Fanconi anemia (FA) develops due to a mutation in one of the FANC genes that are involved in repair of interstrand crosslinks (ICLs). FANCG, a member of the FA core complex, is essential for ICL repair. Previous FANCG-deficient mouse models were generated with drug-based selection cassettes in mixed mice backgrounds, leading to a disparity in interpretation of genotype-related phenotype. To exclude these confounders, we created a Fancg-KO (KO) mouse model using CRISPR/Cas9. The entire Fancg locus was targeted and maintained on the immunological well-characterized C57BL/6J background. Intercrossing of heterozygous mice resulted in sub-Mendelian numbers of homozygous mice, suggesting loss of FANCG can be embryonic lethal. KO mice displayed infertility, hypogonadism but no other developmental problems. Bone marrow analysis revealed a defect in various hematopoietic stem and progenitor subsets with a bias towards myelopoiesis. Cell lines derived from Fancg-KO mice were hypersensitive to crosslinking agents-cisplatin and Mitomycin C, and Fancg-KO mouse embryonic fibroblasts (MEFs) displayed increased γ-H2AX upon cisplatin treatment. Reconstitution of these MEFs with Fancg cDNA corrected for the ICL hypersensitivity. Collectively, this project provides a new, genetically and immunologically well-defined Fancg-KO mouse model for further in vivo and in vitro studies on FANCG and ICL repair.

Agaricus bisporus is well known as a source of polysaccharides that could improve human health. The objective of this study was to explore anti-obesity effect of A. bisporus extract (H2Oslim®) abundant in polysaccharides and its underlying mechanism. Pancreatic lipase inhibitory activity in vitro was determined after treatment with H2Oslim® and chitosan. Treatment with H2Oslim® and chitosan significantly decreased pancreatic lipase activity. Five-week-old male SD rats were randomly divided into three groups for acute feeding with vehicle, H2Oslim® at 80 mg/kg body weight (BW)/day, and H2Oslim® at 160 mg/kg BW/day. H2Oslim® does-dependently increased plasma lipid clearance in an oral lipid tolerance test. Five-week-old male C57BL/6N mice were fed a control diet (CD), a high fat diet (HFD), an HFD with H2Oslim® at 80 mg/kg BW/day, H2Oslim® at 160 mg/kg BW/day, or chitosan at 160 mg/kg BW/day for eight weeks. HFD-fed mice showed significant increases of body weight, fat mass, white adipose tissue, average lipid droplet size, and serum levels of glucose, triglyceride, ALT, and AST compared to those in the CD group. However, H2Oslim® or chitosan administration ameliorated these increases. H2Oslim® or chitosan signifi-cantly reduced dietary efficiency and increased fecal excretion levels of lipid, triglyceride, and total cholesterol. These in vitro and in vivo findings suggest that H2Oslim® might act as an anti-obesity agent by inhibiting pancreatic lipase-mediated lipid absorption, at least in part.

Apicomplexan infections, such as giardiasis and cryptosporidiosis, negatively impact a considerable proportion of human and commercial livestock populations. Despite this, the molecular mecha-nisms of disease, particularly the effect on the body beyond the gastrointestinal tract, are still poorly understood. To highlight host-parasite-microbiome biochemical interactions, we utilised integrated metabolomics-16S rRNA genomics and metabolomics-proteomics approaches in a C57BL/6J mouse model of giardiasis and compared these to Cryptosporidium and uropathogenic Escherichia coli (UPEC) infections. Comprehensive samples (faeces, blood, liver, and luminal contents from duo-denum, jejunum, ileum, caecum and colon) were collected 10 days post infection and subjected to proteome and metabolome analysis by liquid and gas chromatographic mass-spectrometry, re-spectively. Microbial populations in faeces and luminal washes were examined using 16S rRNA metagenomics. Proteome-metabolome analyses indicated that 12 and 16 key pathways were sig-nificantly altered in the gut and liver, respectively, during giardiasis with respect to other infections. Energy pathways including glycolysis and supporting pathways of glyoxylate and dicarboxylate metabolism, and redox pathway of glutathione metabolism, were upregulated in small intestinal luminal contents and the liver during giardiasis. Metabolomics-16S rRNA genetics integration in-dicated that populations of three bacterial families –Autopobiaceae (Up), Desulfovibrionaceae (Up) and Akkermanasiaceae (Down) – were most significantly affected across the gut during giardiasis, causing upregulated glycolysis and short-chained fatty acid (SCFA) metabolism. In particular, the perturbed Akkermanasiaceae population seemed to cause oxidative stress responses along the gut-liver axis. Overall, the systems biology approach applied in this study highlighted that the effects of host-parasite-microbiome biochemical interactions extended beyond the gut ecosystem to the gut-liver axis. These findings form the first steps in a comprehensive comparison to ascertain the major molecular and biochemical contributors of host-parasite interactions and contribute towards the development of biomarker discovery and precision health solutions for apicomplexan infections.

A prime number is a natural number with no divisors other than itself and the number 1. There are many unsolved problems related to prime numbers. One such problem is finding a general method for identifying prime numbers. Although it is known that all prime numbers fall under the categories of 2, 3, or 6n±1 (where n≥1), a formalized method for eliminating composite numbers (non-prime numbers) from these categories has yet to be developed. This paper aims to explore a possible method for such elimination, which involves checking whether there exists an n that satisfies n = 6km+k+m or n = 6km+k-m (where k and m are non-zero integers). This method is expected to be a major step forward in the derivation of prime numbers.

Much research has been conducted to determine how hair regeneration is regulated, as this could provide therapeutic, cosmetic, and even psychological interventions for hair loss. The current study focused on the hair growth effect and effective utilization of fatty oil obtained from Bryde's whales through high-throughput DNA microarray approach in conjunction with immunohistochemical observations. The research also examined the mechanisms and factors involved in hair growth. In an experiment using female C57BL/6J mice, the vehicle control group (VC: propylene glycol: ethanol: water), the positive control group (MXD: 3% minoxidil), and the experimental group (WO: 20% Whale Oil) were topically applied to the back of the mouse. The results showed that 3% MXD and 20% WO were more effective than VC in promoting hair growth, especially 20% WO. Furthermore, in hematoxylin and eosin-stained skin tissue, an increase in the number of hair follicles and subcutaneous tissue thickness was observed with 20% WO. Whole-genome transcriptomic analysis also showed that 20% WO may have lower stress- and inflammation-related responses than 3% MXD. Therefore, whale oil can be expected to be used as a safe hair growth agent.

The social fear conditioning (SFC) paradigm, which is an animal model of social anxiety disorder, has been extensively used to investigate the cellular and molecular mechanisms underlying the psychopathology of this disorder. Studies using the SFC paradigm have suggested that the lateral septum plays a pivotal role in regulating social fear. While several lines of evidence have indicated the involvement of various neuronal mechanisms within the LS in modulating social fear, the role played by LS astrocytes in the tripartite synapses in regulating social fear expression is not yet fully understood. Over the years, astrocytes have emerged as key players in regulating synaptic transmission and a plethora of animal behaviors. Given their dynamic morphological and molecular response to various stimuli, studying astrocyte morphology remains an excellent tool for understanding their role in brain function and disease. By applying immunofluorescent-immunohistochemical methods, here we describe a protocol to characterize changes in the morphology of astrocytes in response to social fear acquisition using confocal microscopy.

Background: In response to inflammation, the absorption of nutritional iron is restricted. Multiple inflammation-related signaling pathways can lead to ferroptosis, an iron-dependent mechanism of programmed cell death. Since the pathophysiological significance of the presence and uptake of iron in chronic inflammation is still unknown, we tested the effect of a low iron diet on the clinical course of arthritis in the mouse model of collagen-induced arthritis (CIA). Methods: Six- to eight-week-old male DBA/1 mice were fed either a normal or a low iron diet starting three weeks before arthritis induction. From day four after the collagen-booster made on day 25, the development of arthritis was regularly monitored until the end of the experiment (day 34), using a standard clinical arthritis score. The complete blood count was determined as well as Fe2+, Fe3+, oxidized and reduced glutathione (GSH and GSSG) and malondialdehyde (MDA) in whole paw tissue by ELISA. Quantitative PCR was performed from whole paw tissue for glutathione peroxidase 4 and other key regulator genes of iron metabolism and ferroptosis. We used nonparametric tests to com-pare markers of iron metabolism and ferroptosis as well as nonlinear regression models for longitu-dinal data for signs of arthritis. Results: Mice fed a low iron diet showed a significantly less severe course of arthritis compared to mice fed a normal iron diet (p

Alzheimer’s disease (AD) poses a significant public health challenge due to its irreversible and progressive nature while lack of a cure. As a potential strategy to combat AD, its prevention becomes increasingly attractive. Mild Cognitive Impairment due to AD (MCI-AD) represents a critical transitional stage between normal age-related cognitive decline and more severe AD conditions, occurring just before dementia onset. Unfortunately, there is currently no established animal model that accurately recapitulates MCI-AD characteristics. While many laboratories have traditionally used normally aged wild-type animals as experimental models, this approach falls short in representing the inherently worse state of MCI-AD compared to normal aging. To address this gap, we introduce an animal model—a transgenic mouse line with genetic inactivation of G protein-coupled receptor kinase-5 (GRK5), commonly known as the GRK5 knockout (GRK5KO) mouse. These GRK5KO mice exhibit amnesia, cognitive deficits, increased β-amyloid levels, neurofibrillary tangle (NFT) immunopositive axonopathy, and hippocampal neurodegenerative changes. Importantly, these pathological alterations predominantly impact the entorhinal, transentorhinal, and hippocampal cortices, aligning with human MCI-AD criteria and Braak stage II of human AD progression. Notably, female GRK5KO mice show approximately 2.5 times more NFT-positive axonopathy than males, mirroring the higher prevalence of AD cases in women. Collectively, existing data strongly supports the GRK5KO mouse as a qualified animal model for studying MCI-AD.

Interferon-gamma (IFN-γ) is an important cytokine in host defense against tuberculosis infection. In some cases, administration of IFN-γ during tuberculosis infection can promote faster cure. In the present work, we have shown that in a mouse model, human interferon-gamma, exhibits some anti-tuberculosis activity, especially in combination with isoniazid.

The pervasive presence of atmospheric pollution, particularly polycyclic aromatic hydrocarbons such as 7,12-dimethylbenz(a)anthracene, instigates aberrant cellular and tissue conditions, precipitating oxidative damage and inflammatory cascades conducive to the onset of cancer, notably mammary cancer. Given the hepatic metabolism of 7,12-dimethylbenz(a)anthracene, liver damage can be found and the imperative of employing natural antioxidants becomes apparent. In this study, we first showed that 7,12-dimethylbenz(a)anthracene-intoxication escalates body weight, disrupts lipid profiles, and incites serum oxidative damage. Concurrently, hepatic and renal oxidative stress ensue, accompanied by heightened antioxidant enzyme activity in the 7,12-dimethylbenz(a)anthracene-exposed group compared to controls (p<0.05). Interestingly, P.lentiscus co-administration rectifies biochemical imbalances, significantly attenuates oxidative stress aberrations, and augments antioxidant enzyme responses (p<0.05). Importantly, histological analysis evinces P.lentiscus's shielding effect against 7,12-dimethylbenz(a)anthracene induced hepatocyte injury and steatosis. Furthermore, our investigations unveil P.lentiscus’s anti-proliferative efficacy against different human breast cancer cell lines. Thus, our findings underscore P.lentiscus‘s robust anti-proliferative, antioxidant, and hepato-protective capacities, mitigating metabolic disturbances, oxidative stress propagation in liver and kidney functions, and potential histological alterations, thereby impeding 7,12-dimethylbenz(a)anthracene induced mammary cancer initiation. We posit that P.lentiscus may serve as a prophylactic agent against breast cancer and liver oxidative damage instigated by this carcinogen.

Glucocorticoids promote muscle atrophy by inducing a class of proteins called atrogenes, resulting in reductions in muscle size and strength. In this work, we evaluated whether a mouse model with pre-existing diet-induced obesity had altered glucocorticoid responsiveness. We observed that all animals treated with the synthetic glucocorticoid dexamethasone had reduced strength, but that obesity exacerbated this effect. These changes were concordant with more pronounced reductions in muscle size, particularly in Type II muscle fibers, and potentiated induction of atrogene expression in the obese mice relative to lean mice. Furthermore, we show that the reductions in lean mass do not fully account for the dexamethasone-induced insulin resistance observed in these mice. Together these data suggest that obesity potentiates glucocorticoid-induced muscle atrophy.

The pervasive presence of atmospheric pollution, particularly polycyclic aromatic hydrocarbons such as 7,12-dimethylbenz(a)anthracene, instigates aberrant cellular and tissue conditions, precipitating oxidative damage and inflammatory cascades conducive to the onset of cancer, notably mammary cancer. Given the hepatic metabolism of 7,12-dimethylbenz(a)anthracene, the imperative of employing natural antioxidants becomes apparent. In this study, we delve into the antioxidant and hepato-protective properties of Pistacia lentiscus against 7,12-dimethylbenz(a)anthracene-induced toxicity, alongside exploring its potential anticancer attributes. Our investigations unveil Pistacia lentiscus's anti-proliferative efficacy against human breast cancer cell lines. Notably, 7,12-dimethylbenz(a)anthracene-intoxication escalates body weight, disrupts lipid profiles, and incites serum oxidative damage. Concurrently, hepatic and renal oxidative stress ensue, accompanied by heightened antioxidant enzyme activity in the 7,12-dimethylbenz(a)anthracene-exposed-group compared to controls (p<0.05). Nonetheless, Pistacia lentiscus co-administration rectifies biochemical imbalances, significantly attenuates oxidative stress aberrations, and augments antioxidant enzyme responses (p<0.05). Importantly, histological analysis evinces Pistacia lentiscus's shielding effect against 7,12-dimethylbenz(a)anthracene induced hepatocyte injury and steatosis. Our findings underscore Pistacia lentiscus's robust anti-proliferative, antioxidant, and hepato-protective capacities, mitigating metabolic disturbances, oxidative stress propagation in liver and kidney functions, and potential histological alterations, thereby impeding 7,12-dimethylbenz(a)anthracene-induced mammary cancer initiation. We posit that Pistacia lentiscus may serve as a prophylactic agent against breast cancer instigated by this carcinogen.

Objective: This research was aimed to estimate the anti-fatigue effects of arecoline and elucidate its underlying mechanisms using a murine model of central fatigue precipitated by sleep deprivation (SD). Methods: Seventy-two male C57BL/6 mice were randomly allocated into six groups: a control group, a SD-induced fatigue model group, a group receiving Rhodiola Rosea capsules (2.5 mg/kg), and arecoline groups administered low, medium, and high doses (10, 20, and 40 mg/kg, respectively). Following 28 days of continuous administrations, the effects of arecoline on the mouse fatigue-related behaviors was assessed by the behavioral tests, including grip strength, rotarod performance, and weight-bearing swimming endurance. Enzyme-linked immunosorbent assays (ELISAs) were utilized to measure the levels of the relevant biochemical markers. Western blotting was employed to quantify the expression of nuclear factor erythroid 2-related factor (Nrf2), Kelch-like ECH-associated protein 1 (Keap1), heme oxygenase 1 (HO-1), sequestosome-1 (p62), and NADPH quinone oxidoreductase 1 (NQO1) in the gastrocnemius muscle. Results: Arecoline administration notably enhanced grip strength, delayed the onset of fatigue as evidenced by extended latencies in rotarod tests, and increased the duration of weight-bearing swimming in mice. In the elevated plus maze, arecoline significantly reduced both the number of entries and the total distance traveled in the open arms. Arecoline markedly decreased serum levels of creatine kinase, blood urea nitrogen, lactate dehydrogenase, triglycerides, and cholesterol, while elevated total testosterone, lactate dehydrogenase, and immunoglobulin G levels. Furthermore, it significantly increased superoxide dismutase(SOD), catalase(CAT), and glutathione peroxidase activity in the gastrocnemius muscle, reduced malondialdehyde levels, augmented hippocampal SOD and CAT activity, and elevated glycogen stores in both liver and muscle tissues. Neurotransmitter levels were significantly increased, cytokine levels were markedly reduced, and the expression of Nrf2, Keap1, NQO1, p62, and HO-1 in brain tissue was significantly upregulated. Conclusion: The current study for the first time demonstrated that arecoline has significant anti-fatigue activity, and its mechanism of action is related to elevate the levels of glucose and lipid metabolism, relieve oxidative stress damage, inhibit neuroinflammatory response, regulate neurotransmitter levels and Keap1/Nrf2/HO-1 signaling pathway. The current study provides a new insight into the potential of arecoline in prevention and improvement of fatigue.

To elucidate mesenchymal stromal cells (MSC)-tumor intricate and ambiguous interactions, the reliable cell labeling and tracking techniques are imperative. Traditional methods of cell labelling have limitations mostly relevant to need for genetic modification what demands the exploration for alternative strategies. Here, we propose using fluorescent photoconvertible microcapsules containing Rhodamine B (RhB) to study mMSC migration in brain tumors. These 3 μm sized microcapsules are readily internalised by cells and undergo photoconversion under 561 nm laser exposure with fluorescence blue shift on demand. Optimal photoconversion was achieved with a laser irradiation duration of 0.4 ms, which provide a maximal brightness of photoconverted label without an excessive laser exposure on cells. Capsules modified with polyallylamine hydrochloride demonstrated the best potential for intracellular uptake without significantly affecting cell viability, motility, or proliferation. The optimal ratio of 20 capsules per mMSC was determined for labeling. Moreover, migration of individual mMSCs within 2D and 3D glioblastoma cell (EPNT-5) colonies over 2 days and in vivo tumor settings over 7 days was tracked. Our study unveils a robust platform for investigating MSC-tumor dynamics, offering insights into therapeutic strategies. Photoconvertible microcapsules could also become an indispensable tool for studying complex fundamental processes of cell-cell interactions for a wide range of problems in biology and medicine.

Ulcerative colitis (UC) is a chronic inflammatory disease, the incidence of which is increasing worldwide. However, the etiology and pathogenesis of UC remains unclear. The n-butanol extract of pulsatilla decoction (BEPD) of the traditional Chinese medicine herbal formula has been shown to be effective in treating UC. We aimed to explore the molecular mechanism underlying the effects of BEPD on UC, in particular its effects on neutrophil extracellular trap (NET) formation by neutrophils. High-performance liquid chromatography was used to determine the principal compounds of BEPD. UC was induced in mice using dextran sodium sulfate, and mice were treated with 20, 40, or 80 mg/kg BEPD daily for seven days. Colonic inflammation was determined by assessing the disease activity index, histopathology, colonic mucosal damage index, colonic mucosal permeability, and pro- and anti-inflammatory cytokine levels. The infiltration and activation status of neutrophils in the colon were determined by analyzing the levels of chemokine (C-X-C motif) ligand (CXCL)1 and CXCL2, reactive oxygen species, Ly6G, and numerous NET proteins. Our results showed that BEPD improved the disease activity index, histopathology, and colonic mucosal damage index scores of mice with UC, and restored colonic mucosal permeability compared with untreated mice. The expression levels of the pro-inflammatory cytokines interleukin-1β, interleukin-6, and tumor necrosis factor-α in colon tissues were significantly decreased, while the expression levels of anti-inflammatory cytokines in colon tissues were significantly increased, exceeding those of control mice. In addition, BEPD reduce the expression of the neutrophil chemokines CXCL1 and CXCL2 in the colon tissue of mice with UC, reduced neutrophil infiltration, reduced reactive oxygen species levels, and significantly reduced the expression of NET proteins. BEPD also significantly reduced NET formation. The results of this study suggest that BEPD exerts therapeutic effects in a murine model of UC by inhibiting neutrophil infiltration and activation in the colon, as well as by inhibiting the expression of key proteins involved in NET formation and reducing NET formation, thereby alleviating local tissue damage and disease manifestations.

Mechanical properties of cardiomyocytes from different transmural regions are heterogeneous in the left ventricular wall. The cardiomyocyte mechanical environment affects this heterogeneity because of mechano-electric feedback mechanisms. In the present study, we investigated the effects of load upon transmural differences in contraction of subendocardial (ENDO) and subepicardial (EPI) single cells isolated from the murine left ventricle. Various loads were applied to the cells using carbon fiber techniques for single myocytes. To simulate experimentally obtained results and to predict mechanisms underlying the cellular response to change in load, our mathematical models of the ENDO and EPI cells were used. Extent of the transmural gradient in the time course of contractions was independent of the loading conditions where unloaded and heavy loaded (isometric) contractions were examined, but the regional gradient of the relaxation time characteristics tended to decrease when the load decreased. Under auxotonic contractions, time to peak contraction (T_max) was significantly longer in ENDO cells than in EPI cells at low preload. An increase in preload (axial stretch) prolonged T_max in both cell types; however, the prolongation was greater in EPI cells, resulting in a decrease in transmural gradient in T_max at high preload. The [Ca²⁺]_i transient decay time constant was consistent with the greater preload dependency in T_max of EPI cells. Our modified mathematical models reproduced experimental results, suggesting that differences in cooperativity of cross bridges and calcium troponin C complex interactions between the ENDO and EPI cardiomyocytes may contribute to the different cellular responses to stretch, which may provide a decrease in transmural dispersion of cellular shortening in the intact heart.

Mouse models are frequently used to study Huntington’s disease (HD). Onset and severity of neuronal and behavioral pathologies vary greatly between HD mouse models, which results from different huntingtin expression levels and different CAG repeat length. HD pathology appears to depend also on strain background of mouse models. Thus, behavioral deficits of HD mice are more severe in the FVB than in the C57BL/6 background. Alterations in medium spiny neuron (MSN) morphology and function has been well documented in young YAC128 mice in the FVB background. We here tested the relevance of strain background for mutant huntingtin (mHTT) toxicity on the cellular level by investigating HD pathologies in YAC128 mice in the C57BL/6 background (YAC128/BL6). Morphology, spine density, synapse function and membrane properties were not or only subtly altered in MSNs of 12-month-old YAC128/BL6 mice. Despite the mild cellular phenotype, YAC128/BL6 mice showed deficits in motor performance. More pronounced alterations in MSN function were found in the HdhQ150 mouse model in the C57BL/6 background (HdhQ150/BL6). Consistent with the differences in HD pathology, the number of inclusion bodies was considerably lower in YAC128/BL6 mice than HdhQ150/BL6 mice. This study highlights the relevance of strain background for mHTT toxicity in HD mouse models.

Previously, we described a 19-base pair double-stranded RNA with 3'-trinucleotide overhangs, acting as immunostimulatory RNA (isRNA). This molecule demonstrated notable antiproliferative effects on cancer cells, inhibited tumor growth, and elicited immunostimulatory and antiviral responses by inducing cytokine and interferon production. Within this study, we compared the efficiency of lung fibrosis development, initiated in mice by BLM or LPS using different schemes of induction. Then we compared the effect of isRNA used in a preventive or therapeutic regimen on the development of fibrosis in selected BLM- and LPS-induced mouse models and showed that isRNA can be used in pathological conditions accompanied by the development of inflammation and the risk of fibrosis formation, without adverse side effects. Prophylactic regimen of isRNA application is beneficial for prevention of the development of pulmonary fibrosis.

The enhancement of early diagnosis of lung cancer is mandatory to improve prognosis. We observed the increase cancer stem cells (CSC) and circulating tumor cells (CTC) in blood of mice on d3 after Lewis lung carcinoma (LLC) cell implantation before disease symptom. Besides we have developed an approach to reprogramming immune cells by inhibiting the MAPK/ERK pathway through MEKi and the PD-1/PD-L1 immune checkpoint signaling pathway. We hypothesized that reprogramming of spleen CD8+ T-cells could also create a population of immune cells with high antitumor activity. We reprogrammed CD8+ T-cells derived from the spleen of C57BL/6 mice (rsCD8+T-cells). The rsCD8+T-cells were able to migrate to lung and were more resistant after the exhaustion in vitro in comparison with naïve sCD8+T-cells. In the orthotopic LLC model, the rsCD8+T-cells therapy increased the amount of proliferating CD8+ and CD4+ T-cells in blood and lung from mice. The amount of CSC decreased in the blood and lung of mice treated with rsCD8+ T-cells. A morphological study revealed a decrease in the number of metastases in lung tissue. The antitumor effects of rsCD8+T-cells are based on the activation of the host immune response by increasing the populations of CD8+ and CD4+ T-cells and apoptosis of CSCs.

Abstract: Endoglin (ENG) is a causative gene of type 1 hereditary hemorrhagic telangiectasia (HHT1). HHT1 patients have arteriovenous malformations (AVMs) in multiple organs, including the brain. In mice, Eng deletion induced by R26RCreER or SM22aCre leads to AVM development in the brain and other organs. We have reported that the severity of brain AVM in mice with activin receptor-like kinase 1 (Alk1, an HHT2 causative gene) mutation is correlated with the number of Alk1 negative endothelial cells (ECs). We hypothesized that increase of Eng negative ECs will enhance AVM severity. To increase EC Eng deletion, we used a codon improved cre (icre), which is more potent in recombination of floxed alleles than the wild type (WT) cre. R26RCreER;Eng^f/f mice that have Rosa promoter driving and tamoxifen (TM) inducible WT cre expression globally and PdgfbiCreER;Eng^f/f that have Pdgfb promoter driving and TM inducible icre expression in ECs were treated with 3 intra-peritoneal injections of TM (2.5 mg/25g of body weight) to delete Eng globally or in the ECs. AAV-VEGF was stereotactically injected into the brain to induce brain focal angiogenesis and brain AVM. We found that iCre caused more Eng deletion in the brain indicated by lower level of Eng proteins (p<0.001) and fewer Eng positive ECs (p=0.01) than mice with WT cre. Mice with iCre mediated Eng deletion have more abnormal vessels (p=0.02), CD68⁺ macrophages (p=0.002), and hemorrhage (p=0.04), and less vascular pericyte and smooth muscle coverage than mice with WT cre. In addition, arteriovenous shunts were detected in the intestines of icre mice, a phenotype that have not been detected in WT cre mice before. RNAseq analysis showed that 8 out of the 10 top upregulated pathways identified by Gene Ontology (GO) analysis are related to the inflammation. Therefore, increase of Eng deletion in ECs exacerbates AVM severity, which is associated with enhanced inflammation. Strategies that can reduce Eng negative ECs could be used to develop new therapies to reduce AVM severity for HHT1 patients.

Meningitis is a severe disease associated with death in children under five with highest rates of infections under age of one. Vaccines for Neisseria meningitides and Haemophilus influenza are used to prevent the main causative agents of meningitis. Administration of H. influenzae type b (Hib) vaccine is recommended at 2, 4 and 6 months with a booster dose at 18 months. N. meningitidis has two commercially available vaccines, the pure polysaccharide is recommended at 24 months meanwhile the protein-conjugated vaccines at 12 months. We sought in this study to examine if coadministering the vaccines for the two main meningitis causing bacteria might be synergistic as a preliminary step towards the possibility of shuffling immunization schedule. So, we coadministered Hib vaccine with commercially available vaccines either quadrate (ACWY) polysaccharide meningococcal (Men) or conjugated meningococcal (Nim) vaccines in Balb/C mice (n = 6/group) and compared to each vaccine administered separately and controls. Thirty-five days post immunization, we measured specific antibodies titers. Hib vaccine increased Men antibody titers significantly for serotypes Y and W. When Hib vaccine was coadministrated with Nim, antibody titer for Y, W and A significantly increased. For serotype C, there was no significant difference in antibody titers among immunized groups. As for effect of meningococcal vaccines on Hib, Men significantly increased Hib antibody titers while Nim had no effect. Collectively, our data suggested that coadministration of Hib and Men or Nim vaccines was safe and had synergistic effect on immune responses elicited to both vaccines. Further studies are needed before immunization schedule modifications. Such immunization schedule recommendation should provide better protection against this life-threatening disease in young children.

Equine herpesvirus type 1 (EHV-1) causes rhinopneumonitis, abortion and neurological outbreaks (equine herpesvirus myeloencephalopathy, EHM) in horses. EHV-1 also causes lethal encephalitis in laboratory small animals such as mice and hamsters experimentally. EHV-1 ORF76 is a homologue of HSV-1 US9, which is a herpesvirus kinase. Starting with an EHV-1 bacterial artificial chromosome clone of neuropathogenic strain Ab4p (pAb4p BAC), we constructed an ORF76 deletion mutant (Ab4p∆ORF76) by replacing ORF76 with the rpsLneo gene. Deletion of ORF76 had no influence on replication, cell-to-cell spread in cultured cells or replication in primary neuronal cells. In western blots of EHV-1-infected cell lysates, an EHV-1 Us9-specific polyclonal antibody detected multiple bands ranging from 35 to 42-kDa. In a CBA/N1 mouse infection model following intranasal inoculation, the parent and Ab4p∆ORF76 revertant caused the same histopathology in the brain and olfactory bulbs. The parent, Ab4p∆ORF76 and revertant mutant replicated similarly in the olfactory mucosa, although Ab4p∆ORF76 was not transported to the olfactory bulbs and was unable to infect the CNS. These results indicated that the ORF76 (US9) plays an essential role in the anterograde spread EHV-1.

Background and Objectives: Mycobacterium bovis Bacillus Calmette–Guérin (BCG) vaccine administration has been suggested to prevent glucose metabolism abnormalities and fatty liver in genetically obese ob/ob mice; however, it is not clear whether the beneficial effects of BCG are also observed in the progression of glucose intolerance induced by a high-fat diet (HFD). Therefore, the effects of BCG vaccination on changes in glucose tolerance and insulin response were investigated in HFD-fed C57BL/6 mice. Materials and Methods: We used the BCG Tokyo 172 strain to determine its effects on abnormalities in glucose metabolism. For vaccination, five-week-old male mice were injected intraperitoneally with BCG and maintained on an HFD three weeks later. The mice were regularly subjected to intraperitoneal glucose tolerance and insulin tolerance tests (IGTT and ITT). These tests were also performed in mice transplanted with bone marrow cells from BCG-vaccinated donor mice. Results: Significant effects of BCG vaccination on blood glucose levels in IGTT and ITT were observed from week 12 of the experiment. BCG vaccination significantly improved changes in fasting glucose and insulin levels, insulin resistance indexes, and glucagon-to-insulin ratios by HFD at the end of the experiment. Significant inhibitory effects in IGTT and ITT on glucose intolerance were also observed by transplantation with bone marrow cells derived from BCG-vaccinated donor mice. Conclusions: BCG vaccination significantly delayed glucose intolerance progression, suggesting a beneficial effect of BCG on the pathogenesis of type 2 diabetes. It has also been demonstrated that the effects of BCG vaccination may be at least partially due to an immune memory (trained immunity) for hematopoietic stem and progenitor cells of the bone marrow.

Val-Phe-Val-Arg-Asn (VFVRN) has been identified and screened from lipid-lowering chickpea peptides (ChPs) by using a pharmacokinetic model in our previous experiment. The present study was conducted to investigate its effects and mechanisms on lipid metabolism. A high-fat diet C57BL/6J mice model and 3T3-L1 preadipocyte cell model were used. VFVRN was found to significantly decrease the levels of some blood lipids. The expressions of LDL receptor (LDLR), peroxisome proliferator-activated receptors (PPAR)α, liver X receptor (LXR)α, cholesterol 7α-hydroxylase (CYP7A1) and AMP-activated protein kinase (p-AMPK) in liver were up-regulated by VFVRN treatment. The expressions of 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGR), fatty acid synthetase (FAS), 1-aminocyclopropane-1-carboxylate synthetase (ACC), sterol regulatory element-binding protein (SREBP)-1c and SREBP-2 in liver were significantly (P<0.05) down-regulated. Additionally, the expressions of PPARα and PPARγ in adipose tissues were up-regulated by VFVRN significantly (P<0.05). VFVRN might also contribute to transintestinal cholesterol efflux (TICE) by up-regulating the expressions of LXRα and ATP binding cassette G5/8 transporters (ABGC5/8). Moreover, VFVRN promoted 3T3-L1 preadipocyte apoptosis by up-regulating the expressions of BaX, cleaved Caspase-3 and down-regulating Bcl-2. VFVRN had potent effects in reversing metabolic disorders of blood and liver in a high-fat diet mice model, as well as to promote the apoptosis of 3T3-L1 preadipocytes.

The chemopreventive effects of various mixed cereal grain (MCG) samples on azoxymethane (AOM, 10 mg/kg) and dextran sulfate sodium (DSS, 2% w/v)-induced colorectal cancer (CRC) in C57BL/6J mice were studied. The main MCG preparation consisted of fermented brown rice (FBR), glutinous brown rice, glutinous Sorghum bicolor, glutinous Panicum miliaceum, Coix lacryma-jobi and black soybean at an appropriate mixing ratio. Other MCG preparations contained rice coated with 5% Phellinus linteus and 5% Curcuma longa (MGR-PC), or 10% Phellinus linteus (MCG-P), or 10% Curcuma longa (MCG-C). Consumption of dietary MCG-PC by CRC mice significantly increased colon length, decreased the ratio of colon weight to length, and reduced the number of colon tumors. Similar effects, although to a lower extent, were observed in CRC mice fed with MCG-P, followed by those fed with MCG-C, MCG, FBR or white rice (WR). MCG-PC significantly suppressed colonic neoplasia, and decreased the levels of various cytokines (tumor necrosis factor: Tnf, interleukin 1 beta: Il1b, interleukin 6: Il6, and interferon gamma: Ifng) in serum and colon tissue of the CRC mice. In addition, MCG-PC increased the mRNA expressions of tumor protein p53(Tp53) and cyclin-dependent kinase inhibitor 1A(Cdkn1a), activated pro-apoptotic caspase 3(Casp3), and reduced expression of both mRNA and protein of inducible inducible nitric oxide synthase 2 (Nos2), prostaglandin-endoperoxide synthase 2 (Ptgs2), and cyclin D1(Ccnd1) in colon tissue. These findings suggest that than compared with other cereal grain preparations, MCG-PC had a greater activity against AOM/DSS-induced CRC by reducing intestinal inflammation, and modulating the expression of certain carcinogenesis related factors (Nos2, Ptgs2, Tp53, Cdkn1a, Ccnd1 and Casp3) in colon tissue of CRC mice.

Overconsumption of an unbalanced diet and overweight, leading to insulin resistance, dyslipidemia, hepatic steatosis, cardiovascular diseases and obesity, is nowadays a worldwide health issue, with different patterns of metabolic disturbances in the young and adult popula-tions, in both gender. Preclinical models that closely mimic the gradual weight gain that occurs in humans upon consumption of a “western-type” diet (WD) are of great interest. In particular, the diet-induced obesity (DIO) model in the C57BL/6J mouse sub-strain is often used in biomed-ical research, considering that it is prone to metabolic disorders and obesity, and is widely used to generate genetically modified mice. This study aimed to phenotypically characterize the C57BL/6J mouse strain fed a WD-like diet, using high-frequency ultrasound imaging (HFUS) as a complementary tool to longitudinally monitor morphofunctional changes in the liver, heart and kidney associated with DIO. Long term WD feeding increased mice body weight (BW), liver/BW ratio and body condition score (BCS), serum transaminases, glucose and insulin, as well as Homeostasis model assessment (HOMA) indexes, and caused dyslipidemia and insulin resistance. According to the 3Rs, ultrasound imaging has enabled a comprehensive study of metabolic syndrome in mice, in vivo and non-invasive, improving the identification of early stages of diseases.

Antigen-presenting cells (APCs) are essential for modulating immune responses, and optimizing their differentiation protocols is critical for cell-based immunotherapies. This study compares eight different protocols for differentiating APCs from C57BL/6J mice using GM-CSF and L-929 supernatant. Four groups treated with GM-CSF and four with L-929 supernatant at various concentrations, alongside a control group were evaluated. Flow cytometry was used to analyze the expression of key markers, including MHC II, CD11c, F4/80, and CD11b. Our findings show that GM-CSF resulted in superior differentiation outcomes compared to L-929 supernatant, with higher expression levels of the analyzed markers. This study underscores the importance of considering both cell yield and protein expression quality in selecting differentiation protocols. For researchers developing therapies targeting specific cell populations, these findings demonstrate how different culture conditions influences both the quantity and phenotypic characteristics of differentiated cells. Balancing efficiency and phenotypic fidelity is crucial for optimizing cell-based immunotherapy strategies. Our data provide a valuable reference for future studies and applications involving APC differentiation from bone marrow precursors, ensuring robust foundations for developing advanced immunotherapies. This comprehensive comparison of differentiation protocols offers insights essential for enhancing the effectiveness and cost-efficiency of cell-based therapies.

We assessed if there were any sex-related differences in the ability of nicotine to increase plasma corticosterone secretion after single or repeated nicotine administration. For single-dose studies, male and female mice were habituated to the test room for 1 h and injected with saline or nicotine (0.25 or 1 mg/kg, s.c.). In repeated-dosing studies, mice were injected with saline or nicotine (1 mg/kg, s.c.) once daily for six days, and, on day 7, received nicotine (1 mg/kg, s.c.). The mice were euthanized 15 min later, and trunk blood was collected for the measurement of corticosterone, nicotine, and cotinine. Our results showed that saline or nicotine each significantly increased plasma corticosterone levels in both male and female mice, with a greater response in female mice. Plasma corticosterone levels were increased in male but not female mice after repeated compared to single nicotine administration. The level of cotinine, a biomarker of nicotine use, was significantly higher in female than in male mice. Taken together, these novel findings suggest that female mice responded to nicotine and stress of handling more than male mice and provide for the first-time quantitative data on the male-female differences in nicotine-induced elevations of corticosterone and of cotinine.

Determining the estrous cycle stages in mice is essential for optimizing breeding strategies, synchronizing experimental time lines, and facilitating studies in behavior, drug testing, and genetics. It is critical for reducing the production of genetically unmodified offspring in the generation and investigation of genetically modified animal models. An accurate detection of the estrus cycle is particularly relevant in the context of the 3Rs—Replacement, Reduction and Refinement. The estrous cycle, encompassing the reproductive phases of mice, is key to refining experimental designs and addressing ethical issues related to the use of animals in research. This study presents results from two independent laboratories on the efficacy of the Mouse Estrus Detector (MED) from Elmi Ltd. (Latvia) for the accurate determination of the estrus phase. The female mice of five strains/stocks (CD1, FVB/N, C57Bl6/J, B6D2F1, and Swiss) were used. The results showed that the MEDProTM is a low -traumatic, simple, rapid and painless method of estrus detection that supports the principles of the 3Rs. The use of the MEDProTM for estrus detection in mice caused minimal stress, enhanced mating efficiency, facilitated an increase in the number of embryos for the in vitro fertilization and allowed the production of the desired number of foster animals.

Polysulfides are endogenously produced in mammals and generally associated with protective functions. Our aim was to investigate the effect of dimethyl trisulfide (DMTS) in a mouse model of acute stress. DMTS activates transient receptor potential ankyrin 1 (TRPA1) channels and leads to neuropeptide release, potentially that of substance P (SP). We hypothesize that DMTS might inhibit the degrading enzymes of endocannabinoids, so this system was also investigated as another possible pathway for mediating the effects of DMTS. Trpa1 gene wild type (WT) and knock out (KO) mice were used to confirm the role of the TRPA1 ion channel in mediating the effects of DMTS. C57BL/6J, NK1 gene KO, and Tac1 gene KO mice were used to evaluate the effect of DMTS on the release and expression of SP. Some C57BL/6J animals were treated with AM251, an inhibitor of the cannabinoid CB1 receptor, to elucidate the role of the endocannabinoid system in these processes. Open field test (OFT) and forced swim test (FST) were performed in each mouse strain. Tail suspension test (TST) was performed in TRPA1 WT and KO animals. C-FOS immunohistochemistry was carried out on TRPA1 WT animals. DMTS treatment increased the number of highly active periods and decreased immobility time in the FST in WT animals, but had no effect on Trpa1 KO mice. DMTS administration induced neuronal activation in stress-related brain areas such as the locus coeruleus, dorsal raphe nucleus, lateral septum, paraventricular nucleus of the thalamus, and paraventricular nucleus of the hypothalamus. DMTS may have a potential role in the regulation of stress-related processes, and the TRPA1 ion channel may also be involved in mediating the effects of DMTS. DMTS can be an ideal candidate for further study as a potential remedy in stress-related disorders.

Despite advances in understanding of the molecular pathogenesis of glioma, outcomes remain dismal. Developing successful treatments for glioma requires faithful in vivo disease modeling and rigorous preclinical testing. Murine models, including xenograft, syngeneic, and genetically engineered models, are used to study gliomagenesis, identify methods of tumor progression, and test novel treatment strategies. Since the discovery of highly recurrent isocitrate dehydrogenase (IDH) mutations in lower-grade gliomas, there is increasing emphasis on effective modeling of IDH mutant brain tumors. Improvements in preclinical models that capture the phenotypic and molecular heterogeneity of gliomas are critical for the development of effective new therapies. Herein, we explore the current status, advancements, and challenges with contemporary murine glioma models.

Decompression sickness (DCS) with neurological disorders is the leading cause of diving accidents. Exposure to high levels of CO2 during diving is a safety concern for occupational , groups at risk of DCS. However, the effects of prior exposure to CO2 have never been evaluated. The purpose of this study was to evaluate the effect of CO2 breathing prior to a provocative dive on the occurrence of DCS in mice. 50 mice were exposed to a maximum CO2 concentration of 70 hPa for one hour at atmospheric pressure. Another 50 mice breathing air under similar conditions served as controls. In the AIR group (controls), 22 out of 50 mice showed post-dive symptoms compared to 44 out of 50 in the CO2 group. We found that CO2 breathing is associated with a decrease in body temperature in mice and that CO2 exposure dramatically increases the incidence of DCS. More unexpectedly, it appears that a lower temperature of the animals even before exposure to the accident-prone protocol leads to an unfavorable prognosis. This study also suggests that the composition of the microbiota may influence thermogenesis and thus accidentology. Depending on prior exposure, some bacteria identified in this work could be perceived as protective or pathogenic.

Abstract: Cleft palate is a congenital condition result from incomplete fusion of palatine shelves. The current study aimed to assess the effects of vitamin B6 on the incidence of corticosteroid-induced cleft palate model. Eighteen pregnant mice were divided into three groups. Mice of control group were injected with sterile physiological saline from 11th - 14th days of gestation. Mice of group II were injected with 125 mg/kg hydrocortisone from 11th - 14th days of gestation. Mice of group III were injected with hydrocortisone as in group II and given drinking water containing 500 µg/ml of vitamin B6 from day zero of gestation until delivery. Two days after delivery, the offspring were counted, and their head circumferences were taken for statistical analysis. The heads of the offspring were fixed and processed for paraffin sectioning and stained with hematoxylin and eosin. Cleft palates were counted and statistically analyzed using ANOVA test to determine any significances (P

Currently, obesity is a critical global public health burden. Numerous studies have demonstrated the regulation of the pathogenesis of obesity and metabolic abnormalities by the gut microbiota and microbial factors; however, their involvement in the various degrees of obesity is not yet understood well. Previously, obesity has been shown to be associated with decreased levels of vitamin B12. Considering exclusive microbial production of vitamin B12, we hypothesised that a decrease in cobalamin levels in obese individuals may be at least partially caused by its depleted production in the intestinal tract by the commensal microbiota. In the present study, our aim was to estimate the abundance of enzymes and metabolic pathways for vitamin B12 synthesis in the gut microbiota of mouse models of alimentary and genetically determined obesity, to evaluate the contribution of the obesogenic microbiome to vitamin B12 synthesis in the gut. We have defined a significantly lower representation of enzymes and metabolic pathways for vitamin B12 biosynthesis in obese mice compared to non-obese mice, wherein enzyme depletion was more pronounced in lepr(-/-) (db/db) mice, which developed severe obesity. The representation of enzymes involved in cobalamin synthesis is strongly correlated with representation of several microbes in high-fat diet fed mice, whereas there were almost no correlations in db/db mice. Therefore, the degree of obesity and the composition of the correspondent microbiota are the main contributors to the representation of genes and pathways for cobalamin biosynthesis in the mouse gut.

Glioblastoma (GBM) is the most aggressive brain cancer. To model GBM in research, orthotopic brain tumor models, including syngeneic models like GL261 and genetically engineered mouse models like TRP, are used. In longitudinal studies, tumor growth and treatment response are typ-ically tracked with in vivo imaging, including bioluminescence imaging (BLI), which is quick, cost-effective, and easily quantifiable. However, BLI requires luciferase-tagged cells, and recent studies indicate that the luciferase gene can elicit an immune response, leading to tumor rejection and experimental variation. We sought to optimize the engraftment of two luciferase-expressing GBM models, GL261 Red-FLuc and TRP-mCherry-FLuc, showing differences in tumor take, with GL261 Red-FLuc cells requiring immunocompromised mice for 100% engraftment. Immuno-histochemistry and MRI revealed distinct tumor characteristics: GL261 Red-FLuc tumors were well-demarcated with densely packed cells, high mitotic activity, and vascularization. In con-trast, TRP-mCherry-FLuc tumors were large, invasive, and necrotic, with perivascular invasion. Quantifying tumor volume using the HALO® AI analysis platform yielded results comparable to manual measurements, providing a standardized and efficient approach for reliable high-throughput analysis of luciferase-expressing tumors. Our study highlights the importance of considering tumor engraftment when using luciferase-expressing GBM models, providing in-sights for preclinical research design.

Adult T-cell leukemia (ATL) is an aggressive hematologic disease caused by human T-cell leukemia virus type 1 (HTLV-1) infection. Various animal models of HTLV-1 infection/ATL have been established to elucidate the pathogenesis of ATL and develop appropriate treatments. For analyses employing murine models, transgenic and immunodeficient mice are used because of the low infectivity of HTLV-1 in mice. HTLV-1 Tax and HBZ transgenic mice spontaneously develop tumors, and roles for both Tax and HBZ in cell transformation and tumor growth have been established. Severely immunodeficient mice were able to engraft ATL cell lines and have been used in preclinical studies of candidate molecules for the treatment of ATL. HTLV-1-infected humanized mice with an established human immune system are a suitable model to characterize cells in the early stages of HTLV-1 infection. This review outlines the characteristics of mouse models of HTLV-1 infection/ATL and describes progress made in elucidating the pathogenesis of ATL and developing related therapies using these mice.

Pericentromeric regions of chromosomes enriched in tandemly repeated satellite DNA although representing a significant part of eukaryotic genomes are still understudied mainly due to interdisciplinary knowledge gaps. Recent studies suggest their important role in genome regulation, karyotype stability and evolution. Thus, the idea of satellite DNA as a junk part of the genome was refuted. Integration of data about molecular composition, chromosome behaviour and details of in situ organization of pericentromeric regions is of great interest. The objective of this work was a cytogenetic analysis of the interactions of pericentromeric regions non-homologous chromosomes in mouse spermatocytes using immuno-FISH. We analysed two events: the associations between cerntomeric regions of X chromosome and autosomes, and associations between centromeric regions of autosomal bivalents forming chromocenters. We conclude that X chromosome form temporary synaptic associations with different autosomes in early meiotic prophase I which normally can be found at pachytene-diplotene without signs of pachytene arrest. These associations are formed between the satellite DNA-enriched centomeric regions of X chromosome and different autosomes but not involve the satellite-poor centromeric region of Y-chromosome. We suggest the mechanism of X chromosome competitive replacement from such associations during synaptic correction. We showed that centromeric region of the X chromosome remains free of γH2Ax-dependent chromatin inactivation, while Y chromosome is completely inactivated. This findings highlights the predominant role of associations between satellite DNA-enriched regions of different chromosomes including X. We assume that X-autosome temporary associations is a manifestation of an additional synaptic disorders checkpoint. These associations are normally corrected before the late diplotene. We revealed that the intense spreading conditions applied to the spermatocytes I nuclei did not lead to destruction of stretched chromatin fibers i.e. elongated chromocenters enriched in satellite DNA. Revealed by us tight associations between pericentromeric regions of different autosomal bivalents and X chromosome may represent the basis for repeat stability maintenance in autosomes an X chromosome. The consequences of our findings are discussed. We obtained the preparations of mouse spermatocytes nuclei in the meiotic prophase I using two approaches: standard and extremely intense surface spread techniques. Using immuno-FISH we visualized tandemly repeated mouse Major and Minor satellite DNA located in the pericentromeric regions of chromosomes and performed a morphological comparison of the standard- and intensely spreaded meiotic nuclei. Based on our results, we assume the remarkable strength of the chromocenter-mediated associations, “chromatin “bridges”, between different bivalents at the pachytene and diplotene stages. We have demonstrated that the chromocenter “bridges” between the centromeric ends of meiotic bivalents are enriched in both tandemly repeated Major and Minor satellite DNA. Association of centromeric regions of autosomal bivalents and X-chromosome but not with Y-chromosome correlates with the absence of Major and Minor satellites on Y-chromosome. We suggest that revealed tight associations between pericentromeric regions of bivalents may represent the network-like system providing dynamic stability of chromosomal territories, as well as add new data for the hypothesis of ectopic recombination in these regions which supports sequence homogeneity between non-homologous chromosomes and does not contradict the meiotic restrictions imposed by the crossing-over interference near centromeres. We conclude that nuclear architecture in meio-sis may play an essential role in contacts between the non-homologous chromosomes providing the specific characteristics of pericentromeric DNA.

Methionine 77 in calmodulin can be stereospecifically oxidized to methionine sulfoxide by mammalian methionine sulfoxide reductase A. Whether this has in vivo significance is unknown. We therefore created a mutant mouse in which wild-type calmodulin-1 was replaced by a calmodulin containing a mimic of methionine sulfoxide at residue 77. Total calmodulin levels were unchanged in the homozygous M77Q mutant, which is viable and fertile. No differences were observed on learning tests, including the Morris water maze and associative learning. Cardiac stress test results were also the same for mutant and wild type mice. .However, young male and female mice were 20% smaller than wild type mice, although food intake was normal for their weight. Young M77Q mice were notably more active and exploratory than wild type mice. This behavior difference was objectively documented on the treadmill and open field tests. The mutant mice ran 20% longer on the treadmill than controls, and in the open field test, the mutant mice explored more than controls and exhibited reduced anxiety These phenotypic differences bore a similarity to those observed in mice lacking calcium/calmodulin kinase Iiα (CaMKIIα). We then showed that M77Q calmodulin was less effective in activating CaMKIIα than wild type calmodulin. Thus, characterization of the phenotype of a mouse expressing a constitutively active mimic of calmodulin led to the identification of the first calmodulin target that can be differentially regulated by the oxidation state of Met77. We conclude that reversible oxidation of methionine 77 in calmodulin by MSRA can regulate cellular function.

Glycogen storage disease type III (GSDIII) is a hereditary glycogenosis caused by deficiency of the glycogen debranching enzyme (GDE), an enzyme, encoded by Agl, enabling glycogen degradation by catalyzing alpha-1,4-oligosaccharide side chain transfer and alpha-1,6-glucose cleavage. GDE deficiency causes accumulation of phosphorylase-limited dextrin, leading to liver disorder followed by fatal myopathy. We tested here the capacity of the new autophagosomal activator GHF-201 to alleviate disease burden by clearing pathogenic glycogen surcharge in the GSDIII mouse model Agl-/-. We used open field, grip strength and rotarod tests for evaluating GHF-201’s effects on locomotion, biochemistry panel to quantify hematological biomarkers, indirect calorimetry to quantify in vivo metabolism, transmission electron microscopy to quantify glycogen in muscle, and fibroblast image analysis to determine cellular features affected by GHF-201. GHF-201 was able to improve all locomotion parameters and partially reversed hypoglycemia, hyperlipidemia and liver and muscle malfunction in Agl-/- mice. Treated mice burnt carbohydrates more efficiently and showed significant improvement of aberrant ultrastructural muscle features. In GSDIII patient fibroblasts, GHF-201 restored mitochondrial membrane polarization and corrected lysosomal swelling. In conclusion, GHF-201 is a viable candidate for treating GSDIII as it recovered a wide range of its pathologies in vivo, in vitro, and ex vivo.

Background: IBD is a spectrum of pathologies characterized by dysregulated immune activation leading to uncontrolled response against intestinal, thus resulting in chronic gut inflammation and tissue damage. Due to its complexity, the molecular mechanisms responsible for disease onset and progression are still elusive, thus requiring intense research effort. In this context, the development of models recapitulating the etiopathology of IBD is critical.Methods: Colon from C57BL/6 or BALB/c mice were cultivated in a gut-ex-vivo system (GEVS), exposed 5h to DNBS 1,5 or 2,5 mg/ml, and the main hallmarkers of IBD were evaluated.Results: Gene expression analysis revealed a DNBS-induced: i) compromised Tight junction organization, responsible for tissue permeability dysregulation; induction of ER stress, and iii) tissue inflammation in colon of C57BL/6 mice. Moreover, the concomitant DNBS-induced apoptosis and ferroptosis pathways was evident in colon from both BALB/c and C57BL/6 mice.Conclusions: Overall, we have provided results demonstrating that GEVS is a consistent, reliable, and cost-effective system for modeling DNBS-induced IBD, useful for studying the onset and progression of human disease at the molecular level, while also reducing animal suffering.

Redox balance is increasingly identified as a major player in cellular signaling. A fundamentally simple reaction of oxidation and reduction of cysteine residues in cellular proteins is the central concept in this complex mode of protein function regulation. Oxidation of key cysteine residues occurs at the physiological levels of reactive oxygen species (ROS) but are reduced by a supply of thiol antioxidant molecules including glutathione, glutaredoxin and thioredoxin. While these molecules show complex compensatory roles in experimental conditions, transgenic animal models provide a comprehensive picture to pinpoint the role of each antioxidant. In this review we have specifically focused on the available literature on Thioredoxin-1 system transgenic models that includes Thioredoxin and Thioredoxin reductase proteins. As identification of Thioredoxin protein targets is technically challenging the true contribution of this system in maintaining cellular balance remains unidentified, including the role of this system in the brain.

This study investigated the effects of silibinin, derived from milk thistle (Silybum marianum), on lipopolysaccharide (LPS)-induced morphological changes in mouse macrophages. Silibinin was treated at various doses and time points to assess its effects on macrophage activation including morphological changes and phagocytosis. Silibinin effectively inhibited LPS-induced pseudopodia formation and size increase, while unstimulated cells remained round. Silibinin's impact on phagocytosis was dose- and time-dependent, showing a decrease. We explored its mechanism of action on kinases using a MAPK array. Among the three MAPK family members tested, silibinin had a limited effect on JNK and p38 but significantly inhibited ERK1/2 and related RSK1/2. Silibinin also inhibited MKK6, AKT3, MSK2, p70S6K, and GSK-3β. These findings highlight silibinin's potent inhibitory effects on phagocytosis and morphological changes in macrophages. We suggest its potential as an anti-inflammatory agent due to its ability to target key inflammatory pathways involving ERK1/2 and related kinases. Overall, this study demonstrates the promising therapeutic properties of silibinin in modulating macrophage function and inflammation.

The circadian clock regulates daily changes in behavioral, endocrine and metabolic activities in mammals. Circadian rhythms in cellular physiology are significantly affected by aging. In particular, we previously found that aging has profound impact on daily rhythms in mitochondrial functions, leading to increased oxidative stress. However, this is unlikely due to malfunction of molecular clocks in the suprachiasmatic nucleus or peripheral tissues, as robust clock oscillations are observed therein in old animals. Nonetheless, aging induces changes in gene expression levels and rhythms in various peripheral and probably central tissues. In this article, we review findings on the roles of the circadian clock and aging in regulating mitochondrial rhythms and redox homeostasis. Chronic sterile inflammation is implicated in mitochondrial dysfunction and increased oxidative stress during aging. In particular, upregulation of CD38 by inflammatory response can disturb mitochondrial functions in multiple ways.

There is evidence that spaceflight poses acute and late risks on the central nervous system. To explore possible mechanisms, the proteomic changes following spaceflight in mouse brain were characterized. Space Shuttle Atlantis (STS-135) was launched at the Kennedy Space Center on a 13-day mission. Within 3–5 hours after landing, brain tissue was collected to evaluate protein expression profiles using quantitative proteomic analysis. Our results showed that there were 26 proteins that were significantly altered after spaceflight in the grey and/or white matter. While there was no overlap between the white and grey matter in terms of individual proteins, there was overlap in terms of function, synaptic plasticity, vesical activity, protein/organelle transport, and metabolism. Our data demonstrate that exposure to the spaceflight environment induces significant changes in protein expression related to neuronal structure and metabolic function. This might lead to a significant impact on brain structural and functional integrity that could affect the outcome of space missions.

Aggregation of the protein α-Synuclein (αSyn) is a hallmark of Parkinson's disease (PD), dementia with Lewy bodies (DLB) and multiple systems atrophy, and alleviating the extent of αSyn pathology is an attractive strategy against neurodegeneration. The engineered binding protein β-wrapin AS69 binds monomeric αSyn. AS69 reduces primary and secondary nucleation as well as fibril elongation in vitro. It also mitigates aSyn pathology in a mouse model based on intrastriatal injection of aSyn pre-formed fibrils (PFF). Since the PFF-based model does not represent all aspects of PD, we tested here whether AS69 can reduce neurodegeneration resulting from αSyn overexpression. Human A53T-αSyn was overexpressed in the mouse Substantia nigra (SN) by using recombinant adeno-associated viral vector (rAAV). AS69 was also expressed by rAAV transduction. Behavioral tests and immunofluorescence stainings were used as outcomes.Transduction with rAAV-αSyn resulted in αSyn pathology as reported by phospho-αSyn staining and caused degeneration of dopaminergic neurons in the SN. The co-expression of rAAV-AS69 did not reduce αSyn pathology or degeneration of dopaminergic neurons. We conclude that αSyn monomer binding by rAAV-AS69 was insufficient to protect from aSyn pathology resulting from αSyn overexpression.

1) Background: Impeded resolution of inflammation contributes substantially to the pathogenesis of Alzheimer's disease (AD); consequently, resolving inflammation is pivotal to the amelioration of AD pathology. This can potentially be achieved by the treatment with specialized pro-resolving lipid mediators (SPMs), which should resolve neuroinflammation in brains. 2) Methods: Here, we report the effects of long-term treatment with a SPM, maresin like 1 (MarL1), on AD pathogenesis in a transgenic 5xFAD mouse model. 3) Results: MarL1 treatment reduced Aβ overload, curbed the loss of neurons in brains especially cholinergic neurons associated with cleaved-caspase-3-associated apoptotic degeneration, reduced astrogliosis and microgliosis and the pro-inflammatory M1 polarization of microglia, curbed the AD-associated decline in an-ti-inflammatory Iba1+Arg-1+-M2 microglia, reduced astrogliosis-associated level of neuroin-flammatory TNF-α, inhibited phenotype switching of pro-inflammatory neurotoxic A1 astrocytes and N1 neutrophils, promoted polarization of inflammation-resolving neuroprotective A2 as-trocytes, promoted the blood–brain-barrier-associated tight-junction protein claudin-5 and de-creased neutrophil leakage in 5xFAD brains, and induced the switch of neutrophils toward the inflammation-resolving N2 phenotype. 4) Conclusion: Long-term administration of MarL1 mit-igates AD-related neuropathogenesis in brains by curbing neuroinflammation and neurodegen-eration. These findings provided the preclinical leads and mechanistic insights for the develop-ment of MarL1 into an effective modality to ameliorate AD pathogenesis.

Obesity is a global health concern. Recent research has suggested that the development of anti-obesity ingredients and functional foods should focus on natural products without side effects. We investigated the anti-obesity efficacy and mechanisms of action of Brassica juncea extract (BJE) using in vitro and in vivo obesity models. In in vitro experiments, BJE treatment downregulated adipogenic-related proteins CCAAT/enhancer-binding protein-α (C/EBP-α), peroxisome proliferator-activated receptor-γ (PPAR-γ), adipocyte protein 2 (aP2), and lipid synthesis-related protein acetyl-CoA carboxylase (ACC). It also upregulated the heat generation protein peroxisome proliferator-activated receptor gamma coactivator-1α (PGC-1α) and fatty acid oxidation protein carnitine palmitoyltransferase-1 (CPT-1). Oral administration of BJE decreased body weight, alleviated liver damage, and inhibited lipid accumulation in high-fat diet (HFD)-induced obese mice. Inhibition of lipid accumulation by BJE in vivo was associated with decreased expression of adipogenic and lipid synthesis proteins and increased expression of heat generation and fatty acid oxidation proteins. BJE administration improved obesity by decreasing adipogenesis and activating heat generation and fatty acid oxidation in 3T3-L1 cells and in HFD-induced obese C57BL/6J mice. These findings indicate that BJE is a promising natural means of preventing obesity-related metabolic diseases.

The mouse visual system recently became the most popular model to study the cellular and circuit mechanisms of sensory processing. However, the importance of eye movements in mice only started to be appreciated recently. Eye movements provide a basis for active sensing and deliver insights into various brain functions and dysfunctions. A plethora of knowledge on the central control of eye movements and their role in perception and behaviour arose from work on primates. However, an overview of the known eye movement types in mice and a comparison to primates is missing.Here, we review the eye movement types described to date in mice and compare them to those observed in primates. We discuss the central neuronal mechanisms for their generation and control. Furthermore, we review the mounting literature on eye movements in mice during head-fixed and freely moving behaviours. Finally, we highlight gaps in our understanding and suggest future directions for research.

Traumatic brain injury (TBI) can result in persistent sensorimotor and cognitive deficits, which occur through a cascade of deleterious pathophysiological events over time. In this study, we investigated the hypothesis that neurodegeneration caused by TBI leads to impairments in sensorimotor function. TBI induces the activation of the caspase-3 enzyme, which triggers cell apoptosis in an in vivo model of fluid percussion injury (FPI). We analyzed caspase-3 mediated apoptosis by TUNEL staining and PARP and annexin V western blotting. We correlated the neurodegeneration with sensorimotor deficits by conducting the animal behavioral tests including grid walk, balance beam, inverted screen test, and climb test. Our study demonstrated that the excess cell death or neurodegeneration correlated with the neuronal dysfunction and sensorimotor impairments associated with TBI.

As humans age, aberrancies in several signaling pathways occur. In the aging population, some patients display abnormal bone morphogenetic protein (BMP) signaling. This can lead to osteoporosis (OP), a debilitating bone disorder caused by an imbalance between osteoblasts and osteoclasts. In 2002, the Food and Drug Administration (FDA) approved usage of recombinant human BMP-2 (rhBMP-2) during spinal fusion surgery as it is crucial for bone formation. However, complications have been reported with rhBMP-2 and primary osteoblasts isolated from OP patients are unresponsive to BMP-2. While patient samples are available, previous medical history may alter results. Therefore, C57BL/6 mice, an aging model that displays aberrant BMP-signaling, can be utilized to investigate OP and aging. We show that BMP receptor type Ia (BMPRIa) is upregulated in the bone marrow stromal cells (BMSCs) of 15-month mice similar to previous data. We show that a conjugation between BMP-2 and Quantum Dots (QDot®s) effectively binds to BMPRIa and can investigate BMP-2 activity. After incubating BMSCs with methyl-β-cyclodextrin (MβCD), BMP-signaling is restored in 15-month mice as shown by western blotting and the von Kossa assay. MβCD may be used to rescue BMPRIa and the BMP-signaling pathway can be utilized by future therapeutics to treat OP.

Background: Hurricanes and other wind events are significant disturbances that affect coastal urban forests around the world. Past research has led to the creation of wind resistance ratings for different tree species which can be used in urban forest management efforts to mitigate the effects of these storms. While useful, these ratings have been limited to species common to one global region (Florida, USA).Methods: Drawing on past ratings and data from a global literature review on tropical storm research, we created a machine learning model to broaden both the geographic coverage and the variety of species currently assessed for their resistance to wind.Results: We were able to assign wind resistance ratings to 281 new species based on the available data and our modelling efforts. The model accuracy and agreement with the original ratings when applied to the testing data set was high with 91% accuracy.Conclusions: The resulting list of wind resistance ratings has been adapted into a spreadsheet-based decision aid for managers, allowing them to assess the overall susceptibility of their urban forest to wind events like hurricanes.

Rats, including those of the Sprague Dawley strain, may kill mice. Because of this muridical behavior, it is standard practice in many research animal housing facilities to separate mice from rats (i.e., the predators) to minimize stress for the mice. We therefore tested the effect of cohousing on the stress levels of mice from either the C57BL/6J (BL6) or the CD1 strain and Sprague Dawley (SD rat) by determining their fecal corticosterone or cortisol metabolites (FCM) concentration and investigated how cohousing impacts a behavioral assay, i.e., conditioned place preference for intragenus (i.e., mouse-mouse or rat-rat) dyadic social interaction (DSI CPP) that had been shown be sensitive to social factors, especially to handling by humans. We found that the two delivery batches of BL6 mice or SD rats, respectively, had different stress levels at delivery that were statistically significant for the BL6 mice. Even so, the BL6 mice cohoused with rats had significantly increased FCM concentrations, indicative of higher stress levels, as compared to (1) BL6 mice housed alone or (2) BL6 mice at delivery. In contrast to their elevated stress levels, the attractiveness for contextual cues associated with mouse-mouse social interaction (DSI CPP) even increased in rat-cohoused BL6 mice, albeit nonsignificantly. Thus, cohousing BL6 mice and rats did not impair a behavioral assay in BL6 mice that had proved to be sensitive to handling stress by humans in our laboratory. SD rats cohoused with BL6- or CD1 mice and CD1 mice cohoused with SD rats showed DSI CPP that was not different from our previously published data on SD rats and BL6 mice of the Jackson- or NIH substrain obtained in the absence of cohousing. Our findings suggest that the effect of cohousing rats and mice under the conditions described above on their stress levels as opposed to their behavior might be less clearcut than generally assumed and might be overriden by conditions that cannot be controlled, i.e., different deliveries. Our findings can help to use research animal housing resources, which usually are limited, more efficiently.

The consumption of foods with fiber and phenolic compounds can be part of treating obesity through interaction with the gastrointestinal tract. Treatment with common bean leaves (BL) for obesity was evaluated in mice on a high-fat, high-fructose diet (HFFD). The proximal and phytochemical characterization of BL was determined. Obesity was induced with a HFFD for 14 weeks. Immediately after, the animals were supplemented with BL (10%) or standard diet (SD) as a strategy to seem a healthy diet (12 additional weeks). Changes in body composi-tion, lipid profile, and intestinal integrity were analyzed. BL contained 27.2% dietary fiber, total phenolics (475.04 mg/100 g), and saponins (2.2 mg/100 g). The VAT consumption of the BL group decreased by 52% compared to the HFFD group. Additionally, triglyceride concentrations were 23% lower in the BL consumption group compared to the HFFD group. The improvement in lipid profile was attributed to the (1.77-fold) higher fecal lipid excretion in the BL consumption group compared to the HFFD group. Likewise, pancreatic lipase decreased by 29%. Furthermore, BL supplementation reduced the level of IL-6 (4.4-fold) and FITC-dextran in serum by 50% compared with that in the HFFD group. Metabolic endotoxemia was inhibited after BL supplementation (-33%) compared to the HFFD group. BL consumption as a treatment in obese mice reduces adipose tissue accumulation and improves the lipid profile. Furthermore, we report for the first time that BL consumption improves intestinal integrity.

Malaria comprises a spectrum of disease syndromes and the immune system is a major participant in malarial disease. This is particularly true in relation to the immune responses elicited against blood stages of Plasmodium-parasites that are responsible for the pathogenesis of infection. Mouse models of malaria are commonly used to dissect the immune mechanisms underlying disease. While no one mouse model of Plasmodium infection completely recapitulates all the features of malaria in humans, collectively the existing models are invaluable for defining the events that lead to the immunopathogenesis of malaria. Here we review the different mouse models of Plasmodium infection that are available, and highlight some of the main contributions these models have made with regards to identifying immune mechanisms of parasite control and the immunopathogenesis of malaria.

Sperm DNA integrity and chromatin status serve as pivotal indicators of sperm quality, given their in-tricate link to sperm function, embryo development, and overall fertility. Defects in chromatin com-paction, which are often associated with compromised protamine content, can lead to damaged DNA strands. In this study, chromatin status and possible correlation with DNA damage was assessed in males of three mouse species: Mus musculus, M. spretus and M. spicilegus. We employed various staining methods, including aniline blue, methylene blue (Diff-Quik), toluidine blue and chromomy-cin A3, to assess chromatin compaction in cauda epididymal sperm. Samples were also analyzed by the sperm chromatin structure assay (SCSA) to estimate DNA fragmentation (%tDFI, %HDS). Analyses were carried out on freshly collected sperm and cells incubated for 3 h in a Hepes-buffered modified Tyrode's medium simulating conditions of the female reproductive tract. Notably, the analysis of chromatin status yielded minimal abnormal values across all three species, employing diverse meth-odologies. SCSA analyses revealed distinct variations in %tDFI between species. Following sperm incubation, the percentages of sperm stained with methylene blue exhibited differences among the species and were significantly correlated to the DNA fragmentation index. HDS demonstrated correla-tions with the percentages of sperm stained by aniline blue, methylene blue and chromomycin A3. Overall, chromatin compaction was high across all species, with limited differences among them. The relationship between chromatin status and DNA integrity appeared to be related to levels of sperm competition among species.

Aging is a major risk factor for Alzheimer's disease (AD). AD mouse models are frequently used to assess pathology, behavior, and memory in AD research. While the pathological characteristics of AD are well established, our understanding of the changes in the metabolic phenotypes with age and pathology is limited. In this work, we used the Promethion cage systems® to monitor changes in physiological metabolic and behavioral parameters with age and pathology in wild-type and 5xFAD mouse models. Then, we assessed whether these parameters could be altered by treatment with oleocanthal, a phenolic compound with neuroprotective properties. Findings demonstrated metabolic parameters such as body weight, food and water intake, energy expenditure, dehydration, and respiratory exchange rate, and the behavioral parameters of sleep patterns and anxiety-like behavior are altered by age and pathology. However, the effect of pathology on these parameters was significantly greater than normal aging, which could be linked to amyloid-β deposition and blood-brain barrier (BBB) disruption. In addition, and for the first time, our findings suggest an inverse correlation between sleep hours and BBB breakdown. Treatment with oleocanthal improved the assessed parameters and reduced anxiety-like behavior symptoms and sleep disturbances. In conclusion, aging and AD are associated with metabolism and behavior changes, with the changes being greater with the latter, which were rectified by oleocanthal. In addition, our findings suggest that monitoring changes in metabolic and behavioral phenotypes could provide a valuable tool to assess disease severity and treatment efficacy in AD mouse models.

Gamma-aminobutyric acid (GABA) and glycine act as inhibitory neurotransmitters. Three types of inhibitory neurons and terminals, GABAergic, GABA/glycine co-releasing, and glycinergic, are orchestrated in the spinal cord neural circuits and play key roles in the regulation of pain, locomotive movement, and respiratory rhythms. Herein, we first describe GABAergic and glycinergic transmission and inhibitory networks, which consist of three types of terminals, in the mature mouse spinal cord. Second, we describe the developmental formation of GABAergic and glycinergic networks, with specific focus on the differentiation of neurons, formation of synapses, maturation of removal systems, and changes in their action. GABAergic and glycinergic neurons are derived from the same domains of the ventricular zone. Initially, GABAergic neurons are differentiated and their axons form synapses. Some of these neurons remain GABAergic in lamina I and II. Many of GABAergic neurons convert to co-releasing state. The co-releasing neurons and terminals remain in the dorsal horn, whereas many of co-releasing ones ultimately become glycinergic in the ventral horn. During the development of terminals and the transformation from radial glia to astrocytes, GABA and glycine receptor subunit compositions markedly change, removal systems mature, and GABAergic and glycinergic action shifts from excitatory to inhibitory.

As symbionts of fungi and algae, lichens produce a variety of secondary products which pharmacological activities. This study aimed to investigate the anti-inflammatory activities of Heterodermia hypoleuca and its main compound, atraric acid. The results confirmed that atraric acid could regulating induced pro-inflammatory cytokine, nitric oxide, induced nitric oxide synthase and cyclooxygenase-2 expression by lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Means while, atraric acid down-regulated expression of phosphorylated IκB, ERK and nuclear factor kappa B (NFκB) signaling pathway to exhibit anti-inflammatory effects in LPS-stimulated RAW264.7 cells. Based on these results, the anti-inflammatory effect of atraric acid during LPS-induced endotoxin shock in a mouse model was confirmed. In the atraric acid treated-group, cytokine production was decreased in the peritoneum and serum, and each organ damaged by LPS-stimulation was recovered. These results show that atraric acid has an anti-inflammatory effect and its molecular mechanism may be involved in the inactivation of the ERK/NFκB signaling pathway, demonstrating its value as a potential therapeutic for inflammatory diseases.

The severest form of muscular dystrophy (MD) termed Duchenne MD (DMD) remains to this day an incurable disease, hence the continued effort to further develop supportive therapies. Perturbation of autophagy, a degradative yet protective mechanism activated when tissues face severe and persistent stress, is critically involved in DMD, consequently, treatments harnessing autophagic capacities represent an amenable therapeutic strategy. We studied the effects of the protective osmolyte ectoine in the standard mouse model of DMD, the MDX, zooming in on the autophagy-related proteome. From birth, mice were treated with ectoine in the drinking water (150mg/kg) or through daily intraperitoneal injection (177mg/kg) until 5 weeks old. Hind limb muscles were dissected, performing western blotting for protein quantification and immunofluorescence to investigate tissue distribution. We report significant alterations of total levels of autophagy related 5 (ATG5), Ser366 phosphorylated sequestosome 1 (SQSTM1) and heat shock protein 70 (HSP70), and of activated microtubule-associated protein 1A/1B-light chain 3 (LC3 II) in mitochondrial fractions. Ectoine tends to restore the shifted balance between LC3 II and SQSTM1 levels observed in MDX muscle, and LC3 II upregulation was most pronounced on muscle fibers of MDX treated with ectoine in the drinking water. Findings from this explorative study support a possible beneficial effect of ectoine on the autophagic deficit in the MDX, which warrants its further exploration as a therapeutic supplement for DMD.

Excretory-secretory products (ESPs) are the main research targets for investigating the hosts and helminths interaction. Parasitic worms can migrate to parasitic sites and avoid the host immune response by secreting this product. Angiostrongylus cantonensisis an important food-borne zoonotic parasite that causes severe neuropathological damage and symptoms, including eosinophilic meningitis or meningoencephalitis in humans. Benzaldehydes are organic compounds composed of a benzene ring and formyl substituents. This compound has anti-inflammatory and antioxidation properties. Previous studies showed that 3-hydroxybenzaldehyde (3-HBA) and 4-hydroxybenzaldehyde (4-HBA) can reduce apoptosis in A. cantonensis ESPs treated astrocytes. These results on the protective effect underlying benzaldehyde have primarily focused on cell survival. The study was designed to investigate the molecular mechanisms of endoplasmic reticulum stress (ER stress) and oxidative stress in astrocytes in A. cantonensis ESPs treated astrocytes and to evaluate the therapeutic consequent of 3-HBA and 4-HBA. First, we initially established the RNA-seq dataset in each group, including Normal, ESPs, ESPs+3-HBA, and ESPs+4-HBA. We also found that benzaldehyde (3-HBA and 4-HBA) can stimulate astrocytes to express ER stress-related molecules after ESP treatment. The level of oxidative stress could also be decreased in astrocytes by elevating antioxidant activity and reducing ROS generation. These results suggested that benzaldehyde may be a potential therapeutic compound for human angiostrongyliasis to support brain cell survival by inducing the expression levels of ER stress- and oxidative stress-related pathway.

Volatile compounds, abundant in breath, can be used to accurately diagnose and monitor a range of medical conditions. This offers a non-invasive, low-cost approach with screening applications; however, uptake of this diagnostic approach has been limited by conflicting published outcomes. Most published reports rely on large scale screening of the public, at single time points and without reference to ambient air. Here, we present a novel approach to volatile sampling from cellular headspace and mouse breath that incorporates multi-time point analysis and ambient air subtraction revealing compound flux as an effective proxy of active metabolism. This approach to investigating breath volatiles offers a new avenue for disease biomarker discovery and diagnosis. Using gas chromatography mass spectrometry (GC/MS), we focus on low molecular weight, metabolic substrate/by-product compounds and demonstrate that this non-invasive technique is sensitive (reproducible at ~1 µg cellular protein, or ~500,000 cells) and capable of precisely determining cell type, status and treatment. Isolated cellular models represent components of larger mammalian systems and we show that stress- and pathology-indicative compounds are detectable in mice, supporting further investigation using this methodology as a tool to identify volatile targets in human patients.

Magnetic resonance elastography (MRE) has revealed sexual dimorphism in brain stiffness in healthy individuals and multiple sclerosis (MS) patients. In the animal model of MS, experimental autoimmune encephalomyelitis (EAE), we showed previously that inflammation-induced brain softening was associated with alterations of the extracellular matrix (ECM). However, it remained unclear whether the brain ECM presents sex-specific properties that can be visualized by MRE. Therefore, we aimed here at quantifying sexual dimorphism in brain viscoelasticity in association with ECM changes in healthy and inflamed brains. Multifrequency MRE was applied to the midbrain of healthy and EAE mice of both sexes to quantitatively map regional stiffness. To define differences in brain ECM composition, gene expression of the key basement membrane components laminin (Lama4, Lama5), collagen (Col4a1, Col1a1) and fibronectin (Fn1) was investigated by RT-qPCR. We showed that the healthy male cortex expressed less Lama4, Lama5, Col4a1 but more Fn1 (all p < 0.05) than the healthy female cortex, which was associated with 9% softer properties (p = 0.044) in that region. At peak EAE, cortical softening was similar in both sexes compared to healthy tissue, with an 8% difference remaining between males and females during EAE (p < 0.001). Cortical Lama4, Lama5 and Col4a1 expression increased 2 to 3-fold in EAE in both sexes while Fn1 decreased only in males (all p < 0.05). No significant sex differences in stiffness were detected in other brain regions. In conclusion, sexual dimorphism in the ECM composition of cortical tissue in the mouse brain is reflected by in vivo stiffness measured with MRE and should be considered in future studies by sex-specific reference values.

Chronic Chagas Cardiomyopathy (CCC) results from infection with the protozoan parasite Trypanosoma cruzi and is a prevalent cause of heart disease in endemic countries. We previously found that cardiac fibrosis can vary widely in C3H/HeN mice chronically infected with T. cruzi JR strain, mirroring the spectrum of heart disease in humans. In this study, we examined functional cardiac abnormalities in this host:parasite combination to determine its potential as an experimental model for CCC. We utilized electrocardiography (ECG) to monitor T. cruzi-infected mice and determine whether ECG markers could be correlated with cardiac function abnormalities. We found that the C3H/HeN:JR combination frequently displayed early onset CCC indicators, such as sinus bradycardia and right bundle branch block, as well as prolonged PQ, PR, RR, ST and QT intervals in the acute stage. Our model exhibited high levels of cardiac inflammation and enhanced iNOS expression in the acute stage, but denervation did not appear to have a role in pathology. These results demonstrate the potential of the C3H/HeN:JR host:parasite combination as a model for CCC that could be used for screening new compounds targeted at cardiac remodeling and for examining the potential of anti-parasitic drugs to prevent or alleviate CCC development and progression.

Coxsackievirus B3 (CVB3) is one of the most common pathogens that cause myocarditis in humans. However, a sufficient therapeutic drug was not developed yet. Caboxamycin, a benzoxazole antibiotic, isolated from the culture broth of the marine strain Streptomyces sp., SC0774, displayed an antiviral effect in the CVB3-infected HeLa cells and CVB3-induced myocarditis mouse model. Caboxamycin significantly inhibited CVB3 VP1 production and cleavage of translation factor eIF4G1 from CVB3-infected HeLa cells at a 100 μg/ml concentration. Moreover, virus RNA amplification was dramatically reduced by caboxamycin treatment in HeLa cells. The caboxamycin cardiac protective effect was observed on the CVB3-mediated myocarditis mice model. The caboxamycin-treated mice survival was significantly increased compared to untreated mice (treated vs untreated, 100 vs 45 %). Heart histologic findings showed that myocardium damage and inflammation were significantly decreased by caboxamycin treatment. Caboxamycin directly inhibited caspase3 activity and cardiac myocytes apoptosis. These results suggested that caboxamycin strongly suppressed cardiac myocyte apoptosis and effectively inhibited the proliferation of CVB3 from in vitro and in vivo conditions. Furthermore, this study proposed that caboxamycin could potentially be applied in developing a new antiviral drug for CVB3-induced myocarditis.

CD8+ cytotoxic T lymphocytes (CTLs) play a crucial role in anti-tumor immunity. In a previous study, we identified a subset of murine effector CTLs expressing the hepatocyte growth factor (HGF) receptor c-Met (c-Met+ CTLs) that are endowed with enhanced cytolytic capacity. HGF directly inhibited the cytolytic function of c-Met+ CTLs, both in 2D in vitro assays and in vivo, leading to reduced T cell responses against metastatic melanoma. To further investigate the role of c-Met+ CTLs in a three-dimensional (3D) setting, we studied their function within B16 melanoma spheroids and examined the impact of cell-cell contact on the modulation of inhibitory checkpoint molecules expression such as KLRG1, PD-1 and CTLA-4. Additionally, we evaluated the cytolytic capacity of human CTLs clones expressing c-Met (c-Met+) and compared it to c-Met− CTLs clones. Our results indicated that, similar to their murine counterparts, c-Met+ human CTLs clones exhibited increased cytolytic activity compared to c-Met− CTLs clones, and this enhanced function was negatively regulated by the presence of HGF. Taken together, our findings highlight the potential of targeting the HGF/c-Met pathway to modulate CTL-mediated anti-tumor immunity. This research holds promises for developing strategies to enhance the effectiveness of CTL-based immunotherapies against cancer.

Ferroptosis is a unique variety of non-apoptotic cell death, driven by massive lipid oxidation in an iron-dependent manner. Since Ferroptosis was introduced as a concept in 2012, it was shown it's essential role in the pathogenesis in neurodegenerative diseases and an important role in therapy-resistant cancer cells. Thus, a detailed molecular understanding of both canonical and alternative ferroptosis pathways are required. There is a set of widely used chemical agents to modulate ferroptosis using different pathway targets: Erastin blocks cystine-glutamate antiporter, system xc-; ML210 directly inactivate GPX4; L-buthionine sulfoximine (BSO) inhibits γ-glutamylcysteine synthetase, an essential enzyme for glutathione synthesis de novo. Most studies were focused on lipidomic profiling of model systems undergoing death in a ferroptotic modality.

Miscarriage due to blastocyst implantation failure occurs in up to two-thirds of all miscarriage cases in human. The calcium ion has been shown to be involved in many cellular signal transduction pathways as well as in the regulation of cell adhesion, which is necessary for the embryo implantation process. Exposure to endocrine-disrupting chemicals (EDs) during early gestation results in disruption of intrauterine implantation and uterine reception, leading to implantation failure. In this study, ovarian estrogen (E2), bisphenol A (BPA), or 4-tert-octylphenol (OP), with or without ICI 182,780 (ICI) were injected subcutaneously from gestation day 1 to gestation day 3 post-coitus. The expression levels of the calcium transport genes were assessed in maternal uteri and implantation sites. The number of implantation sites was significantly low in the OP group, and implantation sites were absent in the E2 and EDs+ICI groups. There were different calcium transient transport channel expression levels in uterus and implantation site samples. The levels of TRPV5 and TRPV6 gene expression were significantly increased by EDs with/without ICI treatment in uterus. Whereas, TRPV5 and TRPV6 gene expression were significantly lower in implantation sites samples. NCX1 and PMCA1 mRNA levels were significantly decreased by OP and BPA in the implantation site samples. Compared to vehicle treatment in uterus, both the MUC1 mRNA and protein levels were markedly high in all but the BPA group. Taken together, these results suggest that both BPA and OP can impair embryo implantation through alteration of calcium transport gene expressions and by affecting uterine receptivity.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

CD44 regulates cell adhesion, proliferation, survival, and stemness and has been considered a tumor therapy target. CD44 possesses the shortest CD44 standard (CD44s) and a variety of CD44 variant (CD44v) isoforms. Since the expression of CD44v is restricted in epithelial cells and carcinomas compared to CD44s, CD44v has been considered a promising target for monoclonal antibody (mAb) therapy. We previously developed an anti‐CD44v10 mAb, C44Mab-18 (IgM, kappa) to recognize the variant exon 10-encoded region. In the present study, a mouse IgG2a version of C44Mab-18 (C44Mab-18-mG2a) was generated to evaluate the antitumor activities against CD44-positive cells compared with previously established anti-pan CD44 mAb, C44Mab-46-mG2a. C44Mab-18-mG2a exhibited higher reactivity compared with C44Mab-46-mG2a to CD44v3–10-overexpressed CHO-K1 (CHO/CD44v3–10) and oral squamous cell carcinoma cell lines (HSC-2 and SAS) in flow cytometry. C44Mab-18-mG2a exerted a superior antibody‐dependent cellular cytotoxicity (ADCC) against CD44v3–10. In contrast, C44Mab-46-mG2a showed a superior complement‐dependent cytotoxicity (CDC) against CD44v3–10. A similar tendency was observed in ADCC and CDC against HSC-2 and SAS. Furthermore, administering C44Mab-18-mG2a or C44Mab-46-mG2a significantly suppressed CD44v3–10, HSC-2, and SAS xenograft tumor growth compared with the control mouse IgG2a. These results indicate that C44Mab-18-mG2a could be a promising therapeutic regimen for CD44v10-positive tumors.

Research on microglia in Down syndrome (DS) has shown that microglial activation, increased inflammatory gene expression, and oxidative stress occur at different ages in DS brains. However, most studies resulted in simplistic definitions of microglia as quiescent or active, ignoring potential intermediate states. However, a recent work on microglial cells in young DS brains indicated that those evolve through different intermediate activation phenotypes before reaching a full activated state. Here we used single nucleus RNA sequencing, to examine how trisomy affects microglial states in the Ts65Dn mouse model of DS. Despite no substantial changes in the proportion of glial populations, differential expression analysis revealed cell type-specific gene expression changes, most notably in astroglia, microglia, and oligodendroglia. Focusing on microglia, we identified differential expression of genes associated with different microglial states, including disease-associated microglia (DAMs), activated response microglia (ARMs), and human Alzheimer’s disease microglia (HAMs), in trisomic microglia. Furthermore, pseudotime analysis reveals a unique reactivity profile in Ts65Dn microglia, with fewer in a homeostatic state and more in an intermediate aberrantly reactive state than in euploid microglia. This comprehensive understanding of microglial transcriptional dynamics sheds light on potential pathogenetic mechanisms but also possible avenues for therapy for neurodevelopmental disorders.

A cell-surface ectonucleotidase CD39 mediates the conversion of extracellular ATP into immunosuppressive adenosine with another ectonucleotidase CD73. The elevated adenosine in the tumor microenvironment (TME) attenuates antitumor immunity, which promotes tumor cell immunologic escape and progression. Anti-CD39 monoclonal antibodies (mAbs), which suppress the enzymatic activity, can be applied to antitumor therapy. Therefore, an understanding of the relationship between the inhibitory activity and epitope of mAbs is important. We previously established an anti-mouse CD39 (mCD39) mAb, C₃₉Mab-1 using the Cell-Based Immunization and Screening (CBIS) method. In this study, we determined the critical epitope of C₃₉Mab-1 using flow cytometry. We performed the PA tag (12 amino acids)-substituted analysis (named PA scanning) and RIEDL tag (5 amino acids)-substituted analysis (named RIEDL scanning) to determine the critical epitope of C₃₉Mab-1 using flow cytometry. By the combination of PA scanning and RIEDL scanning, we identified the conformational epitope, spanning three segments of 275^th to 279^th, 282^nd to 291^st, and 306^th to 323^rd amino acids of mCD39. These analyses would contribute to the identification of the conformational epitope of membrane proteins.

Cyclin-dependent kinase-like 5 (CDKL5) deficiency disorder (CDD) is a rare neurodevelopmental disease caused by mutations in the X-linked CDKL5 gene. CDD is characterized by a broad spectrum of clinical manifestations, including early-onset refractory epileptic seizures, intellectual disability, hypotonia, visual disturbances, and autism-like features. The Cdkl5 knockout (KO) mouse recapitulates several features of CDD, including autistic-like behavior, impaired learning and memory, and motor stereotypies. These behavioral alterations are accompanied by diminished neuronal maturation and survival, reduced dendritic branching and spine maturation, and marked microglia activation. There is currently no cure or effective treatment to ameliorate the symptoms of the disease. Aerobic exercise is known to exert multiple beneficial effects in the brain, not only by increasing neurogenesis, but also by improving motor and cognitive tasks. To date, no studies have analyzed the effect of physical exercise on the phenotype of a CDD mouse model. In view of the positive effects of voluntary running on the brain of mouse models of various human neurodevelopmental disorders, we sought to determine whether voluntary daily running, sustained over a month, could improve brain development and behavioral defects in Cdkl5 KO mice. Our study showed that long-term voluntary running improved hyperlocomotion and impulsivity behaviors, and memory performance of Cdkl5 KO mice. This is correlated with increased hippocampal neurogenesis, neuronal survival, spine maturation, and inhibition of microglia activation. These behavioral and structural improvements were associated with increased BDNF levels. Given the positive effects of BDNF on brain development and function, the present findings support the positive benefits of exercise as an adjuvant therapy for CDD.

The vascular endothelium is key target for immune, and thrombotic responses that has to be controlled in successful xenotransplantation. Several genes were identified that if induced or overexpressed help to regulate the inflammatory response and preserve the transplanted organ function and metabolism. However, few studies addressed combined expression of such genes. The aim of this work was to evaluate in vivo the effects of the simultaneous expression of a three human genes in a mouse generated using the multi-cistronic F2A technology. Male 3-month-old mice that express human heme oxygenase 1 (hHO-1), ecto-5’-nucleotidase (hE5NT), and ecto-nucleoside triphosphate diphosphohydrolase 1 (hENTPD1) (Transgenic) were compared to wild-type FVB mice (Control). Background analysis include extracellular nucleotide catabolism enzymes profile on the aortic surface, blood nucleotide concentration and serum L-arginine metabolites. Furthermore, inflammatory stress induced by LPS in transgenic and control mice was used to characterize interleukin 6 (IL-6) and adhesion molecules endothelium permeabil-ity responses. Transgenic mice had significantly higher rates of extracellular adenosine triphosphate and adenosine monophosphate hydrolysis on the aortic surface in comparison to control. Increased levels of blood AMP and adenosine were also noticed in transgenics. Moreover, transgenic ani-mals demonstrated the decrease in serum monomethyl-L-arginine level and a higher L-arginine/ monomethyl-L-arginine ratio. Importantly, significantly decreased serum IL-6, and adhesion mol-ecule levels were observed in transgenic mice in comparison to control after LPS treatment. Fur-thermore, reduced endothelial permeability in the LPS-treated transgenic mice was noted as com-pared to LPS-treated control. The human enzymes (hHO-1, hE5NT, hENTPD1) simultaneously encoded in transgenic mice demonstrated benefits in sev-eral biochemical and functional aspects of endothelium. This is consistent in use of this approach in the context of xenotransplantation.

Non-alcoholic steatohepatitis (NASH), which is the most severe manifestation of non-alcoholic fatty liver disease (NAFLD), has been recognized as a major hepatocellular carcinoma (HCC) catalyst. However, the molecular mechanism of NAFLD-NASH-HCC sequence remains unclear and a specific and effective treatment for NASH has not yet been established. The progress in this field depends on the availability of reliable preclinical models which show the steady progress to NASH, liver cirrhosis, and HCC. However, most of NASH mouse models that have been described to date develop NASH generally for more than 24 weeks and there is an uncertainty of HCC development. To overcome such shortcomings of experimental NASH studies, we established a novel NASH-HCC mouse model with very high reproducibility, generality, and convenience. We treated male C57BL/6J mice with a newly developed choline-deficient and methionine-restricted high-fat diet (CDMRHFD) for 60 weeks. Treatment of CDMRHFD for 3 weeks revealed marked steatosis, lobular inflammation, and fibrosis, histologically diagnosed as NASH. Liver cirrhosis was observed in all mice with 36-week treatment. Liver nodule emerged at 12 weeks of the treatment, and diameter >2 mm liver tumors developed in all mice at 24 weeks of the treatment. In conclusion, our rapidly progressive and highly reproducible NASH-liver cirrhosis-HCC model is helpful for preclinical development and research on the pathogenesis of human NAFLD-NASH-HCC. Our mouse model would be useful for the development of novel chemistry for NASH-HCC-targeted therapies or HCC prevention strategies.

Two putative boar pheromones (Androstenone and Androstenol) were discovered in endangered mouse deer during captive breeding program. This study further examined the molecular characteristics, pheromone synthesis pathway, and the functional role of these pheromones in reproduction of mouse deer. CYP17A1 and CYB5 genes were cloned and expressed in HEK-293, COS-7 cell lines and gonads of mouse deer to investigate CYP17A1 gene’s andien-β-synthase activity towards synthesis of sex pheromones in mouse deer. An enzyme immunoassay was also developed and standardized to measure the fecal androstenone during reproductive cycles of mouse deer. Results showed that mouse deer’s CYP17A1 gene possesses andien-β-synthase activity and could transform pregnenolone into 5,16-androstadien-3β-ol. The expression of CYP17A1 gene upregulated in the testis and ovary, compared to other tissues in mouse deer. Significantly elevated pheromones and estrogens were recorded prior to delivery and postpartum estrus / mating in mouse deer. Further, there were weak correlations between fecal pheromones and estrogens/ androgens in mouse deer during breeding season. The findings suggest that the boar pheromones might play a direct role in the reproductive activities of mouse deer which might be used for breeding of mouse deer elsewhere.

Ketogenic diet (KD) is getting in the focus as auxiliary cancer therapy, since it provides sufficient energy supply for healthy cells, while impairing energy production in tumor cells underlying the Warburg effect. Thereby, it can assist in inhibiting tumor growth and simultaneously counteract cachexia, which is frequently observed in cancer patients under chemotherapy. In order to provide molecular evidence for the proposed synergistic inhibition of tumor growth, we applied untargeted quantitative metabolome analysis on a breast cancer xenograft mouse model. Healthy mice and such bearing breast cancer xenografts and receiving chemotherapy were compared after treatment with control diet and KD. Metabolomic profiling was performed on plasma samples, applying high-performance liquid chromatography coupled to tandem mass spectrometry. Statistical analysis revealed metabolic fingerprints comprising numerous significantly regulated features in the group of mice bearing breast cancer. This fingerprint disappeared after treatment with KD, resulting in recovery to the metabolic status observed in healthy mice receiving control diet. Moreover, amino acid metabolism as well as fatty acid transport were found to be affected by both, the tumor and the applied KD. Our results provide clear evidence of a significant molecular effect of KD in the context of tumor growth inhibition.

Background/Goals: The gut hormone PYY secreted from intestinal L-cells has been implicated in the mechanisms of satiation via Y2-receptor (Y2R) signaling in the brain and periphery and is a major candidate for mediating the beneficial effects of bariatric surgery on appetite and body weight. Methods: Here we assessed the role of Y2R signaling in the response to low- and high-fat diets and its role in the effects of Roux-en-Y gastric bypass (RYGB) surgery on body weight, body composition, food intake, energy expenditure and glucose handling, in global Y2R-deficient (Y2RKO) and wildtype mice made obese on high-fat diet. Results: Both male and female Y2RKO mice responded normally to low- and high-fat diet in terms of body weight, body composition, fasting levels of glucose and insulin, as well as glucose and insulin tolerance for up to 30 weeks of age. Contrary to expectations, obese Y2RKO mice also responded similarly to RYGB compared to WT mice for up to 20 weeks after surgery, with initial hypophagia, sustained body weight loss, and significant improvements in fasting insulin, glucose tolerance, HOMA-IR, and liver weight compared to sham-operated mice. Furthermore, non-surgical Y2RKO mice weight-matched to RYGB showed the same improvements in glycemic control as Y2RKO mice with RYGB that were similar to WT mice. Conclusions: PYY signaling through Y2R is not required for the normal appetite-suppressing and body weight-lowering effects of RYGB in this global knockout mouse model. Potential compensatory adaptations of PYY signaling through other receptor subtypes or other gut satiety hormones such as GLP-1 remain to be investigated.

Leukocyte migration is an essential function of innate and adaptive immune responses. Chemokines and their receptors control the migration system. The abundance of chemokines is controlled by atypical chemokine receptors (ACKRs), chemokine receptor-like molecules that do not couple to the G protein signaling pathways. Among them, ACKR4 regulates dendritic cell migration by controlling the ligands and is involved in tumor development in mouse models. Because no anti-mACKR4 mAb for flow cytometry has been reported, this study aimed to develop a novel monoclonal antibody (mAb) for mouse ACKR4 (mACKR4). Among the established anti-mACKR4 mAbs, A₄Mab-1 (rat IgG_2b, kappa), A₄Mab-2 (rat IgG_2b, kappa), and A₄Mab-3 (rat IgG_2b, kappa) recognized mACKR4-overexpressed Chinese hamster ovary-K1 (CHO/mACKR4) by flow cytometry. The dissociation constant (K_D) values of A₄Mab-1, A₄Mab-2, and A₄Mab-3 for CHO/mACKR4 were determined as 3.5 × 10⁻⁹ M, 6.0 × 10⁻⁹ M, and 1.6 × 10⁻⁹ M, respectively. Furthermore, A₄Mab-1 and A₄Mab-2 could detect mACKR4 by western blotting. These results indicated that A₄Mab-1, A₄Mab-2, and A₄Mab-3 help to detect mACKR4 by flow cytometry and western blotting and obtain the proof of concept in preclinical models.

C-C motif chemokine receptor 1 (CCR1/CD191) is a member of G-protein-coupled receptors, and is expressed on myeloid cells, such as neutrophils and macrophages. Because the CCR1 signaling promotes tumor expansion in the tumor microenvironment (TME), the modification of TME is an effective strategy for cancer therapy. Although CCR1 is an attractive target for solid tumors and hematological malignancies, anti-CCR1 therapeutic agents have not been approved. Here, we established a novel anti-mouse CCR1 (mCCR1) monoclonal antibody (mAb), C₁Mab-6 (rat IgG_2b, kappa), using the Cell-Based Immunization and Screening (CIBS) method. Flow cytometry and Western blot analyses showed that C₁Mab-6 recognizes mCCR1 specifically. The dissociation constant of C₁Mab-6 for mCCR1-overexpressed Chinese hamster ovary-K1 was determined as 3.9×10^-9 M, indicating that C₁Mab-6 possesses a high affinity to mCCR1. These results suggest that C₁Mab-6 could be a useful tool for targeting CCR1 in preclinical mouse models.

The differentiation of ESCs into cardiomyocytes in vitro is an excellent and reliable model system for studying normal cardiomyocyte development in mammals, modeling cardiac diseases, and for use in drug screening. Mouse ESC differentiation still provides relevant biological information about cardiac development. However, the current methods for efficiently differentiating ESCs into cardiomyocytes are limiting. Here, we describe a “WNT Switch” method to efficiently commit mouse ESCs into cardiomyocytes using the small molecule WNT signaling modulators CHIR99021 and XAV939 in vitro. This method significantly improves the yield of beating cardiomyocytes, reduces number of treatments, and is less laborious.

Atherogenic lipoproteins may impair vascular reactivity, leading to tissue damage in various organs, including the eye. This study aimed to investigate whether ophthalmic artery reactivity is affected in mice lacking the apolipoprotein E gene (ApoE-/-), a model for hypercholesterolemia and atherosclerosis. Twelve-month-old male ApoE-/- mice and age-matched wild-type controls were used to assess vascular reactivity using videomicroscopy. Moreover, vascular mechanics, lipid content, levels of reactive oxygen species (ROS), expression of pro-oxidant redox enzymes and of the lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) were determined in vascular tissue. Unlike the aorta, the ophthalmic artery of ApoE-/- mice developed no signs of endothelial dysfunction and no signs of excessive lipid deposition. Remarkably, levels of ROS, nicotinamide adenine dinucleotide phosphate oxidase 1 (NOX1), NOX2, NOX4, and of LOX-1 were increased in the aorta but not in the ophthalmic artery of ApoE-/- mice. Our findings suggest that ApoE-/- mice develop endothelial dysfunction in the aorta by increased oxidative stress via involvement of LOX-1, NOX1 and NOX2, whereas NOX4 may participate in media remodeling. In contrast, the ophthalmic artery appears to be resistant to chronic apolipoprotein E deficiency. Lack of LOX-1 expression/overexpression in response to increased ox-LDL levels may be a possible mechanism of action.

The CC chemokine receptor 3 (CCR3) is a receptor for CC chemokines, including CCL5/RANTES, CCL7/MCP-3, and CCL11/eotaxin. CCR3 is expressed on the surface of eosinophils, basophils, a subset of Th2 lymphocytes, mast cells, and airway epithelial cells. CCR3 and its ligands are involved in airway hyperresponsiveness in allergic asthma, ocular allergy, and cancers. Therefore, CCR3 is an attractive target for those therapies. Previously, anti-mouse CCR3 (mCCR3) monoclonal antibodies (mAbs), C3Mab-3 (rat IgG2a, kappa), and C3Mab-4 (rat IgG2a, kappa) were developed using the Cell-Based Immunization and Screening (CBIS) method. In this study, the binding epitope of these mAbs was investigated using flow cytometry. The CCR3 extracellular domain-substituted mutant analysis showed that C3Mab-3, C3Mab-4, and a commercially available mAb (J073E5) recognized the N-terminal region (amino acids 1–38) of mCCR3. Next, the alanine scanning was conducted in the N-terminal region. The results revealed that Ala2, Phe3, Asn4, and Thr5 of mCCR3 are involved in C3Mab-3 binding, whereas Ala2, Phe3, and Thr5 are essential to C3Mab-4 binding, and Ala2 and Phe3 are crucial to J073E5 binding. These results reveal the involvement of the N-terminus of mCCR3 in the recognition of C3Mab-3, C3Mab-4, and J073E5.

Background: Pre-treatment with lipopolysaccharide (LPS) protected the kidney against a later lethal ischemia. To reveal the mechanisms of renal cross-tolerance and septic acute kidney injury we investigated the effects of LPS on miRNA expression in the kidney. Methods: Male NMRI mice were injected with 40 and 10 mg/kg LPS ip. and sacrificed at 1.5 and 6 hours (early preconditioning, EP) and at 24 and 48 hours (late preconditioning, LP). The miRNA profile was established using miRCURY LNA™ microarray and confirmed with qPCR. Results: Plasma urea concentration peaked at 24 hours after LPS and decreased thereafter. Renal TNF-α and IL-6 mRNA were extremely elevated at all time-points. miRNome changes were mild at 1.5 hours, most miRNAs were altered at 6 and 24 hours and declined by 48 hours. Not all miRNAs could be assayed or validated by qPCR. In EP miR-762 was newly identified and validated and was the most elevated miRNA with both methods. In LP miR-21a-5p was the most influenced miRNA followed by miR-451a, miR-144-3p and miR-146a-5p. MiR-21a-3p increased significantly in both EP and LP. Conclusion: miR-762 might attenuate the LPS-induced immune response during EP and the miR-144/451 cluster is involved in LPS-induced renal preconditioning.

Most human genetic disease arises from point mutations. These genetic diseases can theoretically be corrected by gene therapy but clinic practice is still far from mature. Nearly half of the pathogenic single-nucleotide polymorphisms (SNPs) are caused by G:C>A:T or T:A>C:G base changes. The best current methods to repair these changes are by base editing without footprint using recently developed CRISPR-Cas9 technology by David Liu’s lab. These base editing methods have been confirmed with precision and efficiency in cultured mammalian cells, but it is barely confirmed and the efficiency is still very low. Animal models are important in dissecting pathogenic mechanism for human genetic diseases and efficacy testing of base correction in vivo. Cytidine base editor BE4 is a newly developed version of cytidine base editing system that converts cytidine (C) to uridine (U) in cultured mammalian cells but has not been proven in vivo. In this study, we have tested this system in cells to inactivate GFP gene and in mice by introducing single-base substitution that leads to a stop codon in tyrosinase gene. High percentage albino coat-colored mice were obtained from black coat-colored donor zygotes after pronuclei microinjection. Sequencing results showed that expected base changes were obtained with high precision and efficiency (56.25%). There are no off-targeting events identified in predicted off-target sites. Results confirm BE4 system can work in vivo with high precision and efficacy, and has great potentials in clinic to repair human genetic mutations.

Our study investigated the innate immune response to Toxoplasma gondii infection by assessing microglial phenotypic changes and sickness behavior as inflammatory response markers post-ocular tachyzoite instillation. Disease progression in Swiss albino mice was compared with documented outcomes in BALB/c mice using identical ocular route and parasite burden (2x105 tachyzoites), with saline as control. Contrary to expectations, Swiss albino mice displayed rapid, lethal disease progression, marked by pronounced sickness behaviors and mortality within 11-12 days post-infection, while survivors showed no apparent signs of infection. Comparative analysis revealed T. gondii-infected BALB/c mice exhibited reduced avoidance of feline odors, while in-fected Swiss albino mice showed enhanced avoidance responses. There was a significant increase in microglial cells in the dentate gyrus molecular layer of infected Swiss albino mice compared to BALB/c mice and their respective controls. Hierarchical cluster and discriminant analyses iden-tified three microglial morphological clusters, differentially affected by T. gondii infection across strains. BALB/c mice exhibited increased microglial branching and complexity, while Swiss al-bino mice showed reduced shrunk microglial arbors, diminishing morphological complexity. These findings highlight strain-specific differences in disease progression and inflammatory reg-ulation, indicating lineage-specific mechanisms in inflammatory responses, tolerance, and re-sistance. These elements are critical in devising control measures for toxoplasmosis.

Background: Cardiac development is a complex developmental process. The early cardiac straight tube is composed of an external myocardial layer and an internal endocardial lining. Soon after rightward looping, the embryonic heart becomes externally covered by a new epithelial lining, the embryonic epicardium. A subset of these embryonic epicardial cells migrate and colonize the embryonic myocardium, contributing to distinct cell types. In recent years, our understanding of the molecular mechanisms that govern proepicardium and embryonic epicardium formation has greatly increased. We have recently witnessed a novel layer of complexity governing gene regulation with the discovery of non-coding RNAs. Our laboratory recently identified three distinct lncRNAs, adjacent to the Wt1, Bmp4 and Fgf8 chicken gene loci, with enhanced expression in the proepicardium that are distinctly regulated by Bmp, Fgf and thymosin 4, providing support of their plausible implication in epicardial formation. Methods: Expression of lncRNAs was analyzed in different chicken and mouse tissues as well as their subcellular distribution in chicken proepicardial, epicardial, ventricle explants and in different murine cardiac cell types. lncRNA transcriptional regulation was analyzed by using siRNAs and expression vectors of different transcription factors in chicken and mouse. Antisense oligonucleotides were used to inhibit Gm14014 expression. Cardiac injury was induced ex vivo in mouse ventricle explants by cryoinjury. Furthermore, RT-qPCR, immunocytochemistry, RNA pulldown, Western blot, viability and cell migration assays were conducted to investigate the biological function of Wt1_76127 and Gm14014. Results: We demonstrated that Wt1_76127 in chicken and its evolutionarily conserved homologue Gm14014 in mice are widely distributed in different embryonic and adult tissues and distinctly regulated by cardiac enriched transcription factors, particularly Mef2c and Nkx2.5. Gm14014 is distinctly regulated in mouse ventricular cryoinjury ex vivo models, displaying a negative correlation with epicardial and epithelial to mesenchymal transition markers. Furthermore, silencing assays demonstrated that mouse Gm14014, but not chicken Wt1_76127, is essential for epicardial, but not endocardial or myocardial cell migration. Such process is governed by partnering with Myl9, promoting cytoskeletal remodeling. Conclusion: Our data evidence that Gm14014 plays a pivotal role in epicardial cell migration essential for heart regeneration.

Important tumor biomarkers, therapeutic targets, and mechanisms of tumorigenesis were discovered in animal models. Mouse models of malignant gliomas were represented by transplantable, chemically-induced, and genetically-engineered cells. The aim of the study was to investigate the morphological, molecular, and immunological characteristics of two original glioblastoma (GB) strains, M2 and M6. These are new, chemically-induced, trans-plantable tissue models of malignant diffuse mouse glioma. Tissues from M2 GB and M6 GB were transplanted into immunocompetent C57BL/6 mice. The clinical manifestations of M2 GB and M6 GB growth in mice include motility disorders, cachexia, and priapism. Morphologically, M2 GB and M6 GB are characterized by diffuse proliferation, cellular and nuclear polymorphism, high mitotic activity, and pathological forms of mitosis due to the aggressive nature of these tumors. Flow cytometry showed that CD3+ T lymphocytes (~32%) and F4/80+ macrophages (~28-50%) highly infiltrated both tumors. M2 GB had higher levels of F4/80+ macrophages than M6 GB. Cdkn2a, S100b, Mki67, Pten, Vegfa, Hif1a, Sox2, Abcb1, and Gfap genes were overexpressed in both tumors. Cd133, Tp53, and Pdgfra expression was increased in M2 GB. High expression of Pi3k and Gdnf was observed in M6 GB. Expression of Cd44, Pi3k, Hif1a, Gdnf and Egfr was higher in the M6 GB tissues com-pared to M2 GB, while Cdkn2a, Tp53, Cd133 and Pdgfra were higher in the M2 GB tissue compared to M6 GB. The transplantable M2 GB and M6 GB tissue models have intratumor immune responses, clinical and morphological features similar to human GB, as well as gene expression patterns that are important for further studies on tumorigenesis. These models can be used to develop diagnostic and therapeutic procedures and study carcino-genesis.

Abstract: This study aimed at investigating the effects of Valencia KK4-type peanut skin ethanolic extract (KK4-PSE) in combination with cisplatin or 5-fluorouracil (5-FU) against HeLa cells in vitro and in xenograft models. MTT assay showed that KK4-PSE, cisplatin, and 5-FU suppressed proliferation of HeLa cells in a dose and time dependent manner. Drug interactions by Chou-Talalay method demonstrated that KK4-PSE enhanced antiproliferative activity of 5-FU against HeLa cells with combination index (CI) values of 0.49 (48 h) and 0.60 (72 h), indicating a synergistic effect, while KK4-PSE combined with cisplatin exhibited an additive effect (CI = 1.02) (72 h) and antagonistic effect at 24 and 48 h exposures (CI = 1.12 and 1.18, respectively). In nude mouse xenograft models, the combination of 5-FU and KK4-PSE markedly reduced HeLa tumor weights compared with control and single agent treatments. The combination of KK4-PSE and 5-FU achieved greater tumor growth inhibition than that of the KK4-PSE-cisplatin combination. KK4-PSE mitigated hepatotoxicity induced by both cisplatin and 5-FU in nude mice. The spleen hyaloserositis was significantly reduced in the combination treatment of 5-FU and KK4-PSE. These findings suggest a potential of KK4-PSE to inhibit cervical cancer cell growth while alleviating the toxicities of cisplatin and 5-FU.

The effect of aqueous extracts of the biomass of the adult Ulomoides dermestoides beetle on the delayed effects of the defoliant paraquat causing parkinsonism in experimental mice was evaluated. The motor activity of the animals was analyzed in behavioral tests using a rotarod and a vertical pole. The number of tyrosine hydroxylase-immunopositive neurons in the ventral part of the substantia nigra of the midbrains of experimental and control mice was studied by immunohistochemistry. In the model in vitro system with SH-SY5Y human neuroblastoma, the effect of the extracts on cell proliferation was examined in the absence and presence of the neurotoxin MPP⁺. The isolation of biologically active substances from raw biomass using cavitation effects made it possible to obtain extracts with protective properties in the model of an early stage of Parkinson's disease used in this study.

USP21, a member of the ubiquitin protease family, plays a vital role in various biological functions. However, the effects of USP21 dysfunction have yet to be fully understood. Here, we generated Usp21 knockout (KO) mice and conducted microarray to identify genes that Usp21 regulates. Its results raised several genes based on their biological characteristics, and RT-qPCR confirmed their expression. KO mice exhibited significant elevations in the expression of the genes Fabp7 and Nlrc5, which play a role in lipid metabolisms, compared to wild-type mice. Blood tests showed no impairment of liver function but did reveal elevated levels of total cholesterol and free fatty acids in KO mice compared to wild-type mice. These data suggest that Usp21 may play roles in lipid metabolism associated with Fabp7 and Nlrc5. To clarify the involvement of USP21 in human hypercholesterolemia, we examined single nucleotide polymorphisms (SNPs) around USP21 in non-hypercholesterolemic and hypercholesterolemic outpatients. We found that the rs11421 SNP downstream of USP21 was associated with hypercholesterolemia. These data suggest that USP21 plays a role in mice and human lipid metabolism and that its polymorphism may be a diagnostic marker for human hypercholesterolemia.

Caseinolytic peptidase P (CLPP) plays a central role in mitochondrial unfolded protein response (mtUPR) by promoting the breakdown of misfolded proteins and setting in motion a cascade of reactions to re-establish protein homeostasis. Global germline deletion of Clpp in mice results in female infertility and accelerated follicular depletion. Telomeres, on the other hand, are tandem repeats of 5’-TTAGGG-3’ sequences found at the ends of the chromosomes. Telomeres are essential for maintaining chromosome stability during somatic cell division and their shortening is associated with cellular senescence and aging. In this study, we asked whether the infertility and ovarian aging phenotype caused by global germline deletion of Clpp is associated with somatic aging, and tested telomere length in tissues of young and aging mice. We found that impaired mtUPR caused by the lack of CLPP is associated with accelerated telomere shortening in both oocytes and somatic cells of aging mice. In addition, expression of several genes that maintain telomere integrity were decreased, and double strand DNA breaks were increased in telomeric regions. Our results highlight how impaired mtUPR can affect telomere integrity and demonstrate a link between loss of mitochondrial protein hemostasis, infertility, and somatic aging.

Gossypol is a complex plant polyphenol reported to be cytotoxic and anti-inflammatory, but little was known about its effect on gene expression in macrophages. The objective was to explore gossypol’s toxicity and its effect on gene expression involved in inflammatory responses, glucose transport and insulin signaling pathway in mouse macrophages. Mouse RAW264.7 macrophages were treated with multiple concentrations of gossypol for 2-24 h. Gossypol toxicity was estimated by MTT assay and soluble protein content. qPCR analyzed the expression of anti-inflammatory tristetraprolin family (TTP/ZFP36), proinflammatory cytokine, glucose transporter (GLUT) and insulin signaling genes. Cell viability was greatly reduced by gossypol, accompanied with dra-matic reduction of soluble protein content in the cells. Gossypol treatment resulted in an increase of TTP mRNA level 6-20 fold and increased ZFP36L1, ZFP36L2 and ZFP36L3 mRNA levels by 26-69 fold. Gossypol increased proinflammatory cytokine TNF, COX2, GM-CSF, INFγ and IL12b mRNA levels up to 39-458 fold. Gossypol treatment upregulated mRNA levels of GLUT1, GLUT3 and GLUT4 genes as well as INSR, AKT1, PIK3R1 and LEPR but not APP genes. This study demonstrated that gossypol induced macrophage death and reduced soluble protein content that was accom-panied with massive stimulation of anti-inflammatory TTP family and proinflammatory cytokine gene expression as well as elevation of gene expression involved in glucose transport and insulin signaling pathway in mouse macrophages.

Pregnancy is a dynamic state with multiple metabolic changes occurring including insulin resistance. Gestational diabetes mellitus (GDM), a form of diabetes that appears during pregnancy, develops if metabolic aberrations occur, in particular, in normal pregnancy-induced insulin resistance. Multi-omics is a powerful approach for uncovering the mechanisms driving metabolic change in different physiologic and pathologic states. A recent study demonstrated that the gestational gut microbiome mediates pregnancy metabolic adaptations through effects on gut indoleamine-2,3 dioxygenase 1 activity and the production of kynurenine. Using the dataset generated from this highly controlled study, we performed a comprehensive analysis of the pregnancy-specific physiological and metabolic profiles, 16S rRNA microbiome, and plasma untargeted LC-MS metabolome data. To facilitate the utilization of these analysis results by other researchers, we developed MOMMI-MP, a database that provides an easy-to-use platform to browse and search differential abundant microbial taxa and metabolites, and to examine metabolic pathways. The datasets consist of data collected from 3 genetically diverse strains of mice (C57BL/6J, CD1, and NIH-Swiss) over 6 time points during the gestational (days 0, 10, 15, and 19 during gestation) and postpartum (days 3 and 20 after delivery) states, totaling 180 samples for each strain. The computational results are presented in various tables and plots, and organized in MOMMI-MP to empower exploratory analyses by other researchers. In conclusion, MOMMI-MP is a resource to facilitate the investigation of novel mechanisms governing metabolic changes during pregnancy.

The fatty acid elongase ELOngation of Very-Long-chain fatty acids protein 2 (ELOVL2) controls the elongation of polyunsaturated fatty acids (PUFA) producing precursors for omega-3, do-cosahexaenoic acid (DHA), and omega-6, docosapentaenoic acid (DPAn6) in-vivo. Expectedly, Elovl2-ablation drastically reduced the DHA and DPAn6 in liver mitochondrial membranes. Unexpectedly, however, total PUFAs levels decreased further than could be explained by Elovl2 ablation. The lipid peroxidation process was not involved in PUFAs reduction since malondial-dehyde-lysine (MDAL) and other oxidative stress biomarkers were not enhanced. The content of mitochondrial respiratory chain proteins remained unchanged. Still, membrane remodeling was associated with high voltage-dependent anion channel (VDAC) and adenine nucleotide trans-locase 2 (ANT2), a possible reflection of the increased demand on phospholipid transport to the mitochondria. Mitochondrial function was impaired despite preserved content of the respiratory chain proteins and the absence of oxidative damage. Oligomycin-insensitive oxygen consumption increased, and coefficients of respiratory control were reduced by 50%. The mitochondria became very sensitive to fatty acid-induced uncoupling and permeabilization, where ANT2 is involved. Mitochondrial volume and number of peroxisomes increased as revealed by transmission elec-tron microscopy. In conclusion, the results imply that endogenous DHA production is vital for the normal function of mouse liver mitochondria and could be relevant not only for mice but also for human metabolism.

Heat shock proteins (Hsps) are highly conserved molecules that are constitutively expressed and upregulated in response to physiological stress conditions. These immunogenic chaperones can have essential functions in fungi, particularly in dimorphic pathogens. Histoplasma capsulatum and Paracoccidioides species are dimorphic fungi that are the causative agents of histoplasmosis and paracoccidioidomycosis, respectively, which are systemic mycoses with significant rates of morbidity and mortality. Current treatment consists of long-term antifungal agents, and there is an urgent need for new therapeutic approaches with higher efficacy, lower toxicity, better biodistribution and improved selectivity. We engineered an immunoglobulin G1 (IgG1) isotype chimeric mouse-human monoclonal antibody, titled ch-MAb 4E12, from the parental IgG2a MAb 4E12, a monoclonal antibody to H. capsulatum Hsp60 that is protective in experimental histoplasmosis and paracoccidioidomycosis models elicited by H. capsulatum var. capsulatum and Paracoccidioides lutzii, respectively. The ch-MAb 4E12 increased phagolysosomal fusion and enhanced the yeasts uptake by PMA differentiated human THP1 macrophage cells in vitro. At low concentrations, the chimeric antibody significantly reduced the pulmonary and splenic fungal burden compared to an irrelevant antibody or no treatment. These results are the first to show that a chimeric mouse-human antibody can modify infection caused by dimorphic fungi.

Multidrug resistance protein 4 (MRP4) is an energy-dependent membrane transporter that is responsible for cellular efflux of a broad range of xenobiotics and physiological substrates. In this trial, we aimed to investigate the co-effects of aging and MRP4 deficiency using gene expression microarray and morphological and electrophysiological analyses of the mouse retina. Mrp4-knockout (null) mice and wild-type (WT) mice were reared in the same condition to 8–12 wk (young) or 45–55 wk (aged). Microarray analysis identified 186 differently expressed genes from the retinas of aged Mrp4-null mice as compared to that from aged WT mice, and subsequence gene ontology and KEGG pathway analyses showed that differently expressed genes were related to lens, eye development, vision, and transcellular barrier function that are involved in metabolic pathways or viral infection pathways. No significant change in thickness was observed for each retinal layer among young/aged WT mice and young/aged Mrp4-null mice. Moreover, immunohistochemical analyses of retinal cell type did not exhibit an overt change in the cellular morphology or distribution among the 4 age/genotype groups, and the electroretinogram responses showed no significant differences in the amplitude or the latency between aged WT mice and aged Mrp4-null mice. Aging would be an insufficient stress to cause some damage to the retina in the presence of MRP4 deficiency.

Background: Brain oxidative lipid damage and inflammation are common in neurodegenerative diseases such as Alzheimer’s disease (AD). Paraoxonase-1 and 3 (PON1 and PON3) protein expression have been described in tissues with no PON1 and PON3 gene expression. In the present study, we aimed to examine differences in PON1 and PON3 protein expression in the brain of a mouse model of AD. Methods: We used peroxidase-based and fluorescence-based immunohistochemistry in 5 brain regions (olfactory bulb, forebrain, posterior midbrain, hindbrain and cerebellum) of transgenic (Tg2576) mice with the Swedish mutation (KM670/671NL) responsible for a familial form of AD and corresponding wild-type mice. Results: We found intense PON1 and PON3 positive staining in star-shaped cells surrounding Aβ plaques in all Tg2576 mouse brain regions studied. Although we could not co-localize PON1 and PON3 with astrocytes, brain star-shaped cells, we found some co-localization of PON3 with microglia. Conclusions: These results suggest that 1) PON1 and PON3 cross the blood-brain barrier in discoidal HDLs and are transferred to specific brain cell types, and 2) PON1 and PON3 play an important role in preventing oxidative stress and lipid peroxidation in particular cell types, likely astrocytes and microglia, in AD pathology, and potentially in other neurodegenerative diseases

Therapeutic hypothermia (TH) has emerged as a promising approach with neuroprotective effects that can mitigate secondary brain damage and intracranial pressure in the acute phase after successful mechanical thrombectomy. However, the effect of TH on cognitive impairment has yet fully elucidated. In the present study, we demonstrated whether TH can improve cognitive impairment in a transient middle cerebral artery occlusion (tMCAO) mouse model Nine-week-old C57BL/6N mice (male) were randomized to three groups: sham, tMCAO, and tMCAO with TH. One month after model induction, cognitive function test and regional cerebral glucose metabolism were evaluated using the Y-maze test and positron emission tomography with fluorine-18 fluorodeoxyglucose, respectively. tMCAO led to cognitive impairment, which was improved by TH. The cerebral glucose metabolism of the thalamus was significantly recovered in the TH group compared to that in the tMCAO group. These results suggest that TH might have potential as a therapeutic strategy for improving the ischemia/reperfusion-induced cognitive impairment.

The C-X-C motif chemokine receptor-1 (CXCR1) is a rhodopsin-like G-protein-coupled receptor, expressed on the cell surface of immune cells and tumors. CXCR1 interacts with some C-X-C chemokines, such as CXCL6, CXCL7, and CXCL8/interleukin-8, which are produced by various cells. Since CXCR1 is involved in several diseases including tumors and diabetes mellitus, drugs targeting CXCR1 has been developed. Therefore, the development of sensitive monoclonal antibodies (mAbs) for CXCR1 has been desired for the diagnosis and treatment. This study established a novel anti-mouse CXCR1 (mCXCR1) mAb; Cx₁Mab-1 (rat IgG₁, kappa), using the Cell-Based Immunization and Screening (CBIS) method. Cx₁Mab-1 reacted with mCXCR1-overexpressed Chinese hamster ovary-K1 (CHO/mCXCR1) and mCXCR1-overexpressed LN229 glioblastoma (LN229/mCXCR1) in flow cytometry. Cx₁Mab-1 demonstrated a high binding affinity for CHO/mCXCR1 and LN229/mCXCR1 with a dissociation constant of 2.6×10^-9 M and 2.1×10^-8 M, respectively. Furthermore, Cx₁Mab-1 could detect mCXCR1 by western blot analysis. These results indicated that Cx₁Mab-1 is useful for detecting mCXCR1, and provides a possibility for targeting mCXCR1-expressing cells in vivo experiments.

C-X-C motif chemokine receptor 3 (CXCR3, CD183) is a G-protein-coupled receptor for CXCL9, CXCL10, and CXCL11. CXCR3 signaling induces chemotaxis of immune cells to inflammation sites and promotes inflammation in inflammatory diseases. Various mouse models to mimic the pathogenesis of each disease have been developed to understand mechanisms and evaluate therapeutics for these diseases. Although CXCR3 is an attractive target to suppress inflammation, anti-CXCR3 therapeutic agents have not been approved. In this study, we established a novel anti-mouse CXCR3 (mCXCR3) monoclonal antibody, Cx₃Mab-4 (rat IgG₁, kappa), using the Cell-Based Immunization and Screening method. Flow cytometric analysis demonstrated that Cx₃Mab-4 bound to mCXCR3-overexpressed Chinese hamster ovary-K1 (CHO/mCXCR3) cells, but did not react to parental CHO-K1 cells. The dissociation constant of Cx₃Mab-4 was determined as 1.3 × 10^-9 M, indicating that Cx₃Mab-4 possesses a high affinity to mCXCR3-expressing cells. Cx₃Mab-4 could be useful for targeting CXCR3-expressing cells in preclinical mouse models.