Because it can make exact double-strand breaks in DNA, CRISPR-Cas9 can help almost every species and type of cell. It is a powerful way to change the DNA code. CRISPR-Cas9 can be used for a lot more than just changing genes. We are close to being able to do high-throughput gene screening, epigenome editing, in-vivo cell tagging, and RNA change. With the help of CRISPR-Cas9, the function of genes can be studied better, and more realistic disease models can be made. The revolutionary new discipline of gene editing has the potential to profoundly impact healthcare and the life sciences. By simplifying the process of creating double-strand breaks in the DNA of almost any species or kind of cell, CRISPR-Cas9 has revolutionized gene editing. Numerous applications have been found for the CRISPR-Cas9 system. High-throughput gene screening, RNA modification, live-cell chromosome marking, and epigenome editing are all examples. CRISPR-Cas9 facilitates gene research, leading to the development of CRISPR-based disease models. CRISPR-Cas9-based methods of altering the genome will aid researchers in learning more about sickness and discovering better ways to cure it, despite the fact that there are still many questions and large difficulties to answer.

Scientists can use the Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) protein 9 system, which is a powerful and flexible tool for changing the genome, to change only certain parts of the genome. This has helped researchers figure out how target genes work in biology and disease. CRISPR/Cas9 is made up of a sequence-specific CRISPR RNA (crRNA) set and a generic Cas9 nuclease. The crRNA set tells Cas9 where to cut DNA and cause double-strand breaks. In the next step of cellular DNA repair, insertions, deletions, and swaps are made at specific spots. For CRISPR/Cas9-mediated DNA cleavage to be specific, the target sequences must match the crRNA, and a protospacer nearby motif must be placed after the target sequences. In this article, we talk about how CRISPR/Cas9 works at the molecular level, what it can be used for, what it can't do, and what its future clinical treatment promise might be.

Genetic engineering in the field for designing crop improvement has become an essential element in responding to the increasing need for food safety, environmental sustainability, and climate-resilient crops. The latest molecular technology is used by many breeders today to achieve remarkable results. Fast genome editing is currently being seen in a variety of organisms, including plants, because to the high specificity, high effectiveness, and low production cost of CRISPR/Cas [Clustered regulatory interspaced short palindromic repeat (CRISPR)-associated protein (Cas)] technology. Its applications in developing higher-yielding, nutrition rich, disease resistance, stress-tolerant crops fruits, and vegetables. Therefore, this technology has the potential to revolutionize agriculture and contribute to global food security. The Cas protein provides the enzymatic machinery necessary for the acquisition of new cells that target invasion elements. Cas proteins such as Cas9, Cas12, Cas13, and Cas14, among others, have distinct architectures and have been used to create new genetic tools that improve features that are important for agriculture. The versatility of Cas has accelerated genomic analysis and facilitated the use of CRISPR/Cas to manipulate and alter nucleic acid sequences in cells of different organisms. This review provides the evolution of CRISPR technology exploring its mechanisms and contrasting it with traditional breeding and transgenic approaches to improve different stress tolerance. We will also discuss the CRISPR/Cas system and explore the workings of the three Cas proteins that are currently known to exist: Cas12, Cas13, and Cas14. The edited crops by this technology do not have foreign DNA inserted into their genome, therefore, they are considered as non-transgenic by the regulatory bodies in most countries.

CRISPR-Cas allows us to introduce desired genome editing, including mutations, epitopes, and deletions with unprecedented efficiency. The development of CRISPR-Cas has progressed to such an extent that it is now applicable in various fields with the help of model organisms. C. elegans is one of the pioneering animals in which numerous CRISPR-Cas strategies have been rapidly es-tablished over the past decade. Ironically, the emergence of numerous methods makes the right choice of method difficult. Choosing an appropriate selection or screening approach is the first step in planning a genome modification. This report summarizes the key features and applications of CRISPR-Cas methods using C. elegans and illustrates key strategies. Our overview of significant advances in CRISPR-Cas will help readers to understand current advances in genome editing and navigate various methods of CRISPR-Cas genome editing.

In "genome editing," a type of genetic engineering, DNA is added, taken away, or changed in an organism's genome. Biomedicine, biotechnology, and synthetic biology, just to name a few, have all gained a lot from how often this method is used. Before the editing process can start, a Double-Strand Breaks (DSB) must be made in the DNA at a specific gene. Researchers have made nucleases, which are sometimes called "molecular scissors," to fix this DSB. Transcription activator-like effector nucleases (TALENs), Zinc-finger nucleases (ZFNs), and homing endonucleases are all examples of protein targets that have been studied and changed. The last part gave an overview of these study projects and explained how to make Cas12a for specific uses. The applications of Cas12a have been extensively studied in recent years, but the protein still holds a lot of promise as a treatment and screening tool. In order to give a quick review of CRISPR-Cas12a and its uses, we will briefly talk about the structure and function of the different parts of the reaction pathway that lead up to the catalysis of the target DNA. Cas12a uses a multistep process to make sure that it is selecting the right DNA. This is a good trait for a device that changes the DNA because it makes it less likely that something bad will happen. Even though data shows that a new CRISPR RNAs (crRNA) molecule can stop Cas12a from randomly destroying ssDNA, it may still hurt the host cell while trying to change the genome. The action of Cas12a catalysis, which is a powerful tool for changing the genome, needs to be changed so that it can be more easily controlled and managed. Using what we know about how Cas12a works, we have made mutants that are less active on ssDNA and more active on dsDNA. So far, only Cas9 and Cas12a, which are both part of the CRISPR family, have been used to change the genome. Because of how similar and different these two endonucleases are, CRISPR can now be used for multiple scientific purposes. Cas12a is better than Cas9 because it makes double-strand breaks (DSBs) that favor Homology-Directed Repair (HDR) over Non-homologous end joining (NHEJ) and can change more than one copy of the genome at the same time. Both Cas9 and Cas12a are being changed to make them better at detecting Protospacer Adjacent Motif (PAM) than they are in their natural state. This will make it possible to start focusing on more genes.

Global crop yield and food security are being threatened by phytophagous insects. Innovative methods are required to increase agricultural output while reducing reliance on hazardous synthetic insecticides. It appears to be quite effective at reducing production costs and boosting farm profitability to use the ground-breaking CRISPR-Cas technology to create plants that are insect resistant. In contrast, this new technique can modify an insect's genome to either produce gene drive or get beyond an insect's tolerance to various insecticides. This paper reviews and critically discusses the use of CRISPR-Cas genome editing technology in long-term insect pest management. The emphasis of this review is on the prospective uses of the CRISPR-Cas system for insect stress management in crop production by creating genome-edited crops and insects. The potential and difficulties of using CRISPR-Cas technology to reduce pest stress in crop plants are critically examined and discussed.

In this work we looked for a stable and accurate procedure to perform feature selection in datasets with a much higher number of predictors than individuals, as in Genome-Wide Association Studies. Due to the instability in feature selection when many potential predictors are measured, a variable selection procedure is proposed that combines several replications of shrinkage regression models. A weighted formulation is used to define the final predictors. The procedure is applied to investigate Single Nucleotide Polymorphisms (SNPs) predictors associated to Alzheimer’s disease in the Alzheimer’s disease Neuroimaging Initiative (ADNI) dataset. Two data scenarios are investigated: one considering only the set of SNPs and another with the covariates age, sex, educational level and APOE4 genotype. The SNP rs2075650 and the APOE4 genotype are given as risk factors for AD, which is in line with the literature, and other four new SNPs are pointed, opening new hypotheses for in vivo analyses. These experiments demonstrate the potential of the new method for stable feature selection.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.

With the rapid population growth, there is an urgent need for innovative crop improvement approaches to meet the increasing demand for food. Classical crop improvement approaches involve, however, a backbreaking process that cannot equipoise with increasing crop demand. RNA based approaches i.e. RNAi-mediated gene regulation and site-specific nuclease based CRISPR/Cas9 system for gene editing has made advances in the efficient targeted modification in many crops for the higher yield and resistance to diseases and different stresses. In functional genomics, RNA interference (RNAi) is a propitious gene regulatory approach that plays a significant role in crop improvement by permitting down-regulation of gene expression by small molecules of interfering RNA without affecting the expression of other genes. Gene editing technologies viz. clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein (CRISPR/Cas) have appeared prominently as a powerful tool for precise targeted modification of nearly all crops genome sequence to generate variation and accelerate breeding efforts. In this regard, the review highlights the diverse roles and applications of RNAi and CRISPR/Cas9 system as powerful technologies to improve agronomically important plants to enhance crop yields and increase tolerance to environmental stress (biotic or abiotic). Ultimately, these technologies can prove to be important in view of global food security and sustainable agriculture.

Fruit production is an important part of the gross domestic product for many countries around the world especially to those who have a strong focus on agriculture. However, long-term maintenance and yield stability of fruit production may be threatened by the ongoing climate change and its consequences like extended drought periods, heavy rain events, and floodings. Genome editing, with its progressive technological developments, offers opportunities to adapt relevant fruit plant species to new climatic conditions. Among modern genome editing techniques, CRISPR/Cas, in particular, has the potential to support breeding for those fruit plant species with extended breeding cycles, e.g., perennial fruits. In this review, we discuss CRISPR/Cas and other genome editing techniques in detail and how these techniques can be applied to support the breeding of fruit plant species for adaptation to changing climates. The chronological history of CRISPR/Cas9 systems, their associated computational tools, genomic data sources, transformation methods along with their delivery vehicles, quality improvement, environmental-stress resiliency, limitations, and future perspectives will also be discussed with respect to securing future global fruit production.

Gene editing is now easy to make new disease models through in-vivo and in vitro tests. It can potentially be used to make animals with single-gene or multiple-gene changes. The mutant strains with changed germlines are no longer needed with in vivo gene editing, which uses the CRISPR-Cas9 system to target cells of interest in their normal tissues. Whereas, the AAVs and other viral vectors have made it possible to change cells selectively. Gene editing hade made it possible to use human induced pluripotent stem cells (iPSC) to model diseases that run in families. Researchers can compare and contrast the human genomes of many different ethnic and racial groups using this method. Scientists may be able to make a disease in a lab dish using iPSCs from a patient. Using CRISPR, iPSCs made from patient cells can be fixed if they have certain problems. This shows that gene therapy is possible and shows what happens when cells aren't working right. The fact that CRISPR-Cas9 can change the DNA by just one nucleotide has had a huge effect on biological studies. CRISPR is becoming more and more popular, which shows how useful, easy, and effective it is. With the broad use of CRISPR-based apps, the tool is now used for much more than just changing genes. This method can be used to screen the whole genome, control the translation of genes based on their sequence, and edit several genes at the same time. Scientists can now model diseases in different species and learn more about how genes work because of these advances. Genome-wide association studies and genome-editing tools like CRISPR are giving us a good look at the future of personalized medicine.

Rapid progress in gene editing based on clustered regularly interspaced short palindromic repeats/CRISPR-associated protein (CRISPR/Cas) has revolutionized the study of gene and genome function and genetic disease correction. While numerous genetically modified cellular and animal models have been created to understand biological processes, the clinical application of CRISPR/Cas tools has been impeded by off-targeting and delivery problems. It is generally accepted that the delivery of CRISPR in the form of a ribonucleoprotein complex (RNP) substantially reduces the time of DNA exposure to the effector nuclease, minimizing off-target effects and facilitating clinical usage. This review focuses on CRISPR/Cas RNP delivery with retro/lentiviral particles and exosomes, whose parallel production by cells transfected with viral vectors is underestimated. We critically evaluate specific mechanisms of extracellular particle formation and loading with CRISPR/Cas for each system. Additionally, the details of Cas-nanoparticle entry and uncoating, previously unappreciated in the context of gene editing efficiency, are discussed. Based on existing knowledge about the consequences of intervention in retroviral assembly, entry, or exosome formation, we outline the potential problems with CRISPR/Cas delivery using extracellular nanoparticles and ways to address them.

Apis mellifera, especially weak ones, are highly vulnerable to Carpoglyphus lactis mites, which can rapidly infest and consume stored pollen, leading to weakened colonies and potentially colony collapse. This study aimed to ascertain and investigate the prevalence of this mite in honeybee colonies across 9 provinces in the Republic of Korea (ROK). A total of 615 honeybee colonies were collected, from 66 apiaries during the spring and 58 apiaries during the summer of 2023. A 1,242 bp segment of the the Cytochrome c oxidase subunit 1 (COI) gene was amplified using the polymerase chain reaction method. The detection levels of C. lactis in the honeybees were compared between winter and summer. Based on the COI sequence analysis, the nucleotide sequence similarity of C. lactis mites isolated in the ROK with those from China (NC048990.1) was found to be 99.5%, and with those from the United Kingdom (KY922482.1) was 99.3%. This study is the first report of C. lactis in Korean apiaries. The findings in this study demonstrate a significantly higher detection rate in winter, which is 4.1 times greater than that in summer (p < 0.001). Furthermore, the results underscore the usefulness of molecular diagnostic techniques for detecting C. lactis mites.

The advent of CRISPR/Cas9 technology has revolutionized genome editing, enabling the attainment of once-unimaginable goals. CRISPR/Cas's groundbreaking attributes lie in its simplicity, versatility, universality, and its independence from customized DNA-protein systems, erasing the need for specialized expertise and broadening its scope of applications. Beyond its editing prowess, the discovery of novel Cas-based systems has spawned an array of additional biotechnological tools, empowering both fundamental and applied research. Researchers have harnessed CRISPR/Cas for gene regulation, deepening insights into gene expression and epigenetic changes. Precisely targeting DNA or RNA sequences, CRISPR/Cas effectively identifies and counters pathogens. Furthermore, it aids in genome imaging and sequencing, revealing genome spatial organization and chromatin dynamics. The non-editing applications of CRISPR/Cas exhibit tremendous potential across diverse domains, including diagnostics, biotechnology, and fundamental research. This article reviews and critically evaluates the primary CRISPR/Cas-based tools developed for plants and animals, underlining their transformative impact.

CRISPR/Cas9-based gene therapy has gotten a lot of interest during last decade. This treatment protocol tries to fix disease-causing traits by changing the DNA code in the exact spot on the chromosome. Therefore, we have tried to elaborate the most current information that shows how well CRISPR/Cas9-based gene therapy works. In vivo methods, like the ones described in the next two lines, are used to study cells in live creatures, like babies that are growing or animals that are already grown up. It has also been suggested to use ex-vivo methods to change somatic stem cells or progenitor cells in a culture outside of the body before putting them back into the patient. CRISPR/Cas is a good way to change specific genes in the DNA. Clustered Regularly Interspaced Short Palindromic Repeats is the full name for CRISPR. Biotechnologists can use them to fix DNA instead of the body's natural ways of doing so. This helps physicians in treatment diseases that run in families more successfully. Cas9 is an enzyme that, along with a guide RNA, is part of the CRISPR/Cas system. As this new technology grows quickly, it is replacing normal medical processes with treatments that are more cutting-edge and can change people's lives. CRISPR-Cas technology has changed biology by making it possible to change genes quickly. CRISPR molecular tools (Cas9 or Cas12a) have a lot of potential, but they are not very useful right now because they depend on the target cell's own DNA repair systems. With or without a template, the body's natural DNA repair processes can fix DNA breaks caused by Cas9 and Cas12a-based technologies. People use these methods a lot, but their effectiveness ranges from cell type to cell type. HDR-mediated DNA repair is a part of cell division, so tools that target it don't work on cells that don't divide, like neurons. CRISPR-associated transposase (CAST) has recently been studied, which suggests that it may offer new ways to change genes with CRISPR. The CRISPR activator of type V-K that is part of CAST has the same structure as the transposase. This is because CRISPR systems can put DNA in the right place without the help of the cell's own DNA repair systems. But a lot of work is being done right now to improve Cas9 and Cas12a so that DNA can be put into a target gene more precisely. Experts are still working hard to come up with better and more reliable ways to change genes, so even though there may be a problem, both methods have useful uses.

CRISPR-Cas9 technology allows the modification of DNA sequences in vivo at the location of interest. Although CRISPR-Cas9 can produce genomic changes that do not require DNA vector carriers, the use of transgenesis for stable integration of DNA coding for gene-editing tools into plant genomes is still the most used approach and it can generate unintended transgenic integrations, while Cas9 prolonged expression can increase cleavage at off-target sites. In addition, the selection of genetically modified cells from millions of treated cells, especially plant cells, is still challenging. These downfalls can be avoided with the delivery of preassembled ribonucleoprotein complexes (RNPs) composed of purified recombinant enzyme Cas9 and in vitro- transcribed guide RNA (gRNA) molecules in a protoplast system. We therefore aimed to develop the first DNA-free protocol for gene-editing in maize and introduced RNPs into their protoplasts with PEG 4000. We performed effective transformation of maize protoplasts using different gRNAs sequences targeting the inositol phosphate kinase gene and applying two different exposure times to RNPs. Using low-cost Sanger sequencing protocol, we observed an efficiency rate of 0.85 up to 5.85%, which is equivalent to DNA-free protocols used in other plant species. A positive correlation was displayed between exposure time and mutation frequency. Mutation frequency was gRNA sequence- and exposure time-dependent. In summary, we demonstrated the suitability of RNP transfection as an effective screening platform for gene-editing in maize. This efficient and relatively easy assay method for selection of gRNA suitable for editing of gene of interest will be highly useful for genome editing in maize, since genome size and GC-content are large and high in maize genome, respectively. Nevertheless, the large amplitude of mutations at target site requires scrutiny when checking mutations at off-target sites and potential safety concerns.

Plant cells' ability to withstand abiotic stress is strongly linked to modifications in their mechanical characteristics. Nevertheless, the lack of a workable method for consistently tracking plant cell mechanical properties severely restricts our comprehension of the mechanical alterations in plant cells under stress. With Polyethylene Glycol (PEG6000), we created a drought-like environment, and we used the Double Resonator Piezoelectric Cytometry (DRPC) method to dynamically and non-invasively track changes in the stress (ΔS) created and viscoelasticity (storage modulus G' and loss modulus G") of protoplasts and suspension cells of rice during drought stress. The findings demonstrate that, rice suspension cells and protoplasts react mechanically differently to 5%–15% PEG6000 stress, implying distinct resistance mechanisms. However, neither of them can withstand 25% PEG6000 stress, they respond mechanically similarly to 25% PEG6000 stress. The results of DRPC are further corroborated by the morphological alterations of rice cells and protoplasts observed under an optical microscope. To sum up, the DRPC technique functions as a precise cellular mechanical sensor and offers novel research tools for the evaluation of plant cell adversity and differentiating between the mechanical reactions of cells and protoplasts under abiotic stress.

The methods used to introduce CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas-mediated genome editing into fruit species, as well as the impacts of the application of this technology to activate and knock out of target genes in different fruit trees species including tree development, yield, fruit quality, and tolerance to biotic and abiotic stresses have been firstly described in this review. The application of this gene editing technology could allow the development of new generations of fruit crops with improved traits by targeting different genetic segments or even could facilitate the introduction of traits in elite cultivars without changing other traits. However, at this moment, the scarcity of efficient regeneration and transformation protocols in some species, the fact that many of those procedures are the genotype-dependent or the convenience of segregating the transgenic parts of the CRISPR system represent the main handicaps limiting the potential of genetic editing techniques for fruit trees. Finally, latest news on the legislation and regulations about the use of plants modified through CRISPR/Cas systems has been also discussed.

Adaptive T cell immunotherapy holds great promise for the successful treatment of leukemia as well as other types of cancers. More recently, it was also shown to be an effective treatment option for chronic virus infections in immunosuppressed patients. Autologous or allogeneic T cells used for immunotherapy are usually genetically modified to express novel T cell or chimeric antigen receptors. The production of such cells was significantly simplified with the CRISPR/Cas system allowing deletion or insertion of novel genes at specific locations within the genome. In this review, we describe recent methodological breakthroughs important for the conduction of these genetic modifications, summarize crucial points to be considered when conducting such experiments, and highlight the potential pitfalls of these approaches.

Duchenne muscular dystrophy (DMD) is a fatal X-linked recessive neuromuscular disorder most commonly caused by mutations disrupting the reading frame of the dystrophin (DMD) gene. DMD codes for dystrophin, which is critical for maintaining the integrity of muscle cell membranes. Without dystrophin, muscle cells receive heightened mechanical stress, becoming more susceptible to damage. An active body of research continues to explore therapeutic treatments for DMD as well as to further our understanding of the disease. These efforts rely on having reliable animal models that accurately recapitulate disease presentation in humans. While current animal models of DMD have served this purpose quite well, each comes with their own limitations. To help overcome this, clustered regularly interspaced short palindromic repeats (CRISPR)-based technology has been extremely useful in creating novel animal models for DMD. This review focuses on animal models developed for DMD that have been created using CRISPR, their advantages and disadvantages as well as their applications in the DMD field.

The growing population meet the challenge for agricultural production. CRISPR/Cas9 technology is based on plant research for the development of the new varieties as well as disease resistance crops. In addition the deletion of significant characters makes the new alleles from the CRISPR/Cas9. Recent and reliable molecular scissor for genetic engineering. The review is focused on the various application of the CRISPR/Cas9 technology in plant enhancement of plant disease resistance, stress burden in plant, nutritional improvement, and quality of crops from the CRISPR/Cas9 system. The clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein9 (cas9) is adopted from the prokaryotic type II system. CRISPR/Cas9 is simplicity and efficiency than ZENs and TALENs for the genome engineering. Due to rapid growing of the CRISPR/Cas9 system has been formulate the adaptation of many plant species. The current advancement of plants and future schemes of improve of CRISPR technology has been presented in contest of multiplex editing, knowledge on induced mutation whether the factor effect in CRISPR/Cas9 technology in plant. Remarkable perspective and challenges of CRISPR/Cas9 technology in significance of plant genetic modification.

Wheat gluten contains epitopes that trigger celiac disease (CD). A life-long strict gluten-free diet is the only treatment accepted for CD. However, very low-gluten wheat may provide an alternative treatment to CD. Conventional plant breeding methods are not sufficient to produce celiac-safe wheat. RNA interference technology, to some extent, succeeded in the development of safer wheat varieties. However, these varieties had multiple challenges in their implementation. Clustered Regularly Interspaced Short Palindromic Repeats-associated nuclease 9 (CRISPR/Cas9) is a versatile gene-editing tool that has the ability to edit the immunogenic gluten genes. So far, only a few studies have applied CRISPR/Cas9 to modify the wheat genome. In this article, we reviewed published literature that applied CRISPR/Cas9 in wheat genome editing to investigate the current status of the CRISPR/Cas9 system to produce a low-immunogenic wheat variety. We found that in recent years, the CRISPR/Cas9 system has been continuously improved to edit the complex hexaploid wheat genome. Although some reduced immunogenic wheat varieties have been reported, CRISPR/Cas9 has still not been fully explored in editing the wheat genome. We conclude that further studies are required to apply the CRISPR/Cas9 gene-editing system efficiently for the development of celiac-safe wheat variety and to establish it as a “tool to celiac safe wheat.”

Clustered regularly interspaced short palindromic repeats or CRISPR, one of the major technological tools from nature's toolbox, has revolutionized the scientific world with its potential use in humans and plants. CRISPR Cas9 was first known as an adaptive immune system of bacteria. It is a system that cleaves foreign DNA. It has been exploited to be used as a genome editing tool for correcting genetic diseases in humans, for plants to create stress-resistant plants, and for a variety of different purposes. This review provides a basic overview of its applications in different areas of biological research. It has immense potential for a variety of researches, but it's still a mystery for science. It feels like scientists just know a tip of an iceberg.

Dielectric elastomers, such as thermoplastic polyurethanes (TPU), are widely used as dielectric layer, emulation layer and substrate of flexible and stretchable devices. To construct capacitors and actuators that work stably upon deformation, it has become an urgent need to investigate the evolution of dielectricity under stress and strain. However, the lack of effective methods for estimating the dielectric constant of elastomers under strain poses a big challenge. This article reports a device for in-situ measuring the dielectric constant of TPU under strain. It is found that upon stretching TPU to a strain of 400%, its dielectric constant decreases from 8.47 to 2.94. In addition, combined Fourier-transform infrared spectroscopy, X-ray scattering technique, and atomic force microscopy have been utilized to characterize the evolution of microstructure under strain. The investigation under tensile strain reveals that a decreased density and average size of polarized hard domains, along with a tendency of the molecular chains to align in parallel with the tensile stress. The evolution of the microstructures results in a reduction of the dielectric constant parallel to the electric field in TPU. Our work provides valuable experimental reference for improving the stability of flexible sensors and actuators based on dielectric elastomers.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

Crop breeding is an important global strategy to meet sustainable food demand. CRISPR-Cas is a most promising gene-editing technology for rapid and precise generation of novel germplasm, and leads to revolutionary crop breeding innovation. In this review, we summarize recent advance of CRISPR/Cas technology in gene function analyses and generation of new germplasms with increased yield, improved product quality, and enhanced resistance to biotic and abiotic stress. We highlight their applications and breakthroughs in agriculture including crop de novo domestication, decoupling the gene pleiotropy tradeoff, crop hybrid seed conventional production, hybrid rice asexual reproduction, and double haploid breeding. Moreover, the challenges and development of CRISPR/Cas technology in crops are also discussed.

The accumulation of brown algae from the genus Sargassum has been increasing over the years in coastal regions of the Caribbean, Africa, Brazil, and Mexico. This causes harmful effects to the ecosystem, health, economy, and climate due to gas emissions from its decomposition process. There is the possibility of this biomass being reused in civil construction, and few studies have been carried out on its application to common Portland cement mortar. As such, the objective of this study is to evaluate the potential of sargassum ash as a mineral addition to partial replacement of fine aggregates in Portland cement mortar. Characterizations of the raw materials were carried out through X-ray fluorescence spectroscopy, loss on ignition, particle size distribution, Brunauer–Emmett–Teller (BET), real density, X-ray diffraction, scanning electron microscopy, and dispersion spectroscopy of electrons. The mortars were prepared by partially replacing the fine aggregate (sand) with sargassum ash, at 0%, 5%, 10% and 20%. Mortar performance was evaluated through water absorption, apparent porosity, apparent specific mass, compressive strength after 7, 28, and 63 days after curing. Lastly, a life cycle assessment in accordance with ISO standards 14040:2006 and 14044:2006. The results showed that replacing sand with sargassum ash increases water absorption, apparent porosity, and decreases the apparent specific mass and compressive strength as replacement increases. Nevertheless, the compressive strength results after 63 days, for 5 and 10% replacement did not differ statistically from reference values. The life cycle assessment indicates that mortars with partial replacement of sand by sargassum ash showed positive environmental impacts when compared to reference values for most categories regardless of the scenario analyzed, especially for mortar with 10% replacement. As such, the use of sargassum ash at 10% does not alter compressive strength values after 63 days while reducing its environmental impact. The application of this biomass in civil construction materials provides a destination for this algae that has been causing several social, environmental, and economic problems.

Abiotic stresses, including drought, salinity, cold, heat, and heavy metals, extensively reduce global agricultural production. Approaches such as conventional breeding and transgenic breeding have been widely used to cope with these environmental stresses. The clustered regularly interspaced short palindromic repeat- Cas (CRISPR/Cas) based gene-editing tool has revolutionized due to its simplicity, accessibility, adaptability, flexibility, and wide applicability. This system has a great potential to build up crop varieties with enhanced tolerance against abiotic stresses. In this review, we summarize the most recent findings on understanding the mechanism of abiotic stress response in plants and the application of CRISPR/Cas mediated gene-editing system towards enhanced tolerance to drought, salinity, cold, heat, and heavy metals stresses. Furthermore, in this review, we highlighted the recent advancements in prime editing and base editing tools for crop improvement.

Infectious diseases are a global health problem affecting billions of people. Developing rapid and sensitive diagnostic tools is key for successful patient management and curbing disease spread. Currently available diagnostics are very specific and sensitive but time-consuming and require expensive laboratory settings and well-trained personnel; thus, they are not available in resource-limited areas, for the purposes of large-scale screenings and in case of outbreaks and epidemics. Developing new, rapid, and affordable point-of-care diagnostic assays is urgently needed. This review focuses on CRISPR-based technologies and their perspectives to become platforms for point-of-care nucleic acid detection methods and as deployable diagnostic platforms that could help to identify and curb outbreaks and emerging epidemics. We describe the mechanisms and function of different classes and types of CRISPR-Cas systems, including pros and cons for developing molecular diagnostic tests and applications of each type to detect a wide range of infectious agents. Many Cas proteins (Cas9, Cas12, Cas13, Cas14) have been leveraged to create highly accurate and sensitive diagnostic tools combined with technologies of signal amplification and fluorescent, potentiometric, colorimetric, or lateral flow assay detection. In particular, the most advanced platforms -- SHERLOCK/v2, DETECTR, or CRISPR-Chip -- enable detection of attomolar amounts of pathogenic nucleic acids with specificity comparable to that of PCR but with minimal technical settings. Further developing CRISPR-based diagnostic tools promises to dramatically transform molecular diagnostics, making them easily affordable and accessible virtually anywhere in the world. The burden of socially significant diseases, frequent outbreaks, recent epidemics (MERS, SARS and the ongoing coronoviral nCov-2019 infection) urgently need the developing of express-diagnostic tools. Recently devised CRISPR-technologies represent the unprecedented opportunity to reshape epidemiological surveillance and molecular diagnostics.

The aim of this research work is to study the influence of temperature, solar irradiation and wind dust on the production of solar energy. In addition, it aims to study the assessment of water quality, in particular groundwater used for cooling and cleaning photovoltaic panels (quality analysis). it's an important source, stable and sustainable can be used entirely for cooling and cleaning PV modules from the sales dust, in order to improve their performance. To date, all research studies carried out in this context of cooling and cleaning using water have not taken account of the nature of this water. We have taken a sample of water from a well in a rural area in the Darra Tafilalet region of Morocco. This region has an arid and semi-arid climate, with very high temperatures and dust-laden winds, particularly in summer. These meteorological characteristics influence the efficiency of cells, particularly photovoltaic (PV) panels, reducing their performance. Next, the water sample was analysed in the laboratory. The results obtained show that the groundwater in this area is very sensitive to cooling and cleaning photovoltaic panels. Moreover, these results indicate that the temperature, solar irradiation and wind-blown dust have a significant influence on energy production.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Herein, we present the design technique of a resonant rectifier for piezoelectric (PE) energy harvesting. We propose two diode equivalents to reduce the voltage drop in the rectifier operation, a minuscule-drop-diode equivalent (MDDE) and a low-drop-diode equivalent (LDDE). The diode equivalents are embedded in resonant rectifier integrated circuits (ICs), which use symmetric bias-flip to reduce the power wasted for charging and discharging the internal capacitance of a PE transducer. The self-startup function is supported by synchronously generating control pulses for the bias-flip from the PE transducer. Two resonant rectifier ICs, using both MDDE and LDDE, are fabricated in a 0.18 μm CMOS process and their performances are characterized under external and self-power conditions. Under the external-power condition, the rectifier using LDDE delivers an output power POUT of 564 μW and a rectifier output voltage VRECT of 3.36 V with a power conversion efficiency (PCE) of 90.1%. Under self-power conditions, the rectifier using MDDE delivers a POUT of 288 μW and a VRECT of 2.4 V with a corresponding PCE of 74.6%. The result shows that the power extraction capability of the proposed rectifier is 5.9 and 3.0 times higher than that of a conventional full-bridge rectifier.

The research reported on this paper was aimed at improving the overall efficiency of a PDO certified artisanal cheese production process. Being a PDO certified foodstuff by the EU, it is considered to have properties and qualities determined by the geographical environment in which is made, with its production taking place in a specific and determined geographical location, in this case the Serra da Estrela region. In that sense, the authors conducted a mapping according to a systemic perspective of the processes involved in the context of manufacturing and distribution of certified Serra da Estrela cheese. Numerous methods were used throughout the process, such as a systemic design analysis, and techniques derived from ethnographic methods, which led to the collection of data in the field and consequently provided the immersion of the researcher in genuine work situations. Critical points were identified and emphasized in the systemic map with the purpose of encouraging initiatives to address and overcome the gaps and inefficiencies detected. The systemic design analysis triggered the development of design work. Observations following an ethnographic approach identified ergonomic risks in cheese making during the process of cutting excess chips, fostering the emergence of musculoskeletal disorders at the wrist. A tool that fits best to the task at hand was developed. A prototype of the new tool enabled collecting feedback from use in the work context, in order to inform product development. The domains of agricultural production and microbiology, considering the specific microorganisms developed trough the ripening process of the cheese, turned out to be aspects of high importance for the issue under focus, contributing to a broader understanding of the ripening process and its risks, simultaneously improving the efficiency and success of cheese production. If it were not for the systemic analysis, which served as a link between the boundaries of distinct domains such as the risk of microorganism contamination, ergonomics, energy efficiency, legislation and regulation policies, transportation challenges and economic viability, approached throughout the research. Simultaneously creating bridges between them, the various problems might not have been detected in the first place, as they are usually addressed in specialized disciplines, predetermined by the restrictions of each specific area of knowledge. As a consequence of the development of this research, which was based on an analysis that sought to establish possible connections between various disciplines and tried to constantly maintain a holistic perspective, making new connections and observing the issues from a new angle, apart from the already established methodologies. All this allowed to lay out the seeds for the development of a plan to tackle the critical points identified by the systemic analysis reported in this paper.

Global population is predicted to approach 10 billion by 2050, an increase of over 2 billion from today. To meet the demands of growing, geographically and socio-economically diversified nations, we need to diversity and expand agricultural production. This expansion of agricultural productivity will need to occur under increasing biotic, and environmental constraints driven by climate change. Clustered regularly interspaced short palindromic repeats-site directed nucleases (CRISPR-SDN) and similar genome editing technologies will likely be key enablers to meet future agricultural needs. While the application of CRISPR-Cas9 mediated genome editing has led the way, the use of CRISPR-Cas12a is also increasing significantly for genome engineering of plants. The popularity of the CRISPR-Cas12a, the type V (class-II) system, is gaining momentum because of its versatility and simplified features. These include the use of a small guide RNA devoid of trans-activating crispr RNA (tracrRNA), targeting of T-rich regions of the genome where Cas9 is not suitable for use, RNA processing capability facilitating simpler multiplexing, and its ability to generate double strand breaks (DSB) with staggered ends. Many monocot and dicot species have been successfully edited using this Cas12a system and further research is ongoing to improve its efficiency in plants, including improving the temperature stability of the Cas12a enzyme, identifying new variants of Cas12a or synthetically producing Cas12a with flexible PAM sequences. In this review we provide a comparative survey of CRISPR-Cas12a and Cas9, and provide a perspective on applications of CRISPR-Cas12 in agriculture.

Biotechnological application of the green microalga Chlamydomonas reinhardtii hinges on the availability of selectable markers for effective expression of multiple transgenes. However, biological safety concerns limit the establishment of new antibiotic resistance genes and until today, only few auxotrophic markers exist for C. reinhardtii. The recent improvements in gene editing via CRISPR/Cas9 allows directed exploration of new endogenous selectable markers. Since editing frequencies with CRISPR/Cas9 techniques are often low, the Cas9-sgRNA ribonucleoprotein (RNP) delivery protocol was strategically optimized by applying nitrogen starvation to the pre-culture, increasing editing frequencies from 10% to 66% after pre-selection. Probing the essential polyamine biosynthesis pathway, the spermidine synthase gene (SPD1) is shown to be a potent selectable marker with versatile biotechnological applicability. Very low levels of spermidine (0.75 mg/L) were required to maintain normal mixotrophic and phototrophic growth in newly designed spermidine auxotrophic strains. Complementation of these strains with a synthetic SPD1 gene was achieved when the mature protein was targeted to either the cytosol or the chloroplast. This work highlights the potential of new selectable markers for biotechnology as well as basic research and proposes an effective pipeline for the identification of new auxotrophies in C. reinhardtii.

This study investigates the long-term stability of the Suomi National Polar-orbiting Partnership (S-NPP) Visible Infrared Imaging Radiometer Suite (VIIRS) moderate-resolution Thermal Emissive Bands (M TEBs; M12 – M16) covering a period from February 2012 to August 2020. It also assesses inter-sensor consistency of the VIIRS M TEBs among three satellites-S-NPP, NOAA-20, and NOAA-21 over eight months spanning from March 18 to November 30, 2023. The field of interesting is limited to the ocean surface between 60°S and 60°N, specifically under clear-sky conditions. Taking radiative transfer modeling (RTM) as the transfer reference, we employed the Community Radiative Transfer Model (CRTM) to simulate VIIRS TEB brightness temperature (BTs), incorporating European Centre for Medium-range Weather Forecasts (ECMWF) reanalysis data as inputs. Our results reveal two key findings. Firstly, the reprocessed S-NPP VIIRS TEBs exhibit a robust long-term stability, as demonstrated through analyses of the observation minus background BT differences (O-B ∆BTs) between VIIRS measurements (O) and CRTM simulations (B). The drifts of the O-B BT differences are consistently less than 0.105 K/Decade across all S-NPP VIIRS M TEB bands. Notably, observations from VIIRS M14 and M16 stand out with drifts well within 0.04 K/Decade, reinforcing their exceptional reliability for climate change studies. Secondly, excellent inter-sensor consistency among these three VIIRS instruments is confirmed through the double-difference analysis method (O-O). This method relies on the O-B BT differences obtained from daily data. The mean inter-VIIRS O-O BT differences remain within 0.08 K for all M TEBs, except for M13. Even in the case of M13, the O-O BT differences between NOAA-21 and NOAA-20/S-NPP have values of 0.312 K and 0.234 K, respectively, which are comparable to the 0.2 K difference between some TEBs among VIIRS and MODIS. These disparities are primarily attributed to the significant differences in the Spectral Response Function (SRF) of NOAA-21 compared to NOAA-20 and S-NPP. Our study confirms the RTM-based TEB quality evaluation method’s versatility and effectiveness in assessing long-term sensor stability and inter-sensor consistency. The double-difference approach effectively mitigates uncertainties and biases inherent to CRTM simulations, establishing itself a robust mechanism for assessing inter-sensor consistency. In addition, we’ve observed that, except for M13, M12 always exhibits larger spatial variations of O-O BT differences with greater uncertainties compared to the other M TEBs. The influence of solar contribution through sea surface reflection on the Top of Atmosphere (TOA) radiance measurements during daytime in M12 should not be underestimated.

The article presents several innovative systems developed through student laboratory projects, including two autonomous vehicles, a four-legged walking robot, an active ankle-foot orthosis, a ball on beam balancing mechanism, a ball on plate system, and a manipulator arm—all powered by pneumatic artificial muscles (PAMs). Fluidic muscles offer significant potential in various mechatronic systems, robots, and manipulators due to their flexible, lightweight nature and compliance. Their ability to produce smooth and adaptable motions is particularly beneficial in applications requiring natural and human-like movement, such as rehabilitation and assistive devices. Although PAMs powered control systems face challenges with nonlinear phenomena, their biologically inspired design holds promise for future applications across various industries. These may include innovative applicability in industrial, automotive, and aerospace sectors, as well as use in sports, medical aids, entertainment, and animatronics. Incorporating self-made laboratory systems actuated by PAMs into control systems education offers a comprehensive learning opportunity that combines theoretical concepts with hands-on experience. This approach develops the necessary skills of future engineers, expanding their understanding of technical principles and preparing them for future challenges in engineering practice.

Smart livestock farming leverages technology to boost production and meet food demand sustainably. This study delves into smart technologies in animal production, covering opportunities, challenges, and solutions. Smart agriculture employs modern technology to enhance efficiency, sustainability, and animal welfare in livestock farming. It includes remote monitoring, GPS-based animal care, robotic milking, smart health collars, predictive disease control, and other innovations to achieve these goals. While smart animal production holds great promise, it does face challenges related to cost, data management, and connectivity. To address these challenges, potential solutions include remote sensing, technology integration, and farmer education. Smart agriculture offers opportunities for increased efficiency, improved animal welfare, and enhanced environmental conservation. A well-planned approach is crucial to maximize the benefits of smart livestock production while ensuring its long-term sustainability. This study confirms the growing adoption of smart agriculture in livestock production, with the potential to support sustainable development goals and deliver benefits such as increased productivity and resource efficiency. To fully realize these benefits and ensure the sustainability of livestock farming, it is essential to address cost and education challenges. Therefore, this study recommends promoting a positive outlook among livestock stakeholders and embracing smart agriculture to enhance farm performance.

Structural health monitoring has been studied by a number of researchers as well as various industries to keep up with the increasing demand for preventive maintenance routines. This work presents a novel method for reconstruct prompt, informed strain/stress responses at the hot spots of the structures based on strain measurements at remote locations. The structural responses measured from usage monitoring system at available locations are decomposed into modal responses using empirical mode decomposition. Transformation equations based on finite element modeling are derived to extrapolate the modal responses from the measured locations to critical locations where direct sensor measurements are not available. Then, two numerical examples (a two-span beam and a 19956-degree of freedom simplified airfoil) are used to demonstrate the overall reconstruction method. Finally, the present work investigates the effectiveness and accuracy of the method through a set of experiments conducted on an aluminium alloy cantilever beam commonly used in air vehicle and spacecraft. The experiments collect the vibration strain signals of the beam via optical fiber sensors. Reconstruction results are compared with theoretical solutions and a detailed error analysis is also provided.

This review summarizes the use of CRISPR system in yeasts, identifying advantages and disadvantages of its applications. 39 articles were evaluated including 12 articles that discussed the advantages of new CRISPR systems that improved the initial system, and another 27 were evaluated, among these: three were applications in Cryptococcus neoformans, four in candida sp., three in Schizosaccharomyces pombe, nine in Saccharomyces cerevisiae, four in Yarrowia lipolytica, and four in industrially important yeasts such as Pichia pastoris and Saccharomyces pastorianus. It was concluded that the CRISPR system is one of the most versatile genetic editing systems available nowadays. It can be applied in different organisms for several effects including gene knock-outs, performing point mutations, gene expression, or even applying multiple edition operations in several genes. However, we recognize that numerous studies lack a control group of the mutated strains, which leaves many questions unanswered. For instance, the extent and precision of this techniques, it also represents a risk to biosecurity standards. Therefore, this review shows the compilation of CRISPR system information, which could be used to generate different alternatives in the industry and clinical fields.

A hallmark of Alzheimer’s disease (AD) are the proteinaceous aggregates formed by the amyloid-beta peptide (Aβ) that is deposited inside the brain as amyloid plaques. The accumulation of aggregated Aβ may initiate or enhance pathologic processes in AD. According to the amyloid hypothesis any agent that has the capability to inhibit Aβ aggregation and/or destroy amyloid plaques represents a potential disease modifying drug. In 2023, a humanized IgG1 monoclonal antibody (lecanemab) against the Aβ soluble protofibrils was approved by US FDA for AD therapy thus providing compelling support to the amyloid hypothesis. To acquire a deeper insight on the in vivo Aβ aggregation, various animal models, including aged herbivores and carnivores, non-human primates, transgenic rodents, fish and worms are widely exploited. This review is based on the recent data obtained using transgenic animal AD models and presents experimental verification of the critical role in Aβ aggregation seeding of the interactions between zinc ions, Aβ with the isomerized Asp7 (isoD7- Aβ) and the α4β2 nicotinic acetylcholine receptor.

Cloud-induced atmospheric extinction and occlusion have a major effect on the effectiveness and quality of telescope observations. Real-time cloud cover distribution and long-term statistical data are essential for astronomical siting and telescope operations. At ground-based astronomical telescope sites, cloud cover distribution is currently analyzed using manual observation methods. However, the main disadvantages of manual observation methods are human subjective, heavy workloads and poor real-time performance. Therefore, a real-time automatic cloud images classification method is desperately needed. This paper presents a new cloud identification method, which is named PSO+XGBoost model by combining eXtreme Gradient Boosting (XGBoost) and Particle Swarm Optimization (PSO). The entire cloud image is divided into 37 sub-regions in order to more precisely identify the distribution of the clouds. 19 features are then extracted, including the sky background, star density, lighting conditions, and subregion grayscale values. The experimental results have shown that the overall classification accuracy of 96.91% and our model is able to outperform several state-of-the-art baseline methods. Our approach achieves high accuracy in comparison with the manual observation methods. Moreover, this method meets telescope real-time scheduling requirements.

Utilization of wasted heat instead of fuel combustion is effective to reduce primary energy consumption for mitigating global warming problem. Because wasted heat sources are not necessarily located close to areas of heat demand, one of the difficulties is that wasted heat has to be transferred from heat source side to heat demand side, which may require heat transportation over long distance. From this point we proposed and have examined new idea of heat transportation using ammonia-water as the working fluid which system is named Solution Transportation Absorption chiller, in short STA. Our previous studies of STA were mainly the experimental investigation with STA facility which cooling power was 25RT (90kW). As a result, the COP of STA was found almost same value 0.65 with the conventional absorption chiller without depending on the transportation distances. The simulation using AspenHYSYS also examined with same experimental condition. The experimental data showed good agreement with the simulation calculation. In this study, we examined the large-scale cooling power STA on simulation. The examination cooling powers were from 90 kW(25RT) to 3517 kW(1000RT). All cooling power achieved around COP 0.64 including pump power consumptions. In addition, we performed the dynamic simulation. As the results, there was no effect of pipeline size on the cooling capacities and mass flow rates. Furthermore, the stability time of the cooling capacities and mass flow rates were almost same regardless of the pipeline size and cooling capacity. In other words, STA may be achieved the same COP even though having various complex conditions compared with the conventional absorption chiller.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

Cystic Fibrosis is a rare genetic disease that affects the transmission of chloride ions due to mutations in the CFTR (cystic fibrosis transmembrane conductance regulator) gene. Even though there are nearly 2000 mutations identified to be related to the condition, the most common mutation is F508del; deletion of a phenylalanine residue at 508. On the other hand, G542X which is a Class I mutation is also found very commonly and there are no modulator treatments available for it. Furthermore, it was investigated that R553X mutation can as well be corrected simultaneously with G542X mutation. Therefore, the main focus is on designing a gene therapy project that can correct all these three mutations at once by utilizing the prime editing technique via lipid-based delivery. In this way, the mutations can be edited through plasmids that were designed containing 2 pegRNAs and the Cas enzyme. To implement such an approach efficiently, both ex vivo, an animal model, and in vivo steps are to be designed. For the cell line, fibroblasts are selected due to their simplicity and low cost. The animal model of the experiment is determined to be a ferret concerning the high similarity to the human's CFTR protein and finally, the procedure will follow on a direct application in human Cystic Fibrosis patients. The plasmids are thought to be delivered through a cationic liposome that will reach the lungs with the aid of a nebulizer. At the last stage of the experimental procedure, Sanger Sequencing will be done to see if the desired edit within the CFTR has been performed successfully, and Next Generation Sequencing will be executed to see if there has been an off-target mutation in the remainder of the genome. Whereas for detecting the presence and expression of CFTR protein in humans, immunodetection with flow cytometry will be conducted.

Neuroblastoma (NB) is a childhood cancer with heterogeneous characteristics, posing challenges to effective treatment. NBs express somatostatin receptors that facilitates the use of somatostatin analogs (SSTAs) as tumor-seeking agents for diagnosis and therapy. High-risk (HR) NBs often have gain-of-function mutations in the receptor tyrosine kinase anaplastic lymphoma kinase (ALK). Despite intensive multimodal treatment, survival rates remain below 40% for children with HR-NB. The aim of this work was to investigate the combined effect of the SSTA 177Lu-octreotide with the ALK inhibitor lorlatinib. Mice bearing human HR-NB CLB-BAR tumors were treated with lorlatinib, 177Lu-octreotide, combination of these pharmaceuticals or saline (control). Tumor volume was monitored and tumor samples were evaluated for cleaved caspase-3 and expression of 84 human genes involved in apoptosis. Combination treatment with 177Lu-octreotide and lorlatinib demonstrated synergistic antitumor effects. Increased number of cleaved caspase 3-positive cells was observed in tumors from mice treated with 177Lu-octreotide alone and in combination with lorlatinib. Modulation of Bcl-2 family gene expression was observed only in the presence of both 177Lu-octreotide and lorlatinib, with BID downregulated and HRK upregulated on days 2 and 7, respectively. The data suggests that ALK signaling pathway inhibition may contribute to radiosensitization in radionuclide therapy with 177Lu-octreotide.

Employing remote sensing techniques to evaluate crop residue cover (CRC) enables rapid mapping of tillage practices over large cropland areas, which has significant practical implications for monitoring the implementation of conservation tillage practices. This research utilized Sentinel-2 MSI and Landsat-8 OLI remotely sensed data, various spectral indices were calculated and the datasets were correlated with the field-measured CRC data. Selected spectral indices, highly significantly correlated, were chosen to build a correlation model between the indices and the CRC. Considering Sentinel-2 MSI and Landsat 8 OLI remotely sensed data variations in spectral and spatial scales, the accuracy of CRC models was evaluated using R2 and RMSE values. From the results, it's evident that all six spectral indices, including STI, NDTI, SRNDR, NDI5, NDI7 and NDSVI, registered correlation coefficients with the CRC exceeded 0.3 in the study area. STI and NDTI showed a stronger correlation to CRC, with coefficients of 0.810 and 0.803, respectively. For the Landsat 8 data, the lowest correlation obtained was for NDSVI with the Landsat 8 data with a correlation coefficient of 0.358. Applying the linear regression technique, STI and NDTI obtained higher accuracy compared to other indices in the Sentinel-2 MSI data. For NDTI and STI, The R2 values were 0.650 and 0.665, respectively, while their corresponding RMSE values were 3.96% and 4.03%. The highest model accuracy was obtained for the STI and NDTI constructed from the Landsat 8 OLI data (R2 values 0.41 and 0.40; RMSE values 5.25% and 5.27%, respectively). The CRC model built using partial least squares regression (PLSR) exhibited greater precision when applied to the Sentinel-2 MSI data (R2 value 0.894; RMSE value 2.18%) in comparison to the Landsat 8 OLI data (R2 value 0.695; RMSE value 3.70%). PLSR has the potential to enhance the precision of the model. In addition, the study area shows that the estimation of the CRC is better in the one-dimensional linear regression model and the PLSR model created with the Sentinel-2 MSI optical data compared to the Landsat 8 OLI optical remotely sensed data. The validation suggests that the CRC estimation in the study area is more precise when using the model relying on Sentinel-2 satellite imagery rather than the Landsat 8 OLI imagery.

There is disagreement on the associations between chorioamnionitis and pneumonia/sepsis, respiratory distress syndrome (RDS), and bronchopulmonary (BPD)dysplasia, three pulmonary outcomes of concern for preterm newborns. Determining clear correlations is challenging due to the intricacy of the prenatal, postnatal, and therapeutic practices that affect the diagnosis of RDS, pneumonia/sepsis, and BPD, two long-term outcomes, as well as their short- and long-term consequences. Owing to the interconnected nature of the variables, the vaguely defined fetal exposures, and the imprecise identification of disorders like RDS and BPD, multivariant studies of huge data sets are unreliable methods for defining associations. On the other hand, research using animal models offers reliable data regarding the effects of exploratory chorioamnionitis on the fetal lung. Understanding the clinical intricacy and the experimental consequences of chorioamnionitis together will help us understand on the impact on the fetal lung .

With the continuous update of gene editing technology, great progress has been made in livestock breeding, researchers have produced gene edited pigs, cattle, sheep and other improved livestock. Gene editing technology is a genetic means to knock in, knock out, delete, inhibit, activate or replace specific bases of DNA or RNA sequences at the genome level to achieve accurate modification, and can edit genes at a fixed point without the need for DNA templates. In recent years, although regular clusters of interspaced short palindromic repeats (CRISPR)/Cas9 system mediated gene editing technology has been widely used in animal genetic breeding research, but so far, the system's precise insertion efficiency of foreign genes is not high enough, and there are certain off-target effects, and it is not enough to be used in genome editing of large livestock such as cashmere goats. In this paper, the development status, challenges, application prospects and look into the distance of CRISPR/ Cas9-mediated precisiongene editing technology in livestock breeding were reviewed, in order to provide theoretical reference for livestock gene function analysis, genetic improvement and livestock breeding with local economic characteristics.

Abstract: High step-up voltage gain nonisolated DC-DC converter have attracted much attention in photovoltaic, fuel cells and other renewable energy system applications. In this paper, by combining input current ripple-free boost cell with coupled-inductor voltage-doubler cell, an input current ripple-free high voltage gain nonisolated converter is proposed. In addition, passive lossless clamp circuit is adopted to recycle the leakage inductor energy and to reduce the voltage spike across the power switch. By utilizing voltage-doubler cell consisting of diode and capacitor, the voltage stress of switch is further reduced and the resonance between the leakage inductor and the stray capacitor of the output diode is eliminated. A low switch-on-resistance low-voltage-rated MOSFET can therefore be employed to reduce the conduction loss and cost. The reverse recovery loss of output diode is reduced, and the efficiency of converter can be improved. Furthermore, the proposed converter can achieve nearly zero input current-ripple and make the design of electromagnetic interference (EMI) filter easy. Steady state analysis and operation mode of the converter is performed. Finally, experimental results are presented to verify the analysis results of the proposed converter.

This paper explores the capability of various machine learning algorithms, including Random Forests and advanced gradient boosting techniques such as XGBoost, LightGBM, and CatBoost, to predict customer churn in the telecommunications sector. For this analysis, a dataset available to the public was employed. The performance of these algorithms was assessed using recognized metrics, including Accuracy, Precision, Recall, F1-score, and the Receiver Operating Characteristic Area Under Curve (ROC AUC). These metrics were evaluated at different phases: subsequent to data preprocessing and feature selection; following the application of SMOTE and ADASYN sampling methods; and after conducting hyperparameter tuning on the data that had been adjusted by SMOTE and ADASYN. The outcomes underscore the notable efficiency of upsampling techniques such as SMOTE and ADASYN in addressing the imbalance inherent in customer churn prediction. Notably, the application of random grid search for hyperparameter optimization did not significantly alter the results, which remained comparatively unchanged. The algorithms' performance post- ADASYN application marginally surpassed that observed after SMOTE application. Remarkably, LightGBM achieved an exceptional F1-score of 89% and an ROC AUC of 95% subsequent to the ADASYN sampling technique. This underlines the effectiveness of advanced boosting algorithms and upsampling methods like SMOTE and ADASYN in navigating the complexities of imbalanced datasets and intricate feature interdependencies.

The African continent has the highest prevalence of hypertension globally, with South Africa reporting the highest prevalence in Southern Africa. While the influence of genetic variability in the pathogenesis of hypertension is well described internationally, limited reports are available for African populations. This study aimed to assess the association of genetic variants and essential hypertension in a cohort of two ethnic South African population groups. Two hundred and seventy-seven hypertensive and one hundred and seventy-six normotensive individuals were genotyped for 79 variants. Genotyping was performed using the Illumina GoldenGate Assay and allele-specific polymerase chain reaction. The association of variants was assessed using the Fisher Exact test under the additive and allelic genetic models, while multivariate logistic regression was used to predict the development of hypertension. Five variants (CYP11B2 rs179998, AGT rs5051 and rs699, AGTR1 rs5186 and ACE rs4646994) were significantly associated with essential hypertension in the cohort under study. Furthermore, AGTR1 rs5186 and AGT rs699 were identified as risk factors for the development of hypertension in both ethnic groups. In two ethnic South African populations an association was observed between Renin-Angiotensin-Aldosterone System (RAAS) related genes and the development of hypertension.

Background: this interventional pilot study aimed to evaluate the short-term (3 years) efficacy of focal laser ablation (FLA) in treating the index lesion of low-intermediate risk prostate cancer, along with assessing the safety of the procedure (ClinicalTrials.gov ID NCT04045756). Methods: forty patients aged between 46 and 86 with histologically proven organ-confined prostate cancer and low to intermediate progression risk were included. FLA was performed under percutaneous fusion magnetic resonance/ultrasound guidance in a Day Hospital setting under local anesthesia. Patients underwent regular clinical assessments, PSA measurements, post-procedure MRI scans, and biopsies at 36 months or if positive findings were detected earlier. Statistical analyses were conducted to assess trends in PSA levels and cavity dimensions over time. Results: forty patients were initially included, with 15 lost to follow-up. At 36 months, a mean PSA reduction of 60% was observed, and 80% of MRI scans showed no signs of in-field clinically significant residual/recurrent cancer. Biopsies at 36 months revealed no malignant findings in 20 patients. No deterioration in sexual function or urinary symptoms was recorded. Conclusions: FLA appears to be safe, feasible and effective in the index lesion treatment of low-intermediate risk prostate cancer, with a high rate of tumor eradication and preservation of quality of life.

A challenge in building large-scale superconducting quantum processors is the precise control and manipulation of the qubit state. However, the crosstalk between the microwave control lines impedes the parallel execution of high-fidelity digital and analog quantum operations. Here, we propose and demonstrate a universal compensation protocol for calibrating the microwave signal crosstalk. We also introduce amplified error sequences to optimize the accuracy. Furthermore, we show a definitive improvement in parallel gate operations with crosstalk cancellation, demonstrating the technique's effectiveness. This work paves the way for superconducting hardware that features automated calibration of microwave crosstalk, leading to enhanced fidelities in multiqubit circuits.

This study explores optimizing Synthetic Aperture Radar (SAR) satellite constellation scheduling for multi-imaging missions in densely targeted areas using an in-house developed Modified Dynamic Programming (MDP) algorithm. By employing Mixed-Integer Linear Programming (MILP) to define the mission planning problem, the research aims to maximize observation of high-value targets within restricted planning horizons. Numerical simulations, covering a wide range of target numbers and satellite configurations, reveal the MDP algorithm’s superior mission allocation efficiency, enhanced success rates, and reduced revisit times, compared to the Greedy algorithm. The findings underscore the MDP algorithm’s improved operational efficiency and planning robustness for complex imaging tasks, demonstrating significant advancements over traditional approaches.

Lynch syndrome (LS) is an inherited cancer predisposition disorder associated with an elevated risk of various epithelial cancers. Despite sharing the same pathogenic variant (PV), Lynch syn-drome variant heterozygotes (LSVH) exhibit considerable phenotypic variability in cancer risk. The role of Human Leukocyte Antigen (HLA) in modifying cancer risk prompted our investiga-tion into whether HLA variations act as genetic modifiers influencing age at cancer diagnosis in a unique cohort of LSVH carrying a PV in the hMLH1 gene in South Africa. Within our extensive LS cohort, 426 individuals carried the same hMLH1 PV (MLH1:c.1528C>T). We selected 100 indi-viduals with the greatest diversity in age at cancer diagnosis and the oldest unaffected individu-als for high-throughput HLA genotyping of 12 HLA class I and II loci using next-generation se-quencing. Statistical analyses employed Kaplan-Meier survival analyses with Logrank tests and Cox proportional hazards. Following the robust application of statistical correction methods, six HLA alleles (3.2%) were significantly associated with a young age at cancer diagnosis. Notably, HLA-B*15:17 and HLA-DPB1*55:01 correlated significantly with very young colorectal cancer (CRC) diagnosis (Mean age: 21y [17-25]; HR = 71.59; q

In this paper, a method is developed for presenting a novel virtual torque sensor based on precise model and position measurements avoids the need of traditional strain gauges and amplifiers. More specifically, the harmonic drive compliance model and the Gaussian process regression (GPR) technique are used together to achieve virtual torque sensor measurement. While the harmonic drive compliance model provides the analytic part, the Gaussian process regression method is used to reconstruct the unmolded part based on motor-side and link-side joint angles as well as motor current. After an automatic offline calibration, the method allows for a lean online implementation. The virtual torque sensor measurement is compared with measurements of a commercial torque sensor, and the results have attested the effectiveness of the proposed method.

The search of DNA polymorphisms useful for the genetic improvement of dairy farm animals lasts more than 40 years with relevant findings in cattle for milk traits, where the best combination of alleles for dairy processing have been found in casein genes and in the DGAT1. Nowadays, similar results are not reached yet in river buffaloes despite advanced genomic technologies and accurate phenotype records are available. The aim of the present study was to investigate and validate in a larger buffalo population the effect on six milk traits of four single nucleotide polymorphisms (SNP) in the CSN1S1, CSN3, SCD and LPL genes, previously reported to be associated with or affect dairy traits in smaller populations often belonging to one farm. A total of 800 buffaloes were genotyped. Daily milk yield (dMY, kg), protein yield (dPY, kg) and fat yields (dFY, kg), fat and protein contents (dFP, % and dPP, %), somatic cell count (SCC, 103cell/ml) and urea (mg/dl) were individually recorded in each month for the whole lactation from 2010 to 2021. A total of 15,742 individual milk test day records (2,496 lactations) were available on 680 buffalo cows with 3.6±1.7 parity (from 1 to 13) and 6.1±1.2 test day records per lactation on average. Three out four SNP in CSN1S1, CSN3 and LPL were associated with at least one of analyzed traits. In particular, the CSN1S1 (AJ005430:c.578C>T) gave favorable associations with all yield traits (dMY, p=0.022; dPY, p=0.014 ; dFY, p=0.029) and SCS (p=0.032), whereas the CSN3 (HQ677596: c.536C>T) positively associated with SCS (p=0.005) and milk urea (p=0.04). Favorable effect on dMY (p=0.028), dFP (p=0.027) and dPP (p=0.050) were observed for the LPL. Conversely, SCD did not show any association with milk traits. This is the first example of confirmation study carried out in the Mediterranean river buffalo for genes of economic interest in dairy field and it represents a very important indication for the preselection of young bulls destined to breeding programs in the view of a more sustainable dairy production.

A U.S. government health agency conducted epidemiological studies to evaluate whether exposures to drinking water contaminated with volatile organic compounds at U.S. Marine Corps Base Camp Lejeune, North Carolina, were associated with increased health risks to children and adults. These health studies required knowledge of contaminant concentrations in drinking water—at monthly intervals—delivered to family housing, barracks, and other facilities within the study area. Because concentration data were limited or unavailable during much of the period of contamination (1950s–1985), the historical reconstruction process was used to quantify estimates of monthly mean contaminant-specific concentrations. This paper integrates many efforts, reports, and papers into a synthesis of the overall approach to, and results from, a drinking-water historical reconstruction study. Results show that at the Tarawa Terrace water treatment plant (WTP) reconstructed (simulated) tetrachloroethylene (PCE) concentrations reached a maximum monthly average value of 183 micrograms per liter (ug/L) compared to a one-time maximum measured value of 215 ug/L and exceeded the U.S. Environmental Protection Agency’s current maximum contaminant level (MCL) of 5 ug/L during the period November 1957–February 1987. At the Hadnot Point WTP, reconstructed trichloroethylene (TCE) concentrations reached a maximum monthly average value of 783 ug/L compared to a one-time maximum measured value of 1,400 ug/L during the period August 1953–December 1984. The Hadnot Point WTP also provided contaminated drinking water to the Holcomb Boulevard housing area continuously prior to June 1972, when the Holcomb Boulevard WTP came on line (maximum reconstructed TCE concentration of 32 ug/L) and intermittently during the period June 1972–February 1985 (maximum reconstructed TCE concentration of 66 ug/L). Applying the historical reconstruction process to quantify contaminant-specific monthly drinking-water concentrations is advantageous for epidemiological studies when compared to using the classical exposed versus unexposed approach.

Bio-inspired gyroid triply periodic minimum surface (TPMS) lattice structures have been the focus of research in automotive engineering because they can absorb a lot of energy and have wider plateau ranges. The main challenge is determining the optimal energy absorption capacity and accurately capturing plastic plateau areas using finite element analysis (FEA). Using nTop's Boolean subtraction method, this study combined walled TPMS gyroid structures with normal TPMS gyroid lattice. This made a composite TPMS-gyroid lattice with relative densities ranging from 14% to 54%. Using the ideaMaker software and the fused deposition modeling (FDM) Raise3D Pro 2 3D printer to print polylactic acid (PLA) bioplastics in 1.75 mm filament made it possible to slice computer aided design (CAD) models and fabricate 36 lattices samples precisely layer by layer technique. Shimadzu 100kN testing equipment was utilized for the mechanical compression experiments. And the validation using finite element analysis (FEA). Further, CTG was examined using a field emission scanning electron microscope (FE-SEM) before and after compression testing. The composite TPMS gyroid lattice showed potential as shock absorbers for vehicles with relative densities of 33%, 38%, and 54%. The Gibson-Ashby model showed that the composite TPMS gyroid lattice deformed mainly by bending, and the size effect was seen when the relative densities were less than 15%. The lattice's relative density had a significant impact on its ability to absorb energy. The research also explored the use of these innovative foam-like composite TPMS-gyroid lattices in high-speed crash box scenarios, potentially enhancing vehicle safety and performance.

Gene or genome editing (GE) revises, removes, or replaces a mutated gene at the DNA level; it is a tool. Gene therapy (GT) offsets mutations by introducing a "normal" version of the gene into the body while the diseased gene remains in the genome; it is a medicine. So far, no GE product has been approved, as opposed to 22 GT products that cost up to millions of dollars per dose. The FDA has recently added a guideline specific to gene editing that should be understood to enable faster development of GE products; at the same time, the FDA also needs to bring more clarification and make several amendments to this guideline to make it more rational.

Amyloid-beta plays an important role in the pathogenesis of Alzheimer’s disease. Aberrant amyloid-beta and tau accumulation induce neuroinflammation, cerebrovascular alterations, synaptic deficits, functional deficits, and neurodegeneration, leading to cognitive impairment. Animal models recapitulating the amyloid-beta pathology such as transgenic, knock-in mouse and rat models have facilitated the understanding of disease mechanisms and development of therapeutics targeting at amyloid-beta. There is a rapid advance in high-field MR in small animals. Versatile high-field magnetic resonance imaging (MRI) sequences such as diffusion tensor imaging, arterial spin labelling, resting-state functional MRI, anatomical MRI, MR spectroscopy as well as contrast agents have been developed for the applications in animal models. These tools have enabled high-resolution in vivo structural, functional, and molecular readouts with a whole brain field-of-view. MRI have been utilized to visualize non-invasively the amyloid-beta deposits, synaptic deficits, regional brain atrophy, impairment in white matter integrity, functional connectivity, cerebrovascular and glymphatic system in animal models of amyloidosis. Many of the readouts are translational in clinical MRI in the brain of patients with Alzheimer’s disease. In this review, we summarize the recent advance of using MRI for visualizing the pathophysiology in amyloidosis animal model. We discuss the outstanding challenges in brain imaging using MRI in small animal and propose future outlook in visualizing amyloid-beta-related alterations in brain of animal models.

Animal models of Alzheimer’s disease amyloidosis that recapitulate cerebral amyloid-beta pathology have been widely used in preclinical research, and have greatly enabled the mechanistic understanding of Alzheimer’s disease and the development of therapeutics. Comprehensive deep phenotyping of the pathophysiological and biochemical features in these animal models are essential. Recent advances in positron emission tomography have allowed the non-invasive visualization of the alterations in the brain of animal models as well as in patients with Alzheimer’s disease, These tools have facilitated our understanding of disease mechanisms, and provided longitudinal monitoring of treatment effect in animal models of Alzheimer’s disease amyloidosis. In this review, we focus on recent positron emission tomography studies of cerebral amyloid-beta accumulation, hypoglucose metabolism, synaptic and neurotransmitter receptor deficits (cholinergic and glutamatergic system), blood-brain barrier impairment and neuroinflammation (microgliosis and astrocytosis) in animal models of Alzheimer’s disease amyloidosis. We further propose the emerging targets and tracers for reflecting the pathophysiological changes, and discuss outstanding challenges in disease animal models and future outlook in on-chip characterization of imaging biomarkers towards clinical translation.

Linear polyamides, known as nylons, are a class of synthetic polymers with a wide range of applications due to their outstanding properties, such as chemical and thermal resistance or mechanical strength. These polymers have been used in various fields: from common and domestic applications, such as socks and fishing nets, to industrial gears or water purification membranes. By their durability, flexibility and wear resistance nylons have been started to be used in addictive manufacturing technology as a good material choice to get sophisticated devices with precise and complex geometric shapes. Furthermore, the emergence of triboelectric nanogenerators and the development of biomaterials have highlighted the versatility and utility of these materials. In order to enhance the triboelectric performance and the range of applications, nylons show a potential use as tribo-positive materials. Because of the easy control of their shape they can be subsequently integrated into nanogenerators. The use of nylons has also extended into the field of biomaterials, where their biocompatibility, mechanical strength and versatility have paved the way for groundbreaking advances in medical devices as dental implants, catheters and non-absorbable surgical sutures. By means 3D bioprinting nylons have been used to develop scaffolds, joint implants and drug carriers with tailored properties for various biomedical applications. The present paper aims to collect these recently specific applications of nylons by reviewing the literature produced in the last decades, with a special focus on the newer technologies in the field of energy harvesting and biomedicine.

Probiotics, living microorganisms with demonstrated health benefits when administered in sufficient quantities, have a rich history as dietary supplements to benefit human health. Recently, understanding of their mechanisms in the gastrointestinal tract has prompted exploration of probiotics in treating human diseases. However, the effective and precise delivery of probiotics remains a significant challenge in therapeutic applications. Here, we review the mechanisms of action of probiotics in human health and the most advanced strategies for efficient probiotic delivery. We also discuss the potential applications of engineered probiotics in disease treatment. This review contributes insights into the evolving landscape of probiotic research for therapeutic applications.

Oligopeptide transporters (OPTs) are a group of membrane localized proteins that have a broad range of substrate transport capabilities and contribute to numerous biological processes. However, limited information has been reported on OPTs in higher plants. In this study, a comprehensive analysis of the OPT gene family in Medicago truncatula was performed. A total of 26 OPT genes (MtOPT01-MtOPT26) have been identified in the Medicago truncatula genome. Phylogenetic analyses indicated that MtOPTs consisted of two distinct subgroups, 12 MtOPTs belonged to the peptide transport subgroup (PT-OPT) based on their predicted amino acid sequences containing the two highly conserved motifs (NPG and KIPPR) and 14 MtOPTs belonged to yellow stripe subgroup (YS-OPT). The MtOPTs distributed on each of 8 chromosomes in Medicago truncatula. Sequence analysis verified that MtOPTs significant similar to those in other plants. The copy number of MtOPTs was low and the multiply of MtOPTs was simple relatively. Gene structure analysis showed that most of the MtOPTs have various numbers of introns. The multiple of MtOPTs might play different biological roles which were supported by the fact that MtOPTs have a distinct tissue-specific expression pattern. The data obtained in this study will help to better understand the complexity of the MtOPTs gene family and provide new evidence for the function and evolution of the OPT gene family in higher plants.

Human gut microbiome is associated with various diseases, including autism spectrum disorders (ASD). Variations of the taxonomical composition in the gut microbiome of children with ASD have been observed repeatedly. However, features and parameters of the CRISPR-Cas systems in the gut microbiome of children with ASD have not been investigated yet. Here we demonstrate such an analysis in comparison with the healthy microbiome. For the identification of CRISPR-Cas systems, we used a combination of the publicly available tools suited for completed genomes with subsequent filtrations. In all considered datasets, the microbiomes of children with ASD contained fewer arrays per Gb of assembly, than the control group, but the arrays included more spacers on average. These patterns were observed systematically in our datasets, although their statistical significance hardly matched the thresholds. CRISPR arrays from the microbiomes of children with ASD differed from the control group neither in the fractions of spacers with protospacers from known genomes, nor in the sets of known bacteriophages providing protospacers. The majority of bacterial protospacers of the gut microbiome systems for both children with ASD and the healthy ones was located in the prophage islands.

HIV-1 is a complicated and perplexing virus. It infects T cells, reverse transcribes its RNA into DNA, utilizes its host DNA machinery to replicate its HIV-DNA, translates the HIV-DNA into proteins, assembles itself for a budding escape from the T cell, and rapidly mutates its conformation. Partially, due to its complexity, there remains no cure for HIV or AIDs. However, recently with the discovery of TALENs, the use of zinc fingers, and most of all the applications of CRISPR-Cas9 technology, has given researchers new hope in finding alternative gene therapies and treatments for diseases. With more focus on CRISPR-Cas9, this new and novel technology uses a guiding RNA, sgRNA, to lead a Cas9 nuclease to its target for deletion or to change that DNA site. CRISPR-Cas9 can delete point mutations and multiple DNA sites. Because CRISPR can alter DNA sequences, several scientists have conducted research into CRISPR, possibly treating more diseases such as cancer, diabetes, and even HIV. HIV-1 drew the focus of a researcher named Dr. Ebina in 2013 when he was the first to design and apply CRISPR-Cas9 to genes found in the binding sites of HIV-1, inhibiting HIV-1 gene expression. Since 2013, several other researchers have blocked HIV replication and infection through CRISPR-Cas9 targeting the receptors of T cells called the CC chemokine receptor 5 or CCR5. HIV-1 binds to the CD4 receptor of T cells, which consists of co-receptors CCR5 and CXCR4. If CCR5 expression can be removed, the HIV virus cannot bind to T-cells, blocking the initial attachment stage, and discontinuing the infection. However, there remain obstacles and issues for the CRISPR deletion of CCR5 for treating HIV-1. The issues include: 1) finding new and safe methods of CRISPR-Cas9 delivery, 2) clearing the latent HIV reservoirs, 3) improving the sgRNA design to avoid off-target mutations or deletions, and 4) effectively analyze the viral escape of HIV from CRISPR-Cas9 modifications. Therefore, the purpose of this review is to discuss possible techniques for removing the obstacles that can lessen the potential of CRISPR to delete CCR5, repressing HIV-1 into long-term remission or a functional cure.

With rapid advances in gene editing and gene therapy technologies, the development of genetic, cell, or protein-based cures to disease are no longer the realm of science fiction but that of today’s practice. The impact of these technologies are rapidly bringing them to the veterinary market as both enhanced therapeutics and towards modeling their outcomes for translational application. Simply put, gene editing enables scientists to modify an organism’s DNA a priori through the use of site-specific DNA targeting tools like clustered regularly interspaced short palindromic repeats and CRISPR-associated protein 9 (CRISPR/Cas9). Gene therapy is a broader definition that encompasses the addition of exogenous genetic materials into specific cells to correct a genetic defect. More precisely, the U.S Food and Drug Administration (FDA) defines gene therapy as “a technique that modifies a person’s genes to treat or cure disease” by either (i) replacing a disease-causing gene with a healthy copy of the gene; (ii) inactivating a disease-causing gene that was not functioning properly; or (iii) introducing a new or modified gene into the body to help treat a disease. In some instances, this can be accomplished through direct transfer of DNA or RNA into target cells of interest or more broadly through gene editing. While gene therapy is possible through the simple addition of genetic information into cells of interest, gene editing allows the genome to be reprogrammed intentionally through the deletion of diseased alleles, reconstitution of wild type sequence, or targeted integration of exogenous DNA to impart new function. Cells can be removed from the body, altered, and reinfused, or edited in vivo. Indeed, manufacturing and production efficiencies in gene editing and gene therapy in the 21^st century has brought the therapeutic potential of in vitro and in vivo reprogrammed cells, to the front lines of therapeutic intervention (Brooks et al., 2016). For example, CAR-T cell therapy is revolutionizing hematologic cancer care in humans and is being translated to canines by us and others, and gene therapy trials are ongoing for mitral valve disease in dogs.

The real systems are often complex, nonlinear, and noisy in various areas including mathematics, natural science, and social science. We present the symplectic entropy (SymEn) measure as well as an analysis method based on SymEn to estimate the nonlinearity of the complex system by analyzing the given time series. The SymEn estimation is a kind of entropy based on symplectic principal component analysis (SPCA) which represent organized but unpredictable behaviors of systems. The key to SPCA is to preserve the global submanifold geometrical properties of the systems through symplectic transform in the phase space, which is a kind of the measure-preserving transforms. The capability of preserving the global geometrical characteristics makes the SymEn a test statistic to detect the nonlinear characteristics in several typical chaotic time series and the stochastic characteristic in the Gaussian white noise. The results are in agreement with findings in the approximate entropy (ApEn), the sample entropy (SampEn) and the fuzzy entropy (FuzzyEn). Moreover, the SymEn method is also used to analyze the nonlinearities of the real signals (including the EEG signals for ASD and healthy subjects, and the sound and vibration signals for the mechanical systems). The results indicate that the SymEn estimation can be taken as a measure for describing the nonlinear characteristics in the data collected from the natural complex systems.

Nanotechnology is an emerging field of modern science based on the use of nanoparticles (NPs) with a huge potential in many sectors, including nanomedicine. Their small size confers them unique properties because they are subject to physical laws that are in the middle between classical and quantum physics. In this context, NPs project plays a pivotal role because the composition, size, shape and surface proprieties need to be carefully considered for their optimal design and application. As reported in this review, NPs are classified in inorganic (metallic NPs; quantum dots; carbon-based nanostructures; mesoporous silica nanoparticles) and organic (liposomes and micelles, dendrimers and polymer nanoparticles) ones. Here, we report an accurate description of the potential of each NPs type focusing on their multiple areas of application like theranostics drug delivery, imaging, tissue engineering, antimicrobial techniques and nanovaccines, and therefore they represent a promise to revolutionize the new era of nanomedicine, especially in cancer research.

Diarrhoea is a serious cause of mortality worldwide that can lead to dehydration, gut barrier function impairment, nutrient malabsorption, and alterations of the gut microbiota (dysbiosis). Current solutions for its management, such as oral rehydration salts (ORS), inhibitors of the gut motility, antibiotics, and living probiotics only partially counteract the mechanisms of the disease and do not provide a full coverage of the problem. Potential risks of the use of living probiotic strains, particularly in immunocompromised patients, can be eliminated with the use of tyndallized (heat-killed) postbiotic bacteria and yeast. ABB C22® is a postbiotic combination of three tyndallized yeasts, namely Saccharomyces boulardii, Saccharomyces cerevisiae, and Kluyveromyces marxianus. To assess the action of the postbiotic combination on diarrhoea, immune and gut epithelial cell signaling assays, gut barrier formation assay and rotavirus gene expression assay were performed. ABB C22® showed a strong anti-inflammatory effect, an induction of the build-up of the gut epithelium, and a degree of protection against rotavirus infection. These experimental studies support the use of the postbiotic ABB C22® as a solution for the management of diarrhoea and gastrointestinal conditions, alone or in combination with existing but incomplete treatments.

Transposable elements (TEs), also known as mobile elements (MEs), are interspersed repeats that constitute a major fraction of the genomes of higher organisms. As one of their important functional impacts on gene function and genome evolution, TEs participate in regulating the expression of genes nearby and even far away at transcriptional and post-transcriptional levels. There are two known principal ways by which TEs regulate expression of genes. First, TEs provide cis-regulatory sequences in the genome with their intrinsic regulatory properties for their own expression making them potential factors for regulating the expression of the host genes. TE-derived cis-regulatory sites are found in promoter and enhancer elements, providing binding sites for a wide range of trans-acting factors. Second, TEs encode for regulatory RNAs with their sequences showed to be present in a substantial fraction of miRNAs and long non-coding RNAs (lncRNAs), indicating the TE origin of these RNAs. Furthermore, TEs sequences were found to be critical for regulatory functions of these RNAs including binding to the target mRNA. TEs thus provide crucial regulatory roles by being part of cis-regulatory and regulatory RNA sequences. Moreover, both TE-derived cis-regulatory sequences and TE-derived regulatory RNAs, have been implicated to provide evolutionary novelty to gene regulation. These TE-derived regulatory mechanisms also tend to function in tissue-specific fashion. In this review, we aim to comprehensively cover the studies regarding these two aspects of TE-mediated gene regulation, mainly focusing on the mechanisms, contribution of different types of TEs, differential roles among tissue types, and lineage specificity, based on data mostly in humans.

Cardiomyopathies are diseases of heart muscle, a significant percentage of which are genetic in origin. Cardiomyopathies can be classified as dilated, hypertrophic, restrictive, arrhythmogenic right ventricular or left ventricular non-compaction, although mixed morphologies are possible. A subset of neuromuscular disorders, notably Duchenne and Becker muscular dystrophies, are also characterized by cardiomyopathy aside from skeletal myopathy. The global burden of cardiomyopathies is certainly high, necessitating further research and novel therapies. Genome editing tools, which include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR) systems have emerged as increasingly important technologies in studying this group of cardiovascular disorders. In this review, we discuss the applications of genome editing in the understanding and treatment of cardiomyopathy. We also describe recent advances in genome editing that may help improve these applications, and some future prospects for genome editing in cardiomyopathy treatment.

In March 2013, a novel avian influenza A H7N9 virus was emerged in China, which cause rapidly progressive pneumonia and with a high fatality rate. Serologic studies to evaluate neutralizing antibodies of infected patients and birds are invaluable tools for immunogenicity research of H7N9 and epidemiological investigation. Conventional neutralization assays are laborious and time-consuming which also hampered by biosafety requirement. In this study, We construct and produce pseudovirus bearing the full-length hemagglutinin (HA) of H7N9 virus in the Env-defective, luciferase-expressing HIV-1 backbone. The production of lentiviral pseudovirus was analysed by HA gene specific real-time reverse-transcription PCR, transmission electron microscopy (TEM), and Western Blot assay to prove the nucleic acid replication, the morphology of virus, and the expression of HA protein in pseudovirus. After that pseudovirus based inhibition assay was established to detect neutralizing antibodies of a panel of serum samples. Our results demonstrated that H7N9 pseudovirus which had single-cycle infection was generated. By comparing the neutralization antibody titers, pseudovirus based neutralization test could be recognized as an alternative of conventional microneutralization (MN). Hence, we conclude that it is possible to use pseudovirus inhibition assay to screen sera samples, as well as evaluate vaccine-induced neutralizing antibodies against H7N9 virus.

The human mandible's cancellous bone, which is characterized by its unique porosity and directional sensitivity to external forces, is crucial for sustaining biting stress. Traditional CAD models fail to fully represent bone's anisotropic structure and thus depend on simple isotropic assumptions. For our research, we use the latest versions of nTopology and Creo Parametric software to make biomimetic Voronoi lattice models that accurately reflect the complex geometry and mechanical properties of trabecular bone. The porosity of human cancellous bone is accurately modeled in this work using biomimetic Voronoi lattice models. The porosities range from 70% to 95%, which can be achieved by changing the pore sizes to 1.0 mm, 1.5 mm, 2.0 mm, and 2.5 mm. Finite element analysis (FEA) was used to examine the displacements, stresses, and strains acting on dental implants with a buttress thread, abutment, retaining screw, and biting load surface. The results show that the Voronoi model accurately depicts the complex anatomy of the trabecular bone in the human jaw, compared to standard solid block models. The ideal pore size for biomimetic Voronoi lattice trabecular bone models is 2 mm, taking into account both the von Mises stress distribution over the dental implant, screw retention, cortical bone, cancellous bone, and micromotions. This pore size displayed balanced performance by successfully matching natural bone's mechanical characteristics. Advanced finite element analysis (FEA) improves biomechanical understanding of how bones and implants interact by creating more accurate models of biological problems and dynamic loading situations. This makes biomechanical engineering better.

Background: Diabetes mellitus (DM) and osteoporosis are two of the most widespread metabolic disease in the world. The aim of this study is to investigate the prevalence of DM among patients affected by osteoporosis and fragility fractures, and to search differences in clinical features. Methods: 713 patients belonging to CTO Bone Unit because of osteoporosis and fragility fractures were divided into two groups, according to the diagnosis of DM. The clinical and bone characteristics of patients were compared. Results: Prevalence of DM was 10.8%. When compared to patients without DM, the median age at the time of first fracture was similar (72 years ± 14 IQR vs 71 years ± 12 IQR); prevalence of combination of vertebral and hip fractures was higher (p=0.039), as well as prevalence of males, although not significantly (p=0.051). Bone mineral density (BMD) at all sites was higher in DM group; Trabecular Bone Score (TBS), instead, was significantly lower (p<0.001). Conclusions: Patients with fragility fractures and DM more frequently show combination of major fractures with higher BMD levels. In these patients, TBS could be a better indicator of bone health than BMD and therefore should be used as a diagnostic tool in clinical practice.

One of the biggest threats we face globally is the emergence of antimicrobial resistant (AMR) bacteria, which runs in parallel with a lack in the development of new antimicrobials. Among these AMR bacteria, pathogens belonging to the ESKAPE group can be highlighted (Enterococcus spp, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter spp) due to their profile of drug resistance and virulence. Therefore, innovative lines of treatment must be developed for these bacteria. In this review, we summarize the different strategies for the treatment and study of molecular mechanisms of AMR in the ESKAPE pathogens based on the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated (Cas) proteins' technologies: loss of plasmid or cellular viability, random mutation or gene deletion as well directed mutations that lead to a gene's loss of function.

Diarrhoea is a serious cause of mortality worldwide that can lead to dehydration, gut barrier function impairment, nutrient malabsorption, and alterations of the gut microbiota (dysbiosis). Current solutions for its management, such as oral rehydration salts (ORS), inhibitors of the gut motility, antibiotics, and living probiotics only partially counteract the mechanisms of the disease and do not provide a full coverage of the problem. Potential risks of the use of living probiotic strains, particularly in immunocompromised patients, can be eliminated with the use of tyndallized (heat-killed) postbiotic bacteria and yeast. ABB C22® is a postbiotic combination of three tyndallized yeasts, namely Saccharomyces boulardii, Saccharomyces cerevisiae, and Kluyveromyces marxianus. To assess the action of the postbiotic combination on diarrhoea, immune and gut epithelial cell signaling assays, gut barrier formation assay and rotavirus gene expression assay were performed. ABB C22® showed a strong anti-inflammatory effect, an induction of the build-up of the gut epithelium, and a degree of protection against rotavirus infection. These experimental studies support the use of the postbiotic ABB C22® as a solution for the management of diarrhoea and gastrointestinal conditions, alone or in combination with existing but incomplete treatments.

The development of CRISPR associated proteins, such as Cas9, has led to increased accessibility and ease of use in genome editing. However, additional tools are needed to quantify and identify successful genome editing events in living animals. We developed a method to rapidly and quantitatively monitor gene editing activity non-invasively in living animals that also facilitates confocal microscopy and nucleotide level analyses at the end of study. Here we report a new CRISPR “footprinting” approach to activate luciferase and fluorescent proteins in mice as a function of gene editing. This system is based on experience with our prior Cre-detector system and is designed for Cas editors able to target LoxP including gRNAs including SaCas9 and ErCas12a [1, 2]. These CRISPRs cut specifically within LoxP, an approach that is a departure from previous gene editing in vivo activity detection techniques that targeted adjacent stop sequences. In this sensor paradigm, CRISPR activity was monitored non-invasively in living Cre reporter mice (FVB.129S6(B6)-Gt(ROSA)26Sortm1(Luc)Kael/J and Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J, which will be referred to as LSL and mT/mG throughout the paper) after intramuscular or intravenous hydrodynamic plasmid injections, demonstrating utility in two diverse organ systems. The same genome-editing event was examined at the cellular level in specific tissues by confocal microscopy to determine the identity and frequency of successfully genome-edited cells. Further, SaCas9 induced targeted editing at efficiencies that were comparable to Cre recombinase demonstrating high effective delivery and activity in a whole animal. This work establishes genome editing tools and models to track CRISPR editing in vivo non-invasively and to fingerprint the identity of targeted cells. This approach also enables similar utility for any of the thousands of previously generated LoxP animal models.

Conventional plant breeding has contributed enormously towards feeding the world and has played crucial roles in the development of modern society. The conventional method creates variation by transferring genes between or within the species. In general, these methods are more expensive and takes more time, to overcome these limitations, new technology is required. Genome editing is a powerful tool for biotechnology applications, with the capacity to alter the function of any gene. With the availability of gene information for the majority of the traits, genome editing emerged as a potential to create a new variation with the introduction of any transgene. The important genome editing tools used nowadays are ZFNs, TALEN, Pentatricopeptide repeats protein, adenine base editor, RNA interference, and CRISPR/Cas9. These tools have opened a new era for crop improvement. Due to the complex genetic architecture of most traits, it is challenging to edit genes controlling them. To overcome these challenges, genome editing provides a broader perspective. Among the above-mentioned tools, CRISPR/Cas9 is the most powerful tool for gene editing. These technologies are being used to create abiotic and biotic resistance crop varieties.

Many farms are replacing the lighting with light emitting diode (LED) bulbs because of the technological modernization. We aimed to investigate the effects of incandescent light (IL) and LED lighting on Cobb500 broiler chickens for six weeks. Production parameters (body weight, feed consumption, feed conversion ratio), calculated slaughter values (yield%, relative breast%, thigh%) and breast meat quality parameters (pH at 45 min and 24 h postmortem, color, drip loss, kitchen equipment losses, shear force, meat composition) were recorded. Non-stop recordings were used to analyze the behavior of the birds in several periods of the rearing. LED group was significantly better in body weigh parameter between week 1-5 and feed conversion ratio between week 2-3. The most significant difference in behavior was observed in the middle of the rearing period. The chickens in the LED group spent more eating time, drinking time, interacting, and resting less. There was no difference in the meat quality parameters, only shear force was significantly lower in the LED group (1781.95±0.33 g/s vs. 2098.82±0.42 g/s). Based on our results, LED lighting can bring positive changes in animal production efficiency, behavior, and important characteristics for meat consumers.

Music has the innate potential to reach all parts of the brain, stimulates certain brain areas which are not achievable through other modalities. Music Therapy (MT) is being used for more than a century to treat individuals who needs personalized care. MT optimizes motor, speech and language responsibilities of the brain and improves cognitive performance. Pervasive developmentdisorder (PDD) is a multifaceted, neuro developmental disorder and autism spectrum disorder (ASD) comes under PDD, which is defined by deficiencies in three principal spheres: social connection with others, communicative and normal movement skills. The conventional imaging studies illustrate reduced brain area connectivity in people with ASD, involving selected parts of the brain cortex. People with ASD express much interest in musical activities which engages the brain network areas and improves communication and social skills.The main objective of this review is to analyze the potential role of MT in treating the neurological conditions, particularly ASD. Evidence based studies have reported the extensive therapeutic application of music on various part of the brain in a nonverbal child with autism through hearing or making music.Hence we hypothesized that MT intervention can improve the communication capacity in people with ASD, than customary neurorestoration therapy alone.

Proposed fundamental laws of biology and a model of health and disease underscore the importance of the lymphatic system. The lymphatics are responsible for two of the laws of biology and the fulcrum of health and disease balancing proliferation with regeneration through the immune system. It is responsible for protection from the environment and repair of senile and damaged tissue. Life is constantly bombarded by forces that increase entropy. Lymphatics provide negative entropy to maintain health. Lymphatics help maintain cellular homeostasis removing products of metabolism. Using these principles, the role of lymphatics is investigated in salt sensitivity hypertension, cardiorenal system, the new pillar of heart failure and kidney disease - Sodium-Glucose Transport Protein 2 (SGLT2) Inhibitors, and brain diseases. The realization of organ lymphatics in maintenance of health and disease opens the avenue to new therapeutics. This is the unrealized potential of lymphatic study.

The key links of face recognition are digital image preprocessing, facial feature extraction and pattern recognition, this article aimed at the current problem of slow speed and low recognition accuracy of face recognition , from the above three key links, on the basic of analyzing the therories of Fractional Differential Masks Operator (FDMO), Principal Component Analysis (PCA) and Support Vector Machine (SVM), design a kind of FDMO+PVA+SVM coupling algorithm that applies to face recognition to improve the speed and accuracy of it. To realize FDMO+PCA+SVM coupling algorithm, first, we should apply FDMO to face image processing binary marginalization, the purpose is getting face contour; Then, we apply PCA to get the feature of face image which is disposed by binary marainalization. At last, we can apply One-Against All of the SVM classifier and LibSVM software package to realize face recognition. Beside, the article with nine different coupling algorithm design four groups of experimental reaults on the ORL face database verified by comparative analysic FDMO+PCA+SVM coupling algorithm in the superiority of face recognition accuracy and speed.

Molnupiravir, a prodrug known for its broad antiviral activity, demonstrated efficacy in animal models of Covid-19, prompting clinical trials where initial results indicated a significant effect against the disease. However, subsequent clinical studies did not confirm these findings, leading to the rejection of molnupiravir for permanent market authorization in many countries. This report critically assessed 19 studies published in 17 reports that investigated the efficacy of molnupiravir in animal models of Covid-19 with the purpose of determining how well the design of these models informed human studies. We found that the administered doses of molnupiravir in most studies involving animal Covid-19 models were disproportionately higher than the dose rec-ommended for human use. Specifically, when adjusted for body surface area, half of the doses of molnupiravir used in the animal studies were more than twice as high as the human dose. Addi-tionally, the drug was frequently given prophylactically or shortly after SARS-CoV-2 inoculation in these models, in contrast to clinical trials where such timing is not consistently achieved. Furthermore, the recommended five-day treatment duration for humans was exceeded in several animal studies. Collectively, we suggest that these design elements in the reported animal studies contributed to a bias favoring molnupiravir, and thus inflated expectations for its efficacy against Covid-19. Addressing these elements may offer avenues to enhance the clinical efficacy of mol-nupiravir for treatment of Covid-19 that include dose increment, early treatment, and admin-istration by inhalation along with use of molnupiravir in antiviral combination therapy.

Neurological disorders are the leading cause of cognitive and physical disability worldwide, affecting 15% of the global population. Due to the demographics of aging, the prevalence of neurological disorders, including neurodegenerative diseases, will double over the next two decades. Unfortunately, while available therapies provide symptomatic relief for cognitive and motor impairment, there is an urgent unmet need to develop disease-modifying therapies that slow the rate of pathological progression. In that context, biomarkers could identify at-risk and prodromal patients, monitor disease progression, track response to therapy, and parse causality of molecular events to identify novel targets for further clinical investigation. Thus, identifying biomarkers that discriminate between diseases and reflect specific stages of pathology would catalyze the discovery and development of therapeutic targets. This review will describe the prevalence, known mechanisms, ongoing or recently concluded therapeutic clinical trials, and biomarkers of three of the most prevalent neurodegenerative diseases, including Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), and Parkinson’s disease (PD).

In view of the problem that the output thrust of solenoid actuator is affected by various factors and is difficult to calculate in actual working conditions, this paper proposes a semi-analytical model constructed by magnetic field subdomain method with internal and external boundary conditions in cylindrical coordinate system for calculation, and the general solution equations of magnetic vector potential for each subdomain are derived and solved by MATLAB. Taking a push-pull electromagnet as an example, the finite element simulation and experimental comparative analysis are carried out. The correctness and applicable conditions of the subdomain method are illustrated by comparing the gradient plot of magnetic vector potential, inductance curve and electromagnetic force. By calculating the output thrust after considering the core gravity, spring force and electromagnetic force, it is shown that this method has the advantage of computational flexibility compared with the finite element method, and it is easier to write special algorithms according to various working conditions to calculate the important parameters in engineering applications.

Despite the successful introduction of oral cholera vaccines, Zambia continues to experience multiple, sporadic, and protracted cholera outbreaks in various parts of the country. While vaccines have been useful in staying the cholera outbreaks, the ideal window for re-vaccinating individual’s resident in cholera hotspot areas remains unclear. Using a prospective cohort study design, 225 individuals were enrolled, re-vaccinated with two doses of Shanchol™ regardless of previous vaccination and followed-up for 90 days. Bloods collected at baseline before re-vaccination, at day 14 prior to second dosing and subsequently on days 28, 60, and 90. Vibriocidal assay was performed on samples collected at all five time points. Our results showed that anti-LPS and vibriocidal antibody titers increased at day 14 after re-vaccination and decreased gradually at 28, 60 and 90 across all the groups. Seroconversion rates were generally comparable in all treatment arms. We therefore conclude that vibriocidal antibody titers generated in response to re-vaccination still wane quickly irrespective of previous vaccination status. However, despite the observed decline, the levels of vibriocidal antibodies remained elevated over baseline values across all groups, an important aspect for Zambia where there is no empirical evidence as to the ideal time for re-vaccination.

Sensory integration is an essential function of human life, and its decline causes difficulties in the quality of life, especially in older adults. In this study, we proposed an arm-reaching task based on a virtual reality head-mounted display (VR-HMD) system to assess sensory integration in daily life, and examined whether reaching task performance was associated with age and resting-state functional connectivity (rsFC) between the brain regions of interest involved in sensory integration. We hypothesized that performance during a reaching task with multiple cognitive loadings would be affected by aging. The gap angle between the reaching hand and target positions was compared between older and middle-aged adults as a measure of sensory integration function. In addition, rsFC, which was significantly correlated with the gap angles of individual participants in the older adult group, was identified using resting-state functional magnetic resonance imaging data. The mean gap angle was significantly larger in the older adults than in the middle-aged group and was also significantly correlated with connections between the left primary motor area and the left inferior temporal gyrus, temporo-occipital part. Because the connectivity between the areas is known to be related to visuomotor integration, the results suggest the involvement of visuomotor integration in the decline of sensory integration function in old age and the validity of the gap angle during the proposed VR-HMD task as an index for the decline in function.

Using nanoparticles (NPs) in drug delivery has exhibited promising therapeutic potential 13 in various cancer types. Nevertheless, several challenges must be addressed, including the 14 formation of the protein corona, reduced targeting efficiency and specificity, potential immune 15 responses, and issues related to NP penetration and distribution within 3-dimensional tissues. 16 To tackle these challenges, we have successfully integrated iron oxide nanoparticles into 17 neuroblastoma-derived extracellular vesicles (EVs) using the parental labeling method. We first de- 18 veloped a tissue-engineered (TE) neuroblastoma model, confirming the viability and proliferation 19 of neuroblastoma cells for at least 12 days, supporting its utility for EV isolation. Importantly, EVs 20 from long-term cultures exhibited no differences compared to short-term cultures. Concurrently, 21 we designed Rhodamine (Rh), Polyacrylic acid (PAA)-functionalized magnetite nanoparticles 22 (Fe3O4@PAA-Rh) with high crystallinity, purity, and superparamagnetic properties (average size: 23 9.2 ± 2.5 nm). We then investigated the internalization of Fe3O4@PAA-Rh nanoparticles within 24 neuroblastoma cells within the TE model. Maximum accumulation was observed overnight while 25 ensuring robust cell viability. However, nanoparticle internalization was low. Taking advantage of 26 the enhanced glucose metabolism exhibited by cancer cells, glucose (Glc)-functionalized nanoparti- 27 cles (Fe3O4@PAA-Rh-Glc) were synthesized, showing superior cell uptake within the 3D model 28 without inducing toxicity. These glucose-modified nanoparticles were selected for parental labeling 29 of the TE models, showing effective NPs encapsulation into EVs. 30 Our research introduces innovative approaches to advance NPs delivery. By partially addressing 31 the challenges associated with 3D systems, optimizing internalization, and enhancing NPs stability 32 and specificity through EV-based carriers. Also, our findings hold the promise of more precise and 33 effective cancer therapies while minimizing potential side effects.

Aiming at the limitations of single-functionality, limited applicability, and complex designs prevalent in current metasurfaces, we propose a terahertz multifunctional and multiband tunable metasurface utilizing a VO2-metal hybrid structure. This metasurface structure comprises a top VO2-metal resonance layer, a middle polyimide dielectric layer, and a gold film reflective layer at the bottom. This metasurface exhibits multifunctionality, operating independently of polarization and incident angle. The varying conductivity states of the VO2 layers, enable the metasurface to achieve various terahertz functionalities, including single-band absorption, broadband THz absorption, and multiband perfect polarization conversion for linear (LP) and circularly polarized (CP) incident waves. Finally, we believe that the functional adaptability of the proposed metasurface expands the repertoire of options available for future terahertz device designs.

Whole genome duplication (WGD) or polyploidization can occur at the cellular, tissue, and organismal levels. At the cellular level, tetraploidization has been proposed as a driver of aneuploidy and genome instability, and correlates strongly with cancer progression, metastasis, and development of drugs resistance[1–6]. WGD is also a key developmental strategy for regulating cell size, metabolism, and cellular function[1,7–10]. In specific tissues, WGD is involved in normal development (e.g. organogenesis), tissue homeostasis, wound healing, and regeneration[10–17]. At the organismal level, WGD propels evolutionary processes such as adaptation[18], speciation[19], and crop domestication[20]. An essential strategy to further our understanding of the mechanisms promoting WGD and its effects is to compare isogenic strains that differ only in their ploidy. Caenorhabditis elegans (C. elegans) is emerging as an animal model for these comparisons, in part because relatively stable and fertile tetraploid strains can be produced rapidly from nearly any diploid strain[7]. Here we review the use of Caenorhabditis polyploids as tools to understand important developmental processes (e.g. sex determination, dosage compensation, and allometric relationships)[21–27] and cellular processes (e.g. cell cycle regulation, chromosome dynamics during meiosis)[28–32]. We also discuss how the unique characteristics of the C. elegans WGD model will enable significant advances in our understanding of mechanisms of polyploidization and its role in development and disease.

In this study, a commercial sodium butyrate protected by a new buffer salt solution (NSB) was tested to determine whether it can be used as an antibiotic alternative in broiler production. 192 1-day-old broilers were randomly allocated to three dietary treatments: soybean meal diet (CON), antibiotic diet (ANT, basal diet + 100 mg/kg aureomycin), and NSB (basal diet + 800 mg/kg NSB). The growth performance, serum anti-inflammatory cytokines, intestinal morphology, gut barrier function, antioxidative parameters, SCFAs content, and cecal microbiota were analyzed. The result showed that NSB significantly improved ADFI, ADG (p < 0.01), and decreased FCR (p < 0.01). Serum anti-inflammatory cytokine IL-10 was up-regulated (p < 0.01), and pro-inflammatory TNF-α was down-regulated (p < 0.05) by NSB supplementation. H&E results showed that VH and VH: CD ratio significantly increased (p < 0.05) in the jejunum and ileum in the NSB group. Furthermore, ZO-1 (p < 0.01), claudin-1 (p < 0.01), and occludin (p < 0.05) in the jejunum and claudin-1 (p < 0.01) and mucin-2 (p < 0.05) in the ileum significantly up-regulated in the NSB group, respectively. Additionally, SOD (p < 0.05) and T-AOC/MDA ratio (p < 0.01) in the jejunum and SOD in the ileum were significantly increased (p < 0.05) in the NSB group. The MDA level also significantly increased (p < 0.01) in the ANT group in the jejunum. Propionic acid (p < 0.05) and butyric acid (p < 0.01) content significantly increased in the NSB group in the jejunum and ileum segments. The 16S rRNA sequencing results showed no significant difference (p > 0.05) in alpha and beta diversity among the groups. LEFSe analysis also indicated that Peptostreptococcaceae, Colidextribacter, Firmicutes, Oscillospira, and Erysipelatoclostridiaceae, which promote SCFA production (p < 0.05), were identified as dominant taxon-enriched bacterial genera in the NSB group. The Spearman correlation analysis revealed that Colidextribacter with ADFI, ADG, VH, claudin-1 (p < 0.05), and unclassified_f__Peptostreptococcaceae with ADFI, IL-10, and ZO-1 were positively correlated (p < 0.05). Furthermore, ADFI and ADG with IL-10, claudin-1, SOD, T-AOC, and butyric acid (p < 0.05), and similarly, ADG with VH (p < 0.05) showed a positive correlation. In conclusion, NSB enhanced the growth performance by improving jejunum and ileum morphology, serum anti-inflammatory cytokines, regulating intestinal barrier function and antioxidant capacity, SCFAs content, and cecum microbiota, showing its potential use as an alternative to antibiotics in poultry nutrition.

With the rising cost of animal feed protein, finding affordable and effective substitutes is crucial. Walnut kernel cake, a polyphenols, fiber, protein and fat-rich byproduct of walnut oil extraction, has been underexplored as a potential protein replacement in pig feed. In this study, we found that feeding large Diqing Tibetan pigs walnut kernel cake promoted adipose deposition and improved pork quality during pig growth. Transcriptome analysis revealed the upregulation of genes ANGPTL8, CCNP, ETV4, and TRIB3, associated with adipose deposition. Pathway analysis highlighted enrichment in adipose-deposition-related pathways, including PPAR, Insulin, PI3K-Akt, Wnt, and MAPK signaling. Further analysis identified DEGs (differentially expressed genes) positively correlated with adipose-related traits, such as PER2 and PTGES. Single-cell transcriptome data pointed to the specific expression of CD248 and PTGES in adipocyte progenitor/stem cells (APSCs), pivotal for adipocyte differentiation and adipose deposition regulation. This study demonstrates walnut kernel cake's potential to substitute soybean cake in pig feed, providing high-quality protein and promoting adipose deposition. It offers insights into feed protein replacement, human functional food, fat metabolism, and related diseases, with marker genes and pathways supporting pig breeding and pork quality improvement.

Gene regulation is vital for cellular function and homeostasis, involving diverse mechanisms controlling specific gene products and contributing to tissue-specific gene expression. Dysregulation leads to diseases, emphasizing the need for understanding these mechanisms. Non-coding regions, notably enhancers and super-enhancers (SEs), act as crucial gene regulators, orchestrating transcriptional activity via transcription factors (TFs). SEs, with high activity, are pivotal in cell identity and disease progression. Current computational approaches focus on individual regulators like TFs and miRNAs, neglecting SE interactions. We emphasize incorporating SEs into models to enhance understanding. Experimental studies have recently linked miRNAs and TFs to SEs. Chromatin immunoprecipitation followed by sequencing (ChIP-Seq) provides valuable SE information. In this review, we categorize computational methods leveraging TF and miRNA data into three areas and explore challenges integrating enhancers/SEs. These include unraveling indirect regulatory networks, identifying network motifs, and enriching pathway identification by dissecting gene regulators, including SEs. We hypothesize that addressing these challenges will enhance our understanding of gene regulation, aiding in identifying therapeutic targets and disease biomarkers. We believe that understanding the role of ChIP-Seq data in predicting the effect of miRNA on gene regulation is crucial to construct statistical/computational model that would tackle these challenges.

One of the most crucial elements in deeply understanding humans on a psychological level is manifested through facial expressions. The analysis of a human behavior can be informed by their facial expressions, making it essential to employ indicators such as expression (Expr), valence-arousal (VA), and action units (AU). In this paper, we introduce the method proposed in the Challenge of the 6th Workshop and Competition on Affective Behavior Analysis in-the-wild (ABAW) at CVPR 2024. Our proposed method utilizes the multi-modal Aff-wild2 dataset, which is splitted into spatial and audio modalities. For the spatial data, we extract features using a SimMiM model that was pre-trained on a diverse set of facial expression data. For the audio data, we extract features using a WAV2VEC model. To fusion the extracted spatial and audio features, we employed the cascaded cross-attention mechanism of a transformer.

Water resources provided by alpine glaciers are an important pillar for people living in the arid regions in the west of China. In this study, the HBV (Hydrologiska Byrans Vattenavdelning) light model was applied to simulate glacier mass balance and runoff in the Koxkar River Basin (KRB) on the south slope of Mt. Tumur, western Tianshan Mts.. Daily temperature and precipitation were calculated by multiple linear regressions and gradient-inverse distance weighting, respectively, based on in-situ observed data by automatic weather stations (AWSs) in the basin (2007–2009) and at four meteorological stations neighbering the basin (1959–2009). Observed daily air temperature and precipitation were taken as input data for the HBV model, which was calibrated using runoff in 2007/08 and 2009/10, and validated in 2008/09 and 2010/11. Generally, the model could simulate runoff very well. The annual glacier mass balance and runoff were calculated using the HBV model driven by interpolated meteorological data for the period of 1959–2009. The simulated glacier mass balance were reasonable when compared with those observed values at nearby glaciers, indicating a decrease trend of mass balance in the basin with an average value of –370.4 mm a^-1 since 1959. The annual runoff showed a slight increase trend (5.51 mm a^-1). Futher analysis indicated that the runoff is more sensitive to temperature than precipitation amuont in the Koxkar river basin.

Tomato (Solanum lycopersicum) is one of the most cultivated vegetables in the world due to its consumption in a large variety of raw, cooked, or processed foods. Tomato breeding and productivity highly depend on the use of hybrid seeds and their higher yield, environmental adaption, and disease tolerance. However, the emasculation procedure during hybridization raises tomato seed production costs and labor expenses. Using male sterility is an effective way to reduce the cost of hybrid seeds and ensure cultivar purity. Recent developments in CRISPR genome editing technology enabled tomato breeders to investigate the male sterility genes and to develop male-sterile tomato lines. In the current study, the tomato Acotinase (SlACO) gene family was investigated via in-silico tools and functionally characterized with CRISPR/Cas9-mediated gene disruption. Genome-wide blast and HMM search represented two SlACO genes located on different tomato chromosomes. Both genes were estimated to have a segmental duplication in the tomato genome due to their identical motif and domain structure. One of these genes, SlACO2, showed a high expression profile in all generative cells of tomato. Therefore, the SlACO2 gene was targeted with two different gRNA/Cas9 construct to identify their functional role in tomato. The gene was mutated in a total of 6 genome-edited tomato lines, 2 of which were homozygous. Surprisingly, pollen viability was found to be extremely low in mutant plants compared to their wild-type (WT) counterparts. Likewise, the number of seeds per fruit also sharply decreased more than fivefold in mutant lines (10-12 seed) compared to that in WT (67 seed). The pollen shape, anther structures, and flower colors/shapes were not significantly varied between the mutant and WT tomatoes. The mutated lines were also subjected to salt and mannitol-mediated drought stress to test the effect of SlACO2 on abiotic stress tolerance. The results of the study indicated that mutant tomatoes have higher tolerance with significantly lower MDA content under stress conditions. This is the first CRISPR-mediated characterization of ACO genes on pollen viability, seed formation, and abiotic stress tolerance in tomato.

The emergence of the COVID-19 pandemics prompted a fast development of novel diagnostic methods of the etiologic virus SARS-CoV-2. Methods based on CRISPR-Cas systems have been particularly promising because they can achieve a similar sensitivity and specificity to the golden standard RT-qPCR, especially when coupled to an isothermal pre-amplification step. Furthermore, they have also solved inherent limitations of RT-qPCR that impede its decentralized use and deployment in the field, such as the need for expensive equipment, high cost per reaction, and delivery of results in hours, among others. In this review, we evaluate publicly available methods to detect SARS-CoV-2 that are based on CRISPR-Cas and isothermal amplification. We critically analyze the steps required to obtain a successful result from clinical samples and pinpoint key experimental conditions and parameters that could be optimized or modified to improve clinical and analytical outputs. The COVID outbreak has propelled intensive research in a short time, which is paving the way to develop effective and very promising CRISPR-Cas systems for the precise detection of SARS-CoV-2. This review could also serve as an introductory guide to new labs delving into this technology.