Tyrosyl-DNA phosphodiesterase 1 (TDP1) is a human DNA repair protein. It is a member of the phospholipase D family based on the structure similarity. TDP1 is a key enzyme involved in repairing stalled topoisomerase 1 (TOP1)-DNA complexes. Previously we obtained with the CRISPR/Cas9 method HEK293A cells with the homozygous knockout of the Tdp1 gene and used knockout cells as a cellular model for studying the mechanisms of anticancer therapy. In this work we studied for the first time by transcriptomic analysis the effect of Tdp1 gene knockout on genes expression changes in human HEK293A cell line. We received original data that may indicate a role of TDP1 in other process besides repair of DNA-TOP1 complex. The differentially expressed genes (DEGs) analysis revealed that TDP1 could be involved in different processes such as cell adhesion and communication, spermatogenesis, mitochondrial function, neurodegeneration, cytokine response, and MAPK pathway signaling.

UPF3B is a constituent of the classical nonsense-mediated mRNA decay (NMD) pathway that degrades both the aberrant transcripts and a set of physiological transcripts. In higher eukaryotes, UPF3B have significant biochemical functions in diverse cellular processes including NMD and translation. UPF3B plays a crucial role in neuronal development and differentiation. Next-generation sequencing technologies identified several loss-of-function mutations in the UPF3B gene that results in neuro-developmental disorders in humans. To uncover the mechanistic role of UPF3B in neuronal functions, we have generated the UPF3B-knockout mammalian cell line model system using CRISPR-Cas9 gene editing method. RNA-Sequencing Analysis of cellular transcriptome from UPF3B-KO cells identified specific genes involved in cell growth and neuronal functions. Altered expression of genes related to the axon guidance pathway delineated the UPF3B function to regulate the neuron-specific genes. Functional enrichment analysis identified the genes involved in the disorders related to mental health and intellectual disability. Our study has the potential to identify the direct players of intellectual disability and will have broader implications.

Novel Cellular Immunotherapy with engineered T cells has improved cancer treatment and established therapeutic promises to prevent tumor formation in clinical studies. Due to certain restrictions and difficulties, CAR and TCR T cells therapies were inadequate at points. CRISPR Cas9 genome-editing tool has a significant potential for these two cell-based therapies. As a specialized gene-editing technique, CRISPR Cas9 is used to repair genetic alternation with minimum damage. It is used as an adjunct to Immunotherapy to stimulate a more robust immune response. CRISPR has long outpaced other target-specific genome editing methods such as ZFNs and TALEN due to its high efficiency, competence in targeting, and stable operating condition. CRISPR can overcome the two major drawbacks of universal CAR T cells: allorejection and graft-vs-host disease. TCR-based T cell treatment can reduce inappropriate binding between endogenous and transgenic TCR, resulting in a reduction of severe toxicity. The CAR and TCR T based cell therapies uphold an excellent future for tumor malignancies This article has elucidated the administration of CRISPR Cas9 in Novel Cellular Immunotherapy, CAR, and TCR T cell therapy. However, this article did not fail to observe this technology's ethical concerns, limitations, and challenges. Furthermore, the article compares CRISPR-mediated allogeneic CAR T cell to TCR-T cell therapy.

The growing population meet the challenge for agricultural production. CRISPR/Cas9 technology is based on plant research for the development of the new varieties as well as disease resistance crops. In addition the deletion of significant characters makes the new alleles from the CRISPR/Cas9. Recent and reliable molecular scissor for genetic engineering. The review is focused on the various application of the CRISPR/Cas9 technology in plant enhancement of plant disease resistance, stress burden in plant, nutritional improvement, and quality of crops from the CRISPR/Cas9 system. The clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein9 (cas9) is adopted from the prokaryotic type II system. CRISPR/Cas9 is simplicity and efficiency than ZENs and TALENs for the genome engineering. Due to rapid growing of the CRISPR/Cas9 system has been formulate the adaptation of many plant species. The current advancement of plants and future schemes of improve of CRISPR technology has been presented in contest of multiplex editing, knowledge on induced mutation whether the factor effect in CRISPR/Cas9 technology in plant. Remarkable perspective and challenges of CRISPR/Cas9 technology in significance of plant genetic modification.

Duchenne muscular dystrophy (DMD) is a fatal X-linked recessive neuromuscular disease prevalent in 1 in 3500 to 5000 males worldwide. As a result of mutations that interrupt the reading frame of the dystrophin gene (DMD), DMD is characterized by a loss of dystrophin protein which leads to decreased muscle membrane integrity, which increases susceptibility to degeneration. CRISPR/Cas9 technology has garnered interest as an avenue for DMD therapy due to its potential for permanent exon skipping, which can restore the disrupted DMD reading frame in DMD and lead to dystrophin restoration. An RNA-guided DNA endonuclease system, CRISPR/Cas9 allows for the targeted editing of specific sequences in the genome. The efficacy and safety of CRISPR/Cas9 as a therapy for DMD has been evaluated by numerous studies in vitro and in vivo, with varying rates of success. Despite the potential of CRISPR/Cas9-mediated gene editing for the long-term treatment of DMD, its translation into the clinic is currently challenged by issues such as off-targeting, immune response activation, and sub-optimal in vivo delivery. Its nature as being mostly a personalized form of therapy also limits applicability to DMD patients, who exhibit a wide spectrum of mutations. This review summarizes the various CRISPR/Cas9 strategies that have been tested in vitro and in vivo for the treatment of DMD. Perspectives on the approach will be provided, and the challenges faced by CRISPR/Cas9 in its road to the clinic will be briefly discussed.

Antisocial behavior is a behavior disorder inherited according to the inheritance of X-linked chromosome. This disorder derives from mutations in the MAOA gene. One of the mutations results in the MAOA-L allele activity. The MAOA-L allele activity can cause antisocial behavior in both healthy and unhealthy people. Antisocial behavior from healthy males can originate from maltreatment during childhood. Currently, MAOA inhibitor can reverse antisocial behavior to normal behavior in animal models. However, this disorder cannot be treated permanently; to treat it permanently in the future, technologies such as CRISPR/Cas9, iPSCs and ssODN are required. These technologies have succeeded to correct erroneous segments in the F8 gene and F9 gene. Both genes occupy the X chromosome. The MAOA gene also occupies the X chromosome. Therefore, it is reasonable to state that CRISPR/Cas9 and iPSCs technique for instance can be beneficial tools to edit the MAOA gene to treat antisocial behavior. CRISPR/Cas9 can be used in combination with iPSCs or ssODN for instance. This combination can greatly help the permanent healing of antisocial behavioral disorders.

BACKGROUND: Chronic hepatitis B infected with Hepatitis B virus remains a major health concern worldwide. Despite standard interferon-α and nucleotide analogues have been shown to reduce the deterioration of liver disease among chronic hepatitis B patients, covalently closed circular DNA was still difficult to eradicate. METHODS: A literature search of Pubmed and Web of science was performed with the following key words: ‘CRISPR’, ‘CRISPR/Cas9’, ‘hepatitis B’, ‘HBV’, ‘chronic hepatitis B’ and ‘HBV cccDNA’. The information about CRISPR/Cas9 for the treatment of HBV cccDNA or hepatitis B was reviewed. RESULTS: CRISPR/Cas9 could treat hepatitis B through suppressing or clearing HBV cccDNA with different gRNAs. CONCLUSION: With the emergence of CRISPR/Cas9 (the RNA-guided clustered regulatory interspaced short palindromic repeats, CRISPR) editing technology, clearance of hepatitis B virus and better prevention of liver carcinoma seemed to be possible.

In the last decade, the genetic engineering world has been shaken up by a relatively new genetic editing tool based on RNA-guided Nucleases (RGNs): the CRISPR/Cas9 system. Since the first report in 1987 and its characterization in 2007 as a bacterial defense mechanism, the interest and research on this system have grown exponentially. CRISPR systems provide immunity to bacteria against invading genetic material; however, with specific modifications in sequence and structure, it becomes a precise editing system that makes it possible to genetically modify almost any organism. There are diverse approaches regarding the refinement of these modifications, such as constructing more accurate nucleases, understanding the cellular context and facing the epigenetic conditions, or re-designing guide RNAs (gRNAs). Considering the critical importance for the correct CRISPR/Cas9 systems performance, our scope will emphasize in the latter approach. Hence, we present an overview of the past and the most recent guide RNA web-based design tools, highlighting their computational architecture and gRNA characteristics evolution through the years. Our study concisely explains the computational approaches that use machine learning techniques, deep neural networks, and large datasets of gRNA/target interactions to make possible both predictions and classifications directed to design, optimize, and create promising gRNAs suitable for future gene therapies.

The RNA-guided endonuclease system CRISPR-Cas9 has been extensively modified since its discovery, allowing its capabilities to be extending far beyond double-stranded cleavage to high fidelity insertions, deletions, and single base edits. Such innovations have been possible due to the modular architecture of CRISPR-Cas9 and the robustness of its component parts to modifications and the fusion of new functional elements. Here, we review the broad toolkit of CRISPR-Cas9-based systems now available for diverse genome editing tasks. We provide an overview of their core molecular structure and mechanism and distil the design principles used to engineer their diverse functionalities. We end by looking beyond the biochemistry and towards the societal and ethical challenges that these CRISPR-Cas9 systems face if their transformative capabilities are to be deployed in a safe and acceptable manner.

CRISPR/Cas9 has emerged as the predominant method for genome editing due to its cost-effectiveness and broad applicability, playing a crucial role in advancing sustainable practices across various sectors. This systematic review leverages the PRISMA methodology to explore CRISPR/Cas9's impact on environmental protection, thereby supporting the Sustainable Development Goals (SDGs). Analyzing data from the Web of Science, the review found significant growth in related publications, with a 30% increase since 2014, predominantly from the US, China, Germany, and the UK. The study categorizes the scientific developments into three trends: advancements in agriculture, gene editing techniques, and biofuel production. Key discussions include the use of CRISPR/Cas9 in developing fourth-generation biofuels and environmental biosensors, as well as its applications in enhancing genetic resilience and controlling invasive species. These innovations highlight CRISPR/Cas9's potential in promoting sustainable resource management and energy generation, marking a pivotal contribution to ecological conservation and sustainability efforts.

Clustered regularly interspaced short palindromic repeats/associated protein 9 nuclease (CRISPR/Cas9) technology guided by a single-guide RNA (sgRNA) has recently opened a new avenue for antiviral therapy. A unique capability of the CRISPR/Cas9 system is multiple genome engineering. However, there are few applications in insect viruses by a single Cas9 enzyme targeting two or more sgRNA at different genomic sites for simultaneous production of multiple DNA breaks. To address the need for multi-gene editing and sustained delivery of multiplex CRISPR/Cas9-based genome engineering tools, we developed a one-vector (pSL1180-Cas9-U6-sgRNA) system to express multiple sgRNA and Cas9 protein to excise Bombyx mori nucleopolyhedrovirus (BmNPV) in insect cells. Here, ie-1, gp64, lef-11, and dnapol genes were screened and identified as multiple sgRNA editing sites according to the BmNPV system infection and DNA replication mechanism. Furthermore, we constructed a multiplex editing vector sgMultiple to efficiently regulate multiplex gene editing steps and inhibit BmNPV replication after viral infection. This is the first report that describes the application of multiplex CRISPR/Cas9 system inhibiting insect virus replication. This multiplex system can significant enable the potential of CRISPR/Cas9-based multiplex genome engineering in transgenic silkworms.

Clustered regularly interspaced short palindromic repeats or CRISPR, one of the major technological tools from nature's toolbox, has revolutionized the scientific world with its potential use in humans and plants. CRISPR Cas9 was first known as an adaptive immune system of bacteria. It is a system that cleaves foreign DNA. It has been exploited to be used as a genome editing tool for correcting genetic diseases in humans, for plants to create stress-resistant plants, and for a variety of different purposes. This review provides a basic overview of its applications in different areas of biological research. It has immense potential for a variety of researches, but it's still a mystery for science. It feels like scientists just know a tip of an iceberg.

Fanconi anemia (FA) develops due to a mutation in one of the FANC genes that are involved in repair of interstrand crosslinks (ICLs). FANCG, a member of the FA core complex, is essential for ICL repair. Previous FANCG-deficient mouse models were generated with drug-based selection cassettes in mixed mice backgrounds, leading to a disparity in interpretation of genotype-related phenotype. To exclude these confounders, we created a Fancg-KO (KO) mouse model using CRISPR/Cas9. The entire Fancg locus was targeted and maintained on the immunological well-characterized C57BL/6J background. Intercrossing of heterozygous mice resulted in sub-Mendelian numbers of homozygous mice, suggesting loss of FANCG can be embryonic lethal. KO mice displayed infertility, hypogonadism but no other developmental problems. Bone marrow analysis revealed a defect in various hematopoietic stem and progenitor subsets with a bias towards myelopoiesis. Cell lines derived from Fancg-KO mice were hypersensitive to crosslinking agents-cisplatin and Mitomycin C, and Fancg-KO mouse embryonic fibroblasts (MEFs) displayed increased γ-H2AX upon cisplatin treatment. Reconstitution of these MEFs with Fancg cDNA corrected for the ICL hypersensitivity. Collectively, this project provides a new, genetically and immunologically well-defined Fancg-KO mouse model for further in vivo and in vitro studies on FANCG and ICL repair.

CRISPR-Cas9 technology allows the modification of DNA sequences in vivo at the location of interest. Although CRISPR-Cas9 can produce genomic changes that do not require DNA vector carriers, the use of transgenesis for stable integration of DNA coding for gene-editing tools into plant genomes is still the most used approach and it can generate unintended transgenic integrations, while Cas9 prolonged expression can increase cleavage at off-target sites. In addition, the selection of genetically modified cells from millions of treated cells, especially plant cells, is still challenging. These downfalls can be avoided with the delivery of preassembled ribonucleoprotein complexes (RNPs) composed of purified recombinant enzyme Cas9 and in vitro- transcribed guide RNA (gRNA) molecules in a protoplast system. We therefore aimed to develop the first DNA-free protocol for gene-editing in maize and introduced RNPs into their protoplasts with PEG 4000. We performed effective transformation of maize protoplasts using different gRNAs sequences targeting the inositol phosphate kinase gene and applying two different exposure times to RNPs. Using low-cost Sanger sequencing protocol, we observed an efficiency rate of 0.85 up to 5.85%, which is equivalent to DNA-free protocols used in other plant species. A positive correlation was displayed between exposure time and mutation frequency. Mutation frequency was gRNA sequence- and exposure time-dependent. In summary, we demonstrated the suitability of RNP transfection as an effective screening platform for gene-editing in maize. This efficient and relatively easy assay method for selection of gRNA suitable for editing of gene of interest will be highly useful for genome editing in maize, since genome size and GC-content are large and high in maize genome, respectively. Nevertheless, the large amplitude of mutations at target site requires scrutiny when checking mutations at off-target sites and potential safety concerns.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Abiotic stresses, including drought, salinity, cold, heat, and heavy metals, extensively reduce global agricultural production. Approaches such as conventional breeding and transgenic breeding have been widely used to cope with these environmental stresses. The clustered regularly interspaced short palindromic repeat- Cas (CRISPR/Cas) based gene-editing tool has revolutionized due to its simplicity, accessibility, adaptability, flexibility, and wide applicability. This system has a great potential to build up crop varieties with enhanced tolerance against abiotic stresses. In this review, we summarize the most recent findings on understanding the mechanism of abiotic stress response in plants and the application of CRISPR/Cas mediated gene-editing system towards enhanced tolerance to drought, salinity, cold, heat, and heavy metals stresses. Furthermore, in this review, we highlighted the recent advancements in prime editing and base editing tools for crop improvement.

Phenotypic complementation of gene knock-outs is an essential step in establishing function. Here we describe a simple strategy for ‘gold standard’ complementation in which the mutant allele is replaced in situ with a wild type (WT) allele in a procedure that exploits CRISPR/Cas9. The method relies on the prior incorporation of a unique 24 nucleotide (nt) ‘bookmark’ sequence into the mutant allele to act as a guide RNA target during its Cas9-mediated replacement with the WT allele. The bookmark comprises a 23 nt Cas9 target sequence plus an additional nt to ensure the deletion is in-frame. Here, bookmarks are tailored to Streptococcus pyogenes CRISPR/Cas9, but could be designed for any CRISPR/Cas system. For proof of concept, 9 bookmarks were tested in Clostridium autoethanogenum. Complementation efficiencies reached 91%. As complemented strains are indistinguishable from their progenitors, concerns over contamination may be satisfied by incorporation of ‘watermark’ sequences into the complementing genes.

The rapid advancements in gene therapy have opened up new possibilities for the treatment of genetic disorders, including Duchenne muscular dystrophy, Thalassemia, cystic fibrosis, Hemophilia, and Familial hypercholesterolemia. The utilization of the clustered regularly interspaced short palindromic repeats (CRISPR) - CRISPR-associated protein (Cas) system has revolutionized the field of gene therapy by enabling precise targeting of genes. In recent years, CRISPR/Cas9 has demonstrated remarkable efficacy in treating cancer and genetic diseases. However, the susceptibility of nucleic acid drugs to degradation by nucleic acid endonucleases, necessitates the development of functional vectors capable of protecting the nucleic acids from enzymatic degradation, while ensuring safety and effectiveness. This review aims to explore the biomedical potential of non-viral vector-explore CRISPR/Cas9 systems for the treatment of genetic diseases. Furthermore, it provides a comprehensive overview of recent research advances in viral and non-viral vector-based gene therapy for genetic disorders, including insights from preclinical and clinical studies. Additionally, the review analyzes the current limitations of these delivery systems and proposes avenues for the development of novel nano-delivery platforms.

Chronic myeloid leukaemia (CML) is a haematological neoplasm driven by the BCR/ABL fusion oncogene. The monogenic aspect of the disease and the feasibility of ex vivo therapies in haematological disorders make CML an excellent candidate for gene therapy strategies. The ability to abolish any coding sequence by CRISPR-Cas9 nucleases offers a powerful therapeutic opportunity to CML patients. However, a definitive cure can only be achieved when only CRISPR-edited cells are selected. A gene-trapping approach combined with CRISPR technology would be an ideal approach to ensure this. Here, we have developed a CRISPR-Trap strategy that efficiently inserts a donor gene trap (SA-CMV-Venus) cassette into the BCR-ABL1-specific fusion point in the CML K562 human cell line. The trapping cassette interrupts the on-cogene coding sequence and expresses a reporter gene that enables the selection of edited cells. Quantitative expression analyses showed significantly higher level of expression of the BCR-Venus allele coupled with a drastically lower level of BCR/ABL expression in Venus+ cell fractions. Functional in vitro experiments showed cell proliferation arrest and apoptosis in selected Venus+ cells. Finally, xenograft experiments with the selected Venus+ cells showed a large reduction in tumour growth, thereby demonstrating a therapeutic benefit in vivo. This study is a proof of concept for the therapeutic potential of a CRISPR-Trap system as a novel strategy for gene elimination in haematological neoplasms.

Despite the high quality of soybean protein, raw soybeans and soybean meal cannot be directly included into animal feed mixtures due to the presence of Kunitz (KTi) and Bowman Birk protease inhibitors (BBi) which reduces animal performance. Heat treatment can substantially inactivate trypsin and chymotrypsin inhibitors (BBi) but such treatment is energy intensive, adds expense, and negatively impact the quality of seed proteins. As an alternative approach we have employed CRISPR/Cas9 gene editing to create mutations in BBi genes to drastically lower the protease inhibitor content in soybean seed. Agrobacterium-mediated transformation was used to generate several stable transgenic soybean events. These independent CRISPR/Cas9 events were examined in comparison to wild type plants using Sanger sequencing, proteomic analysis, trypsin/chymotrypsin inhibitor activity assays and q15RT-PCR. Collectively, our results demonstrate the creation of an allelic series of loss of function mutations affecting the major BBi gene in soybean. Mutations in two of the highly expressed seed specific BBi genes lead to substantial reductions in both trypsin and chymotrypsin inhibitor activities.

Wheat gluten contains epitopes that trigger celiac disease (CD). A life-long strict gluten-free diet is the only treatment accepted for CD. However, very low-gluten wheat may provide an alternative treatment to CD. Conventional plant breeding methods are not sufficient to produce celiac-safe wheat. RNA interference technology, to some extent, succeeded in the development of safer wheat varieties. However, these varieties had multiple challenges in their implementation. Clustered Regularly Interspaced Short Palindromic Repeats-associated nuclease 9 (CRISPR/Cas9) is a versatile gene-editing tool that has the ability to edit the immunogenic gluten genes. So far, only a few studies have applied CRISPR/Cas9 to modify the wheat genome. In this article, we reviewed published literature that applied CRISPR/Cas9 in wheat genome editing to investigate the current status of the CRISPR/Cas9 system to produce a low-immunogenic wheat variety. We found that in recent years, the CRISPR/Cas9 system has been continuously improved to edit the complex hexaploid wheat genome. Although some reduced immunogenic wheat varieties have been reported, CRISPR/Cas9 has still not been fully explored in editing the wheat genome. We conclude that further studies are required to apply the CRISPR/Cas9 gene-editing system efficiently for the development of celiac-safe wheat variety and to establish it as a “tool to celiac safe wheat.”

With the continuous update of gene editing technology, great progress has been made in livestock breeding, researchers have produced gene edited pigs, cattle, sheep and other improved livestock. Gene editing technology is a genetic means to knock in, knock out, delete, inhibit, activate or replace specific bases of DNA or RNA sequences at the genome level to achieve accurate modification, and can edit genes at a fixed point without the need for DNA templates. In recent years, although regular clusters of interspaced short palindromic repeats (CRISPR)/Cas9 system mediated gene editing technology has been widely used in animal genetic breeding research, but so far, the system's precise insertion efficiency of foreign genes is not high enough, and there are certain off-target effects, and it is not enough to be used in genome editing of large livestock such as cashmere goats. In this paper, the development status, challenges, application prospects and look into the distance of CRISPR/ Cas9-mediated precisiongene editing technology in livestock breeding were reviewed, in order to provide theoretical reference for livestock gene function analysis, genetic improvement and livestock breeding with local economic characteristics.

Glioblastoma (GBM) is the most common malignant brain tumor in adults. Despite advancements in treatment, the prognosis for patients with GBM remains poor due to its aggressive nature and resistance to therapy. CRISPR-based genetic screening has emerged as a powerful tool for identifying genes crucial for tumor progression and treatment resistance, offering promising targets for tumor therapy. In this review, we provide an overview of the recent advancements in CRISPR-based genetic screening approaches and their applications in GBM. We highlight how these approaches have been used to uncover genetic determinants of GBM progression and susceptibility to various therapies. Furthermore, we discuss ongoing challenges and future directions of CRISPR-based screening methods in advancing GBM research.

Gene editing tools such as CRISPR-Cas9 have created unprecedented opportunities for genetic studies in plants and animals. We designed a course-based undergraduate research experience (CURE) to train introductory biology students in the concepts and implementation of gene editing technology as well as develop their soft skills in data management and scientific communication. We present two versions of the course that can be implemented with twice-weekly meetings over a five-week period. In the remote-learning version, students perform homology searches, design guide RNAs and primers, and learn the principles of molecular cloning. This version is appropriate when access to laboratory equipment or in-person instruction is limited, such as closures that have occurred in response to the Covid-19 pandemic. In the in-person version, students design guide RNAs, clone CRISPR-Cas9 constructs, and perform genetic transformation of the model plant Arabidopsis thaliana. The highly parallel nature of the CURE makes it possible to target dozens to hundreds of genes, depending on the number of course sections available. Applying this approach in a sensitized mutant background enables focused reverse genetic screens for genetic suppressors or enhancers. The course can be readily adapted to other organisms or projects that employ gene editing.

Biotechnological application of the green microalga Chlamydomonas reinhardtii hinges on the availability of selectable markers for effective expression of multiple transgenes. However, biological safety concerns limit the establishment of new antibiotic resistance genes and until today, only few auxotrophic markers exist for C. reinhardtii. The recent improvements in gene editing via CRISPR/Cas9 allows directed exploration of new endogenous selectable markers. Since editing frequencies with CRISPR/Cas9 techniques are often low, the Cas9-sgRNA ribonucleoprotein (RNP) delivery protocol was strategically optimized by applying nitrogen starvation to the pre-culture, increasing editing frequencies from 10% to 66% after pre-selection. Probing the essential polyamine biosynthesis pathway, the spermidine synthase gene (SPD1) is shown to be a potent selectable marker with versatile biotechnological applicability. Very low levels of spermidine (0.75 mg/L) were required to maintain normal mixotrophic and phototrophic growth in newly designed spermidine auxotrophic strains. Complementation of these strains with a synthetic SPD1 gene was achieved when the mature protein was targeted to either the cytosol or the chloroplast. This work highlights the potential of new selectable markers for biotechnology as well as basic research and proposes an effective pipeline for the identification of new auxotrophies in C. reinhardtii.

HIV-1 is a complicated and perplexing virus. It infects T cells, reverse transcribes its RNA into DNA, utilizes its host DNA machinery to replicate its HIV-DNA, translates the HIV-DNA into proteins, assembles itself for a budding escape from the T cell, and rapidly mutates its conformation. Partially, due to its complexity, there remains no cure for HIV or AIDs. However, recently with the discovery of TALENs, the use of zinc fingers, and most of all the applications of CRISPR-Cas9 technology, has given researchers new hope in finding alternative gene therapies and treatments for diseases. With more focus on CRISPR-Cas9, this new and novel technology uses a guiding RNA, sgRNA, to lead a Cas9 nuclease to its target for deletion or to change that DNA site. CRISPR-Cas9 can delete point mutations and multiple DNA sites. Because CRISPR can alter DNA sequences, several scientists have conducted research into CRISPR, possibly treating more diseases such as cancer, diabetes, and even HIV. HIV-1 drew the focus of a researcher named Dr. Ebina in 2013 when he was the first to design and apply CRISPR-Cas9 to genes found in the binding sites of HIV-1, inhibiting HIV-1 gene expression. Since 2013, several other researchers have blocked HIV replication and infection through CRISPR-Cas9 targeting the receptors of T cells called the CC chemokine receptor 5 or CCR5. HIV-1 binds to the CD4 receptor of T cells, which consists of co-receptors CCR5 and CXCR4. If CCR5 expression can be removed, the HIV virus cannot bind to T-cells, blocking the initial attachment stage, and discontinuing the infection. However, there remain obstacles and issues for the CRISPR deletion of CCR5 for treating HIV-1. The issues include: 1) finding new and safe methods of CRISPR-Cas9 delivery, 2) clearing the latent HIV reservoirs, 3) improving the sgRNA design to avoid off-target mutations or deletions, and 4) effectively analyze the viral escape of HIV from CRISPR-Cas9 modifications. Therefore, the purpose of this review is to discuss possible techniques for removing the obstacles that can lessen the potential of CRISPR to delete CCR5, repressing HIV-1 into long-term remission or a functional cure.

Antioxidant, anti-inflammatory and chemo-preventive features have been reported for the carotenoid diatoxanthin. Diatoxanthin is only produced by a few groups of microalgae where it functions in photoprotection. Its large-scale production in microalgae is currently not feasible. In fact, rapid conversion into the inactive pigment diadinoxanthin is triggered when the cells are removed from the high-intensity light source, which will be the case during large-scale harvesting of microalgae biomass. Zeaxanthin epoxidase (ZEP) 2 and/or ZEP3 have been suggested to be responsible for the back-conversion of high-light accumulated diatoxanthin to diadinoxanthin in low light in diatoms. Using the CRISPR/Cas9 gene editing technology we knocked out the ZEP2 and ZEP3 genes in the already commercially used marine diatom Phaeodactylum tricornutum to investigate their role in the diadinoxanthin-diatoxanthin cycle, and to determine if one of the mutant strains could function as a diatoxanthin production line. Light shift experiments proved that ZEP3 encodes the enzyme converting diatoxanthin to diadinoxanthin in low light. Loss of ZEP3 caused the high-light accumulated diatoxanthin to be stable for several hours after the cultures had been returned to low light, suggesting that zep3 mutant strains could be suitable as commercial production lines of diatoxanthin.

Scientists can use the Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) protein 9 system, which is a powerful and flexible tool for changing the genome, to change only certain parts of the genome. This has helped researchers figure out how target genes work in biology and disease. CRISPR/Cas9 is made up of a sequence-specific CRISPR RNA (crRNA) set and a generic Cas9 nuclease. The crRNA set tells Cas9 where to cut DNA and cause double-strand breaks. In the next step of cellular DNA repair, insertions, deletions, and swaps are made at specific spots. For CRISPR/Cas9-mediated DNA cleavage to be specific, the target sequences must match the crRNA, and a protospacer nearby motif must be placed after the target sequences. In this article, we talk about how CRISPR/Cas9 works at the molecular level, what it can be used for, what it can't do, and what its future clinical treatment promise might be.

Genetic engineering has become an essential element in developing climate-resilient crops and environmental sustainable solutions to respond to the increasing need for global food security. Genome editing using CRISPR/Cas [Clustered regulatory interspaced short palindromic repeat (CRISPR)-associated protein (Cas)] technology is being applied to a variety of organisms, including plants. This technique has become popular because of its high specificity, effectiveness, and low production cost. Therefore, this technology has the potential to revolutionize agriculture and contribute to global food security. Over the past few years, increasing efforts have been seen in its application in developing higher-yielding, nutrition rich, disease resistant, stress-tolerant “crops” fruits and vegetables. Cas proteins such as Cas9, Cas12, Cas13, and Cas14, among others, have distinct architectures and have been used to create new genetic tools that improve features that are important for agriculture. The versatility of Cas has accelerated genomic analysis and facilitated the use of CRISPR/Cas to manipulate and alter nucleic acid sequences in cells of different organisms. This review provides the evolution of CRISPR technology exploring its mechanisms and contrasting it with traditional breeding and transgenic approaches to improve different stress tolerance. We have also discussed the CRISPR/Cas system and explored three Cas proteins that are currently known to exist: Cas12, Cas13, and Cas14 and their potential to generate foreign DNA free or non-transgenic crops that could be easily regulated for commercialization in most countries.

Memory and emotion are highly vulnerable to psychiatric disorders like post-traumatic stress disorder (PTSD), which has been linked to serotonin (5-HT) metabolism disruptions. In fact, over 90% of the 5-HT precursor tryptophan (Trp) is metabolized via the Trp-kynurenine (KYN) meta-bolic pathway, producing a variety of bioactive molecules. The aadat (kat2) gene encodes mito-chondrial kynurenine aminotransferase (KAT) isotype 2, responsible for kynurenic acid (KYNA) production. Little is known about its role in behavior. In CRISPR/Cas9-induced aadat knockout (kat2−/−) mice, we examined the effects on emotion, memory, motor function, Trp and its metabolite levels, enzyme activities in the plasma and the urine of 8-week-old males compared to wild-type mice. Transgenic mice showed more depressive-like behaviors in the forced swim test, but not in the tail suspension, anxiety, or memory tests. They also had fewer center field and corner entries, shorter walking distances, and fewer jumping counts in the open field test. Plasma metabolite levels are generally consistent with those of urine: KYN, antioxidant KYNs, 5-hydroxyindolacetic acid, and indole-3-acetic acid levels are lower; enzyme activities in KATs, kynureninase, and monoamine oxidase/aldehyde dehydrogenase are lower, but kynurenine 3-monooxygenase is higher; and ox-idative stress and excitotoxicity indices are higher. Transgenic mice show depression-like behavior in a learned helplessness model, emotional indifference, and motor deficits, coupled with a decrease in KYNA, a shift of Trp metabolism toward the KYN-3-HK pathway, and a partial decrease in the gut microbial Trp-indole pathway metabolite. This is the first evidence that deleting the aadat gene causes depression-like behaviors that are unique to despair experience, which appears to be linked to excitatory neurotoxic and oxidative stresses. This may lead to the development of a double-hit preclinical model in experience-based depression, better understanding of these complex condi-tions, and more effective therapeutic strategies by elucidating the relationship between Trp me-tabolism and PTSD pathogenesis.

The human angiotensin-converting enzyme 2 (ACE2) has a crucial role on blood pressure control; however, ACE2 is also the primary SARS-CoV-2 (S domain) virus receptor. Inhibiting or even reducing the expression of the native ACE2 might diminish the viral entry into the cells, but may cause a failure of ACE2 biological activity, primarily in patients with comorbidities, including diabetes mellitus or hypertension. Since the ACE2 catalytic site and the SARS-Cov-2 receptor are distinct, we designed a Crispr-Cas9 model system, predicting the respective sequences for a guide RNA (gRNA) and a single-stranded oligo dideoxy nucleotide (ssODN), to introduce point mutations into the exon 1 of the human ACE2 gene, which encodes the alpha-helix, implicated on the binding of the SARS-CoV-2 envelope S protein. Protein modeling predicted that the specific substitutions of residues Phe28, Lys31, and Tyr41 for Ala at the ACE2 alpha-helix do not significantly alter ACE2 native conformation. The analysis of the impact of these mutations on ACE2 receptor function predicted a weakening of the binding of the SARS-CoV-2 protein S. An experimental genome editing of cells based on these Crispr-Cas9 elements might reduce the SARS-CoV-2 ability to enter the epithelial cell, preserving the biological activity of ACE2 enzyme.

We have previously reported that 60% sucrose diet-fed ChREBP knockout mice (KO) showed body weight loss resulting in lethality. We aimed to elucidate whether sucrose and fructose metabolism are impaired in KO. Wild type mice (WT) and KO were fed a diet containing 30% sucrose with/without 0.08% miglitol, an α-glucosidase inhibitor, and these effects on phenotypes were tested. Furthermore, we compared metabolic changes of oral and peritoneal fructose injection. Thirty percent sucrose diet feeding did not affect phenotypes in KO. However, miglitol induced lethality in 30% sucrose-fed KO. Thirty percent sucrose plus miglitol diet-fed KO showed increased cecal contents, increased fecal lactate contents, increased growth of lactobacillales and Bifidobacterium and decreased growth of clostridium cluster XIVa. ChREBP gene deletion suppressed the mRNA levels of sucrose and fructose related genes. Next, oral fructose injection did not affect plasma glucose levels and liver fructose contents; however, intestinal sucrose and fructose related mRNA levels were increased only in WT. In contrast, peritoneal fructose injection increased plasma glucose levels in both mice; however, the hepatic fructose content in KO was much higher owing to decreased hepatic Khk mRNA expression. Taken together, KO showed sucrose intolerance and fructose malabsorption owing to decreased gene expression.

The adulteration of goat milk powder occurs frequently, cattle-derived and soybean-derived ingredients are common adulterants in goat milk powder. However, simultaneously and rapidly detecting cattle-derived and soybean-derived components is still a challenge. high throughput and efficient screening method for adulteration detection is need. In this study, a rapid method was developed to detect the adulteration of common cattle-derived and soybean-derived components simultaneously in goat milk powder by combining the CRISPR/ Cas12a system with recombinant polymerase amplification (RPA). A dual DNA extraction method was employed, primers and crRNA for dual detection were designed and screened, and a series of condition optimizations were carried out in this experiment. The optimized assay can rapidly detect cattle-derived and soybean-derived components in 40 min. The detection limits of both cattle-derived and soybean-derived components were 1% (w/w) for the mixed adulteration models. The established method was applied into a blind survey of 55 commercially available goat milk powder products. The results showed that 36.36% of the samples contained cattle-derived or soybean-derived ingredients, which revealed the noticeable adulteration situation in the goat milk powder market. This study realizes a fast flow of dual extraction, dual amplification and dual detection of cattle-derived and soybean-derived components in goat milk powder for the first time. It can be used for high-throughput and high-efficiency on-site primary screening of goat milk powder adulterants, and provide a technical reference for combating with food adulteration.

Redox balance is increasingly identified as a major player in cellular signaling. A fundamentally simple reaction of oxidation and reduction of cysteine residues in cellular proteins is the central concept in this complex mode of protein function regulation. Oxidation of key cysteine residues occurs at the physiological levels of reactive oxygen species (ROS) but are reduced by a supply of thiol antioxidant molecules including glutathione, glutaredoxin and thioredoxin. While these molecules show complex compensatory roles in experimental conditions, transgenic animal models provide a comprehensive picture to pinpoint the role of each antioxidant. In this review we have specifically focused on the available literature on Thioredoxin-1 system transgenic models that includes Thioredoxin and Thioredoxin reductase proteins. As identification of Thioredoxin protein targets is technically challenging the true contribution of this system in maintaining cellular balance remains unidentified, including the role of this system in the brain.

The tumor organoid (tumoroid) model in three-dimensional (3D) culture systems has been developed to reflect more closely the in vivo tumors than 2D-cultured tumor cells. Notably, extracellular vesicles (EVs) are efficiently collectible from the culture supernatant of gel-free tumoroids. Matrix metalloproteinase (MMP) 3 is a multi-functional factor playing crucial roles in tumor progression. However, roles of MMP3 within tumor growth and EVs have not unveiled. Here, we investigated the protumorigenic roles of MMP3 on integrities of tumoroids and EVs. We generated MMP3-knockout (KO) cells using the CRISPR/Cas9 system from rapidly metastatic LuM1 tumor cells. Moreover, we established fluorescent cell lines with palmitoylation signal-fused fluorescent proteins (tdTomato and enhanced GFP). Then we confirmed the exchange of EVs between cellular populations and tumoroids. LuM1-tumoroids released large EVs (300-1000 nm) and small EVs (50-200 nm) while the knockout of MMP3 resulted in the additional release of broken EVs from tumoroids. The loss of MMP3 leads to a significant reduction in tumoroid size and to the development of the necrotic area within tumoroids. MMP3 and CD9 (a category-1 EV marker tetraspanin protein) were significantly down-regulated in MMP3-KO cells and their EV fraction. These weakened phenotypes by MMP3 KO were markedly rescued by the addition of MMP3-rich EVs or conditioned medium (CM) collected from LuM1-tumoroids, which caused a dramatic rise in the expression of MMP3, CD9, and Ki-67 (a marker of proliferating cells) in the MMP3-null/CD9-low tumoroids. Notably, MMP3 enriched in tumoroids-derived EVs and CM deeply penetrated into recipient MMP3-KO tumoroids, resulting in a remarkable enlargement of solid tumoroids, while MMP3-null EVs did not. These data demonstrate that EVs can mediate molecular transfer of MMP3 resulting in increasing the proliferation and CD9+ tumorigenesis, indicating crucial roles of MMP3 in tumor progression.

Because it can make exact double-strand breaks in DNA, CRISPR-Cas9 can help almost every species and type of cell. It is a powerful way to change the DNA code. CRISPR-Cas9 can be used for a lot more than just changing genes. We are close to being able to do high-throughput gene screening, epigenome editing, in-vivo cell tagging, and RNA change. With the help of CRISPR-Cas9, the function of genes can be studied better, and more realistic disease models can be made. The revolutionary new discipline of gene editing has the potential to profoundly impact healthcare and the life sciences. By simplifying the process of creating double-strand breaks in the DNA of almost any species or kind of cell, CRISPR-Cas9 has revolutionized gene editing. Numerous applications have been found for the CRISPR-Cas9 system. High-throughput gene screening, RNA modification, live-cell chromosome marking, and epigenome editing are all examples. CRISPR-Cas9 facilitates gene research, leading to the development of CRISPR-based disease models. CRISPR-Cas9-based methods of altering the genome will aid researchers in learning more about sickness and discovering better ways to cure it, despite the fact that there are still many questions and large difficulties to answer.

CRISPR/Cas9-based gene therapy has gotten a lot of interest during last decade. This treatment protocol tries to fix disease-causing traits by changing the DNA code in the exact spot on the chromosome. Therefore, we have tried to elaborate the most current information that shows how well CRISPR/Cas9-based gene therapy works. In vivo methods, like the ones described in the next two lines, are used to study cells in live creatures, like babies that are growing or animals that are already grown up. It has also been suggested to use ex-vivo methods to change somatic stem cells or progenitor cells in a culture outside of the body before putting them back into the patient. CRISPR/Cas is a good way to change specific genes in the DNA. Clustered Regularly Interspaced Short Palindromic Repeats is the full name for CRISPR. Biotechnologists can use them to fix DNA instead of the body's natural ways of doing so. This helps physicians in treatment diseases that run in families more successfully. Cas9 is an enzyme that, along with a guide RNA, is part of the CRISPR/Cas system. As this new technology grows quickly, it is replacing normal medical processes with treatments that are more cutting-edge and can change people's lives. CRISPR-Cas technology has changed biology by making it possible to change genes quickly. CRISPR molecular tools (Cas9 or Cas12a) have a lot of potential, but they are not very useful right now because they depend on the target cell's own DNA repair systems. With or without a template, the body's natural DNA repair processes can fix DNA breaks caused by Cas9 and Cas12a-based technologies. People use these methods a lot, but their effectiveness ranges from cell type to cell type. HDR-mediated DNA repair is a part of cell division, so tools that target it don't work on cells that don't divide, like neurons. CRISPR-associated transposase (CAST) has recently been studied, which suggests that it may offer new ways to change genes with CRISPR. The CRISPR activator of type V-K that is part of CAST has the same structure as the transposase. This is because CRISPR systems can put DNA in the right place without the help of the cell's own DNA repair systems. But a lot of work is being done right now to improve Cas9 and Cas12a so that DNA can be put into a target gene more precisely. Experts are still working hard to come up with better and more reliable ways to change genes, so even though there may be a problem, both methods have useful uses.

Research on Cas9 nucleases from different organisms holds great promise for advancing genome engineering and gene therapy tools as it could provide novel structural insights into CRISPR editing mechanisms, expanding its application area in biology and medicine. The current study focuses on generating a construct to express a compact Cas9 nuclease (AnoCas9) from the thermophilic microorganism Anoxybacillus flavithermus. Next, distinctive AnoCas9 properties are investigated. AnoCas9 gene is expressed in E.coli producing a polypeptide fused with the maltose-binding protein (MBP-AnoCas9). His-Tag in its structure enables purification using metal-chelate chromatography followed by the cleavage of the polypeptide by TEV protease. Bioinformatical analysis of the CRISPR array found in the genome of an Anoxybacillus flavithermus strain helps predict a functional PAM sequence for AnoCas9, which is supported by in vitro experiments. The purified protein demonstrates nuclease activity in the presence of crRNA:tracrRNA duplex in the 37-60 °С range, with maximum activity observed at 45-55 °С. The analysis of FAM-labeled dsDNA substrate cleavage has allowed us to determine the functional AnoCas9 PAM motif as 5’-NNNNCDAA-3’. Thus, AnoCas9 adds to the repertoire of thermophilic Cas9 effectors and its properties suggest application in areas requiring the presence of thermostable CRISPR/Cas systems.

Crop breeding is an important global strategy to meet sustainable food demand. CRISPR-Cas is a most promising gene-editing technology for rapid and precise generation of novel germplasm, and leads to revolutionary crop breeding innovation. In this review, we summarize recent advance of CRISPR/Cas technology in gene function analyses and generation of new germplasms with increased yield, improved product quality, and enhanced resistance to biotic and abiotic stress. We highlight their applications and breakthroughs in agriculture including crop de novo domestication, decoupling the gene pleiotropy tradeoff, crop hybrid seed conventional production, hybrid rice asexual reproduction, and double haploid breeding. Moreover, the challenges and development of CRISPR/Cas technology in crops are also discussed.

Duchenne muscular dystrophy (DMD) is an X-linked recessive neuromuscular disorder with a prevalence of approximately 1 in 3,500-5,000 males. DMD manifests as childhood-onset muscle degeneration, followed by loss of ambulation, cardiomyopathy, and death in early adulthood due to a lack of functional dystrophin protein. Out-of-frame mutations in the dystrophin gene are the most common underlying cause of DMD. Gene editing via the clustered regularly interspaced short palindromic repeats (CRISPR) system is a promising therapeutic for DMD, as it can permanently correct DMD mutations and thus restore the reading frame, allowing for the production of functional dystrophin. The specific mechanism of gene editing can vary based on a variety of factors such as the number of cuts generated by CRISPR, the presence of an exogenous DNA template, or the current cell cycle stage. CRISPR-mediated gene editing for DMD has been tested both in vitro and in vivo, with many of these studies discussed herein. Additionally, novel modifications to the CRISPR system such as base or prime editors allow for more precise gene editing. Despite recent advances, limitations remain including delivery efficiency, off-target mutagenesis, and long-term maintenance of dystrophin. Further studies focusing on safety and accuracy of the CRISPR system are necessary prior to clinical translation.

Phospholipid metabolism, including phosphatidylcholine (PC) biosynthesis, is crucial for various biological functions and is associated to longevity. Phosphatidylethanolamine N-methyltransferase (PEMT) is a protein that catalyzes the biosynthesis of PC, the levels of which change in various organs such as brain and kidney during aging. However, the role of PEMT for systemic PC supply is not fully understood. To address how PEMT affects aging-associated energy metabolism in tissues responsible for nutrient absorption, lipid storage and energy consumption, we employed NMR-based metabolomics to study liver, plasma, intestine (duodenum, jejunum, ileum), brown/white adipose tissues (BAT, WAT), and skeletal muscle of young (9–10 weeks) and old (96–104 weeks) wild-type (WT) and PEMT knockout (KO) mice. We found that the effect of PEMT-knockout was tissue-specific and age-dependent. Deficiency of PEMT affected the metabolome of all tissues examined, among which the metabolome of BAT from both young and aged KO mice was dramatically changed in comparison to WT mice, whereas the metabolome of jejunum was only slightly affected. As for aging, the absence of PEMT increased the divergence of metabolome during aging of liver, WAT, duodenum and ileum and decreased the impact on skeletal muscle. Overall, our results suggest that PEMT plays a previously unexplored critical role in both aging and energy metabolism.

Gene editing is now easy to make new disease models through in-vivo and in vitro tests. It can potentially be used to make animals with single-gene or multiple-gene changes. The mutant strains with changed germlines are no longer needed with in vivo gene editing, which uses the CRISPR-Cas9 system to target cells of interest in their normal tissues. Whereas, the AAVs and other viral vectors have made it possible to change cells selectively. Gene editing hade made it possible to use human induced pluripotent stem cells (iPSC) to model diseases that run in families. Researchers can compare and contrast the human genomes of many different ethnic and racial groups using this method. Scientists may be able to make a disease in a lab dish using iPSCs from a patient. Using CRISPR, iPSCs made from patient cells can be fixed if they have certain problems. This shows that gene therapy is possible and shows what happens when cells aren't working right. The fact that CRISPR-Cas9 can change the DNA by just one nucleotide has had a huge effect on biological studies. CRISPR is becoming more and more popular, which shows how useful, easy, and effective it is. With the broad use of CRISPR-based apps, the tool is now used for much more than just changing genes. This method can be used to screen the whole genome, control the translation of genes based on their sequence, and edit several genes at the same time. Scientists can now model diseases in different species and learn more about how genes work because of these advances. Genome-wide association studies and genome-editing tools like CRISPR are giving us a good look at the future of personalized medicine.

RNA-guided genomic transcriptional regulation tools, namely Clustered Regularly Interspaced Short Palindromic Repeats interference (CRISPRi) and CRISPR-mediated gene activation (CRISPRa), are a powerful technology for the field of functional genomics. Deriving from the CRISPR/Cas9 system, both systems comprise a catalytically dead Cas9 (dCas9) and a single guide RNA (sgRNA). This type of dCas9 is incapable of cleaving DNA but retains its ability to specifically bind to DNA. The binding of the dCas9/sgRNA complex to a target gene results in transcriptional interference. The CRISPR/dCas9 system has been explored as a tool for transcriptional modulation and genome imaging. Despite its potential applications and benefits, the challenges and limitations faced by the CRISPR/dCas9 system include the off-target effects, PAM sequence requirement, efficient delivery methods, and the CRISPR/dCas9-interfered crops being labeled as genetically modified organisms in several countries. This review highlights the progression of CRISPR/dCas9 technology as well as its applications and potential challenges in crop improvement.

This review summarizes the use of CRISPR system in yeasts, identifying advantages and disadvantages of its applications. 39 articles were evaluated including 12 articles that discussed the advantages of new CRISPR systems that improved the initial system, and another 27 were evaluated, among these: three were applications in Cryptococcus neoformans, four in candida sp., three in Schizosaccharomyces pombe, nine in Saccharomyces cerevisiae, four in Yarrowia lipolytica, and four in industrially important yeasts such as Pichia pastoris and Saccharomyces pastorianus. It was concluded that the CRISPR system is one of the most versatile genetic editing systems available nowadays. It can be applied in different organisms for several effects including gene knock-outs, performing point mutations, gene expression, or even applying multiple edition operations in several genes. However, we recognize that numerous studies lack a control group of the mutated strains, which leaves many questions unanswered. For instance, the extent and precision of this techniques, it also represents a risk to biosecurity standards. Therefore, this review shows the compilation of CRISPR system information, which could be used to generate different alternatives in the industry and clinical fields.

Infectious diseases are a global health problem affecting billions of people. Developing rapid and sensitive diagnostic tools is key for successful patient management and curbing disease spread. Currently available diagnostics are very specific and sensitive but time-consuming and require expensive laboratory settings and well-trained personnel; thus, they are not available in resource-limited areas, for the purposes of large-scale screenings and in case of outbreaks and epidemics. Developing new, rapid, and affordable point-of-care diagnostic assays is urgently needed. This review focuses on CRISPR-based technologies and their perspectives to become platforms for point-of-care nucleic acid detection methods and as deployable diagnostic platforms that could help to identify and curb outbreaks and emerging epidemics. We describe the mechanisms and function of different classes and types of CRISPR-Cas systems, including pros and cons for developing molecular diagnostic tests and applications of each type to detect a wide range of infectious agents. Many Cas proteins (Cas9, Cas12, Cas13, Cas14) have been leveraged to create highly accurate and sensitive diagnostic tools combined with technologies of signal amplification and fluorescent, potentiometric, colorimetric, or lateral flow assay detection. In particular, the most advanced platforms -- SHERLOCK/v2, DETECTR, or CRISPR-Chip -- enable detection of attomolar amounts of pathogenic nucleic acids with specificity comparable to that of PCR but with minimal technical settings. Further developing CRISPR-based diagnostic tools promises to dramatically transform molecular diagnostics, making them easily affordable and accessible virtually anywhere in the world. The burden of socially significant diseases, frequent outbreaks, recent epidemics (MERS, SARS and the ongoing coronoviral nCov-2019 infection) urgently need the developing of express-diagnostic tools. Recently devised CRISPR-technologies represent the unprecedented opportunity to reshape epidemiological surveillance and molecular diagnostics.

Methylmercury (MeHg) intoxication is a global health concern. Although MeHg neurotoxicity is well-recognized, less is known about MeHg's effects on metabolism. In this study, we evaluated MeHg intoxication (20mg/L in drinking water for 20 days) effects on liver and epididymal white fat (EWF) in young ApoE knockout (ko) and wild-type mice. The former is well-known to show spontaneous dyslipidemia. Hg levels in hair, liver, and EWF were measured to assess the degree of MeHg exposure. We also evaluated body weight gain, plasma triglycerides, total cholesterol levels, and liver injury by assessing steatosis score, AST, ALT, SOD, and TBAR levels. To evaluate EWF, we analyzed mean wet weight and adipocyte diameter, plasma leptin levels and metabolomics. Hg levels were markedly higher among intoxicated mice. ApoE ko mice showed higher Hg in the hair but lower levels in the liver and EWF than wild-type controls. Among wild-type mice, MeHg compromised weight gain and increased liver TBAR levels compared to non-challenged controls. Among non-intoxicated mice, ApoE deficiency significantly increased triglyceride, total cholesterol, and liver transaminases with reduced EWF wet weight, hepatic SOD, and plasma leptin levels. MeHg accumulation together with ApoE deficiency elevated total cholesterol, triglycerides, hepatic transaminases, and TBARS. We found distinct EWF metabolite activity in different scenarios of ApoE deficiency and MeHg intoxication, highlighting increased cardiovascular risk especially when both challenges occur. Further studies are required to elucidate the underlying mechanisms involved in these effects and the target nutritional interventions in most need to ameliorate them.

Duchenne muscular dystrophy (DMD) is a fatal X-linked recessive neuromuscular disorder most commonly caused by mutations disrupting the reading frame of the dystrophin (DMD) gene. DMD codes for dystrophin, which is critical for maintaining the integrity of muscle cell membranes. Without dystrophin, muscle cells receive heightened mechanical stress, becoming more susceptible to damage. An active body of research continues to explore therapeutic treatments for DMD as well as to further our understanding of the disease. These efforts rely on having reliable animal models that accurately recapitulate disease presentation in humans. While current animal models of DMD have served this purpose quite well, each comes with their own limitations. To help overcome this, clustered regularly interspaced short palindromic repeats (CRISPR)-based technology has been extremely useful in creating novel animal models for DMD. This review focuses on animal models developed for DMD that have been created using CRISPR, their advantages and disadvantages as well as their applications in the DMD field.

The CRISPR/Cas9 gene editing system has enormous potential in the treatment of multiple genetic disorders. To fully harness this potential, it is essential to deliver CRISPR-Cas9 components safely and effectively into the nuclei of target cells. In this study, we tested the amphipathic cell-penetrating peptide LAH5, previously used for DNA delivery, to intracellularly deliver spCas9: sgRNA ribonucleoprotein (RNP) and RNP/single-stranded homology-directed repair (HDR) template. We discovered that the LAH5 peptide effectively formed nanocomplexes with both RNP and RNP/HDR cargo, and that these nanocomplexes were taken up by cells effectively. Peptide/RNP nanocomplexes were characterized for size and charge, and nanocomplexation with RNP and RNP/HDR cargo was demonstrated via an electrophoretic mobility shift assay. Various ratios of peptide/RNP nanocomplexes were functionally screened on fluorescent reporter cell lines for gene editing and HDR-mediated gene correction. Additionally, targeted gene editing of the CCR5 gene was demonstrated in various cell lines. This LAH5-based delivery strategy paves the way for the development of therapeutic delivery systems for CRISPR/Cas-based genomic engineering.

Adamantinomatous Craniopharyngioma (ACP) is a rare epithelial tumor located in the craniopharyngeal duct, often associated with high morbidity and a high long-term recurrence rate. ACP is predominantly diagnosed in children below the age of 15 and accounts for a majority of Craniopharyngioma cases in the United States. It is most commonly caused by a mutation in exon 3 of the CTNNB1 gene, which promotes overaccumulation of β-Catenin in the WNT pathway. As β-Catenin accumulates, it over-activates the transcription factor, causing an over-transcription of WNT proteins and uncontrolled cell growth. Current methods of treatment for ACP are centered around surgical intervention and radiotherapy, including gross-total resection (GTR), subtotal resection (STR), and a combination of subtotal resection and adjuvant radiotherapy (STR+XTR). These methods of treatment are associated with high risk due to the proximity of ACP to critical structures near the craniopharyngeal duct. High recurrence rates and morbidity are closely associated with current methods of treatment and other methods have yet to be attempted in craniopharyngioma. This review will explore two possible methods of non-surgical and non-radiological therapeutic interventions. The use of RNAi therapy and CRISPR may provide insight and be a potential way to treat ACP with increased quality of life and decreased recurrence rates.

In "genome editing," a type of genetic engineering, DNA is added, taken away, or changed in an organism's genome. Biomedicine, biotechnology, and synthetic biology, just to name a few, have all gained a lot from how often this method is used. Before the editing process can start, a Double-Strand Breaks (DSB) must be made in the DNA at a specific gene. Researchers have made nucleases, which are sometimes called "molecular scissors," to fix this DSB. Transcription activator-like effector nucleases (TALENs), Zinc-finger nucleases (ZFNs), and homing endonucleases are all examples of protein targets that have been studied and changed. The last part gave an overview of these study projects and explained how to make Cas12a for specific uses. The applications of Cas12a have been extensively studied in recent years, but the protein still holds a lot of promise as a treatment and screening tool. In order to give a quick review of CRISPR-Cas12a and its uses, we will briefly talk about the structure and function of the different parts of the reaction pathway that lead up to the catalysis of the target DNA. Cas12a uses a multistep process to make sure that it is selecting the right DNA. This is a good trait for a device that changes the DNA because it makes it less likely that something bad will happen. Even though data shows that a new CRISPR RNAs (crRNA) molecule can stop Cas12a from randomly destroying ssDNA, it may still hurt the host cell while trying to change the genome. The action of Cas12a catalysis, which is a powerful tool for changing the genome, needs to be changed so that it can be more easily controlled and managed. Using what we know about how Cas12a works, we have made mutants that are less active on ssDNA and more active on dsDNA. So far, only Cas9 and Cas12a, which are both part of the CRISPR family, have been used to change the genome. Because of how similar and different these two endonucleases are, CRISPR can now be used for multiple scientific purposes. Cas12a is better than Cas9 because it makes double-strand breaks (DSBs) that favor Homology-Directed Repair (HDR) over Non-homologous end joining (NHEJ) and can change more than one copy of the genome at the same time. Both Cas9 and Cas12a are being changed to make them better at detecting Protospacer Adjacent Motif (PAM) than they are in their natural state. This will make it possible to start focusing on more genes.

The methods used to introduce CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas-mediated genome editing into fruit species, as well as the impacts of the application of this technology to activate and knock out of target genes in different fruit trees species including tree development, yield, fruit quality, and tolerance to biotic and abiotic stresses have been firstly described in this review. The application of this gene editing technology could allow the development of new generations of fruit crops with improved traits by targeting different genetic segments or even could facilitate the introduction of traits in elite cultivars without changing other traits. However, at this moment, the scarcity of efficient regeneration and transformation protocols in some species, the fact that many of those procedures are the genotype-dependent or the convenience of segregating the transgenic parts of the CRISPR system represent the main handicaps limiting the potential of genetic editing techniques for fruit trees. Finally, latest news on the legislation and regulations about the use of plants modified through CRISPR/Cas systems has been also discussed.

The constitutively active tyrosine kinase BCR/ABL1 oncogene plays a key role in human chronic myeloid leukemia development and disease maintenance, and determines most of the features of this leukemia. For this reason, tyrosine kinase inhibitors are the first-line treatment, offering most patients a life expectancy like that of an equivalent healthy person. However, since the oncogene is not destroyed, lifelong oral medication is essential, even though this trigger adverse effects in many patients. Furthermore, leukemic stem cells remain quiescent and resistance is observed in approximately 25% of patients. Thus, new therapeutic alternatives are still needed. In this scenario, the emergence of CRISPR technology can offer a definitive treatment based on its capacity to disrupt coding sequences. This review describes CML disease and the main advances in the genome-editing field by which it may be treated in the future.

In bioprocess development, the host and the genetic construct for a new biomanufacturing process are selected in the early developmental stages. This decision, made at the screening scale with very limited information about the performance of the selected cell factory in larger reactors, has a major influence on the performance of the final process. To overcome this, scaledown approaches are essential to run screenings that show the real cell factory performance at industrial like conditions. We present a fully automated robotic facility with 24 parallel mini-bioreactors that is operated by a model based adaptive input design framework for the characterization of clone libraries under scale-down conditions. The cultivation operation strategies are computed and continuously refined based on a macro-kinetic growth model that is continuously re-fitted to the available experimental data. The added value of the approach is demonstrated with 24 parallel fed-batch cultivations in a mini-bioreactor system with eight different Escherichia coli strains in triplicate. The 24 fed-batches ran under the desired conditions generating sufficient information to define the fastest growing strain in an environment with varying glucose concentrations similar to industrial scale bioreactors.

CRISPR-Cas allows us to introduce desired genome editing, including mutations, epitopes, and deletions with unprecedented efficiency. The development of CRISPR-Cas has progressed to such an extent that it is now applicable in various fields with the help of model organisms. C. elegans is one of the pioneering animals in which numerous CRISPR-Cas strategies have been rapidly es-tablished over the past decade. Ironically, the emergence of numerous methods makes the right choice of method difficult. Choosing an appropriate selection or screening approach is the first step in planning a genome modification. This report summarizes the key features and applications of CRISPR-Cas methods using C. elegans and illustrates key strategies. Our overview of significant advances in CRISPR-Cas will help readers to understand current advances in genome editing and navigate various methods of CRISPR-Cas genome editing.

Adaptive T cell immunotherapy holds great promise for the successful treatment of leukemia as well as other types of cancers. More recently, it was also shown to be an effective treatment option for chronic virus infections in immunosuppressed patients. Autologous or allogeneic T cells used for immunotherapy are usually genetically modified to express novel T cell or chimeric antigen receptors. The production of such cells was significantly simplified with the CRISPR/Cas system allowing deletion or insertion of novel genes at specific locations within the genome. In this review, we describe recent methodological breakthroughs important for the conduction of these genetic modifications, summarize crucial points to be considered when conducting such experiments, and highlight the potential pitfalls of these approaches.

COVID-19 represents an unprecedented threat to global public health and economies. Assays are urgently needed for rapid detection and diagnosis of SARS-CoV-2-infected patients in order to inform treatment and quarantine strategies. Establishing globally accepted easy-to-access diagnostic tests is extremely important to understanding the epidemiology of the present pandemic. While nucleic acid-based tests are considered to be more sensitive with respect to serological tests, but the present gold standard RT-PCR-based assays possess limitations such as low sample throughput, requirement for sophisticated reagents and instrumentation. To overcome these shortcomings, recent efforts of incorporating LAMP-based isothermal detection, and minimizing the number of reagents required are on rise. Novel CRISPR- and other nuclease-based techniques, when merge with isothermal and allied technologies, promises to provide sensitive and rapid detection of SARS-CoV-2 nucleic acids. Here we discuss and present compilation of state-of-the-art CRISPR based detection techniques for use in COVID diagnosis and epidemiology.

Presynaptic Ca²⁺-influx through voltage-gated Ca²⁺ channels (VGCC) is a key signal for synaptic vesicle release. Synaptic neurexins can partially determine the strength of transmission by regulating VGCCs. However, it is unknown whether neurexins modulate Ca²⁺-influx via all VGCC subtypes similarly. Here, we performed live cell imaging of synaptic boutons from primary hippocampal neurons with a Ca²⁺-indicator. We used the expression of inactive and active Cre recombinase to compare control to conditional knockout neurons lacking either all or selected neurexin variants. We found that reduced total presynaptic Ca²⁺-transients caused by the deletion of all neurexins were primarily due to the reduced contribution of P/Q-type VGCCs. The deletion of neurexin1α alone also reduced the total presynaptic Ca²⁺-influx but increased Ca²⁺-influx via N-type VGCCs. Moreover, we tested whether the decrease of Ca²⁺-influx induced by activation of cannabinoid receptor 1 (CB1-receptor) is modulated by neurexins. Unlike earlier observations emphasizing a role for β-neurexins, we found that the decrease of presynaptic Ca²⁺-transients induced by CB1-receptor activation depended more strongly on the presence of α-neurexins in hippocampal neurons. Together, our results suggest that neurexins have unique roles in the modulation of presynaptic Ca²⁺-influx through VGCC subtypes and that different neurexin variants may affect specific VGCCs.

Purpose: Inducible Slc4a11 KO leads to corneal edema by disruption of the pump and barrier functions of the corneal endothelium (CE). The loss of Slc4a11 NH3-activated mitochondrial uncoupling leads to mitochondrial membrane potential hyperpolarization-induced oxidative stress. The goal of this study is to investigate the link between oxidative stress and failure of pump and barrier functions and test different approaches to revert the process. Methods: Mice homozygous for Slc4a11 Flox and Estrogen receptor –Cre Recombinase fusion protein alleles at 8 weeks of age were fed Tamoxifen (Tm) enriched chow (0.4 g/Kg) for 2 weeks, and controls were fed normal chow. During the initial 14 days, Slc4a11 expression, corneal thickness (CT), stromal [lactate], Na+-K+ ATPase activity, mitochondrial superoxide levels, expression of lactate transporters, and activity of key kinases were assessed. In addition, barrier function was assessed by fluorescein permeability, ZO-1 tight junction integrity, and cortical cytoskeleton F-actin morphology. Results: Tm induced a rapid decay in Slc4a11 expression that was 84% complete at 7 days and 96% at 14 days of treatment. Superoxide levels increased significantly by day 7; CT and fluorescein permeability by day 14. Tight junction ZO-1 distribution and cortical cytoskeleton were disrupted at day 14 concomitant with decreased expression of Cldn1 yet an increase in tyrosine phosphorylation. Stromal lactate increased by 60%, Na+-K+ATPase activity decreased by 40%, and expression of lactate transporters MCT2 and MCT4 significantly decreased, but MCT1 was unchanged at 14 days. Src kinase was activated but not Rock, PKCα, JNK, or P38Mapk. Mitochondrial antioxidant Visomitin (SkQ1, mitochondrial targeted antioxidant) or Src kinase inhibitor eCF506 significantly slowed the increase in CT, with concomitant decreased stromal lactate retention, improved barrier function, reduced Src activation and Cldn1 phosphorylation, and rescued MCT2 and MCT4 expression. Conclusions: Slc4a11 KO-induced CE oxidative stress triggered increased Src kinase activity that results in perturbation of pump components and barrier function of the CE.

Current understanding of mechanisms of cellular resistance to genotoxic stress is incomplete but is critical for a variety of medical applications. Recent developments in the CRISPR/Cas technologies open new opportunities for targeted interrogation of resistance genes and pathways. In the present work, we used nuclease dead Cas9 constructs to achieve targeted overexpression of endogenous genes encoding two essential subunits of DNA damage sensor complex, XPC and HR23B, in HEK293T cells. Both individual and simultaneous overexpression of the two genes was achieved and the effects on cellular resistance to ionizing radiation and paraquat was examined. Using the fluorometric microculture cytotoxicity assay, we showed that simultaneous, but not separate overexpression of the two genes lead to a 30% increase in survivability. Irradiated cells that overexpressed both XPC and HR23B genes showed higher clonogenic capacity and proliferation rate compared to the irradiated transfection control as revealed by the clonogenic survival assay. Modulation of the gene expression did not affect cell resistance to paraquat. In summary, our results demonstrate a high potential of CRISPR/dCas9-enabled multiplex overexpression of stress-response genes in functionally justified combinations, exemplified here by the XPC-HR23B complex, for achieving an enhanced cellular radioresistance.

The rapid and accurate detection of parasites is crucial for timely curative intervention in parasitosis and for epidemiological surveillance. To meet the needs of clinical diagnosis, it is imperative to develop a diagnostic tool based on nucleic acid that combines the sensitivity and specificity of established nucleic acid amplifica-tion tests with the speed, cost-effectiveness, and convenience of isothermal amplification methods. A new nu-cleic acid detection method, utilizing the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) nuclease, holds promise for point-of-care testing. Specifically, the CRISPR-Cas12a system has demonstrated numerous advantages for detecting parasites, with hopeful outcomes for identify-ing malaria, toxoplasmosis, and other parasitic ailments. This review provides an overview of how CRISPR-Cas12a can be utilized for parasite detection, evaluates its advantages and disadvantages, and sug-gests ways to improve the efficiency and sensitivity of CRISPR-Cas12a-based assays.

Regulatory T cells (Tregs) are major drivers behind immunosuppressive mechanisms and present a major hurdle for cancer therapy. Tregs are characterized by high expression of CD25, which is a potentially valuable target for Treg depletion to alleviate immune suppression. The preclinical anti-CD25 (αCD25) antibody, clone PC-61, has met with modest anti-tumor activity, due to its capacity to clear Tregs from circulation and lymph nodes but not those that reside in the tumor. Optimization of the Fc domain of this antibody clone has been shown to enhance intratumoral Treg depletion capacity. Here, we generated a stable cell line that produces optimized recombinant Treg depleting antibodies. A genome engineering strategy in which CRISPR-Cas9 was combined with homology directed repair (CRISPR-HDR) was utilized to optimize the Fc domain of the hybridoma PC-61 for effector functions by switching it from the original rat IgG1 to a mouse IgG2a isotype. In a syngeneic tumor mouse model the resulting αCD25-m2a antibody mediated effective depletion of tumor resident Tregs leading to a high effector T cell (Teff) to Treg ratio. Moreover, combination of the αCD25-m2a with αPD-L1 treatment augmented tumor eradication in mice, demonstrating the potential for αCD25 as a cancer immunotherapy.

Klebsiella pneumonia (K. pneumoniae) is a Gram-negative bacterium that causes nosocomial infections in the lung, bloodstream, and urinary tract. Therefore, detecting K. pneumoniae in early time is important in preventing severe infections. However, clinical detection of K. pneumoniae requires a long time of agar plate culture. Nucleic acid detection like qPCR is precise but requires expensive equipment. Recent research reveals that collateral cleavage activity of CRISPR-LbCas12a has been applied in nucleic acid detection. In this study, PCR combined with CRISPR-LbCas12a targeting the K. pneumoniae system was established. This system showed excellent detection specificity and sensitivity in both bench work and clinical samples. Due to its advantages, its application can meet different detection requirements in health centers where qPCR is not accessible.

Cas endonuclease-mediated genome editing provides a long-awaited molecular biological approach to the modification of predefined genomic target sequences in living organisms. Although cas9/guide (g)RNA constructs are straightforward to assemble and can be customized to target virtually any site in the plant genome, the implementation of this technology can be cumbersome, especially in species like Triticale that are difficult to transform, for which only limited genome information is available and/or which carry comparatively large genomes. To cope with these challenges, we have pre-validated cas9/gRNA constructs (1) by frameshift restitution of a reporter gene co-introduced by ballistic DNA transfer to barley epidermis cells, and (2) via transfection in Triticale protoplasts followed by either a T7E1-based cleavage assay or by deep-sequencing of target-specific PCR amplicons. For exemplification, we addressed the Triticale ABA 8’-hydroxylase 1 gene, one of the putative determinants of pre-harvest sprouting of grains. We further show that in-del induction frequency in Triticale can be increased by TREX2 nuclease activity, which holds true for both well- and poorly performing gRNAs. The presented results constitute a sound basis for the targeted induction of heritable modifications in Triticale genes.

With the rapid population growth, there is an urgent need for innovative crop improvement approaches to meet the increasing demand for food. Classical crop improvement approaches involve, however, a backbreaking process that cannot equipoise with increasing crop demand. RNA based approaches i.e. RNAi-mediated gene regulation and site-specific nuclease based CRISPR/Cas9 system for gene editing has made advances in the efficient targeted modification in many crops for the higher yield and resistance to diseases and different stresses. In functional genomics, RNA interference (RNAi) is a propitious gene regulatory approach that plays a significant role in crop improvement by permitting down-regulation of gene expression by small molecules of interfering RNA without affecting the expression of other genes. Gene editing technologies viz. clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein (CRISPR/Cas) have appeared prominently as a powerful tool for precise targeted modification of nearly all crops genome sequence to generate variation and accelerate breeding efforts. In this regard, the review highlights the diverse roles and applications of RNAi and CRISPR/Cas9 system as powerful technologies to improve agronomically important plants to enhance crop yields and increase tolerance to environmental stress (biotic or abiotic). Ultimately, these technologies can prove to be important in view of global food security and sustainable agriculture.

One of the biggest threats we face globally is the emergence of antimicrobial resistant (AMR) bacteria, which runs in parallel with a lack in the development of new antimicrobials. Among these AMR bacteria, pathogens belonging to the ESKAPE group can be highlighted (Enterococcus spp, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter spp) due to their profile of drug resistance and virulence. Therefore, innovative lines of treatment must be developed for these bacteria. In this review, we summarize the different strategies for the treatment and study of molecular mechanisms of AMR in the ESKAPE pathogens based on the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated (Cas) proteins' technologies: loss of plasmid or cellular viability, random mutation or gene deletion as well directed mutations that lead to a gene's loss of function.

Ranaviruses have been associated with rising numbers of mass die-offs in amphibian populations globally. With life-stages occupying different environments and presenting distinct physiologies, amphibian of different ages are likely to play an important role in pathogen persistence. To assess the potential role of post-metamorphic amphibians as a Ranavirus reservoir, we performed a bath-exposure study on wood frogs using environmentally relevant doses (~10³ and ~10⁴ PFU/mL) of wild-type (WT) and knockout Frog virus 3 (FV3), deficient for the vIF-2α immune-evasion gene, the effects of which have never been addressed in post-metamorphic anurans. We observed 42% infection prevalence and low mortality (10%) across the virus challenges, with half of the mortalities attributable to ranavirosis. Prevalence and viral loads followed a dose-dependent pattern. Notably, when exposed to the vIF-2α knockout (DvIF-2α) FV3, individuals exhibited significantly decreased growth and increased lethargy in comparison to WT FV3 treatments. Although 85% of individuals in the virus treatments exhibited stereotypic signs of ranavirosis throughout the experiment, at termination (40 days post exposure) most individuals were clear of signs of infection. Overall, this study provides evidence that even a single short time exposure to environmentally relevant doses of Ranavirus may cause sublethal infections in post-metamorphic amphibians, thus indicating their possible role as a reservoir for this pathogen.

microRNAs can cause male infertility by impacting sperm quality and impaired spermatogenesis. Since the miR-125 family plays an important role in regulating embryo development, but the function of miR-125b-2 in male reproduction remains unknown. In this study, we prepared a model of miR-125b knockout (KO) mice. Among the KO mice, the progeny test showed that litter sizes decreased significantly and the rate of non-parous females increased significantly (p<0.05). At the same time, the testosterone concentration increased significantly (p<0.01), with the remarkable decrease for estradiol (p<0.05). Moreover, sperm count decreased obviously (p<0.05) and the percentage of abnormal sperms increased significantly (p<0.01). Testicular transcriptome sequencing demonstrated that there were 173 up-regulated genes, including Papolb (PAP), and 151 down-regulated genes in KO mice compared with wild type (WT). KEGG and GO analysis showed many of these genes were involved in sperm mitochondrial metabolism and other cellular biological processes. Meanwhile, the sperm mitochondria DNA (mtDNA) copy number was increased significantly (p<0.01) in KO mice, but the integrity of mtDNA and nuclear DNA (nDNA) had no change. In the top 10 up-regulated genes, as a testis specific expressing gene, PAP can affect the process of spermatogenesis. Western blotting and Luciferase Assay validated that PAP was the target of miR-125b-5p. Intriguingly, we also found that both miR-125b and PAP were only highly expressed in germ cells (GC) instead of Leydig cells (LC) and Sertoli cells (SC), and miR-125b-5p could target PAP to regulate TM3 cell secretion of testosterone (p<0.05). Our study firstly demonstrated that miR-125b-2 could regulate testosterone secretion by directly targeting PAP and increase sperm mtDNA copy number to affect semen quality. The study indicated that miR-125b-2 had a positive influence on the reproductive performance of animal and could be a potential therapeutic target for male infertility.

Aim: Complementary effects of dabigatran etexilate (DE), exercise training (ET) and combination (DE+ET) on the development and composition of the atherosclerotic lesions in diabetic apoE knockout (apoE-/-) mice. Methods: In 48 male apoE-/- diabetic mice, streptozotocin (STZ) was induced for 5 consecutive days. Mice received figh-fat diet (HFD) for 8 weeks and were randomized into 4 groups (1.Control/CG, 2.DEG: HFD with DE, 3.ETG: ET on treadmill, 4.DE+ETG: Combination DE and ET treatment). At the end of 8th week, all mice were euthanatized and morphometry of the aortic lesions at the level of aortic valve was obtained. Collagen, elastin, TNF-a, MCP-1, matrix-metalloproteinases (MMP-2,-3,-9), and TIMP-1 concentration within plaques at aortic valve were determined. Results: All active groups had significantly smaller aorta stenosis (DEG:7.9±2.2%, ETG:17.3±5.3%, DE+ETG:7.1±2.7%) compared to CG (23.3±5.5% p&lt;0.05), reduced the relative intra-plaque concentrations of macrophages, MCP-1, MMP-3 and MMP-9, and considerably increased collagen, elastin and TIMP-1 (p&lt;0.05). Group 4 showed the most pronounced results (p&lt;0.05). Both DEG and DE+ETG significantly reduced MMP-2 and TNF-a concentrations compared to ETG and CG (p&lt;0.010). Conclusion: DE and ET treatment in diabetic apoE-/- mice showed complementary amelioration of atherosclerotic lesions development and stability, mediated by the anti-inflammatory modulation of both DE and ET.

Crop yield enhancement is crucial for ensuring food security and meeting the growing global demand for agricultural products. The development of innovative technologies, such as CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), has provided new avenues for precise genetic modifications in crops. In this research article, we explore the application of CRISPR technology for crop yield improvement. We discuss the methodology, present recent results, and engage in a comprehensive discussion of the potential benefits, challenges, and future prospects of CRISPR-mediated crop yield enhancement.

Global crop yield and food security are being threatened by phytophagous insects. Innovative methods are required to increase agricultural output while reducing reliance on hazardous synthetic insecticides. It appears to be quite effective at reducing production costs and boosting farm profitability to use the ground-breaking CRISPR-Cas technology to create plants that are insect resistant. In contrast, this new technique can modify an insect's genome to either produce gene drive or get beyond an insect's tolerance to various insecticides. This paper reviews and critically discusses the use of CRISPR-Cas genome editing technology in long-term insect pest management. The emphasis of this review is on the prospective uses of the CRISPR-Cas system for insect stress management in crop production by creating genome-edited crops and insects. The potential and difficulties of using CRISPR-Cas technology to reduce pest stress in crop plants are critically examined and discussed.

Human gut microbiome is associated with various diseases, including autism spectrum disorders (ASD). Variations of the taxonomical composition in the gut microbiome of children with ASD have been observed repeatedly. However, features and parameters of the CRISPR-Cas systems in the gut microbiome of children with ASD have not been investigated yet. Here we demonstrate such an analysis in comparison with the healthy microbiome. For the identification of CRISPR-Cas systems, we used a combination of the publicly available tools suited for completed genomes with subsequent filtrations. In all considered datasets, the microbiomes of children with ASD contained fewer arrays per Gb of assembly, than the control group, but the arrays included more spacers on average. These patterns were observed systematically in our datasets, although their statistical significance hardly matched the thresholds. CRISPR arrays from the microbiomes of children with ASD differed from the control group neither in the fractions of spacers with protospacers from known genomes, nor in the sets of known bacteriophages providing protospacers. The majority of bacterial protospacers of the gut microbiome systems for both children with ASD and the healthy ones was located in the prophage islands.

Copper, the highly toxicity micronutrient, plays two essential roles: it is a catalytic and structural cofactor for Cu-dependent enzymes, and it acts as a secondary messenger. In the cells, copper is imported by CTR1, a transmembrane high-affinity copper importer, and DMT1 (divalent metal transporter). In cytosol, enzyme-specific chaperones receive copper from CTR1 C-terminus and deliver it to their apoenzymes. DMT1 cannot be a donor of catalytic copper because it does not have cytosol domain which is required for copper transfer to the Cu-chaperons and following to cuproenzymes. Here we assume that DMT1 can mediate copper way required for regulatory copper pool. To verify this thought, we used CRISPR/Cas9 to generate H1299 cell line with CTR1 or DMT1 single knockout (KO) and CTR1/DMT1 double knockout (DKO). To confirm KOs of the genes qRT-PCR were used. Two independent clones for each gene were selected for further studies. In CTR1-KO cells, expression of the DMT1 gene was significantly increased. In subcellular compartments, copper concentration decreased dramatically in DKO cells. CTR1-KO cells, but not DMT1-KO, demonstrated reduced sensitivity to cisplatin and silver ions, agents that enter the cell through CTR1. The expression of genes, whose protein products require copper: HIF1α, XIAP, COMMD1, CCS, Cp, but not SOD1 and NF-kB, changed their level. Perhaps these data will help to understand how the disturbances of copper homeodynamics lead to the development of neurodegenerative and oncological disorders. Possibility of using CTR1 KO and DMT1 KO cells to study homeodynamics of catalytic and signaling copper selectively is discussed.

Background: Obesity and its attendant conditions have become major health problems worldwide and is currently ranked as the fifth most common leading cause of death globally. Complex environmental and genetic factors are the cause of the current obesity epidemic. Diet, lifestyle, chemical exposures, and other confounding factors are difficult to manage in humans. The mice model is helpful in researching genetics BW gain because genetic and environmental risk factors can be controlled in mice. Studies in mouse strains with various genetic backgrounds and established genetic structures provide unparalleled opportunities to find and analyze trait-related genomic loci. In this study, we used the Collaborative Cross (CC), a large panel of recombinant inbred mouse strains, to present a predictive study using CC mice SMAD4 knockout profiles to understand and effectively identify predisposition to body weight gain. Materials and Methods: Male C57Bl / 6J Smad4+/- mice were mated with female mice from 10 different CC lines to create F1 mice (Smad4+/- x CC). Body weight (BW) was measured weekly until week 16, then monthly until the end (week 48). The heritability H2 of the assessed traits was estimated and presented. Comparative analysis of various machine learning algorithms for predicting the BW changes and genotype of mice was conducted. Results and conclusions: Our data showed that the body weight records of F1 mice with different CC lines differed between wildtype and mutant Smad4 mice during the experiment. Genetic background affects weight gain and some lines gained more weight in the presence of Smad4 knockout, while others gained less, but in general, the mutation caused overweight mice, except for a few lines. In both control and mutant groups, female %BW had a higher heritability H2 value than males. Additionally, both sexes with wildtype genotypes showed higher heritability values than the mutant group. Logistic Regression provides the most accurate mouse genotype predictions using machine learning. We plan to validate the proposed method on more CC lines and mice per line to expand machine learning for BW prediction.

POGZ (Pogo transposable element derived with ZNF domain) is known to function as a regulator of gene expression. While variations in the POGZ gene have been associated with intellectual disabilities and developmental delays in humans, the exact pathophysiological mechanisms re-main unclear. To shed light on this, we created two lines of conditional knockout mice for Pogz, one specific to excitatory neurons (Emx1-Pogz mice) and the other to inhibitory neurons (Gad2-Pogz mice) in the brain. Emx1-Pogz mice showed a decrease in body weight, similar to total Pogz knockout mice. Although the two lines did not display significant morphological ab-normalities in the telencephalon, impaired POGZ function affected the electrophysiological prop-erties of both excitatory and inhibitory neurons differently. These findings suggest that these mouse lines could be useful tools for clarifying the precise pathophysiological mechanisms of neurodevelopmental disorders associated with POGZ gene abnormalities.

Rapid progress in gene editing based on clustered regularly interspaced short palindromic repeats/CRISPR-associated protein (CRISPR/Cas) has revolutionized the study of gene and genome function and genetic disease correction. While numerous genetically modified cellular and animal models have been created to understand biological processes, the clinical application of CRISPR/Cas tools has been impeded by off-targeting and delivery problems. It is generally accepted that the delivery of CRISPR in the form of a ribonucleoprotein complex (RNP) substantially reduces the time of DNA exposure to the effector nuclease, minimizing off-target effects and facilitating clinical usage. This review focuses on CRISPR/Cas RNP delivery with retro/lentiviral particles and exosomes, whose parallel production by cells transfected with viral vectors is underestimated. We critically evaluate specific mechanisms of extracellular particle formation and loading with CRISPR/Cas for each system. Additionally, the details of Cas-nanoparticle entry and uncoating, previously unappreciated in the context of gene editing efficiency, are discussed. Based on existing knowledge about the consequences of intervention in retroviral assembly, entry, or exosome formation, we outline the potential problems with CRISPR/Cas delivery using extracellular nanoparticles and ways to address them.

Proteinuria is known to be associated with all-cause and cardiovascular mortality, and nephrotic syndrome is defined by the level of proteinuria and hypoalbuminemia. With advances in medicine, new causative genes for genetic kidney diseases are being discovered increasingly frequently. We reviewed articles on proteinuria/nephrotic syndrome, focal segmental glomerulosclerosis, membranous nephropathy, diabetic kidney disease/nephropathy, hypertension/nephrosclerosis, Alport syndrome, and rare diseases, which have been studied in mouse models. Significant progress has been made in understanding the genetics and pathophysiology of kidney diseases thanks to advances in science, but research in this area is ongoing. In the future, genetic analyses of patients with proteinuric kidney disease/nephrotic syndrome may ultimately lead to personalized treatment options.

The pro-protein convertase FURIN (PCSK3) is implicated in a wide range of normal and pathological biological processes such as infectious disease, cancer and cardiovascular disease. Previously, we performed a systemic inhibition of FURIN in a mouse model of atherosclerosis and demonstrated significant plaque reduction and alterations in macrophage function. To understand the cellular mechanisms affected by FURIN inhibition in myeloid cells, we optimized a CRISPR-mediated gene deletion protocol for successfully deriving hemizygous (HZ) and nullizygous (NZ) FURIN knockout clones in U937 monocytic cells using lipotransfection based procedures and a dual guide RNA delivery strategy. We observed differences in monocyte and macrophage functions involving phagocytosis, lipid accumulation, cell migration, inflammatory gene expression, cytokine release patterns, secreted proteomics (cytokines) and whole-genome transcriptomics between wild-type, HZ and NZ FURIN clones. These studies provide a mechanistic basis on the possible roles of myeloid cell FURIN in cardiovascular disorders.

The emergence of the COVID-19 pandemics prompted a fast development of novel diagnostic methods of the etiologic virus SARS-CoV-2. Methods based on CRISPR-Cas systems have been particularly promising because they can achieve a similar sensitivity and specificity to the golden standard RT-qPCR, especially when coupled to an isothermal pre-amplification step. Furthermore, they have also solved inherent limitations of RT-qPCR that impede its decentralized use and deployment in the field, such as the need for expensive equipment, high cost per reaction, and delivery of results in hours, among others. In this review, we evaluate publicly available methods to detect SARS-CoV-2 that are based on CRISPR-Cas and isothermal amplification. We critically analyze the steps required to obtain a successful result from clinical samples and pinpoint key experimental conditions and parameters that could be optimized or modified to improve clinical and analytical outputs. The COVID outbreak has propelled intensive research in a short time, which is paving the way to develop effective and very promising CRISPR-Cas systems for the precise detection of SARS-CoV-2. This review could also serve as an introductory guide to new labs delving into this technology.

Background: Genome-wide association studies have identified the chromosome 9p21 locus as one of the most important genetic risk factors for cardiovascular disease. However, the mechanism by which this locus promotes disease remains unclear due to difficulty identifying the causal genes and lack of a suitable animal model. Methods and Results: A total of 180 coronary artery autopsy specimens were analyzed histopathologically. The genotype of 9p21 (rs1333049) was not associated with any coronary risk factors nor the vulnerable plaque phenotype, but carriers of 9p21 risk allele did demonstrate more lesional calcification. To extend these studies into an animal model, mice with a targeted deletion of the orthologous 70-kb non-coding interval on chromosome 4 (chr4^D70kb/D70kb) were bred onto ApoE^-/- and fed with high fat diet. Targeted deletion of the 9p21 risk interval increased susceptibility to atherosclerotic plaque progression, but did not affect plaque rupture in the tandem stenosis model. Coronary risk factors such as body weight, blood pressure, lipid, and glucose levels did not differ between genotypes. Von Kossa staining revealed that chr4^D70kb/D70kb, ApoE^-/- developed more calcification in the plaque compared with chr4^+/+, ApoE^-/- mice, and that this this change was accompanied by increased aortic mRNA expression of Runx2, a key osteogenic transcription factor. Primarily cultured smooth muscle cells from chr4^D70kb/D70kb were hyperproliferative, and showed a calcification-prone phenotype after exposure to high-phosphate medium. Treatment with Palbociclib, a selective inhibitor of cyclin-dependent kinase 4/6, reduced mRNA expression of osteogenic genes in smooth muscle cells. Conclusion: Results from human and mouse studies indicate that the 9p21 non coding risk interval is associated with larger atherosclerotic plaque burden, but not with plaque rupture. 9p21 may promote lesion expansion by inducing the proliferation of de-differentiated and osteogenic smooth muscle cells.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

One of the ways to regulate the sensitivity of human cells to the influenza virus is to knock out genes of the innate immune response. Promising targets for the knockout are genes of the interferon-inducible transmembrane protein (IFITM) family, in particular the IFITM3 gene, whose product limits the entry of a virus into the cell by blocking the fusion of the viral and endosomal membranes. In this study, by means of genome-editing system CRISPR/Cas9, monoclonal cell lines with an IFITM3 knockout were obtained based on WI-38 VA13 cells (human origin). It was found that such cell lines are more sensitive to infection by influenza A viruses of various subtypes. Nonetheless, this feature is not accompanied by an increased titer of newly formed viral particles in a culture medium.

The advent of CRISPR/Cas9 technology has revolutionized genome editing, enabling the attainment of once-unimaginable goals. CRISPR/Cas's groundbreaking attributes lie in its simplicity, versatility, universality, and its independence from customized DNA-protein systems, erasing the need for specialized expertise and broadening its scope of applications. Beyond its editing prowess, the discovery of novel Cas-based systems has spawned an array of additional biotechnological tools, empowering both fundamental and applied research. Researchers have harnessed CRISPR/Cas for gene regulation, deepening insights into gene expression and epigenetic changes. Precisely targeting DNA or RNA sequences, CRISPR/Cas effectively identifies and counters pathogens. Furthermore, it aids in genome imaging and sequencing, revealing genome spatial organization and chromatin dynamics. The non-editing applications of CRISPR/Cas exhibit tremendous potential across diverse domains, including diagnostics, biotechnology, and fundamental research. This article reviews and critically evaluates the primary CRISPR/Cas-based tools developed for plants and animals, underlining their transformative impact.

The CRISPR-Cas9 system is an emerging therapeutic tool with the potential to correct diverse ge-netic disorders. However, for gene therapy applications an efficient delivery vehicle is required, capable of delivering the CRISPR-Cas9 components into the cytosol of the intended target cell population. Once there, the ribonucleoprotein complex (RNP) can be transported into the nucleus. Lipid nanoparticles (LNP) serve as promising candidates for delivery of CRISPR-Cas9 RNP. These delivery vehicles have been optimized for the delivery of nucleic acids, such as mRNA. Co-delivery of Cas9 encoding mRNA with the accompanying sgRNA leads to translation of the Cas9 protein and formation of the Cas9 RNP inside the cell. Only recently, direct delivery of the CRISPR-Cas9 RNP complexes has been explored, which requires adjustments to the LNP formulation. In this study, the importance of buffer composition and cationic charge during RNP and ssDNA en-trapment in LNP are demonstrated. After optimizing several formulation parameters, LNP were prepared that were colloidally stable in human plasma and efficiently deliver the SpCas9 RNP and ssDNA for HDR-correction in reporter cells. Under optimal formulation conditions, gene knock-out and gene correction efficiencies as high as 80% and 20%, respectively were achieved at nanomolar CRISPR-Cas9 RNP concentrations.

Fruit production is an important part of the gross domestic product for many countries around the world especially to those who have a strong focus on agriculture. However, long-term maintenance and yield stability of fruit production may be threatened by the ongoing climate change and its consequences like extended drought periods, heavy rain events, and floodings. Genome editing, with its progressive technological developments, offers opportunities to adapt relevant fruit plant species to new climatic conditions. Among modern genome editing techniques, CRISPR/Cas, in particular, has the potential to support breeding for those fruit plant species with extended breeding cycles, e.g., perennial fruits. In this review, we discuss CRISPR/Cas and other genome editing techniques in detail and how these techniques can be applied to support the breeding of fruit plant species for adaptation to changing climates. The chronological history of CRISPR/Cas9 systems, their associated computational tools, genomic data sources, transformation methods along with their delivery vehicles, quality improvement, environmental-stress resiliency, limitations, and future perspectives will also be discussed with respect to securing future global fruit production.

Cystic Fibrosis is a rare genetic disease that affects the transmission of chloride ions due to mutations in the CFTR (cystic fibrosis transmembrane conductance regulator) gene. Even though there are nearly 2000 mutations identified to be related to the condition, the most common mutation is F508del; deletion of a phenylalanine residue at 508. On the other hand, G542X which is a Class I mutation is also found very commonly and there are no modulator treatments available for it. Furthermore, it was investigated that R553X mutation can as well be corrected simultaneously with G542X mutation. Therefore, the main focus is on designing a gene therapy project that can correct all these three mutations at once by utilizing the prime editing technique via lipid-based delivery. In this way, the mutations can be edited through plasmids that were designed containing 2 pegRNAs and the Cas enzyme. To implement such an approach efficiently, both ex vivo, an animal model, and in vivo steps are to be designed. For the cell line, fibroblasts are selected due to their simplicity and low cost. The animal model of the experiment is determined to be a ferret concerning the high similarity to the human's CFTR protein and finally, the procedure will follow on a direct application in human Cystic Fibrosis patients. The plasmids are thought to be delivered through a cationic liposome that will reach the lungs with the aid of a nebulizer. At the last stage of the experimental procedure, Sanger Sequencing will be done to see if the desired edit within the CFTR has been performed successfully, and Next Generation Sequencing will be executed to see if there has been an off-target mutation in the remainder of the genome. Whereas for detecting the presence and expression of CFTR protein in humans, immunodetection with flow cytometry will be conducted.

Global population is predicted to approach 10 billion by 2050, an increase of over 2 billion from today. To meet the demands of growing, geographically and socio-economically diversified nations, we need to diversity and expand agricultural production. This expansion of agricultural productivity will need to occur under increasing biotic, and environmental constraints driven by climate change. Clustered regularly interspaced short palindromic repeats-site directed nucleases (CRISPR-SDN) and similar genome editing technologies will likely be key enablers to meet future agricultural needs. While the application of CRISPR-Cas9 mediated genome editing has led the way, the use of CRISPR-Cas12a is also increasing significantly for genome engineering of plants. The popularity of the CRISPR-Cas12a, the type V (class-II) system, is gaining momentum because of its versatility and simplified features. These include the use of a small guide RNA devoid of trans-activating crispr RNA (tracrRNA), targeting of T-rich regions of the genome where Cas9 is not suitable for use, RNA processing capability facilitating simpler multiplexing, and its ability to generate double strand breaks (DSB) with staggered ends. Many monocot and dicot species have been successfully edited using this Cas12a system and further research is ongoing to improve its efficiency in plants, including improving the temperature stability of the Cas12a enzyme, identifying new variants of Cas12a or synthetically producing Cas12a with flexible PAM sequences. In this review we provide a comparative survey of CRISPR-Cas12a and Cas9, and provide a perspective on applications of CRISPR-Cas12 in agriculture.

Base excision repair (BER) is the predominant pathway to remove most forms of hydrolytic, oxidative and alkylative DNA damage. The precise functioning of BER is achieving by the regulation of each step by regulatory/accessory proteins, with the most important of which being poly(ADP-ribose) polymerase 1 (PARP1). The PARP1 regulatory functions extend to many cellular processes including regulation of mRNA stability and decay. PARP1 can therefore affect BER both at the level of the BER proteins and at the level of their mRNAs. Systematic data on how the PARP1 content affects the activities of key BER proteins and the levels of their mRNAs in human cells are extremely limited. In this study the CRISPR/Cas9 based technique has been used to knocked out the PARP1 gene in the human HEK 293FT line. The obtained cell clones with putative PARP1 deletion were characterized by several approaches including: PCR analysis of deletions in genomic DNA, Sanger sequencing of genomic DNA, qPCR analysis of PARP1 mRNA, western-blot analysis of whole-cell-extract proteins with anti-PARP1 antibodies, and the PAR synthesis in the whole-cell-extracts. qPCR analysis of mRNAs coding the BER related proteins: PARP2, uracil DNA glycosylase 2, AP endonuclease 1, DNA polymerase β, DNA ligase III and XRCC1 did not reveal crucial influence of PARP1 knockout. The corresponding catalytic activities in the whole-cell extracts (WCEs) evaluated in parallel did not differ significantly between mutant and parental cell lines. No considerable influence of poly(ADP-ribose) synthesis on the activity of the above WCE enzymes was revealed.

Clustered regularly interspaced short palindromic repeats (CRISPR) based gene-editing has begun to transform the treatment landscape of genetic diseases. The history of the discovery of CRISPR/CRISPR-associated (Cas) proteins/single guide RNA (sgRNA)-based gene-editing since the first report of repetitive sequences of unknown significance in 1987 is fascinating, instructive, and inspiring for future advances. The recent approval of CRISPR-Cas9-based gene therapy to treat patients with severe sickle cell anemia and transfusion-dependent beta thalassemia has renewed hope for treating other hematologic diseases, including patients with germline predisposition to hematologic malignancies, who would benefit greatly from the development of CRISPR-based gene therapies. The purpose of this manuscript is three-fold: first, a chronological description of the history of CRISPR-Cas9-sgRNA-based gene editing; second, a brief description of the current state of clinical research in hematologic diseases, including selected applications in treating hematologic diseases with CRISPR-based gene therapy; and third, the current progress in gene therapies in inherited hematologic diseases and bone marrow failure syndromes, to hopefully stimulate efforts towards developing these therapies for patients with inherited bone marrow failure syndromes and other inherited conditions with germline predisposition to hematologic malignancies.

Tomato (Solanum lycopersicum) is one of the most cultivated vegetables in the world due to its consumption in a large variety of raw, cooked, or processed foods. Tomato breeding and productivity highly depend on the use of hybrid seeds and their higher yield, environmental adaption, and disease tolerance. However, the emasculation procedure during hybridization raises tomato seed production costs and labor expenses. Using male sterility is an effective way to reduce the cost of hybrid seeds and ensure cultivar purity. Recent developments in CRISPR genome editing technology enabled tomato breeders to investigate the male sterility genes and to develop male-sterile tomato lines. In the current study, the tomato Acotinase (SlACO) gene family was investigated via in-silico tools and functionally characterized with CRISPR/Cas9-mediated gene disruption. Genome-wide blast and HMM search represented two SlACO genes located on different tomato chromosomes. Both genes were estimated to have a segmental duplication in the tomato genome due to their identical motif and domain structure. One of these genes, SlACO2, showed a high expression profile in all generative cells of tomato. Therefore, the SlACO2 gene was targeted with two different gRNA/Cas9 construct to identify their functional role in tomato. The gene was mutated in a total of 6 genome-edited tomato lines, 2 of which were homozygous. Surprisingly, pollen viability was found to be extremely low in mutant plants compared to their wild-type (WT) counterparts. Likewise, the number of seeds per fruit also sharply decreased more than fivefold in mutant lines (10-12 seed) compared to that in WT (67 seed). The pollen shape, anther structures, and flower colors/shapes were not significantly varied between the mutant and WT tomatoes. The mutated lines were also subjected to salt and mannitol-mediated drought stress to test the effect of SlACO2 on abiotic stress tolerance. The results of the study indicated that mutant tomatoes have higher tolerance with significantly lower MDA content under stress conditions. This is the first CRISPR-mediated characterization of ACO genes on pollen viability, seed formation, and abiotic stress tolerance in tomato.

LONP1 is the principal AAA+ unfoldase and bulk protease in the mitochondrial matrix, so its deletion causes embryonic lethality. The AAA+ unfoldase CLPX and the peptidase CLPP also act in the matrix, conspicuously during stress periods, but their substrates are poorly defined. Mammalian CLPP deletion triggers infertility, deafness, growth retardation, and cGAS-STING activated cytosolic innate immunity. CLPX mutations impair heme biosynthesis and heavy metal homeostasis. CLPP and CLPX are conserved from bacteria to human, despite their secondary role for proteolysis. Based on recent proteomic-metabolomic evidence from knockout mice and patient cells, we propose that CLPP acts on phase-separated ribonucleoprotein granules, and CLPX on multi-enzyme condensates, near the inner mitochondrial membrane, as first-aid system. Trimming within assemblies, CLPP rescues stalled processes in mitoribosomes, in mitochondrial RNA granules and nucleoids, and in D-foci-mediated degradation of toxic double-stranded mtRNA / mtDNA. Unfolding multi-enzyme condensates, CLPX maximizes PLP-dependent delta-transamination, and rescues malformed nascent peptides. Overall, their actions occur in granules with multivalent or hydrophobic interactions, separated from the aqueous phase. Thus, the role of CLPXP in the matrix is compartment-selective, like peptidases MPP at precursor import pores, m-AAA and i-AAA at either IMM face, PARL within the IMM, and OMA1/HTRA2 in the intermembrane space.

Matrix metalloproteinase 3 (MMP3) plays multiple roles in pro-tumorigenic proteolysis and in intracellular transcription. These include inducing connective tissue growth factor [CTGF, also known as cellular communication network factor 2 (CCN2)] and prompting a new definition of MMP3 as a moonlighting metalloproteinase. Members of the MMP family have been found within tumor-derived extracellular vesicles (EVs) such as oncosomes or exosomes. We here investigated the roles of MMP3-rich oncosomes in tumor progression, molecular transmission, and gene regulation. MMP3 and CCN2/CTGF were significantly co-expressed in tumor samples derived from patients suffering from colorectal adenocarcinoma. We found that oncosomes derived from a rapidly metastatic colon cancer cells (LuM1) were enriched in MMP3 and a C-terminal half fragment of CCN2/CTGF. MMP3-rich oncosomes were highly transmissive into recipient cells and were pro-tumorigenic in an allograft mouse model. Oncosome-derived MMP3 was transmissive into recipient cell nuclei, trans-activated CCN2/CTGF promoter, and induced CCN2/CTGF production at 1 to 6 hours after the addition of oncosomes to culture media. In addition, CRISPR/Cas9-mediated knockout of MMP3 showed significant anti-tumor effects, including inhibition of migration and invasion of LuM1 cells in vitro, inhibition of tumor growth in vivo, and reduction of CCN2/CTGF and its promoter activity in vitro. These data newly demonstrate that the oncosome-derived moonlighting metalloproteinase promotes metastasis and is pro-tumorigenic at distant sites as well as a transmissive trans-activator for the cellular communication network gene.

African swine fever virus (ASFV) is a large double stranded DNA arbovirus that is highly contagious and seriously endangers the lives of domestic and wild pigs. In the past decade, African swine fever (ASF) has spread in many countries in the Caucasus, Russian Federation, Eastern Europe and Asia, causing significant losses to the pig industry. At present, there is a lack of effective vaccine and treatment for ASF. Therefore, the rapid and accurate detection is crucial for ASF prevention and control. In this study, we have developed a portable lateral flow strip (LFS) detection method mediated by recombinase polymerase amplification (RPA) and DNA enzyme (LwCas13a), which is performed at 37 ℃ and visualized by eyes without the need for complex instruments. This RPA-LwCas13a-LFS is based on the ASFV structural protein p17 gene (D117L), with a detection sensitivity up to 2 gene copies. This method is highly specific and has no cross reactivity to 7 other pig viruses. In the detection of 33 clinical samples, the p17 (D117L) RPA-LwCas13a-LFS had 100% coincidence with conventional quantitative PCR (qPCR). These findings demonstrate the potential of this simple, rapid, sensitive, and specific ASFV detection method for on-site ASFV detection.

With the rising prevalence of obesity, Non-Alcoholic Fatty Liver Disease (NAFLD) now affects 20-25% of the global population. NAFLD, a progressive condition associated with oxidative stress, can result in cirrhosis and liver cancer in 10% and 3% of patients suffering NAFLD, re-spectively. Therapeutic options are currently limited, emphasizing the need for novel treatments. In this study, we examined the potential of activating the transcription factor NRF2, a crucial player in combating oxidative stress, as an innovative approach to treating NAFLD. Utilizing a CRISPR-engineered human cell line, we were able to monitor the expression of heme oxygenase-1 (HMOX1), an NRF2 target, using a Nanoluc luciferase tag. Our model was validated using a known NRF2 activator, after which we screened 1200 FDA-approved drugs, unearthing six compounds (Disulfiram, Thiostrepton, Auranofin, Thimerosal, Halofantrine, and Vorinostat) that enhanced NRF2 activity and antioxidant response. These compounds demonstrated protec-tive effects against oxidative stress and lipid accumulation in vitro. Our study underscores the utility of CRISPR tagging with Nanoluc luciferase in identifying potential NRF2 activators, pav-ing the way for potential NAFLD therapeutics.

In addition to its use as a food additive, sesame is also very popular in conventional drugs because of its antifungal, anticancer, analgesic, antioxidant, and antiproliferative, vitamin B and E supplier, serum cholesterol and blood pressure-lowering, wound healing potential. In this study, the cytotoxicity, wound healing, and anticancer (antiproliferation) properties of the ex-tract obtained from in vitro cultures of Sesamum orientale L. cv. "Gökova" were investigated using in L929 fibroblast, MCF-7 breast, and A549 lung epithelial cell lines. In our study, the cisplatin was also used as a control group to compare the anticancer efficacy of our plant extract. The IC50 values obtained from cell treatments were 922.73 µg.ml-1 (plant extract) and 33.09 µg.ml-1 (cispla-tin) for A549 µg.ml-1, 1837.07 µg.ml-1 (plant extract) and 19.27 µg.ml-1 (cisplatin) for MCF-7, and 154.70 µg.ml-1 (plant extract) for L929, respectively. The subcytotoxic doses of the treated plant extract provided the healing of artificially created wounds on L929 fibroblast cell cultures within 48 hours. For the evaluation of the anticancer activity, it was also determined that transcriptomic analyzes of BCL-XL gene, which is negatively correlated with apoptotic pathway, and Cas3 and Cas9 genes, which are positively correlated with apoptotic pathway, showed a statistically sig-nificant increase in A549 and MCF-7 cell lines treated with plant extract or cisplatin. In the light of the results obtained from the present study, it was seen that sesame plant extract may have wound healing potential at decreasing doses and anticancer activity potential at increasing dos-es. The present study can be a useful resource for the development of a drug with wound healing and/or antiproliferative potential, with applications to be made in different cell lines in the future.

The paper focuses on the application of a multilevel, integrative and territorial approach to the protection of cultural heritage through planning instruments in Serbia. It points out the problems of the sectoral approach and discusses international recommendations that can be integrated into the planning methodology. The case study is the area of Djerdap National Park, which has an already established international and national importance. The research suggests that the cultural heritage in the area, with the exception of the Roman limes, is still recognized at the level of individual localities. The study emphasizes the importance of aligning all levels of governance to safeguard the whole spatial entity rather than focusing solely on its particular areas. The interna-tional and national importance of the planning area contributes to the strengthening of awareness of heritage and its institutional protection. However, the vitality of the area, which is key to its sustainable development, comes from the local level. Planning documents contribute to the inte-gration of local values and local communities into development programs and projects.

Glycosidic linkage analysis was conducted on the unfractionated polysaccharides in the alcohol-insoluble residues (AIRs) prepared from six red seaweeds (Gracilariopsis sp., Prionitis sp., Mastocarpus papillatus, Callophyllis sp., Mazzaella splendens, and Palmaria palmata) using GC-MS/FID analysis of partially methylated alditol acetates (PMAAs). The cell walls of P. palmata primarily contained mixed-linkage xylans and small amounts of sulfated galactans and cellulose. In contrast, the unfractionated polysaccharides of the other five species were rich in galactans displaying diverse 3,6-anhydro-galactose and galactose linkages with varied sulfation patterns. Different levels of cellulose were also observed. This glycosidic linkage method offers advantages for cellulose analysis over traditional monosaccharide analysis that is known for underrepresenting glucose in crystalline cellulose. Relative linkage compositions calculated from GC-MS and GC-FID measurements showed that anhydro sugar linkages generated more response in the latter detection method. This improved linkage workflow presents a useful tool for studying polysaccharide structural variations across red seaweed species. Furthermore, for the first time, relative linkage compositions from GC-MS and GC-FID measurements, along with normalized FID and total ion current (TIC) chromatograms without peak assignments, were analyzed using principal component analysis (PCA) as a proof-of-concept demonstration of the technique's potential to differentiate various red seaweed species.

Background: Educating college students about the importance of good sleep habits could lead to the adoption of healthier sleep routines, including sufficient sleep duration and sleep quality. The current pre-post study examines the impact of completing a sleep education program called “Sleep 101” on (1) sleep hygiene practices, (2) sleep quality, and (3) weekday and weekend sleep behaviors among college students. “Sleep 101” is an interactive online course developed to educate college students about the importance of sleep by addressing basic sleep physiology, the impact of sleep on mood, academic and physical performance, the interactions between sleep and various substances, and common sleep disorders. Methods: 338 college students were recruited from a midsized public university in the US and invited to participate in “Sleep 101”, of which 25 participants completed the baseline and post-intervention questionnaire. The Sleep Hygiene Index (SHI) was utilized to evaluate sleep hygiene practices, while standard questions were employed to assess weekday and weekend sleep behaviors and overall sleep quality. Results: Those who completed the study demonstrated a significant increase in weekday sleep duration and were less likely to engage in negative prior bedtime activities. In addition, 40% of those who completed baseline and post-intervention assessments noticed improvements in their sleep quality. Conclusion: These findings suggest that a brief online program is beneficial in improving sleep behaviors among college and could be a scalable approach to addressing current sleep issues and preventing future sleep problems in college students.

The profile of secondary metabolites occurring in apple cuticular layer is not only characteristic for particular apple cultivar, but also dynamically reflects various external factors in growing environment. In this study, the possibility to authenticate apple samples based on analysis of their cuticular layer extracts was investigated. Ultra-high-performance liquid chromatography coupled to high resolution tandem mass spectrometry (UHPLC-HRMS/MS) was employed for obtaining metabolomic fingerprints. In total, 274 authentic apple samples, four cultivars harvested within the seasons 2020 to 2022 in the Czech Republic and Poland were analysed. The generated complex data processed by univariate and multivariate statistical methods enabled to build classification models for discrimination of apple cultivars as well as their geographical origin. The models showed very good performance in differentiation of Czech and Polish samples for three of four cultivars: ‘Gala’, ‘Golden Delicious’ and ‘Idared’, moreover, the validity of the models was verified over harvest seasons. The diagnostic markers, besides metabolites of triterpene biosynthetic pathway, mainly represented wax esters. ‘Jonagold’, which is known to be susceptible to mutations, was the only cultivar for which the unambiguous classification of geographical origin was not possible.

Strawberry root rot caused by Neopestalotiopsis clavispora is one of the main diseases of strawberry and significantly impacts the yield and quality of strawberry fruit. There are now no effective control techniques available except for fungicide sprays, which may directly impact consumers. Biological control is becoming an alternative method for the control of plant diseases to replace or decrease the application of traditional synthetic chemical fungicides. Trichoderma is widely used as a biological agent for controlling strawberry root rot. In order to provide resources for screening the highly effective biocontrol fungus for controlling strawberry root rot caused by Neopestalotiopsis clavispora, the biocontrol mechanism,the control effects of Trichoderma asperellum CMT10 against strawberry root rot and growth-promoting effects on strawberry seedlings were investigated by plate culture, microscopy observation and root drenching methods.The results showed that CMT10 had obvious competitive, antibiotic and hyperparasitism effects on Neopestalotiopsis clavispora CMGF3. The CMT10 could quickly occupy nutritional space, and the inhibition rates of CMT10 against CMGF3 in confrontation culture on 7 d was 65.49%. The inhibition rates of volatile metabolite and fermentation metabolite produced by CMT10 against CMGF3 were 79.67% and 69.84%, respectively. The mycelium of strain CMT10 can act as hyperparasites by making contacting, winding and penetrating hyphae of CMGF3. Pot experiment showed that the biocontrol efficacy of CMT10 on strawberry root rot caused by Neopestalotiopsis clavispora was 63.00%. CMT10 had obvious promotion effect on strawberry growth, the plant height, root length, total fresh weight, root fresh weight, stem fresh weight and root dry weight, with the promotion rates were 20.09%, 22.39%, 87.11%, 101.58%, 79.82% and 72.33%, respectively. Overall, this study showed the ability of Trichoderma asperellum CMT10 to control strawberry root rot and their potential to develop as novel biocontrol agents to replace chemical fungicides for eco-friendly, sustainable agriculture.

Apis mellifera, especially weak ones, are highly vulnerable to Carpoglyphus lactis mites, which can rapidly infest and consume stored pollen, leading to weakened colonies and potentially colony collapse. This study aimed to ascertain and investigate the prevalence of this mite in honeybee colonies across 9 provinces in the Republic of Korea (ROK). A total of 615 honeybee colonies were collected, from 66 apiaries during the spring and 58 apiaries during the summer of 2023. A 1,242 bp segment of the the Cytochrome c oxidase subunit 1 (COI) gene was amplified using the polymerase chain reaction method. The detection levels of C. lactis in the honeybees were compared between winter and summer. Based on the COI sequence analysis, the nucleotide sequence similarity of C. lactis mites isolated in the ROK with those from China (NC048990.1) was found to be 99.5%, and with those from the United Kingdom (KY922482.1) was 99.3%. This study is the first report of C. lactis in Korean apiaries. The findings in this study demonstrate a significantly higher detection rate in winter, which is 4.1 times greater than that in summer (p &lt; 0.001). Furthermore, the results underscore the usefulness of molecular diagnostic techniques for detecting C. lactis mites.