby, it can assist in inhibiting tumor growth and simultaneously counteract cachexia, which is frequently observed in cancer patients under chemotherapy. In order to provide molecular evidence for the proposed synergistic inhibition of tumor growth, we applied untargeted quantitative metabolome analysis on a breast cancer xenograft mouse model. Healthy mice and such bearing breast cancer xenografts and receiving chemotherapy were compared after treatment with control diet and KD. Metabolomic profiling was performed on plasma samples, applying high-performance liquid chromatography coupled to tandem mass spectrometry. Statistical analysis revealed metabolic fingerprints comprising numerous significantly regulated features in the group of mice bearing breast cancer. This fingerprint disappeared after treatment with KD, resulting in recovery to the metabolic status observed in healthy mice receiving control diet. Moreover, amino acid metabolism as well as fatty acid transport were found to be affected by both, the tumor and the applied KD. Our results provide clear evidence of a significant molecular effect of KD in the context of tumor growth inhibition.

Background/Goals: The gut hormone PYY secreted from intestinal L-cells has been implicated in the mechanisms of satiation via Y2-receptor (Y2R) signaling in the brain and periphery and is a major candidate for mediating the beneficial effects of bariatric surgery on appetite and body weight. Methods: Here we assessed the role of Y2R signaling in the response to low- and high-fat diets and its role in the effects of Roux-en-Y gastric bypass (RYGB) surgery on body weight, body composition, food intake, energy expenditure and glucose handling, in global Y2R-deficient (Y2RKO) and wildtype mice made obese on high-fat diet. Results: Both male and female Y2RKO mice responded normally to low- and high-fat diet in terms of body weight, body composition, fasting levels of glucose and insulin, as well as glucose and insulin tolerance for up to 30 weeks of age. Contrary to expectations, obese Y2RKO mice also responded similarly to RYGB compared to WT mice for up to 20 weeks after surgery, with initial hypophagia, sustained body weight loss, and significant improvements in fasting insulin, glucose tolerance, HOMA-IR, and liver weight compared to sham-operated mice. Furthermore, non-surgical Y2RKO mice weight-matched to RYGB showed the same improvements in glycemic control as Y2RKO mice with RYGB that were similar to WT mice. Conclusions: PYY signaling through Y2R is not required for the normal appetite-suppressing and body weight-lowering effects of RYGB in this global knockout mouse model. Potential compensatory adaptations of PYY signaling through other receptor subtypes or other gut satiety hormones such as GLP-1 remain to be investigated.

Leukocyte migration is an essential function of innate and adaptive immune responses. Chemokines and their receptors control the migration system. The abundance of chemokines is controlled by atypical chemokine receptors (ACKRs), chemokine receptor-like molecules that do not couple to the G protein signaling pathways. Among them, ACKR4 regulates dendritic cell migration by controlling the ligands and is involved in tumor development in mouse models. Because no anti-mACKR4 mAb for flow cytometry has been reported, this study aimed to develop a novel monoclonal antibody (mAb) for mouse ACKR4 (mACKR4). Among the established anti-mACKR4 mAbs, A₄Mab-1 (rat IgG_2b, kappa), A₄Mab-2 (rat IgG_2b, kappa), and A₄Mab-3 (rat IgG_2b, kappa) recognized mACKR4-overexpressed Chinese hamster ovary-K1 (CHO/mACKR4) by flow cytometry. The dissociation constant (K_D) values of A₄Mab-1, A₄Mab-2, and A₄Mab-3 for CHO/mACKR4 were determined as 3.5 × 10⁻⁹ M, 6.0 × 10⁻⁹ M, and 1.6 × 10⁻⁹ M, respectively. Furthermore, A₄Mab-1 and A₄Mab-2 could detect mACKR4 by western blotting. These results indicated that A₄Mab-1, A₄Mab-2, and A₄Mab-3 help to detect mACKR4 by flow cytometry and western blotting and obtain the proof of concept in preclinical models.

C-C motif chemokine receptor 1 (CCR1/CD191) is a member of G-protein-coupled receptors, and is expressed on myeloid cells, such as neutrophils and macrophages. Because the CCR1 signaling promotes tumor expansion in the tumor microenvironment (TME), the modification of TME is an effective strategy for cancer therapy. Although CCR1 is an attractive target for solid tumors and hematological malignancies, anti-CCR1 therapeutic agents have not been approved. Here, we established a novel anti-mouse CCR1 (mCCR1) monoclonal antibody (mAb), C₁Mab-6 (rat IgG_2b, kappa), using the Cell-Based Immunization and Screening (CIBS) method. Flow cytometry and Western blot analyses showed that C₁Mab-6 recognizes mCCR1 specifically. The dissociation constant of C₁Mab-6 for mCCR1-overexpressed Chinese hamster ovary-K1 was determined as 3.9×10^-9 M, indicating that C₁Mab-6 possesses a high affinity to mCCR1. These results suggest that C₁Mab-6 could be a useful tool for targeting CCR1 in preclinical mouse models.

The differentiation of ESCs into cardiomyocytes in vitro is an excellent and reliable model system for studying normal cardiomyocyte development in mammals, modeling cardiac diseases, and for use in drug screening. Mouse ESC differentiation still provides relevant biological information about cardiac development. However, the current methods for efficiently differentiating ESCs into cardiomyocytes are limiting. Here, we describe a “WNT Switch” method to efficiently commit mouse ESCs into cardiomyocytes using the small molecule WNT signaling modulators CHIR99021 and XAV939 in vitro. This method significantly improves the yield of beating cardiomyocytes, reduces number of treatments, and is less laborious.

Atherogenic lipoproteins may impair vascular reactivity, leading to tissue damage in various organs, including the eye. This study aimed to investigate whether ophthalmic artery reactivity is affected in mice lacking the apolipoprotein E gene (ApoE-/-), a model for hypercholesterolemia and atherosclerosis. Twelve-month-old male ApoE-/- mice and age-matched wild-type controls were used to assess vascular reactivity using videomicroscopy. Moreover, vascular mechanics, lipid content, levels of reactive oxygen species (ROS), expression of pro-oxidant redox enzymes and of the lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) were determined in vascular tissue. Unlike the aorta, the ophthalmic artery of ApoE-/- mice developed no signs of endothelial dysfunction and no signs of excessive lipid deposition. Remarkably, levels of ROS, nicotinamide adenine dinucleotide phosphate oxidase 1 (NOX1), NOX2, NOX4, and of LOX-1 were increased in the aorta but not in the ophthalmic artery of ApoE-/- mice. Our findings suggest that ApoE-/- mice develop endothelial dysfunction in the aorta by increased oxidative stress via involvement of LOX-1, NOX1 and NOX2, whereas NOX4 may participate in media remodeling. In contrast, the ophthalmic artery appears to be resistant to chronic apolipoprotein E deficiency. Lack of LOX-1 expression/overexpression in response to increased ox-LDL levels may be a possible mechanism of action.

The CC chemokine receptor 3 (CCR3) is a receptor for CC chemokines, including CCL5/RANTES, CCL7/MCP-3, and CCL11/eotaxin. CCR3 is expressed on the surface of eosinophils, basophils, a subset of Th2 lymphocytes, mast cells, and airway epithelial cells. CCR3 and its ligands are involved in airway hyperresponsiveness in allergic asthma, ocular allergy, and cancers. Therefore, CCR3 is an attractive target for those therapies. Previously, anti-mouse CCR3 (mCCR3) monoclonal antibodies (mAbs), C3Mab-3 (rat IgG2a, kappa), and C3Mab-4 (rat IgG2a, kappa) were developed using the Cell-Based Immunization and Screening (CBIS) method. In this study, the binding epitope of these mAbs was investigated using flow cytometry. The CCR3 extracellular domain-substituted mutant analysis showed that C3Mab-3, C3Mab-4, and a commercially available mAb (J073E5) recognized the N-terminal region (amino acids 1–38) of mCCR3. Next, the alanine scanning was conducted in the N-terminal region. The results revealed that Ala2, Phe3, Asn4, and Thr5 of mCCR3 are involved in C3Mab-3 binding, whereas Ala2, Phe3, and Thr5 are essential to C3Mab-4 binding, and Ala2 and Phe3 are crucial to J073E5 binding. These results reveal the involvement of the N-terminus of mCCR3 in the recognition of C3Mab-3, C3Mab-4, and J073E5.

Background: Pre-treatment with lipopolysaccharide (LPS) protected the kidney against a later lethal ischemia. To reveal the mechanisms of renal cross-tolerance and septic acute kidney injury we investigated the effects of LPS on miRNA expression in the kidney. Methods: Male NMRI mice were injected with 40 and 10 mg/kg LPS ip. and sacrificed at 1.5 and 6 hours (early preconditioning, EP) and at 24 and 48 hours (late preconditioning, LP). The miRNA profile was established using miRCURY LNA™ microarray and confirmed with qPCR. Results: Plasma urea concentration peaked at 24 hours after LPS and decreased thereafter. Renal TNF-α and IL-6 mRNA were extremely elevated at all time-points. miRNome changes were mild at 1.5 hours, most miRNAs were altered at 6 and 24 hours and declined by 48 hours. Not all miRNAs could be assayed or validated by qPCR. In EP miR-762 was newly identified and validated and was the most elevated miRNA with both methods. In LP miR-21a-5p was the most influenced miRNA followed by miR-451a, miR-144-3p and miR-146a-5p. MiR-21a-3p increased significantly in both EP and LP. Conclusion: miR-762 might attenuate the LPS-induced immune response during EP and the miR-144/451 cluster is involved in LPS-induced renal preconditioning.

Most human genetic disease arises from point mutations. These genetic diseases can theoretically be corrected by gene therapy but clinic practice is still far from mature. Nearly half of the pathogenic single-nucleotide polymorphisms (SNPs) are caused by G:C>A:T or T:A>C:G base changes. The best current methods to repair these changes are by base editing without footprint using recently developed CRISPR-Cas9 technology by David Liu’s lab. These base editing methods have been confirmed with precision and efficiency in cultured mammalian cells, but it is barely confirmed and the efficiency is still very low. Animal models are important in dissecting pathogenic mechanism for human genetic diseases and efficacy testing of base correction in vivo. Cytidine base editor BE4 is a newly developed version of cytidine base editing system that converts cytidine (C) to uridine (U) in cultured mammalian cells but has not been proven in vivo. In this study, we have tested this system in cells to inactivate GFP gene and in mice by introducing single-base substitution that leads to a stop codon in tyrosinase gene. High percentage albino coat-colored mice were obtained from black coat-colored donor zygotes after pronuclei microinjection. Sequencing results showed that expected base changes were obtained with high precision and efficiency (56.25%). There are no off-targeting events identified in predicted off-target sites. Results confirm BE4 system can work in vivo with high precision and efficacy, and has great potentials in clinic to repair human genetic mutations.

Important tumor biomarkers, therapeutic targets, and mechanisms of tumorigenesis were discovered in animal models. Mouse models of malignant gliomas were represented by transplantable, chemically-induced, and genetically-engineered cells. The aim of the study was to investigate the morphological, molecular, and immunological characteristics of two original glioblastoma (GB) strains, M2 and M6. These are new, chemically-induced, trans-plantable tissue models of malignant diffuse mouse glioma. Tissues from M2 GB and M6 GB were transplanted into immunocompetent C57BL/6 mice. The clinical manifestations of M2 GB and M6 GB growth in mice include motility disorders, cachexia, and priapism. Morphologically, M2 GB and M6 GB are characterized by diffuse proliferation, cellular and nuclear polymorphism, high mitotic activity, and pathological forms of mitosis due to the aggressive nature of these tumors. Flow cytometry showed that CD3+ T lymphocytes (~32%) and F4/80+ macrophages (~28-50%) highly infiltrated both tumors. M2 GB had higher levels of F4/80+ macrophages than M6 GB. Cdkn2a, S100b, Mki67, Pten, Vegfa, Hif1a, Sox2, Abcb1, and Gfap genes were overexpressed in both tumors. Cd133, Tp53, and Pdgfra expression was increased in M2 GB. High expression of Pi3k and Gdnf was observed in M6 GB. Expression of Cd44, Pi3k, Hif1a, Gdnf and Egfr was higher in the M6 GB tissues com-pared to M2 GB, while Cdkn2a, Tp53, Cd133 and Pdgfra were higher in the M2 GB tissue compared to M6 GB. The transplantable M2 GB and M6 GB tissue models have intratumor immune responses, clinical and morphological features similar to human GB, as well as gene expression patterns that are important for further studies on tumorigenesis. These models can be used to develop diagnostic and therapeutic procedures and study carcino-genesis.

USP21, a member of the ubiquitin protease family, plays a vital role in various biological functions. However, the effects of USP21 dysfunction have yet to be fully understood. Here, we generated Usp21 knockout (KO) mice and conducted microarray to identify genes that Usp21 regulates. Its results raised several genes based on their biological characteristics, and RT-qPCR confirmed their expression. KO mice exhibited significant elevations in the expression of the genes Fabp7 and Nlrc5, which play a role in lipid metabolisms, compared to wild-type mice. Blood tests showed no impairment of liver function but did reveal elevated levels of total cholesterol and free fatty acids in KO mice compared to wild-type mice. These data suggest that Usp21 may play roles in lipid metabolism associated with Fabp7 and Nlrc5. To clarify the involvement of USP21 in human hypercholesterolemia, we examined single nucleotide polymorphisms (SNPs) around USP21 in non-hypercholesterolemic and hypercholesterolemic outpatients. We found that the rs11421 SNP downstream of USP21 was associated with hypercholesterolemia. These data suggest that USP21 plays a role in mice and human lipid metabolism and that its polymorphism may be a diagnostic marker for human hypercholesterolemia.

Caseinolytic peptidase P (CLPP) plays a central role in mitochondrial unfolded protein response (mtUPR) by promoting the breakdown of misfolded proteins and setting in motion a cascade of reactions to re-establish protein homeostasis. Global germline deletion of Clpp in mice results in female infertility and accelerated follicular depletion. Telomeres, on the other hand, are tandem repeats of 5’-TTAGGG-3’ sequences found at the ends of the chromosomes. Telomeres are essential for maintaining chromosome stability during somatic cell division and their shortening is associated with cellular senescence and aging. In this study, we asked whether the infertility and ovarian aging phenotype caused by global germline deletion of Clpp is associated with somatic aging, and tested telomere length in tissues of young and aging mice. We found that impaired mtUPR caused by the lack of CLPP is associated with accelerated telomere shortening in both oocytes and somatic cells of aging mice. In addition, expression of several genes that maintain telomere integrity were decreased, and double strand DNA breaks were increased in telomeric regions. Our results highlight how impaired mtUPR can affect telomere integrity and demonstrate a link between loss of mitochondrial protein hemostasis, infertility, and somatic aging.

Gossypol is a complex plant polyphenol reported to be cytotoxic and anti-inflammatory, but little was known about its effect on gene expression in macrophages. The objective was to explore gossypol’s toxicity and its effect on gene expression involved in inflammatory responses, glucose transport and insulin signaling pathway in mouse macrophages. Mouse RAW264.7 macrophages were treated with multiple concentrations of gossypol for 2-24 h. Gossypol toxicity was estimated by MTT assay and soluble protein content. qPCR analyzed the expression of anti-inflammatory tristetraprolin family (TTP/ZFP36), proinflammatory cytokine, glucose transporter (GLUT) and insulin signaling genes. Cell viability was greatly reduced by gossypol, accompanied with dra-matic reduction of soluble protein content in the cells. Gossypol treatment resulted in an increase of TTP mRNA level 6-20 fold and increased ZFP36L1, ZFP36L2 and ZFP36L3 mRNA levels by 26-69 fold. Gossypol increased proinflammatory cytokine TNF, COX2, GM-CSF, INFγ and IL12b mRNA levels up to 39-458 fold. Gossypol treatment upregulated mRNA levels of GLUT1, GLUT3 and GLUT4 genes as well as INSR, AKT1, PIK3R1 and LEPR but not APP genes. This study demonstrated that gossypol induced macrophage death and reduced soluble protein content that was accom-panied with massive stimulation of anti-inflammatory TTP family and proinflammatory cytokine gene expression as well as elevation of gene expression involved in glucose transport and insulin signaling pathway in mouse macrophages.

Pregnancy is a dynamic state with multiple metabolic changes occurring including insulin resistance. Gestational diabetes mellitus (GDM), a form of diabetes that appears during pregnancy, develops if metabolic aberrations occur, in particular, in normal pregnancy-induced insulin resistance. Multi-omics is a powerful approach for uncovering the mechanisms driving metabolic change in different physiologic and pathologic states. A recent study demonstrated that the gestational gut microbiome mediates pregnancy metabolic adaptations through effects on gut indoleamine-2,3 dioxygenase 1 activity and the production of kynurenine. Using the dataset generated from this highly controlled study, we performed a comprehensive analysis of the pregnancy-specific physiological and metabolic profiles, 16S rRNA microbiome, and plasma untargeted LC-MS metabolome data. To facilitate the utilization of these analysis results by other researchers, we developed MOMMI-MP, a database that provides an easy-to-use platform to browse and search differential abundant microbial taxa and metabolites, and to examine metabolic pathways. The datasets consist of data collected from 3 genetically diverse strains of mice (C57BL/6J, CD1, and NIH-Swiss) over 6 time points during the gestational (days 0, 10, 15, and 19 during gestation) and postpartum (days 3 and 20 after delivery) states, totaling 180 samples for each strain. The computational results are presented in various tables and plots, and organized in MOMMI-MP to empower exploratory analyses by other researchers. In conclusion, MOMMI-MP is a resource to facilitate the investigation of novel mechanisms governing metabolic changes during pregnancy.

The fatty acid elongase ELOngation of Very-Long-chain fatty acids protein 2 (ELOVL2) controls the elongation of polyunsaturated fatty acids (PUFA) producing precursors for omega-3, do-cosahexaenoic acid (DHA), and omega-6, docosapentaenoic acid (DPAn6) in-vivo. Expectedly, Elovl2-ablation drastically reduced the DHA and DPAn6 in liver mitochondrial membranes. Unexpectedly, however, total PUFAs levels decreased further than could be explained by Elovl2 ablation. The lipid peroxidation process was not involved in PUFAs reduction since malondial-dehyde-lysine (MDAL) and other oxidative stress biomarkers were not enhanced. The content of mitochondrial respiratory chain proteins remained unchanged. Still, membrane remodeling was associated with high voltage-dependent anion channel (VDAC) and adenine nucleotide trans-locase 2 (ANT2), a possible reflection of the increased demand on phospholipid transport to the mitochondria. Mitochondrial function was impaired despite preserved content of the respiratory chain proteins and the absence of oxidative damage. Oligomycin-insensitive oxygen consumption increased, and coefficients of respiratory control were reduced by 50%. The mitochondria became very sensitive to fatty acid-induced uncoupling and permeabilization, where ANT2 is involved. Mitochondrial volume and number of peroxisomes increased as revealed by transmission elec-tron microscopy. In conclusion, the results imply that endogenous DHA production is vital for the normal function of mouse liver mitochondria and could be relevant not only for mice but also for human metabolism.

Heat shock proteins (Hsps) are highly conserved molecules that are constitutively expressed and upregulated in response to physiological stress conditions. These immunogenic chaperones can have essential functions in fungi, particularly in dimorphic pathogens. Histoplasma capsulatum and Paracoccidioides species are dimorphic fungi that are the causative agents of histoplasmosis and paracoccidioidomycosis, respectively, which are systemic mycoses with significant rates of morbidity and mortality. Current treatment consists of long-term antifungal agents, and there is an urgent need for new therapeutic approaches with higher efficacy, lower toxicity, better biodistribution and improved selectivity. We engineered an immunoglobulin G1 (IgG1) isotype chimeric mouse-human monoclonal antibody, titled ch-MAb 4E12, from the parental IgG2a MAb 4E12, a monoclonal antibody to H. capsulatum Hsp60 that is protective in experimental histoplasmosis and paracoccidioidomycosis models elicited by H. capsulatum var. capsulatum and Paracoccidioides lutzii, respectively. The ch-MAb 4E12 increased phagolysosomal fusion and enhanced the yeasts uptake by PMA differentiated human THP1 macrophage cells in vitro. At low concentrations, the chimeric antibody significantly reduced the pulmonary and splenic fungal burden compared to an irrelevant antibody or no treatment. These results are the first to show that a chimeric mouse-human antibody can modify infection caused by dimorphic fungi.

Multidrug resistance protein 4 (MRP4) is an energy-dependent membrane transporter that is responsible for cellular efflux of a broad range of xenobiotics and physiological substrates. In this trial, we aimed to investigate the co-effects of aging and MRP4 deficiency using gene expression microarray and morphological and electrophysiological analyses of the mouse retina. Mrp4-knockout (null) mice and wild-type (WT) mice were reared in the same condition to 8–12 wk (young) or 45–55 wk (aged). Microarray analysis identified 186 differently expressed genes from the retinas of aged Mrp4-null mice as compared to that from aged WT mice, and subsequence gene ontology and KEGG pathway analyses showed that differently expressed genes were related to lens, eye development, vision, and transcellular barrier function that are involved in metabolic pathways or viral infection pathways. No significant change in thickness was observed for each retinal layer among young/aged WT mice and young/aged Mrp4-null mice. Moreover, immunohistochemical analyses of retinal cell type did not exhibit an overt change in the cellular morphology or distribution among the 4 age/genotype groups, and the electroretinogram responses showed no significant differences in the amplitude or the latency between aged WT mice and aged Mrp4-null mice. Aging would be an insufficient stress to cause some damage to the retina in the presence of MRP4 deficiency.

Background: Brain oxidative lipid damage and inflammation are common in neurodegenerative diseases such as Alzheimer’s disease (AD). Paraoxonase-1 and 3 (PON1 and PON3) protein expression have been described in tissues with no PON1 and PON3 gene expression. In the present study, we aimed to examine differences in PON1 and PON3 protein expression in the brain of a mouse model of AD. Methods: We used peroxidase-based and fluorescence-based immunohistochemistry in 5 brain regions (olfactory bulb, forebrain, posterior midbrain, hindbrain and cerebellum) of transgenic (Tg2576) mice with the Swedish mutation (KM670/671NL) responsible for a familial form of AD and corresponding wild-type mice. Results: We found intense PON1 and PON3 positive staining in star-shaped cells surrounding Aβ plaques in all Tg2576 mouse brain regions studied. Although we could not co-localize PON1 and PON3 with astrocytes, brain star-shaped cells, we found some co-localization of PON3 with microglia. Conclusions: These results suggest that 1) PON1 and PON3 cross the blood-brain barrier in discoidal HDLs and are transferred to specific brain cell types, and 2) PON1 and PON3 play an important role in preventing oxidative stress and lipid peroxidation in particular cell types, likely astrocytes and microglia, in AD pathology, and potentially in other neurodegenerative diseases

Therapeutic hypothermia (TH) has emerged as a promising approach with neuroprotective effects that can mitigate secondary brain damage and intracranial pressure in the acute phase after successful mechanical thrombectomy. However, the effect of TH on cognitive impairment has yet fully elucidated. In the present study, we demonstrated whether TH can improve cognitive impairment in a transient middle cerebral artery occlusion (tMCAO) mouse model Nine-week-old C57BL/6N mice (male) were randomized to three groups: sham, tMCAO, and tMCAO with TH. One month after model induction, cognitive function test and regional cerebral glucose metabolism were evaluated using the Y-maze test and positron emission tomography with fluorine-18 fluorodeoxyglucose, respectively. tMCAO led to cognitive impairment, which was improved by TH. The cerebral glucose metabolism of the thalamus was significantly recovered in the TH group compared to that in the tMCAO group. These results suggest that TH might have potential as a therapeutic strategy for improving the ischemia/reperfusion-induced cognitive impairment.

The C-X-C motif chemokine receptor-1 (CXCR1) is a rhodopsin-like G-protein-coupled receptor, expressed on the cell surface of immune cells and tumors. CXCR1 interacts with some C-X-C chemokines, such as CXCL6, CXCL7, and CXCL8/interleukin-8, which are produced by various cells. Since CXCR1 is involved in several diseases including tumors and diabetes mellitus, drugs targeting CXCR1 has been developed. Therefore, the development of sensitive monoclonal antibodies (mAbs) for CXCR1 has been desired for the diagnosis and treatment. This study established a novel anti-mouse CXCR1 (mCXCR1) mAb; Cx₁Mab-1 (rat IgG₁, kappa), using the Cell-Based Immunization and Screening (CBIS) method. Cx₁Mab-1 reacted with mCXCR1-overexpressed Chinese hamster ovary-K1 (CHO/mCXCR1) and mCXCR1-overexpressed LN229 glioblastoma (LN229/mCXCR1) in flow cytometry. Cx₁Mab-1 demonstrated a high binding affinity for CHO/mCXCR1 and LN229/mCXCR1 with a dissociation constant of 2.6×10^-9 M and 2.1×10^-8 M, respectively. Furthermore, Cx₁Mab-1 could detect mCXCR1 by western blot analysis. These results indicated that Cx₁Mab-1 is useful for detecting mCXCR1, and provides a possibility for targeting mCXCR1-expressing cells in vivo experiments.

C-X-C motif chemokine receptor 3 (CXCR3, CD183) is a G-protein-coupled receptor for CXCL9, CXCL10, and CXCL11. CXCR3 signaling induces chemotaxis of immune cells to inflammation sites and promotes inflammation in inflammatory diseases. Various mouse models to mimic the pathogenesis of each disease have been developed to understand mechanisms and evaluate therapeutics for these diseases. Although CXCR3 is an attractive target to suppress inflammation, anti-CXCR3 therapeutic agents have not been approved. In this study, we established a novel anti-mouse CXCR3 (mCXCR3) monoclonal antibody, Cx₃Mab-4 (rat IgG₁, kappa), using the Cell-Based Immunization and Screening method. Flow cytometric analysis demonstrated that Cx₃Mab-4 bound to mCXCR3-overexpressed Chinese hamster ovary-K1 (CHO/mCXCR3) cells, but did not react to parental CHO-K1 cells. The dissociation constant of Cx₃Mab-4 was determined as 1.3 × 10^-9 M, indicating that Cx₃Mab-4 possesses a high affinity to mCXCR3-expressing cells. Cx₃Mab-4 could be useful for targeting CXCR3-expressing cells in preclinical mouse models.

Macrophages play a pivotal role in the process of healing burns. One of the major risks in the course of burns healing, in the absence of regenerating epidermis, is infections which greatly contribute to morbidity and mortality in such patients. Therefore, it is widely agreed that accelerating recruitment of macrophages into burns may contribute to faster regeneration of the epidermis and thus, decreasing the risk of infections. This review describes a unique method for rapid recruitment of macrophages into burns and activation of these macrophages to mediate accelerated regrowth of the epidermis and healing of burns. The method is based on application of bio-degradable “alpha-gal” nanoparticles to burns. These nanoparticles present multiple alpha-gal epitopes (Gal alpha1-3Gal beta1-4GlcNAc-R) which bind the abundant natural anti-Gal antibody that constitutes ~1% of immunoglobulins in humans. Anti-Gal/alpha-gal nanoparticles interaction activates the complement system, resulting in localized production of the complement cleavage-peptides C5a and C3a that are highly effective chemotactic factors for monocytes derived macrophages. The macrophages recruited into the alpha-gal nanoparticles treated burns are activated following interaction between the Fc portion of anti-Gal coating the nanoparticles and the multiple Fc receptors on macrophages cell membranes. The activated macrophages secrete a variety of cytokines/growth factors that accelerate the regrowth of the epidermis and regeneration of the injured skin, thereby cutting the healing time by half. Studies on healing of thermal injuries in the skin of anti-Gal producing mice, demonstrated a much faster recruitment of macrophages into burns treated with alpha-gal nanoparticles than in control burns treated with saline and healing of the burns within 6 days, whereas healing of control burns takes ~12 days. alpha-Gal nanoparticles are non-toxic, and do not cause chronic granulomas or keloids. These findings suggest that alpha-gal nanoparticles treatment may harness anti-Gal for inducing similar accelerated burn healing effects also in humans.

The Carbonic Anidrase isoform IX (hCA IX) is one of the main player in extracellular tumor pH regulation and it is known to be overexpressed in breast cancer as well as in many common tu-mors. hCA IX has shown to contribute to the growth and survival of tumor cells and its expres-sion is correlated to metastasis and resistance to therapies making it an interesting biomarker for diagnosis and potential image-guided therapy. The aim of this work is the development of an MRI Imaging probe able to target the extracellular non catalytic PG domain of CAIX. A new specific nano probe has been designed by conjugating a peptidic interactor of PG domain on the surface of a liposome loaded with Gd-based contrast agents. Mouse Mammary Adenocarcinoma Cell Line (TS/A ) has been chosen as in vitro breast cancer model to test the efficacy of the de-veloped probe. MRI results display a high selectivity towards hCA IX marker and a good sensi-tivity of the Imaging probe. These findings make this approach promising for future develop-ment of in vivo diagnostic protocols aimed at visualizing this enzyme expression.

Edaravone is a mitochondrially targeted drug with a suggested capability to modify the course of diverse neurological diseases. Nevertheless, edaravone has not been tested yet in the context of spinocerebellar ataxia 1 (SCA1), an incurable neurodegenerative disease characterized mainly by cerebellar disorder with a strong contribution of inflammation and mitochondrial dysfunction. This study aimed to address this gap, exploring the potential of edaravone to slow down SCA1 progression in a mouse knock-in SCA1 model. SCA1154Q/2Q and healthy SCA12Q/2Q mice were getting either edaravone or saline daily for more than 13 weeks. The functional impairments were assessed via a wide spectrum of behavioral assays reflecting motor and cognitive deficits and behavioral abnormalities. Moreover, we used high-resolution respirometry to explore mitochondrial function, and immunohistochemical and biochemical tools to assess the magnitude of neurodegeneration, inflammation and neuroplasticity. Data were analyzed using (hierarchical) Bayesian regression models combined with the methods of multivariate statistics. Our analysis pointed out various previously documented neurological and behavioral deficits of SCA1 mice. However, we did not detect any plausible therapeutic effect of edaravone on either behavioral dysfunctions or other disease hallmarks in SCA1 mice. Thus, our results did not provide support for the therapeutic potential of edaravone in SCA1.

Amyotrophic Lateral Sclerosis (ALS) is an irreversible neurodegenerative disease with no known cure. Recent studies suggest a strong metabolic component in ALS pathogenesis and have shown an inverse relationship between leptin levels and ALS progression, although the effects of leptin as a treatment have not yet been studied. Therefore, we aim to examine whether the acute treatment with leptin has beneficial effects on brain pathology and cognitive function in the transgenic TDP43A315T line of ALS. Mice were treated intranasally (IN) with 0.03mg/kg of leptin or vehicle (VH) daily for 7 days. Data showed a progressive decline in body weight and motor coordination in TDP43A315T mice. Moreover, Lep-treated TDP43A315T mice showed an earlier disease onset, along with an improvement in motor performance. Altered levels of some of the adipokines and metabolic proteins studied were found in TDP43A315T mice, which were differently expressed among Lep-treated and VH-treated animals. Furthermore, some correlations were found among the serum levels of this proteins in WT and TDP43A315T mice. As far as we know, this is the first pilot study to provide evidence of the therapeutic effect of leptin treatment in a mice model of ALS, although further studies are needed to expound on the underlying mechanisms.

Nicotine is a pharmacologically active component of tobacco which adversely affects the male reproductive system and fertility and Icariin (ICA) is the main active ingredient of Epimedium herba which has been used to treat several male reproductive problems. This study was aimed at investigating the protective or ameliorative effect of ICA against reproductive toxicity induced by intraperitoneal injection of nicotine in mice. Forty male mice were randomly divided into 4 groups: control, nicotine (0.75 mg/kg intraperitoneally), icariin (ICA, 75 mg/kg), and icariin plus nicotine (ICA + nicotine) group. After 35 days of treatment, the mice were weighed, sacrificed, and their reproductive organs were collected and examined for further studies. In the nicotine-treated group, epididymal sperm density and serum testosterone concentrations significantly decreased relative to the control group. Nicotine also caused oxidative damage as shown by significant reduction in the activities of antioxidant enzymes and an elevation in Malondialdehyde (MDA) levels. Icariin on the other hand, improved the reduction in sperm characteristics, hormone levels, and activities of antioxidant enzymes alterations observed in the nicotine treated mice. These findings indicate that the nicotine-induced reproductive toxicity and oxidative damages on male reproductive tissues can be effectively attenuated by icariin.

Methionine oxidation to the sulfoxide form (MSox) is a poorly understood post-translational modification of proteins associated with nonspecific chemical oxidation from reactive oxygen species (ROS) whose chemistries are linked to various disease pathologies including neurodegeneration. Emerging evidence shows MSox site occupancy is in some cases under enzymatic regulatory control mediating cellular signaling including phosphorylation and/or calcium signaling, raising questions as to the speciation and functional nature of MSox across the proteome. The 5XFAD lineage of the C57BL/6 mouse has well-defined Alzheimer’s and aging states. Using this model, we analyzed age, sex and disease dependent MSox speciation in mouse hippocampus. In addition, we explore chemical stability and statistical variance of oxidized peptide signals to understand needed power for MSox based proteome studies. Our results identify mitochondrial and glycolytic pathway targets with increases in MSox with age as well as neuroinflammatory targets accumulating MSox with AD in proteome studies of mouse hippocampus. Further, the paper establishes a foundation for reproducible and rigorous experimental MSox-omics appropriate for biological discovery novel target identification, and biomarker analysis in ROS and other oxidation linked diseases.

Melanin is extensively distributed in organisms and believed to be synthetized by tyrosinase (TYR), leading to aberrant coloring and skin conditions when over-produced. Loquat (Eriobotrya japonica (Thunb.) Lindl.) flowers contain large amounts of bioactive substances currently few studied on their suppressive capabilities to melanin synthesis. Its isolate product (LFP) was obtained by ethanol solution extraction and resin purification, of which the inhibitory mechanism on TYR activity was elaborated by enzyme kinetics and multi-spectroscopy determinations and the impact on related proteins’ expression in mouse melanoma B16 cells was analyzed with Western blotting. HPLC-MS analysis indicated that LFP was identified into 137 compounds, with 12 including flavonoids (quercetin, isorhamnoin, p-coumaric acid, etc.), cinnamic acid and its derivatives as well as benzene and its derivatives owning TYR inhibitory activities. LFP inhibited TYR activity in a concentration-dependent manner with its IC50 value being 2.8 mg/mL and an anti-competitive mechanism involved altering the enzyme's conformation. LFP reduced the expression of TYR, TRP1, and TRP2 in melanoma B16 cells, hence inhibiting the synthesis of melanin. Considered collectively, LFP would be a viable option for treating hyperpigmentation caused by tyrosinase, providing a theoretical basis for the value-added utilization of loquat flower resource in beauty and aging related functional products.

Sepsis is a life-threatening organ dysfunction caused by a dysregulated host response to infection, with septic cardiomyopathy being a common and severe complication. Despite its significant clinical impact, the molecular mechanisms underlying sepsis-induced cardiomyopathy (SICM) remain incompletely understood. In this study, we performed a comparative analysis of whole transcriptome profiles in two widely used mouse models of septic cardiomyopathy, the cecal ligation and puncture (CLP) model and the lipopolysaccharide (LPS) model. Our aim was to identify key genes and pathways involved in the development of septic cardiomyopathy and to evaluate the similarities and differences between the two models. Our findings suggested that 1) both methods can induce septic heart dysfunction within 24 hours; 2) distinct whole transcriptome expression profiles are revealed; 3) potentially different pathways are involved in causing heart failure in sepsis. The comprehensive comparison provides valuable insights into the molecular basis of septic cardiomyopathy and contributes to the ongoing search for effective treatment strategies, triggered by different factors for SICM.

CD39 is involved in adenosine metabolism through conversion of extracellular ATP to adenosine. Because extracellular adenosine plays a critical role in the immune suppression of tumor microenvironment, the inhibition of CD39 activity by monoclonal antibodies (mAbs) is one of the important strategies for tumor therapy. In this study, we developed specific and sensitive mAbs for mouse CD39 (mCD39) using the Cell-Based Immunization and Screening (CBIS) method. The established anti-mCD39 mAbs, which were established by the CBIS method including C₃₉Mab-1 (rat IgG_2a, kappa) and C₃₉Mab-2 (rat IgG_2a, lambda), reacted with not only mCD39-overexpressed Chinese hamster ovary-K1 (CHO/mCD39) but also endogenously mCD39-expressed cell lines, such as L1210 (mouse lymphocytic leukemia) and J774-1 (mouse macrophage-like) cell lines through flow cytometry. Kinetic analyses using flow cytometry indicated that the dissociation constant (K_D) of C₃₉Mab-1 and C₃₉Mab-2 for CHO/mCD39 was 7.3 × 10⁻⁹ M and 5.5 × 10⁻⁹ M, respectively. K_D of C₃₉Mab-1 and C₃₉Mab-2 for L1210 was 3.3 × 10⁻⁹ M and 3.6 × 10⁻¹⁰ M, respectively. Furthermore, C₃₉Mab-1 could detect the lysate of CHO/mCD39 by western blot analysis. These results indicate that C₃₉Mab-1 and C₃₉Mab-2 are useful for the detection of mCD39 in many functional studies.

Celiac disease (CD) is a permanent intolerance to dietary protein, gluten, from wheat rye and barley. It occurs in about 1% worldwide population, in genetically predisposed individuals bearing human leukocyte antigen (HLA) DQ2/DQ8. Gut epithelial cell stress and innate immune activation are responsible for breaking oral tolerance to gliadin, the gluten component. To date, the only treatment available for CD is a long-term gluten-free diet. Several evidences show that an altered composition of the intestinal microbiota (dysbiosis) could play a key role in the pathogenesis of CD, through the modulation of intestinal permeability and the regulation of the immune system. Here we show that gliadin induces a chronic ER stress condition in the small intestine of a CD mouse model and that the co-administration of probiotics efficiently attenuates both UPR and gut inflammation. Moreover, the composition of probiotics formulations might differ in their activity at molecular level, especially toward the three axes of the UPR. Therefore, rebalancing the gut microbiota composition by probiotics administration might rep-resent a new strategy to treat CD affected patients.

Spinocerebellar ataxia type 2 (SCA2) is caused by polyglutamine expansion in Ataxin-2 (ATXN2). This factor binds RNA/proteins to modify metabolism after stress, and to control calcium (Ca2+) homeostasis after stimuli, thus exerting crucial neuroprotection for cerebellar ataxias and corticospinal motor neuron degeneration. Our Atxn2-CAG100-Knock-In mouse faithfully models features observed in patients at pre-onset, early and terminal stages. Here, its cerebellar global RNA profiling revealed downregulation of signaling cascades to precede motor deficits. Validation work at mRNA/protein level defined alterations that were independent of constant physiological ATXN2 functions, but specific for RNA/aggregation toxicity, and progressive across the short lifespan. Earliest changes were detected at 3 months among Ca2+ channels/transporters (Itpr1, Ryr3, Atp2a2, Atp2a3, Trpc3), IP3 metabolism (Plcg1, Inpp5a, Itpka), and Ca2+-Calmodulin dependent kinases (Camk2a, Camk4). CaMKIV–Sam68 control over alternative splicing of Nrxn1, an adhesion component of glutamatergic synapses between granule and Purkinje neurons, was found affected. Systematic screening of pre/post-synapse components, with dendrite morphology assessment, suggested early impairment of CamKIIα abundance together with weakening of parallel fiber connectivity. These data reveal molecular changes due to ATXN2 pathology, impacting communication and excitability of cerebellar neurons. Discovery of such risk versus progression markers improves the assessment of pre-symptomatic treatments in SCA2 and related disorders.

The zebrafish is now an important model organism for cancer biology studies and provides some unique and complementary opportunities in comparison to the mammalian equivalent. The translucency of zebrafish has allowed in vivo live imaging studies of tumour initiation and progression at the cellular level thus providing novel insights into our understanding of cancer. Here we summarise and discuss available transgenic zebrafish tumour models and what we have gleaned from them with respect to cancer inflammation. In particular, we focus on the host inflammatory response toward transformed cells during the pre-neoplastic stage of tumour development. We discuss features of tumour associated macrophages and neutrophils in mammalian models and present evidence which supports the idea that these inflammatory cells promote early stage tumour development and progression. Direct live imaging of tumour initiation in zebrafish models has shown that the intrinsic inflammation induced by pre-neoplastic cells is tumour promoting. Signals mediating leukocyte recruitment to pre-neoplastic cells in zebrafish correspond to signals mediating leukocyte recruitment in mammalian tumours. The activation state of macrophages and neutrophils recruited to pre-neoplastic cells appears to be heterogenous, as seen in mammalian models, which provides an opportunity to study the plasticity of innate immune cells during tumour initiation. Although several potential mechanisms are described that might mediate the trophic function of innate immune cells during tumour initiation in zebrafish, there are several unknowns that are yet to be resolved. Rapid advancement of genetic tools and imaging technologies for zebrafish will facilitate research into the mechanisms that modulate leukocyte function during tumour initiation and identify targets for cancer prevention.

One aspect of reproducibility in preclinical research that is frequently overlooked is the physical condition in which physiological, pharmacological, or behavioural recordings are conducted. In this study, the physical conditions of mice were altered through the attachments of wireless electrophysiological recording devices (Neural Activity Tracker-1, NAT-1). NAT-1 devices are miniaturised multichannel devices with on-board memory for direct high-resolution recording of brain activity for >48 hrs. Such devices may limit the mobility of animals and affect their behavioural performance due to the added weight (total weight of approximately 3.4 g). Mice were additionally treated with saline (control), N-methyl-D-aspartate (NMDA) receptor antagonist MK801 (0.85 mg/kg), or the muscarinic acetylcholine receptor blocker scopolamine (0.65 mg/kg) to allow exploration of the effect of NAT-1 attachments in pharmacologically treated mice. We found only minimal differences in behavioural outcomes with NAT-1 attachments in standard parameters of locomotor activity widely reported for the open field test between drug-treatments. Hypoactivity was globally observed as a consistent outcome in MK801-treated subjects and hyperactivity in scopolamine groups regardless of NAT-1 attachments. These data collectively confirm the reproducibility for combined behavioural, pharmacological and physiological endpoints even in the presence of lightweight wireless data loggers. The NAT-1 therefore constitutes a pertinent tool for investigating brain activity in e.g. drug discovery, models of neuropsychiatric and/or neurodegenerative diseases with minimal effects on pharmacological and behavioural outcomes.

Although conventional chemotherapeutic drugs are the first line of treatment for cancer, they have numerous side effects. One of the emerging challenges in cancer treatment is drug resistance. Nat-ural compounds have proven effective against various hallmarks of cancer for their multi-target inhibition properties, but especially for their ability to synergistically bypass low bioavailability. Methods: The present study investigated the in vivo antitumor effects of a combination of two natural dietary agents, epigallocatechin-3-gallate (EGCG) from Camelia Sinensis and curcumin, a component of turmeric (Curcuma longa). We aimed to compare, for the first time in vivo, the antiangiogenic and antitumor effects of sunitinib with the combination of curcumin and EGCG in a mouse model of renal cell carcinoma (ccRCC). It was shown that they are able to inhibit cell survival, proliferation of several type of cancer, including renal cell carcinoma (ccRCC), by mod-ulating different signaling pathways and that their combination respect to single compound syn-ergistically decreased angiogenesis. Results: Herein, we highlighted that these compounds inhib-ited the growth of xenografted renal cancer in nude mice by significant inhibition of tumor vol-ume, tumor weight and CD31 expression with no signs of hepatic toxicity. Moreover, mice treated with these natural compounds showed a significant reduction in angiogenesis and an improve-ment in survival rate with p<0.05. Finally, pretreatment of mice with a diet containing 0.6% curcumin before injection of tumor cells showed a significant inhibition of tumor engraftment in 60% of mice with respect to controls and other groups. Conclusions: Taken together, our data in-dicate, for the first time, that the combination of curcumin and EGCG acts in a synergistic manner to inhibit the growth and angiogenesis of ccRCC and with less toxicity than sunitinib and provide an important rationale for future clinical development for chemoprevention and treatment of re-nal cancer.

Cholangiocarcinoma is an aggressive cancer with limited treatment options. Current therapies, such as cisplatin and 5-fluorouracil (5-FU), often cause side effects and drug resistance. This study investigated a potential new approach by combining a peanut skin extract (KK4-PSE) with these drugs. The extract effectively inhibited the growth of cholangiocarcinoma cells in laboratory studies and showed even greater selectivity for cancer cells compared to healthy cells. When combined with cisplatin or 5-FU, KK4-PSE enhanced the drugs' effects, leading to cell cycle arrest and increased cell death. These combined treatments also reduced levels of proteins that promote cancer cell survival. In animal models, KK4-PSE combined with 5-FU showed superior tumor suppression compared to the combination with cisplatin. Overall, these findings suggest that KK4-PSE may be a promising synergistic agent to improve the effectiveness of chemotherapy for cholangiocarcinoma, warranting further clinical investigation.

Proteins are considered to be the main carriers of antigenic properties of Mycobacterium tuberculosis and Mycobacterium bovis, the causative agents of tuberculosis, the most serious infectious disease. Neutrophils, following resident macrophages, are among the first to attack the mycobacteria in defense of the organism. Neutrophils themselves are also the target of mycobacterial products; and their effect on neutrophil functions has been less studied. We have obtained about 70 protein fractions from M. bovis lysate; among them four protein fractions (10, 22, 24, and 40 kDa) had high serological activity against the serum of a rabbit immunized with M. bovis cells. We studied the effect of the serologically active proteins isolated from M. bovis on the generation of reactive oxygen species by bone marrow granulocytes of the Balb/c mouse, evaluated by luminol-dependent chemiluminescence. For comparison, two synthetic peptides (both 3 kDa) carrying immunogenic epitopes of MPB 70 protein (M. bovis) were taken. Proteins of 10, 22, and 24 kDa at concentrations of 83, 80, and 59 ng/mL, respectively, were found to activate ROS generation by mouse granulocytes. The 10- and 40-kDa antigens inhibited the receptor-mediated respiratory responses to opsonized zymosan (OZ) and N-formyl-MLF peptide (fMLF) but significantly enhanced the response to the phorbol ester PMA, which directly activates protein kinase C. Antigens with molecular weights of 22 and 24 kDa enhanced the fMLF-induced response and had no effect on the response activated by PMA. The response to OZ was suppressed in the presence of the 22 kDa protein. Synthetic peptides over a wide range of concentrations showed no activity in any case. All M. bovis proteins examined did not affect both proliferation and cell viability of the A549 and THP-1 cells; therefore, they have no cytotoxic or proliferative effects. Thus, serologically active proteins with molecular weights of 10, 22, 24, and 40 kDa isolated from M. bovis modulated the respiratory responses of mouse granulocytes induced by the formyl peptide, while proteins of 10, 22, and 40 kDa inhibited the responses induced by OZ.

Under inflammatory conditions including lymphatic disorders, bone marrow-derived myeloid cells often express lymphatic endothelial cell (LEC) markers called LEC progenitor cells, which extend lymphatic vessels by fusing with existing lymphatic vessels. However, studies on the mechanism of lymphatic regeneration using three-dimensional images of lymphatic structures are limited. In this study, scanning electron microscopy (SEM) was used to observe the three-dimensional structure of lymphangiogenesis in a mouse model of secondary lymphedema. The model was established in C57BL/6J mice via circumferential incision in the inguinal region of the left hind limb. Skin samples were obtained from the lymphedema region on days 2, 5, and 8 after surgery. To determine lymphatic vessel positions using SEM analysis, we detected anti-lymphatic vessel endothelial hyaluronan receptor 1 (LYVE-1) immunoreactivity in serial sections and overlaid them during SEM observation. On days 2 and 5, spherical cells, probably myeloid cells, were attached and fused to the LYVE-1-positive lymphatic vessel walls. On day 8, spherical cells were converted to string-shaped cells, forming a new lymphatic vessel wall resembling an intraluminal pillar. Our results show the three-dimensional lymphatic structures formed during lymphatic regeneration.

Cell autonomous circadian oscillation is present in central and various peripheral tissues. The intrinsic tissue clock and various extrinsic cues drive gene expression rhythms. Transcription regulation is thought to be the main driving force for gene rhythms. However, how transcription rhythms arise remains to be fully characterized, due to the fact that transcription is regulated at multiple steps. In particular, Pol II recruitment and pause release are two critical regulatory steps that determine the status of Pol II pausing. Recently, we showed that Pol II pausing exhibits genomewide changes during daily transcription in mouse liver. In this article, we review historical as well as recent findings on the regulation of transcription rhythms. We also discuss the possible mechanisms for daily changes in Pol II pausing and the critical involvement of Pol II pausing regulation in generating rhythmic transcription output.