A progressive and chronic neurological condition called MSA (Multiple System Atrophy) is characterized clinically by varying degrees of dysautonomia, cerebellar ataxia, and parkinsonism. The concept of mitochondrial dysregulation in MSA is one perspective in handling this neurodegenerative disease. Damage to functional mitochondria is driven by the presence of ɑ-Synuclein-induced mitochondrial localization. The goal of MSA treatment up until now has been to reduce symptoms. One of the innovations in the treatment of MSA could be the novel idea based on mitochondrial reprogramming pathways. Mitochondrial reprogramming can be done in various ways in which the use of hydrogen, magnesium and low-dose hydrogen peroxide.

Background:Caregiving for individuals with neurological disease involves providing physical, emotional, and social support, which can be a challenging and stressful experience. This study aims to compare the caregivers' burden, including the impact on mental and physical health, social support, and quality of life, in different neurodegenerative disorders. Methods:Fifty-five primary caregivers (F=41;mean age=53.07±12.29) of patients with Parkinson's Disease (PD=26), Multiple System Atrophy (MSA=16), and Amyotrophic Lateral Sclerosis (ALS=13), took part in the study. Standardized screening scales for the quality of life (EQ-5D/EQ-VAS and PQoL), levels of the caregiving burden (CBI and FSQ), and the assessment of the anxiety-depressive axis (HADS) were administered. Results: The mean CBI score was higher for caregivers of MSA patients (28.81±21.90) and ALS (25.15±16.23) than for caregivers of PD patients (16.08±10.34; p=0.036). Critical burden (cut-off>36) was present in the caregivers of MSA (31.3%), ALS (23.1%), and PD (19.2%) patients. Caregivers of patients with ALS had a worse perception of quality of life (EQ-5D total score) than caregivers of patients with MSA and PD (p

Background: Multiple system atrophy (MSA) is a rapidly progressive neurodegenerative disorder that has no curative treatment. Diagnosis is based on a set of criteria established by Gilman (1998 and 2008) and recently updated by Wenning (2022). We aim to determine the effectiveness of [123I]Ioflupane SPECT in MSA, especially at the initial clinical suspicion. Methods: Cross-sectional study of patients at initial clinical suspicion of MSA, referred for [123I]Ioflupane SPECT. Results: 139 patients (68 men, 71 women) were included, 104 being MSA-probable and 35 MSA-possible. MRI was normal in 89.2% while SPECT was positive in 78.45%. SPECT showed high sensitivity (82.46%) and positive predictive value (86.24), reaching maximum sensitivity in MSA-P (97.26%). Significant differences were found when relating both SPECT assessments in the healthy-sick and inconclusive-sick groups. We also found an association when relating SPECT to the subtype (MSA-C or MSA-P), as well as to the presence of parkinsonian symptoms. Lateralization of striatal involvement was detected (left side). Conclusions: [123I]Ioflupane SPECT is a useful and reliable tool for diagnosing MSA, with good effectiveness and accuracy. Qualitative assessment shows a clear superiority when distinguishing between the healthy-sick categories, as well as between the parkinsonian (MSA-P) and cerebellar (MSA-C) subtypes at initial clinical suspicion.

Aggregated alpha-synuclein (-synuclein) is the main component of Lewy bodies (LBs), Lewy neurites (LNs), and glial cytoplasmic inclusions (GCIs), which are pathological hallmarks of idiopathic Parkinson’s disease (IPD) and multiple system atrophy (MSA), respectively. Initiating factors that culminate in forming LBs/LNs/GCIs remain elusive. Several species of -synuclein exist, including phosphorylated and nitrated forms. It is unclear which -synuclein post-translational modifications (PTMs) appear within aggregates throughout disease pathology. Herein we aimed to establish the predominant synuclein PTMs in post-mortem IPD and MSA pathology using immunohistochemistry. We examined the patterns of three -synuclein PTMs (pS87, pS129, nY39) simultaneously in pathology-affected regions of 15 PD, 5 MSA, 6 neurologically normal controls. All antibodies recognized LBs, LNs, and GCIs, albeit to a variable extent. pS129 -synuclein antibody was particularly immunopositive for LNs and synaptic dot-like structures followed by nY39 -synuclein antibody. GCIs, neuronal inclusions, and small threads were positive for nY39 -synuclein in MSA. Quantification of the LB scores revealed that pS129 -synuclein was the dominant and earliest -synuclein PTM followed by nY39 -synuclein, while lower amounts of pSer87 -synuclein appeared later in disease progression in PD. These results may have implications for novel biomarker and therapeutic developments.

Doxorubicin (Dox) is a commonly used chemotherapeutic that can adversely affect skeletal muscle, including causing muscle atrophy. Dox is known to induce an event known as mitochondrial permeability transition (MPT) in cardiac muscle and this plays an important role in Dox-mediated cardiac toxicity. Further to this, recent evidence identifies MPT as a mechanism of atrophy in skeletal muscle, suggesting that MPT may underlie some of the Dox-related toxicity in skeletal muscle. To test this hypothesis, we used cultured human primary myotubes, C2C12 myotubes, and single adult mouse flexor digitorum brevis (FDB) muscle fibers in experiments involving Dox treatment with or without inhibitors of MPT. Dox treatment of myotubes caused myonuclear translocation of the mitochondrial protein apoptosis inducing factor (AIF) and increased mitochondrial reactive oxygen species (mROS), consistent with the known consequences of MPT. Furthermore, Dox caused atrophy in C2C12 myotubes grown on patterned plates, human primary myotubes, and single muscle fibers from adult mice. Notably, Dox-induced atrophy could be prevented by a wide variety of agents that inhibit MPT, as well as by inhibiting mROS or Caspase 3. In conclusion, our results indicate that MPT plays an important role in driving Dox-mediated skeletal muscle atrophy.

Cloud computing refers to applications delivered as services over the Internet. Cloud systems employ policies that are inherently dynamic in nature and that depend on temporal conditions defined in terms of external events, such as the measurement of bandwidth, use of hosts, intrusion detection or specific time events. In this paper, we investigate an optimized resource management scheme named v-Mapper. The basic premise of v-Mapper is to exploit application-awareness concepts using software-defined networking (SDN) features. This paper makes three key contributions to the field: (1) We propose a virtual machine (VM) placement scheme that can effectively mitigate the VM placement issues for data-intensive applications; (2) We propose a validation scheme that will ensure that a service is entertained only if there are sufficient resources available for its execution and (3) We present a scheduling policy that aims to eliminate network load constraints. An evaluation was carried out with various benchmarks and demonstrated that v-Mapper shows improved performance over other state-of-the-art approaches in terms of average task completion time, service delay time and bandwidth utilization. Given the growing importance of supporting large-scale data processing and analysis in datacentres, the v-Mapper system has the potential to make a positive impact in improving datacentre performance in the future.

By introducing environmental mediator, for avoiding randomness in selecting indicators and subjectivity in deciding interaction path coefficients to reveal interaction mechanism among forest industry, ecology and environmental capacity, structural Pressure–State–Impact–Response (PSIR) and quantitative Structural Equation Modeling (SEM) are utilized with data on thirty–one provinces of China. We can find that: (i) forest industry has a negative influence on ecology, whereas ecology has a positive influence on industry; (ii) the destructive influence that industry has on ecology is much greater than the positive effect ecology has on industry; and (iii) environmental capacity plays a partial mediating role between industry and ecology. According to these results we can conclude that: (i) forest industry and ecology are not in a symbiotic relationship and have not reached a level of ecological security; (ii) the interaction between industry and ecology is in a period of transition from antagonistic to beneficial; and (iii) industry dominates ecology. However, we prospect the following advice: (i) methods of forest industry should be changed; (ii) new modes of industrial integration and circular economy should be developed; and (iii) the ability of the environment to sustain itself should be enhanced. The level of forest ecological security to discuss the symbiotic mechanism of industry and ecology will propose to be measured in future.

Taiwan’s auditors have suffered from processing excessive audit data, including drawing audit evidence. This study advances sampling techniques by integrating machine learning with sampling. This machine learning integration helps avoid sampling bias, keep randomness and variability, and target the risker samples. We first apply a Naive Bayes classifier to classify data into some classes. Next, a user-based, item-based, or hybrid approach is employed to draw audit evidence. The representativeness index is the primary metric for measuring the representativeness of audit evidence. The user-based approach denotes the selection of samples between two percentiles in a class as audit evidence. It may be equivalent to a combination of monetary and variable sampling methods. The item-based approach represents the choice of risky samples as audit evidence. It may be identical to a combination of non-statistical and monetary sampling methods. Auditors can hybridize those user-based and item-based approaches to balance representativeness and riskiness in selecting audit evidence. Three experiments show that sampling using machine learning integration has the benefits of drawing unbiased samples, handling complex patterns, correlations, and unstructured data, and improving efficiency in sampling big data. However, the limitations are the classification accuracy output by machine learning algorithms and the range of prior probabilities.

In the dynamic landscape of the telecommunications industry, understanding and mitigating customer churn is paramount for maintaining competitive advantage and sustaining revenue streams. This comprehensive literature review delves into the intricacies of customer churn prediction, a crucial aspect in fortifying the bond between telecom businesses and their customers. The review methodically analyzes 11 articles published between 2000 and March 2024, spotlighting the strategic role of Customer Relationship Management and the prevalence of high churn rates that necessitate a shift from customer acquisition to retention strategies. Furthermore, the review navigates through the challenges inherent in churn prediction, including the complexities of managing large, imbalanced, and noisy datasets and the intricacies involved in model selection and optimization. Despite these challenges, the paper highlights the superior capability of machine learning techniques in handling complex datasets to provide accurate predictions, albeit acknowledging their practical complexities. The main aim of the study is to provide an overview, serving as a knowledge base for researchers interested in machine learning techniques within the realm of telecommunications.

Herein, we present the design technique of a resonant rectifier for piezoelectric (PE) energy harvesting. We propose two diode equivalents to reduce the voltage drop in the rectifier operation, a minuscule-drop-diode equivalent (MDDE) and a low-drop-diode equivalent (LDDE). The diode equivalents are embedded in resonant rectifier integrated circuits (ICs), which use symmetric bias-flip to reduce the power wasted for charging and discharging the internal capacitance of a PE transducer. The self-startup function is supported by synchronously generating control pulses for the bias-flip from the PE transducer. Two resonant rectifier ICs, using both MDDE and LDDE, are fabricated in a 0.18 μm CMOS process and their performances are characterized under external and self-power conditions. Under the external-power condition, the rectifier using LDDE delivers an output power POUT of 564 μW and a rectifier output voltage VRECT of 3.36 V with a power conversion efficiency (PCE) of 90.1%. Under self-power conditions, the rectifier using MDDE delivers a POUT of 288 μW and a VRECT of 2.4 V with a corresponding PCE of 74.6%. The result shows that the power extraction capability of the proposed rectifier is 5.9 and 3.0 times higher than that of a conventional full-bridge rectifier.

This paper proposes a novel single-stage buck-boost three-Level neutral-point-clamped (NPC) inverter with two independent dc sources coupled for the grid-tied photovoltaic (PV) application, which can effectively solve the unbalanced operational conditions generally appeared between two coupled independent PV sources induced by the unequal irradiation and temperature distribution. The proposed control scheme can simultaneously guarantee the maximum power point (MPP) operation of both PV sources and maintain the output waveform quality. Compared to the traditional two-stage PV inverter, the proposed NPC inverter could reduce the PV array voltage requirement and dc-link capacitors’ voltage rating, meanwhile show the advantage in operational efficiency. MATLAB simulations and the captured experimental results are presented to show the performance of the proposed three-level inverter.

Recent studies have been able to detect α-synuclein (αSyn) seeding in formaldehyde-fixed paraffin-embedded (FFPE) tissues from patients with synucleinopathies using seed amplification assays (SAAs), but with relatively low sensitivity due to limited protein extraction efficiency. With the aim of introducing an alternative option to frozen tissues, we developed a streamlined protein extraction protocol for evaluating disease-specific seeding in FFPE human brain. We evaluated the protein extraction efficiency of different tissue preparations, deparaffinizations, and protein extraction buffers using formaldehyde-fixed and FFPE tissue of a single Lewy body disease (LBD) subject. Alternatively, we incorporated heat-induced antigen-retrieval and dissociation using a commercially available kit. Our novel protein extraction protocol has been optimized to work with 10 sections of 4.5-µm-thickness or 2-mm-diameter micro-punch of FFPE tissue that can be used to seed SAAs. We demonstrated that extracted proteins from FFPE still preserve seeding potential and further show disease-specific seeding in LBD and multiple system atrophy. To the best of our knowledge, our study is the first to recapitulate disease-specific αSyn seeding behavior in FFPE human brain, with structural validation. Our findings open new perspectives in re-evaluating archived human brain tissue, extending the disease-specific seeding assays to larger cohorts to facilitate molecular subtyping of synucleinopathies.

The article presents several innovative systems developed through student laboratory projects, including two autonomous vehicles, a four-legged walking robot, an active ankle-foot orthosis, a ball on beam balancing mechanism, a ball on plate system, and a manipulator arm—all powered by pneumatic artificial muscles (PAMs). Fluidic muscles offer significant potential in various mechatronic systems, robots, and manipulators due to their flexible, lightweight nature and compliance. Their ability to produce smooth and adaptable motions is particularly beneficial in applications requiring natural and human-like movement, such as rehabilitation and assistive devices. Although PAMs powered control systems face challenges with nonlinear phenomena, their biologically inspired design holds promise for future applications across various industries. These may include innovative applicability in industrial, automotive, and aerospace sectors, as well as use in sports, medical aids, entertainment, and animatronics. Incorporating self-made laboratory systems actuated by PAMs into control systems education offers a comprehensive learning opportunity that combines theoretical concepts with hands-on experience. This approach develops the necessary skills of future engineers, expanding their understanding of technical principles and preparing them for future challenges in engineering practice.

Intelligent fault diagnosis techniques have replaced the time-consuming and unreliable human analysis, increasing the efficiency of fault diagnosis. Deep learning model can improve the accuracy of intelligent fault diagnosis with the help of its multilayer nonlinear mapping ability. This paper has proposed a novel method named Deep Convolutional Neural Networks with Wide First-layer Kernels (WDCNN). The proposed method uses raw vibration signals as input (data augmentation is used to generate more inputs), and uses the wide kernels in first convolutional layer for extracting feature and suppressing high frequency noise. Small convolutional kernels in the preceding layers are used for multilayer nonlinear mapping. AdaBN is implemented to improve the domain adaptation ability of the model. The proposed model addresses the problem that currently, the accuracy of CNN applied to fault diagnosis is not very high. WDCNN can not only achieve 100% classification accuracy on normal signals, but also outperform state of the art DNN model which is based on frequency features under different working load and noisy environment.

Scientists can use the Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) protein 9 system, which is a powerful and flexible tool for changing the genome, to change only certain parts of the genome. This has helped researchers figure out how target genes work in biology and disease. CRISPR/Cas9 is made up of a sequence-specific CRISPR RNA (crRNA) set and a generic Cas9 nuclease. The crRNA set tells Cas9 where to cut DNA and cause double-strand breaks. In the next step of cellular DNA repair, insertions, deletions, and swaps are made at specific spots. For CRISPR/Cas9-mediated DNA cleavage to be specific, the target sequences must match the crRNA, and a protospacer nearby motif must be placed after the target sequences. In this article, we talk about how CRISPR/Cas9 works at the molecular level, what it can be used for, what it can't do, and what its future clinical treatment promise might be.

In this paper, a method is developed for presenting a novel virtual torque sensor based on precise model and position measurements avoids the need of traditional strain gauges and amplifiers. More specifically, the harmonic drive compliance model and the Gaussian process regression (GPR) technique are used together to achieve virtual torque sensor measurement. While the harmonic drive compliance model provides the analytic part, the Gaussian process regression method is used to reconstruct the unmolded part based on motor-side and link-side joint angles as well as motor current. After an automatic offline calibration, the method allows for a lean online implementation. The virtual torque sensor measurement is compared with measurements of a commercial torque sensor, and the results have attested the effectiveness of the proposed method.

This paper aims to develop a hierarchical risk assessment model using the newly-developed evidential reasoning (ER) rule, which constitutes a generic conjunctive probabilistic reasoning process. In this paper, we first provide a brief introduction to the basics of the ER rule and emphasize the strengths for representing and aggregating uncertain information from multiple experts and sources. Further, we discuss the key steps of developing the hierarchical risk assessment framework systematically, including (1) formulation of risk assessment hierarchy, (2) representation of both qualitative and quantitative information, (3) elicitation of attribute weights and information reliabilities, (4) aggregation of assessment information using the ER rule and (5) quantification and ranking of risks using utility-based transformation. The proposed hierarchical risk assessment framework can potentially be implemented to various complex and uncertain systems. A case study on the fire/explosion risk assessment of marine vessels demonstrates the applicability of the proposed risk assessment model.

Abstract: High step-up voltage gain nonisolated DC-DC converter have attracted much attention in photovoltaic, fuel cells and other renewable energy system applications. In this paper, by combining input current ripple-free boost cell with coupled-inductor voltage-doubler cell, an input current ripple-free high voltage gain nonisolated converter is proposed. In addition, passive lossless clamp circuit is adopted to recycle the leakage inductor energy and to reduce the voltage spike across the power switch. By utilizing voltage-doubler cell consisting of diode and capacitor, the voltage stress of switch is further reduced and the resonance between the leakage inductor and the stray capacitor of the output diode is eliminated. A low switch-on-resistance low-voltage-rated MOSFET can therefore be employed to reduce the conduction loss and cost. The reverse recovery loss of output diode is reduced, and the efficiency of converter can be improved. Furthermore, the proposed converter can achieve nearly zero input current-ripple and make the design of electromagnetic interference (EMI) filter easy. Steady state analysis and operation mode of the converter is performed. Finally, experimental results are presented to verify the analysis results of the proposed converter.

Estimating ground surface PM2.5 with fine spatiotemporal resolution is a critical technique for exposure assessments in epidemiological studies of its health risks. Previous studies have utilized monitoring, satellite remote sensing or air quality modeling data to evaluate the spatiotemporal variations of PM2.5 concentrations, but such studies rarely combined these data simultaneously. We develop a three-stage model to fuse PM2.5 monitoring data, satellite-derived aerosol optical depth (AOD) and community multi-scale air quality (CMAQ) simulations together and apply it to estimate daily PM2.5 at a spatial resolution of 0.1˚ over China. Performance of the three-stage model is evaluated using a cross-validation (CV) method step by step. CV results show that the finally fused estimator of PM2.5 is in good agreement with the observational data (RMSE = 23.00 μg/m^3 and R2 = 0.72) and outperforms either AOD-retrieved PM2.5 (R2 = 0.62) or CMAQ simulations (R2 = 0.51). According to step-specific CVs, in data fusion, AOD-retrieved PM2.5 plays a key role to reduce mean bias, whereas CMAQ provides all-spacetime-covered predictions, which avoids sampling bias caused by non-random incompleteness in satellite-derived AOD. Our fused products are more capable than either CMAQ simulations or AOD-based estimates in characterizing the polluting procedure during haze episodes and thus can support both chronic and acute exposure assessments of ambient PM2.5. Based on the products, averaged concentration of annual exposure to PM2.5 was 55.75 μg/m3, while averaged count of polluted days (PM2.5 > 75 μg/m3) was 81, across China during 2014. Fused estimates will be publicly available for future health-related studies.

Natural polluted insulator surfaces are always coated with various kinds of soluble constituents, and those constituents affect flashover performance differentially. Currently this fact is not considered either in laboratory experiments or field pollution degree measurements, causing the existing insulation selection method to be deficient. In this paper a systematical research on insulator flashover voltage gradient correction involving types of soluble pollution constituents was presented. Taking typical type glass insulator as the sample, its flashover tests polluted by typical soluble chemicals NaCl, NaNO₃, KNO₃, NH₄NO₃, MgSO₄, Ca(NO₃)₂ and CaSO₄ were carried out. Then the flashover gradient correction was made combining the flashover performance of each soluble constituent, the ESDD contribution of the seven constituents, as well as the saturation performance of CaSO₄. The correction was well verified with the flashover test results of insulator polluted by three types of soluble mixture. Research results indicate that the flashover gradient correction method proposed by this paper performs well in reducing the calculating error. It is recommended to carry out component measurements and flashover gradient correction to better select outdoor insulation configuration.

This study investigates the long-term stability of the Suomi National Polar-orbiting Partnership (S-NPP) Visible Infrared Imaging Radiometer Suite (VIIRS) moderate-resolution Thermal Emissive Bands (M TEBs; M12 – M16) covering a period from February 2012 to August 2020. It also assesses inter-sensor consistency of the VIIRS M TEBs among three satellites-S-NPP, NOAA-20, and NOAA-21 over eight months spanning from March 18 to November 30, 2023. The field of interesting is limited to the ocean surface between 60°S and 60°N, specifically under clear-sky conditions. Taking radiative transfer modeling (RTM) as the transfer reference, we employed the Community Radiative Transfer Model (CRTM) to simulate VIIRS TEB brightness temperature (BTs), incorporating European Centre for Medium-range Weather Forecasts (ECMWF) reanalysis data as inputs. Our results reveal two key findings. Firstly, the reprocessed S-NPP VIIRS TEBs exhibit a robust long-term stability, as demonstrated through analyses of the observation minus background BT differences (O-B ∆BTs) between VIIRS measurements (O) and CRTM simulations (B). The drifts of the O-B BT differences are consistently less than 0.105 K/Decade across all S-NPP VIIRS M TEB bands. Notably, observations from VIIRS M14 and M16 stand out with drifts well within 0.04 K/Decade, reinforcing their exceptional reliability for climate change studies. Secondly, excellent inter-sensor consistency among these three VIIRS instruments is confirmed through the double-difference analysis method (O-O). This method relies on the O-B BT differences obtained from daily data. The mean inter-VIIRS O-O BT differences remain within 0.08 K for all M TEBs, except for M13. Even in the case of M13, the O-O BT differences between NOAA-21 and NOAA-20/S-NPP have values of 0.312 K and 0.234 K, respectively, which are comparable to the 0.2 K difference between some TEBs among VIIRS and MODIS. These disparities are primarily attributed to the significant differences in the Spectral Response Function (SRF) of NOAA-21 compared to NOAA-20 and S-NPP. Our study confirms the RTM-based TEB quality evaluation method’s versatility and effectiveness in assessing long-term sensor stability and inter-sensor consistency. The double-difference approach effectively mitigates uncertainties and biases inherent to CRTM simulations, establishing itself a robust mechanism for assessing inter-sensor consistency. In addition, we’ve observed that, except for M13, M12 always exhibits larger spatial variations of O-O BT differences with greater uncertainties compared to the other M TEBs. The influence of solar contribution through sea surface reflection on the Top of Atmosphere (TOA) radiance measurements during daytime in M12 should not be underestimated.

Utilization of wasted heat instead of fuel combustion is effective to reduce primary energy consumption for mitigating global warming problem. Because wasted heat sources are not necessarily located close to areas of heat demand, one of the difficulties is that wasted heat has to be transferred from heat source side to heat demand side, which may require heat transportation over long distance. From this point we proposed and have examined new idea of heat transportation using ammonia-water as the working fluid which system is named Solution Transportation Absorption chiller, in short STA. Our previous studies of STA were mainly the experimental investigation with STA facility which cooling power was 25RT (90kW). As a result, the COP of STA was found almost same value 0.65 with the conventional absorption chiller without depending on the transportation distances. The simulation using AspenHYSYS also examined with same experimental condition. The experimental data showed good agreement with the simulation calculation. In this study, we examined the large-scale cooling power STA on simulation. The examination cooling powers were from 90 kW(25RT) to 3517 kW(1000RT). All cooling power achieved around COP 0.64 including pump power consumptions. In addition, we performed the dynamic simulation. As the results, there was no effect of pipeline size on the cooling capacities and mass flow rates. Furthermore, the stability time of the cooling capacities and mass flow rates were almost same regardless of the pipeline size and cooling capacity. In other words, STA may be achieved the same COP even though having various complex conditions compared with the conventional absorption chiller.

Structural health monitoring has been studied by a number of researchers as well as various industries to keep up with the increasing demand for preventive maintenance routines. This work presents a novel method for reconstruct prompt, informed strain/stress responses at the hot spots of the structures based on strain measurements at remote locations. The structural responses measured from usage monitoring system at available locations are decomposed into modal responses using empirical mode decomposition. Transformation equations based on finite element modeling are derived to extrapolate the modal responses from the measured locations to critical locations where direct sensor measurements are not available. Then, two numerical examples (a two-span beam and a 19956-degree of freedom simplified airfoil) are used to demonstrate the overall reconstruction method. Finally, the present work investigates the effectiveness and accuracy of the method through a set of experiments conducted on an aluminium alloy cantilever beam commonly used in air vehicle and spacecraft. The experiments collect the vibration strain signals of the beam via optical fiber sensors. Reconstruction results are compared with theoretical solutions and a detailed error analysis is also provided.

There is a marked momentum towards the use of clean hydrogen energy as an alternative for fossil fuels. Renewable energies such as solar and wind are being used to generate hydrogen from the water hydrolysis process. Indeed, this approach stores renewable energies in the form of combustible hydrogen for other energy uses. The other alternative that could be economically more cost-effective at the current technology stage is to explore the natural “Hydrogen System” where the natural hydrogen is generated and accumulated within the earth system, the same that stands for a “Petroleum System”. The Discovery of a large accumulation of relatively pure natural hydrogen (H2) in Mali has triggered the opportunity of searching for natural hydrogen accumulations in other countries. The generation of hydrogen from a circular depression in Mali and some other countries is linked to the presence of geologically very old iron-rich basement rocks. Solid-liquid redox reactions between iron-rich minerals and groundwater that split water are a possible source of H2 in deep basement rocks. It is believed that the hydrogen degassing may be detected by surface topographic circular to sub-circular shallow depressions. Chemical processes such as dissolution by hydrogen are considered to play the main role in the formation of the circular depressions through preferential vertical hydrogen migration channel. Archean iron-rich Yilgarn Craton that covers a vast area of Western Australia (WA) contains abundant iron-rich mafic-ultramafic rocks. The craton reveals many surficial circular depressions visible through satellite images. The area has abundant fault systems and is blanketed with Eocene sedimentary rocks containing high-quality reservoir rocks. All these characteristics seem to provide most of the required elements, such as hydrogen source, migration pathway, and reservoir rock for a “Hydrogen System” in this area.

This study explores optimizing Synthetic Aperture Radar (SAR) satellite constellation scheduling for multi-imaging missions in densely targeted areas using an in-house developed Modified Dynamic Programming (MDP) algorithm. By employing Mixed-Integer Linear Programming (MILP) to define the mission planning problem, the research aims to maximize observation of high-value targets within restricted planning horizons. Numerical simulations, covering a wide range of target numbers and satellite configurations, reveal the MDP algorithm’s superior mission allocation efficiency, enhanced success rates, and reduced revisit times, compared to the Greedy algorithm. The findings underscore the MDP algorithm’s improved operational efficiency and planning robustness for complex imaging tasks, demonstrating significant advancements over traditional approaches.

Familial Alzheimer’s disease (FAD) can be caused by mutations in PSEN1 that encodes presenilin-1, a component of the gamma-secretase complex that cleaves amyloid precursor protein. Alterations in calcium (Ca2+) homeostasis and glutamate signaling are implicated in the pathogenesis of FAD, however it has been difficult to assess in humans whether or not these phenotypes are the result of amyloid or tau pathology. This study aimed to assess early calcium and glutamate phenotypes of FAD by measuring the Ca2+ response of induced pluripotent stem cell (iPSC)-derived neurons bearing PSEN1 mutations to glutamate and the ionotropic glutamate receptor agonists NMDA, AMPA and kainate compared to isogenic control and healthy lines. The data shows that in early neurons, even in the absence of amyloid and tau phenotypes, FAD neurons exhibit increased Ca2+ responses to glutamate and AMPA, but not NMDA or kainate. Together this suggests that PSEN1 mutations alter Ca2+ and glutamate signaling as an early phenotype of FAD.

Astaxanthin (AX) is a carotenoid that exerts potent antioxidant activity and acts in the lipid bilayer. This study aimed to investigate the effects of AX on muscle atrophy-mediated disturbance of mitochondria that have a lipid bilayer. Tail suspension was used to establish muscle- atrophied mouse models. AX diet fed to tail-suspension mice prevented loss of muscle weight and decreased myofiber size in the soleus muscle. Additionally, AX improved down-regulation of mitochondrial respiratory chain complexes II and III in the soleus muscle after tail suspension. To confirm the AX phenotype in the soleus muscle, we examined its effects on mitochondria using Sol8 myotubes derived from the soleus muscle. We found that AX was preferentially detected in the mitochondrial fraction; it significantly suppressed mitochondrial complex III-driven production of reactive oxygen species in Sol8 myotubes. Moreover, AX inhibited the activation of caspase 3 via inhibiting the release of cytochrome c into the cytosol in antimycin A-treated Sol8 myotubes. These results suggested that AX inhibited mitochondrial oxidative stress through a mitochondria-mediated apoptosis pathway and thus prevented muscle atrophy.

Aiming at the limitations of single-functionality, limited applicability, and complex designs prevalent in current metasurfaces, we propose a terahertz multifunctional and multiband tunable metasurface utilizing a VO2-metal hybrid structure. This metasurface structure comprises a top VO2-metal resonance layer, a middle polyimide dielectric layer, and a gold film reflective layer at the bottom. This metasurface exhibits multifunctionality, operating independently of polarization and incident angle. The varying conductivity states of the VO2 layers, enable the metasurface to achieve various terahertz functionalities, including single-band absorption, broadband THz absorption, and multiband perfect polarization conversion for linear (LP) and circularly polarized (CP) incident waves. Finally, we believe that the functional adaptability of the proposed metasurface expands the repertoire of options available for future terahertz device designs.

Nearly half a century has passed since the discovery of cytoplasmic inheritance of human chloramphenicol resistance. The inheritance was then revealed to take place maternally by mitochondrial DNA (mtDNA). Later, a number of mutations in mtDNA were identified as a cause of severe inheritable metabolic diseases with neurological manifestation, and the impairment of mitochondrial functions has been probed in the pathogenesis of a wide range of illnesses including neurodegenerative diseases. Recently growing number of preclinical studies has revealed that animal behaviors are influenced by the impairment of mitochondrial functions and possibly by the loss of mitochondrial stress resilience. Indeed, as high as 54% of patients with one of the most common primary mitochondrial diseases, mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS) syndrome, present psychiatric symptoms including cognitive impairment, mood disorder, anxiety, and psychosis. Mitochondria are multifunctional organelles which produce cellular energy and play a major role in other cellular functions including homeostasis, cellular signaling, and gene expression, among other. Mitochondrial functions are observed to be compromised and to become less resilient under continuous stress. Meanwhile, stress and inflammation have been linked to the activation of the tryptophan (Trp)-kynurenine (KYN) metabolic system, which observably contributes to development of pathological conditions including neurological and psychiatric disorders. This narrative review discusses the functions of mitochondria and the Trp-KYN system, the interaction of the Trp-KYN system with mitochondria, and the current understanding of the involvement of mitochondria and the Trp-KYN system in preclinical and clinical studies of major neurological and psychiatric diseases.

The variation of aerosols, especially dust aerosol, in time and space plays an important role in climate forcing studies. Aerosols can effectively reduce land surface longwave emission and re-emit energy at a colder temperature, making estimation of downwelling surface longwave radiation (DSLR) with satellite data difficult. Using the latest atmospheric radiative transfer code (MODTRAN 5.0), we simulate the outgoing longwave radiation (OLR) and DSLR under different land surface and atmospheric profile conditions. The results show that dust aerosol has an obvious “warming” effect to longwave radiation compared with other aerosols, that aerosol longwave radiative forcing (ALRF) increased with increasing aerosol optical depth (AOD), and that the atmospheric water vapor content (WVC) is critical to the understanding of ALRF. A method is proposed to improve the accuracy of DSLR estimation from satellite data for the skies under heavy dust aerosols. The AOD and atmospheric WVC under cloud-free conditions with a relatively simple satellite-based radiation model that yields the high accurate DSLR under heavy dust aerosol are used explicitly as model input to reduce the effects of dust aerosol on the estimation of DSLR. Validations of the proposed model with satellites data and field measurements show that it estimates the DSLR accurately under heavy dust aerosol skies. The root mean square errors (RMSEs) are 20.4 W/M² and 24.2 W/M² for Terra and Aqua satellites, respectively, at the Yingke site, and the biases are 2.7 W/M² and 9.6 W/M², respectively. For the Arvaikheer site, the RMSEs are 23.2 W/M² and 19.8 W/M² for Terra and Aqua, respectively, and the biases are 7.8 W/M² and 10.5 W/M², respectively. The proposed method is especially applicable to acquire relatively high accurate DSLR under heavy dust aerosol using MODIS data with available WVC and AOD data.

Mitochondrial disorders, although heterogeneous, are traditionally described as conditions characterized by encephalomyopathy, hypotonia and progressive postnatal organ failure. Here we provide a systematic review of Linear Skin Defects with Multiple Congenital Anomalies (LSDMCA), a rare unconventional mitochondrial disorder which presents as a developmental disease; its main clinical features include microphthalmia with different degrees of severity, linear skin lesions, and central nervous system malformations. The molecular basis of this disorder has been elusive for several years. Mutations were eventually identified in three X-linked genes, i.e., HCCS, COX7B, and NDUFB11, which are all endowed with defined roles in the mitochondrial respiratory chain. A peculiar feature of this condition is its inheritance pattern: X-linked dominant male-lethal. Only female or XX male individuals can be observed, implying that nullisomy for these transcripts is incompatible with normal embryonic development in mammals. All three genes undergo X-inactivation that, according to our hypothesis, may contribute to the extreme variable expressivity observed in this condition. We propose that mitochondrial dysfunction should be considered as an underlying cause in developmental disorders. Moreover, LSDMCA should be taken into consideration by clinicians when dealing with patients with microphthalmia with or without associated skin phenotypes.

Hydrogen has a leading role in accomplishing a net zero green-house gas emission future. Today’s challenge is producing green hydrogen to cover the fuel demand of transportation and industry, to gain independence from fossil fuels. This review’s goal is to demonstrate critically the existing methods of biomass treatment and assess their ability to scale up. Biomass is an excellent hydrogen carrier and biomass-derived processes are the main target for hydrogen production as it is an innovative pathway to green hydrogen production. Comparing the existing processes, thermochemical treatment is found to be far more evolved than biological or electrochemical treatment especially with regard to scaling prospects.

This paper explores the capability of various machine learning algorithms, including Random Forests and advanced gradient boosting techniques such as XGBoost, LightGBM, and CatBoost, to predict customer churn in the telecommunications sector. For this analysis, a dataset available to the public was employed. The performance of these algorithms was assessed using recognized metrics, including Accuracy, Precision, Recall, F1-score, and the Receiver Operating Characteristic Area Under Curve (ROC AUC). These metrics were evaluated at different phases: subsequent to data preprocessing and feature selection; following the application of SMOTE and ADASYN sampling methods; and after conducting hyperparameter tuning on the data that had been adjusted by SMOTE and ADASYN. The outcomes underscore the notable efficiency of upsampling techniques such as SMOTE and ADASYN in addressing the imbalance inherent in customer churn prediction. Notably, the application of random grid search for hyperparameter optimization did not significantly alter the results, which remained comparatively unchanged. The algorithms' performance post- ADASYN application marginally surpassed that observed after SMOTE application. Remarkably, LightGBM achieved an exceptional F1-score of 89% and an ROC AUC of 95% subsequent to the ADASYN sampling technique. This underlines the effectiveness of advanced boosting algorithms and upsampling methods like SMOTE and ADASYN in navigating the complexities of imbalanced datasets and intricate feature interdependencies.

One of the most crucial elements in deeply understanding humans on a psychological level is manifested through facial expressions. The analysis of a human behavior can be informed by their facial expressions, making it essential to employ indicators such as expression (Expr), valence-arousal (VA), and action units (AU). In this paper, we introduce the method proposed in the Challenge of the 6th Workshop and Competition on Affective Behavior Analysis in-the-wild (ABAW) at CVPR 2024. Our proposed method utilizes the multi-modal Aff-wild2 dataset, which is splitted into spatial and audio modalities. For the spatial data, we extract features using a SimMiM model that was pre-trained on a diverse set of facial expression data. For the audio data, we extract features using a WAV2VEC model. To fusion the extracted spatial and audio features, we employed the cascaded cross-attention mechanism of a transformer.

Abstract: This study investigates the transition to sustainable shipping industry within the framework of the IMO's 2050 carbon neutrality objective, focusing on socio-technical systems analysis. The research delves into the sustainable paradigm shift towards alternative marine fuels such as LNG, methanol, ammonia, and hydrogen from a socio-technical transition perspective, analyzing the multi-level per-spective challenges and opportunities. Specifically, it scrutinizes the implications of adopting these al-ternative fuels for global shipping, identifying technical uncertainties, financial constraints, and infra-structure needs. Through a comprehensive review of existing literature on ship emissions and alterna-tive fuels, coupled with socio-technical transition theory, the study addresses the multifaceted chal-lenges and opportunities in meeting the IMO's environmental objectives. It emphasizes the necessity of collaborative governance, innovative niche strategies, and a holistic approach to leverage the current window of opportunity in facilitating the maritime industry's transition to sustainable fuel options. Fi-nally, this research enhances our understanding of the intricate interplay between technological, social, industrial, and cultural dynamics in the greening of shipping and offers insights into the strategic adop-tion of environmentally friendly marine fuels for a sustainable future.

Sarcopenia is associated with clinical complications, which increase mortality. Effective sarcopenia risk screening in the elderly should be grounded in a comprehensive assessment, encompassing both nutritional status and medication use. Current screening tools, while emphasizing muscular per-formance, exhibit limited sensitivity in identifying elderly individuals at risk of sarcopenia. This cross-sectional study aimed to develop a sarcopenia risk screening tool, named Sarc-Global, with enhanced sensitivity, incorporating factors pertinent to the overall health of the elderly. Utilizing the criteria established by EWGSOP2 for diagnosing sarcopenia, we evaluated 395 communi-ty-dwelling elderly individuals. This evaluation served as a reference for assessing the efficacy of two validated questionnaires, Sarc-F and Sarc-CalF, and our newly developed Sarc-Global. Con-structed through multiple logistic regression, Sarc-Global integrates variables such as sex, age, medication use, body mass index, arm circumference, and handgrip strength – all significantly associated with sarcopenia (p

In large-capacity energy storage systems, instructions are decomposed typically using an equalized power distribution strategy, where clusters/modules operate at the same power and durations. When dispatching shifts from stable single conditions to intricate coupled conditions, this distribution strategy inevitably results in increased inconsistency and hastened system aging. This paper presents a novel differentiated power distribution strategy comprising three control variables: the rotation status, the operating boundaries for both Depth of Discharge (DOD) and C-rates (C) within a control period. The proposed strategy integrates an aging cost prediction model developed to express the mapping relationship between these control variables and aging costs. Additionally, it incorporates the multi-colony particle swarm optimization (Mc-PSO) algorithm into the optimization model to minimize aging costs. The aging cost prediction model consists of three functions: predicting health features (HFs) based on the cumulative charge/discharge throughput quantity and operating boundaries, characterizing HFs as comprehensive scores, and calculating aging costs using both comprehensive scores and residual equipment value. Further, we elaborated on the engineering application process for the proposed control strategy. In the simulation scenarios, this strategy prolonged the service life by 14.62%, reduced the overall aging cost by 6.61%, and improved module consistency by 21.98%, compared with the traditional equalized distribution strategy. In summary, the proposed strategy proves effective in elongating service life, reducing overall aging costs, and increasing the benefit of energy storage systems in particular application scenarios.

The focus of the current research indicates a new Bianchi type-V anisotropic, homogeneous astrophysical model with modified theory of f(R, T) gravity and Λ(t), time-dependent cosmological constant. The significant effect of the model is that the field equations solutions find using a time-dependent quadratic deceleration parameter. We observed anisotropy parameter remains constant both in the belated universe and early universe. The deportment of the equation of state (EOS) parameter, pressure, and energy density, cosmological constant and other parameters are also discussed. This cosmological model indicated the possibility of an accelerating universe with negative pressure, such as a universe dominated by dark energy. Om(z) diagnostic test suggested that the universe starts with quintessence nature and ends as a phantom model. Also, energy conditions of this model are represented here to ensure the model is physically reasonable and based on observations.

Prostate cancer is the second leading cause of death in males in America, with advanced prostate cancers exhibiting a 5-year survival rate of only 32%. Castration-resistance is often developed during the course of treatment, though its influences require further understanding. This study explores the human microbiome for its implications in castration-resistance and metastasis in prostate cancer. RNA sequencing data was downloaded for bone and soft tissue biopsies of patients with metastatic castration-resistant prostate cancer. These sequences were mapped to bacterial sequences to yield species-level abundance approximations. Numerous species were found to correlate to the expression of known markers of castration-resistance, including AR, PI3K, and AKT. Castration-resistance-associated signaling pathways were also enriched with these species, including PI3K-AKT signaling and endocrine resistance. For their implications in cancer aggression and metastasis, cancer stem cell markers were further explored for relation to these species. EGFR and SLC3A2 were widely downregulated with greater abundance of most species. Our results suggest that the microbiome is heavily associated with castration-resistance and stemness in prostate cancer. By considering the microbiome’s importance in these factors, we may better understand the highly aggressive and highly invasive nature of prostate cancer, allowing for needed improvement in the treatment of this disease.

Multiple sclerosis (MS) is a chronic autoimmune inflammatory disease that affects the nervous system. Peripheral blood leukocyte telomere length (LTL) and mitochondrial DNA copy number (mtDNA-CN) are potential biomarkers of disability and neurological damage. The present work evaluated LTL and mtDNA-CN in 75 relapsing-remittent MS (RRMS) patients 50 of whom had an Expanded Disability Status Scale (EDSS) 0 to 3 (mild-moderate disability), and 25 had an EDSS of 3.5 to 7 (severe disability). Absolute LTL and absolute mtDNA-CN were measured via real-time polymerase chain reaction (qPCR). The LTL and mtDNA-CN were significantly lower in RRMS severe disability than in RRMS mild-moderate disability (3.924 ± 0.124 vs 2.854 ± 0.092, p<00001; 75.14 ± 1.77 vs 68.06 ± 1.608, p<0.00001, respectively). The LTL and mtDNA-CN showed a linear correlation in RRMS with mild-moderate disability (r=0.2986, p=0.0351). In addition, in a binary logistic regression model the LTL can predict severe disability (AUC=0.697, p=0.0031, cutoff ≤ 3.0875 Kb, sensitivity= 73.1%, specificity=62.5%), the prediction is improved by including age to the model (AUC=0.765, <0.0001, sensitivity=78.26%, specificity=81.25%). Aging is closely linked to the development of disability in RRMS and can be evaluated through LTL and mtDNA-CN absolute quantification.

With the rapid increase in diabetes worldwide, the number of patients with diabetic kidney disease (DKD), a complication of diabetes mellitus, is also on the rise. DKD is a major cause of chronic kidney disease progressing to end-stage renal failure; however, current medical treatments for DKD do not achieve satisfactory outcomes. Molecular hydrogen (H2) is an antioxidant that selectively reduces hydroxyl radicals, a reactive oxygen species with a very potent oxidative capacity. H2 was recently shown to exert not only antioxidant, but also anti-inflammatory, cell lethality-regulating, and signal transduction-regulating effects, and is now being applied clinically. Many factors contribute to the onset and progression of DKD, with mitochondrial dysfunction, oxidative stress, and inflammation being strongly implicated. Recent preclinical and clinical trials reported that substances with antioxidant properties may slow the progression of DKD. Therefore, we conducted a literature review on animal models and human clinical trials in which H2 showed efficacy against various renal diseases. This literature review and our previous findings collectively suggest that H2 exerts therapeutic effects in patients with DKD by improving mitochondrial function. Future large-scale clinical studies are needed to confirm these findings.

This research investigates the complex transformation of the Baltic Clean and Dirty Tankers markets from 1998 to 2023. Our study quantifies the market multifractality in two distinct periods, from 1998 to 2010 and 2010 to 2023. We compare multifractal measures of the original, surrogated, and shuffled data, which indicate high multifractality and a complex market structure influenced by temporal organization and inherent volatility. Shuffled data analysis emphasizes the critical role of temporal sequences within market behaviour. Additionally, the study delves into external factors such as regulatory changes, economic disturbances, technological innovation, and environmental concerns contributing to market complexity. A distinct shift in multifractal values between the two periods suggests an evolution from crisis-induced complexities to a market influenced by diversified and modern dynamics. Our findings offer a concise understanding of the multifractal nature of the tanker markets and how global crises can impact the markets, emphasizing the importance of considering systemic risks in freight market analysis.

Background and Objectives: In this current state, Type 2 Diabetes Mellitus (T2DM) is more prevalent in the population, and metformin is used as a first-line medication for treating it. There was up surge in the utilization of alternative therapies in the management of diabetes. Especially in diabetes, Herbal medicines are considered safe and reliable by majority of the population. Aim: The purpose of this research is aimed to estimate the safety and efficacy of Polyherbal Metabolite Compounds (PHMC) capsules in adults with T2DM. Materials and Methods: In this study, 60 T2DM patients aged 18-60 years were randomly assigned to Groups A (30) receiving Metformin 500 mg twice a day after food and Group B (30) receiving PHMC capsule 500 mg twice a day after food in a prospective, randomized and open-label clinical study. The in-silico simulation study was performed to selected plants major compounds on target protein Insulin-like Growth Factor-1 (1K3A). Result: The PHMC is found to be safe and effective in the management of T2DM. The FBS, PPBS and HbA1c were significantly lowered (p

Estimating parameters for multiple datasets can be time consuming, especially when the number of datasets is large. One solution is to sample from multiple datasets simultaneously using Bayesian methods such as adaptive multiple importance sampling (AMIS). Here we use the AMIS approach to fit a von Misses distribution to multiple datasets for wind trajectories derived from a Lagrangian Particle Dispersion Model driven from a 3D meteorological data. The primary objective is to characterise the uncertainties in wind trajectories in a form that can be used as inputs for predictive models of wind-dispersed insect pests and pathogens of agricultural crops for use in evaluating risk and in planning mitigation actions. Our results show that AMIS can significantly improve the efficiency of parameter inference for multiple datasets.

Food systems will need to undergo considerable transformation. To be better prepared for and resilient to uncertainty and disturbances in the future, resource users and managers need to further develop knowledge about the food and farming system, with its dominating feedback structures and complexities, and to test robust and integrated system-based solutions. This paper investigates how participatory system dynamics modeling can be adapted to groups at the community level with low or no formal educational background. The paper also analyzes the refinement of workshop participants’ mental models as a consequence of a participatory system dynamics intervention. For this purpose, we ran two workshops with small-scale farmers in Zambia. Analysis of workshop data and post-workshop interviews shows that participatory system dynamics is well adaptable to support an audience-specific learning-by-doing approach. The use of pictures, objects and water glasses in combination with the basic aspects of causal loop diagramming makes for a well-balanced toolbox. Participants acquire understanding that is also relevant beyond systems thinking in that is offers a range of practical insights such as a critical evaluation of common food security strategies.

With the development of higher voltage power grid, the high and low voltage parallel loops are emerging, which lead to energy losses, even threaten the security and stability of power system. The multi-infeed HVDC configurations widely appearing in AC/DC interconnected power system make this situation even worse. Aimed at energy saving and system security, a decision optimization method for power grid operating condition with high and low voltage parallel loops is proposed in this paper. Firstly, considering hub substation distribution and power grid structure, parallel loop opening schemes are generated with GN algorithm. Then, candidate opening schemes are preliminarily selected from all these generated schemes based on a filtering index. Finally, with the influence on power system security, stability and operation economy in consideration, an evaluation model for candidate opening schemes is founded based on analytic hierarchy process (AHP). And a fuzzy evaluation algorithm is used to find the optimal scheme. Simulation results of New England 39-bus system and an actual power system validate the effectiveness and superiority of this proposed method.

The voluminous daily output of autism research has become increasingly disconnected, existing largely within highly specific subspecialty areas, and lacking cross-disciplinary linkages of context, theory, and findings to inform a unified body of knowledge. Robust syntheses of published research across the fields of psychiatry, cellular and molecular biology, neurology, endocrinology, immunology, behavioral and social sciences, and pedagogy may help clarify and extend current knowledge by guiding more efficient future research efforts investigating underlying causes, developmental divergences, novel treatments, and specific, sensitive biological markers in autism. This synthesis of interdisciplinary research indicates the hypothalamic-pituitary-adrenal (HPA) stress axis may be at the center of an interaction among sex steroids, immune function, signaling protein transcriptions, neurogenesis, and dysregulation of brain structures sending or receiving projections from the HPA stress axis. These interaction manifest observably as a range of sexually dimorphic behaviors and functional limitations often falling within the current diagnostic features of Autism Spectrum Disorder (ASD). The pathogenicity of endocrine dysregulation may serve as a valuable model for developing a cohesive theory of ASD by explaining how the HPA and connected brain areas respond to extreme conditions of dysregulated endocrine signaling to cause symptoms associated with autism.

Reactions of quinones with compounds containing an amino group can produce a wide variety of addition or substitution products that depend on reactivity of both quinone and amino derivative. 6,7-Dichloropyrido[1,2-a]benzimidazole-8,9-diones undergo selective nucleophilic substitution reaction with different benzohydrazides and α-hydroxy-p-quinone imine derivatives stabilized by strong intramolecular hydrogen bond were isolated. Synthesized compounds represent a combination of several structural motifs: benzimidazole core fused with α-hydroxy-p-quinone imine which contains a benzamido fragment. The protonation/deprotonation processes were investigated in a solution using UV-Vis spectroscopy and 1H NMR titration experiment. X-ray crystallography analysis revealed a set of weak non-covalent interactions such as intra- and intermolecular hydrogen bonds and π-π stacking. Additionally, the redox behavior of 6,7-dichloropyrido[1,2-a]benzimidazole-8,9-dione and its p-imino derivative was investigated in acidic and neutral environment using cyclic voltammetry measurements. Cathode material based on 6,7-dichloropyrido[1,2-a]benzimidazole-8,9-dione could act as potential effective active electrode in aqueous electrolyte batteries, however further optimization is required.

Abstract: The Willows, belonging to the genus Salix, encompass a vast array of species and hybrids, totaling between 330 to 500 species along with approximately 200 hybrids. These plants are found across continents such as Africa, North America, Europe, and Asia, exhibiting diverse forms ranging from trees to shrubs and prostrate plants. Traditionally, Willows have been utilized in folk medicine due to their rich reservoir of biologically active compounds, with salicin being a notable example, serving as a prodrug for salicylic acid.The chemical composition of Willows is highly diverse, with 322 secondary metabolites identified thus far. These include various classes such as flavonoids (94 types encompassing flavonols, flavones, flavanones, isoflavones, flavan-3-ols like catechins and procyanidins, chalcones, dihydrochalcone, anthocyanins, and dihydroflavonols), phenolic glycosides (76), organic acids (28), non-phenolic glycosides (17), sterols, and terpenes (17), simple phenolics (13), lignans (7), as well as volatiles and fatty acids (69). This rich chemical di-versity underpins the various pharmacological activities exhibited by Willows. The pharmacological properties attributed to Willows are extensive and include analgesic, an-ti-inflammatory, antioxidant, anticancer, cytotoxic, antidiabetic, antimicrobial, antiobesity, neuroprotective, and hepatoprotective effects. These properties make Willows a subject of con-siderable interest in the fields of medicine and pharmacology. In summary, Willows represent a valuable natural resource with a diverse chemical composition and a wide range of pharmacological activities. This study aimed to enhance our comprehension of the medicinal characteristics of willow bark extract, focusing on its antimicrobial properties. This investigation holds significance in validating the traditional usage of willow bark and investi-gating its potential utility in contemporary medicine.

The article delves into the crucial realm of compressing hydrogen in its gaseous state, a pivotal process for enhancing its viability in both civil and industrial sectors. The study initiates by providing a concise overview and comparison of diverse hydrogen storage methodologies, laying the groundwork with an in-depth analysis of hydrogen's thermophysical properties. It scrutinizes plausible configurations for hydrogen compression, aiming to strike a delicate balance between energy consumption, predominantly derived from the fuel itself, and the requisite number of compression stages. Notably, to render hydrogen storage competitive in terms of volume, pressures of at least 350 bar are deemed essential, albeit at an energy cost amounting to approximately 10% of the fuel's calorific value. Multi-stage compression emerges as a crucial strategy, not solely for energy efficiency, but also to curtail temperature rise, with an upper limit set at 200°C. This nuanced approach is underlined by the exploration of compression levels commonly cited in the literature, particularly 350 bar and 700 bar. Ultimately, the study advocates for a three-stage compression system as a pragmatic compromise, capable of achieving high-pressure solutions while keeping compression work below 10 MJ/kg, a threshold indicative of sustainable energy utilization.

Epilepsy is a heterogenous neurological disorder characterized by recurrent unprovoked seizures, mitochondrial stress, and neurodegeneration. Hydrogen sulfide (H2S), a gasotransmitter, promotes mitochondrial function and biogenesis, elicits neuromodulation and neuroprotection, and may acutely suppress seizures. A major gap in knowledge remains in understanding the role of mitochondrial dysfunction and progressive changes in H2S levels following acute seizures and during epileptogenesis. We thus sought to quantify changes in H2S and its methylated metabolite (MeSH) via LC-MS/MS subsequent to acute maximal electroshock and 6 Hz 44 mA seizures in mice, as well as in the corneal kindled mouse model of chronic seizures. Plasma H2S was acutely reduced after a maximal electroshock seizure. H2S or MeSH levels in whole brain homogenate and expression of related genes in corneal kindled mice were not altered. However, plasma H2S and MeSH levels were significantly lower during kindling, but not after established kindling. Morever, we demonstrated a time-dependent increase in expression of mitochondrial membrane integrity-related proteins, Opa1, Mfn2, Drp1, and Mff during kindling, which did not correlate with gene expression. Taken together, short-term reductions in plasma H2S could be a novel biomarker for seizures. Future studies should further define the role of H2S and mitochondrial stress in epilepsy.

In the context of carbon neutrality and carbon peaking, in order to achieve low carbon emissions and promote the efficient utilization of wind energy, hydrogen energy as an important energy carrier is proposed to mix hydrogen and natural gas to form hydrogen enriched compressed natu-ral gas (HCNG). It is also injected into the natural gas pipeline network to realize the transmission and utilization of hydrogen energy. At the same time, the participation of demand response is considered, the load peak and trough period is adjusted, and large-scale consumption of renewa-ble energy and the reduction of carbon emissions are realized. First of all, a fine model of hydro-gen production and hydrogen use equipment is established to analyze the impact of adding hy-drogen mixing on the economy and low-carbon of the system. With green certificates and demand response, the utilization rate of hydrogen energy is improved to further explore the energy utiliza-tion rate and emission reduction capacity of the system. Secondly, on the basis of modeling, the optimal scheduling strategy is proposed with the sum of energy purchase cost, equipment opera-tion cost, carbon emission cost, wind curtailment cost and green certificate income as the lowest objective function. Considering the constraints such as hydrogen blending ratio and flexible load ratio of the pipeline network, a low-carbon economic scheduling model of hydrogen mixed natu-ral gas was established. The model was linearized and solved by using MATLAB and CPLEX solver. By comparing different scenarios, the superiority of the model and the effectiveness of the strategy are verified.

Multi-rotor drones, a kind of unmanned equipment which is widely used in military, commercial consumption and other fields, has been developed very rapidly in recent years. However, their short flight time has hindered the expansion of their application range. This can be addressed by utilizing hydrogen fuel cells, which exhibit high energy density, strong adaptability to ambient temperature, and no pollution emissions, as the power source. Accordingly, the application of hydrogen fuel cells as the power source in multi-rotor drones is a promising technology that has attracted significant research attention. This paper summarizes the development process of hydrogen fuel cell mul-ti-rotor drones and analyzes the key obstacles that need to be addressed for the further development of hydrogen fuel cell multi-rotor drones, including structural lightweight, hydrogen storage methods, energy management strategies. Additionally, prospects for the future development of hydrogen fuel cell multi-rotor drones are presented.

MIMO (multiple-input multiple-output) radar provides much more flexibility than the traditional radar for its ability to realize far more observation channels than the actual number of T/R (transmit and receive) elements. Designing the array of MIMO imaging radar, the commonly used virtual array theory generally assumes that all elements are placed on the same line. However, due to the physical size of the antennas and coupling effect between T/R elements, a certain height difference between T/R arrays is essential, resulting in the defocusing of edge points of the scene. On the other hand, the virtual array theory implies far-field approximation, leading to inevitable high grating lobes in the imaging result of near-field edge points of the scene observed by common MIMO array. To tackle these problems, this paper derives the relationship between target’s PSF (point spread function) and pattern of T/R arrays, by which the design criterion of near-field imaging MIMO array is presented. Firstly, the proper height between T/R arrays is designed to focus the near-field edge points well. Secondly, the far-field array is modified to suppress the grating lobes in the near-field area. Finally, the validity of the proposed methods is verified by simulations and an experiment.

Cerebral ischemia, which is a leading cause of disability and mortality worldwide, sets off a chain of molecular and cellular pathologies that are associated with some central nervous system (CNS) disorders, mainly including ischemic stroke, Alzheimer's disease (AD), Parkinson's disease (PD), epilepsy and other CNS diseases. In recent times, despite significant advancements in the treatment of the pathological processes underlying various neurological illnesses, effective therapeutic approaches specifically targeted at minimizing the damage of such diseases remain absent. Remarkably, ischemia causes severe damage to cells in Ischemia-associated CNS Diseases. Cerebral ischemia initiates oxygen and glucose deprivation, which subsequently promotes mitochondrial dysfunction, including MPTP opening, mitophagy dysfunction, and excessive mitochondrial fission, triggering various forms of cell death, such as autophagy, apoptosis, as well as ferroptosis. Ferroptosis, a novel type of regulated cell death (RCD), is characterized by iron-dependent accumulation of lethal reactive oxygen species and lipid peroxidation. Mitochondrial dysfunction and ferroptosis both play critical roles in the pathogenic progression of Ischemia-associated CNS Diseases. In recent years, growing evidence has indicated that mitochondrial dysfunction interplays with ferroptosis to aggravate cerebral ischemia injury. However, the potential connections between mitochondrial dysfunction and ferroptosis in Cerebral Ischemia have not yet been clarified. Thus, we analyze the underlying mechanism between mitochondrial dysfunction and ferroptosis in Ischemia-associated CNS Diseases. We also discovered that GSH depletion and GPX4 inactivation cause lipoxygenase activation and calcium influx following cerebral ischemia injury, resulting in MPTP opening and mitochondrial dysfunction. Additionally, dysfunction in mitochondrial electron transport and an imbalanced fusion-to-fission ratio can lead to the accumulation of reactive oxygen species and iron overload, which further contribute to the occurrence of ferroptosis. This creates a vicious cycle that continuously worsens cerebral ischemia injury. In this study, our focus is on exploring the interplay between mitochondrial dysfunction and ferroptosis, which may offer new insights into potential therapeutic approaches for the treatment of Ischemia-associated CNS Diseases.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) persists throughout the world with over 65 million registered cases of survivors with post-COVID-19 sequelae, also known as LongCOVID-19 (LongC). LongC survivors exhibit various symptoms that span multiple organ systems, including the nervous system. To search for neurological biomarkers of LongC, we investigated the soluble proteins present in the plasma and the proteins associated with plasma neuronal-enriched extracellular vesicles (nEVs) in 33 LongC patients with neurological impairment (nLongC), 12 COVID-19 survivors without any LongC symptoms (Cov), and 28 pre-COVID-19 healthy controls (HC). COVID-19 positive participants were infected from 2020-2022, not hospitalized, and were vaccinated or unvaccinated before infection. IL-1b was significantly increased in both nLongC and Cov and IL-8 elevated in only nLongC. Both brain-derived neurotropic factor and cortisol were significantly elevated in nLongC and Cov compared to HC. nEVs from people with nLongC had significantly elevated protein markers of neuronal dysfunction, including amyloid beta 42, pTau181 and TDP-43. This study shows chronic peripheral inflammation with increased stress after COVID-19 infection. Additionally, differentially expressed nEV neurodegenerative proteins were identified in people recovering from COVID-19 regardless of persistent symptoms.

Under the "dual carbon" target in China, virtual power plants (VPPs) play an important role in improving grid security and promoting clean and low-carbon energy transformation. VPPs can integrate and control distributed resources to participate in the energy market and make full use of distributed resources. However, the intermittency and volatility of renewable energy and the "heat-driven" working mode of CHP units create contradictions that seriously affect the peak-shaving ability of VPPs and lead to high carbon emissions. To solve these problems, this paper aggregates CHP units, wind power, photovoltaics, carbon capture, hydrogen energy storage, and electric boilers into a new type of virtual power plant. The "hydrogen energy storage-electric boiler" joint decoupling CHP working mode is used to strengthen the coupling relationship between electric-thermal-hydrogen load. At the same time, a tiered carbon trading mechanism is considered, with the net profit of the VPP as the optimization objective, balancing economic and environmental considerations. A low-carbon economic dispatch model for VPPs is established, and a genetic algorithm is used for optimization. Three different scheduling strategies are set, and simulations are conducted in three different seasonal scenarios. The results show that the net profit in the cooling season increased by 50.4%, and carbon emissions decreased by 42.3%. In the transitional season, the net profit increased by 39.2%, and carbon emissions decreased by 44.9%. In the heating season, the net profit increased by 19.4%, and carbon emissions decreased by 43.4%. Overall, the proposed dispatch strategy can improve the new energy consumption capacity and total revenue of VPPs while achieving the goal of reducing carbon emissions.

Natural gas plays a significant role in Tunisia's energy mix. Tunisia imports 66% of natural gas (NG) from Algeria (ANG), and the rest is provided by local gas fields mainly Miskar gas (MNG). To counteract this deficit, the Power-to-Gas approach emerges as a promising solution, given Tunisia's abundant renewable energy resources. By blending green hydrogen into the NG network, it is possible to (i) address the current energy crisis, (ii) lower the carbon intensity of the gas grid, and (iii) encourage sector coupling through the use of various renewable energy sources. This study presents an overview of various interchangeability indicators and investigates accordingly the allowable ratios for hydrogen blending with two types of natural gas distributed in Tunisia (ANG and MNG). It also explores the impact of hydrogen injection on the energy content variation and various combustion parameters. The results confirm that both ANG and MNG can withstand a maximum hydrogen blend of up to 20%. The article concludes with recommendations for further experimental testing of the findings and emphasizes the need to look into infrastructure and safety requirements with regards to the Natural gas network in Tunisia. This research serves as a critical step towards harnessing the potential of green hydrogen in Tunisia.

The integration of the increasing share of Renewable Energy Sources (RES) requires the availability of suitable energy storage systems to improve the grid flexibility, and Compressed Air Energy Storage (CAES) systems could be a promising option. In this study, a CO2-free Diabatic CAES system is proposed and analysed. The plant configuration is derived from a down-scaled version of the McIntosh diabatic CAES plant, where the natural gas is replaced with green hydrogen, produced on site by a Proton Exchange Membrane electrolyser powered by a Photovoltaic power plant. In this study, the components of the hydrogen production system are sized to maximize the Self-Consumption share of PV energy generation and the effect of the design parameters on the H2-CAES plant performance are analysed on a yearly basis. Moreover, a comparison between the use of natural gas and hydrogen in terms of energy consumption and CO2 emissions is discussed. The results show that the proposed hydrogen fuelled CAES can effectively match the generation profile and the yearly production of the natural gas fuelled plant by using all the PV energy production, while producing zero CO2 emissions.

Maternal type 2 diabetes mellitus (T2DM) has been shown to result in fetal programming of the hypothalamus-pituitary-adrenal (HPA) axis, leading to adverse fetal outcomes. T2DM is preceded by prediabetes and shares similar pathophysiological complications. However, no studies have investigated the effects of maternal prediabetes on fetal HPA axis function and postnatal offspring development, hence this study. Pre-diabetic (PD) and non-pre-diabetic (NPD) female Sprague Dawley rats were mated with non-prediabetic males. After gestation, male pups born from the PD and NPD groups were collected. Markers of HPA axis function, adrenocorticotropin hormone (ACTH) and corticosterone were measured in all dams and pups. Glucose tolerance and expression of mineralocorticoid (MR) and glucocorticoid (GR) receptors were further measured in all pups at birth and their developmental milestones. The results demonstrated increased basal concentrations of ACTH and corticosterone in the dams from the PD group by comparison to NPD. Furthermore, the results show an increase in pups ACTH and corticosterone concentrations, impaired glucose tolerance and dysregulated MR and GR expression in the PD group at all developmental milestones. These observations reveal that pregestational prediabetes is associated with maternal dysregulation of the HPA axis, impacting offspring HPA axis development along with impaired glucose handling.

Urea cycle disorders (UCDs) are common inborn errors of metabolism, with an incidence of one in 30,000 births. They are caused by deficiencies in any of six enzymes and two carrier proteins, the most common being Ornithine Transcarbamylase Deficiency (OTCD). OTCD results in impairment to excrete nitrogen, causing toxic buildup of ammonia with resultant encephalopathy. Hyperammonemia (HA) induces the conversion of glutamate to glutamine in the brain. Excess glutamine in the brain causes osmotic changes cerebral edema, changes in astrocyte morphology, and cell death. Acute symptoms of HA include vomiting, hyperventilation, seizures, and irritability. Long-term neurological changes include deficits in working memory and executive function. To date, there are no predictors of prognosis of infants with neonatal onset OTCD outside of plasma ammonia level at presentation and duration of hyperammonemic coma. We provide a comprehensive analysis of a 16-year-old male with neonatal onset of OTCD as an example of how brain biomarkers may be useful to monitor disease course and outcome. This male presented at 8 days post natal with plasma ammonia and glutamine of 677 and 4024 micromol/L and had a missense mutation in Exon 4 (p.R129H). Treatment included protein restriction, sodium benzoate, and citrulline, arginine, and iron. He suffered recurrent acute hyperammonemic episodes despite compliance, triggered by infections or catabolic stressors. We discuss the long-term effects of the hyperammonemic episodes by following MRI based disease biomarkers.

This study investigates the influence of adding hydrogen as an additive to gasoline in a four-stroke engine, utilizing a comprehensive thermodynamic comparative analysis conducted with self-developed engine model. The research aims to assess the performance, emissions, and efficiency of the engine when using gasoline-hydrogen blends, and to provide insights into the potential benefits of this approach. First the engine performance and emissions under different hydrogen blending levels were examined. A range of different air-to-fuel ratios (rich to lean) and varying percentages of hydrogen were considered. This systematic variation allowed for a detailed evaluation of the influence of hydrogen content on combustion efficiency, power out-put, and emissions characteristics. The analysis results included key parameters such as indicated specific fuel consumption and mean effective pressure. Additionally, the study focused on range prediction of nitrogen oxides (NOx) emissions, which are a critical environmental concern asso-ciated with internal combustion engines. The analysis of pressure and temperature profiles throughout the engine cycle shed light on the combustion characteristics and efficiency im-provements associated with hydrogen addition. In terms of emissions, the study projected that all emissions were reduced except NOx, which is highly dependent on hydrogen percentage, and it might be reduced in some cases, but with higher temperatures and pressures associated with hydrogen addition in most cases there is actually NOx increase, especially at higher engine loads.

Predominantly antibody deficiencies (PAD) represent the most common type of primary immu-nodeficiencies in humans, characterized by a wide variation in disease onset, clinical manifesta-tions, complications and outcome. Considering that the prevalence of PAD in Greece is unknown and there is limited knowledge on clinical and laboratory characteristics of affected patients, we conducted a nationwide study, including 153 patients (male/female: 66/87; median age: 43.0 years; range: 7.0-77.0) diagnosed and/or followed-up between April 2007 to September 2023. Furthermore, we classified our cohort into five Groups according to their medical history, im-munoglobulin levels, and CTLA4-mutational status: 123 had common variable immunodeficien-cy (CVID), 12 with CVID-like disease (with a history of a previous B-cell depletion immunother-apy for autoimmune or malignant disease), seven with combined IgA and IgG subclass deficien-cies, five with immune dysregulation syndrome and CTLA4 defects, and six with unclassified hypogammaglobulinemia. We demonstrated a remarkable delay of PAD diagnosis, several years after the onset of related symptoms (median: 9.0 years, range: 0-43.0). Family history of PAD was only 11.8%, with the majority of patients considered sporadic cases. Most patients were diag-nosed in the context of a diagnostic work-up for recurrent infections, or recurrent/resistant auto-immune cytopenias. Interestingly, ten patients (5.6%) had no history of infection, diagnosed due to either recurrent/resistant autoimmunity, or during a work-up of their medical/family history. Remarkable findings included an increased prevalence of lymphoproliferation (60.1%) and atopy (24.2%), while 39 patients (25.5%) developed bronchiectasis and 16 (10.5%) granulomatous dis-ease. Patients with CTLA4 defects displayed a variable clinical phenotype at diagnosis, with four patients diagnosed during a work-up of re-current infections, while one also displayed a massive splenomegaly. Cancer was a common complication in our cohort (25 patients, 16.3%), with B-cell malignancies representing the most common neoplasms (56.7%). Our findings indicate the necessity of awareness about PAD and their complications, aiming for early diagnosis and appropriate management of affected patients

By repeated unloading and loading of the excavation dynamic and static loads, repeated train dynamic and static loads of multi-factors, the underpass tunnel, cross tunnel engineering influence area rock layer, the existing tunnel structure of the three constitutes a multifaceted structure, multi-factor interaction system. Existing tunnels into the prediction theory model of the new tunnel excavation process of dynamic and static loads, dynamic and static loads of existing tunnels are mostly analyzed individually, the results of synergistic analysis needs to be improved. Based on the theory of the current layer method, the paper comprehensively considers the stiffness of the existing tunnel, the stiffness of the new tunnel, the excavation method load and the existing tunnel load, coupled with Peck's empirical formula, the theoretical model of deformation prediction for excavation of a two-lane highway tunnel under the tunnel through the existing railroad is proposed, and verified and optimized by numerical calculations and monitoring data, which proves the applicability and reliability of the theoretical model in the similar strata and the project promotion.

Nowadays molecular research is essential for the better understanding of tumor cells pathophysiology. The increasing number of neoplasms is taken under ‘the molecular magnifying glass’ therefore it is possible to discover complex relationships between cytophysiology and tumor cells. Signal transducer and activator of transcription 3 (STAT3) belongs to the family of latent cytoplasmic transcription factors called STATs which comprises seven members: STAT1, STAT2, STAT3, STAT5A, STAT5B, STAT6. Those proteins play important role in cytokine-activated gene expression by transducing signals from the cell membrane to the nucleus. Abnormal prolonged activation results in tumorigenesis, metastasis, cell proliferation, invasion, migration and angiogenesis. Inhibition of this transcription factor inhibits previously mentioned effects in cancer cells whereas normal cells are not affected. Hence STAT3 might be a viable target for cancer therapy.

Transient receptor potential canonical (TRPC) channels are ubiquitously expressed in excitable and non-excitable cardiac cells where they sense and respond to a wide variety of physical and chemical stimuli. As other TRP, TRPC may form homo or heterotetrameric ion channel, and they can associate with other membrane receptors and ion channels to regulate intracellular calcium concentration. Dysfunctions of TRPC channels are involved in many types of cardiovascular diseases. Significant increase of the expression of different TRPC isoforms has been observed in different animal model of heart infarcts, and in vitro experimental model of ischemia and reperfusion. TRPC-mediated increase of the intracellular Ca²⁺ concentration seems required for the activation of signaling pathway that plays minor roles in the healthy heart, but they are more relevant for cardiac responses to ischemia, such as the activation of different factors of transcription and cardiac hypertrophy, fibrosis, and angiogenesis. In this review, we will highlight the current knowledge regarding TRPC implication in different cellular processes related to ischemia and reperfusion, and to heart infarction.

This paper describes a novel concept of producing energy efficient ”Maroon enriched natural gas “ and then Pink hydrogen” from any hydrocarbon base. The key idea is the extraction of hydrogen from water in addition to that from the hydrocarbon in an optimal fashion. This has the benefit of higher water vapor to CO2 exhaust ratio than conventional carbonaceous fuels when generating energy via combustion, a prudent step in achieving Netzero goals in a shorter time, and creating energy independence in most places.. The process of production makes concentrated CO₂ available for use and or sequestration. The process also maximizes use of renewable electricity in hydrogen generation, and maximizes use of existing infrastructure, with a minimum capital cost by energy recycle in the process. The process design applies sound thermodynamic principles which evolved during the nineteenth century, and mimics the geochemical processes going on in some of the natural 'colorless hydrogen'.

This paper is concerned with the optimal linear quadratic Gaussian (LQG) control problem for discrete time-varying system with multiple input delays and multiplicative noises. The main contributions are two-fold. Firstly, when the state variables can be observed exactly, we obtain a necessary and suffcient condition for the multiple-delays system in terms of the non-homogeneous relationship between the state and costate, which is the solution to the coupled forward and backward stochastic difference equations. Secondly, when the state variables are partially observed, we derive a suboptimal linear output feedback controller for the discrete-time system based on the obtained results of the optimal LQG control. Numerical examples are shown to illustrate the proposed algorithm.

This study empirically analyzes the effectiveness of resource optimization utilizing artificial intelligence (AI) within cloud computing environments. It compares systems that have been transitioned from a Monolithic structure to Microservices Architecture (MSA) with those adopting a simple Rehost strategy, to validate the operational efficiency of two systems whose resource efficiency has been enhanced compared to traditional legacy systems. The research is based on systems that determined resource efficiency post-cloud migration using APM tools. It points out the limitations of traditional heuristic operation methods in resource optimization, which lead to issues such as application performance degradation, resource over-allocation, and increased operational costs. This study aims to overcome the conventional resource optimization standards that depended on the average peak usage of CPU and memory infrastructure, by introducing AI-based optimization tools, and applying on-premise standards to cloud and container environments to achieve resource optimization. The paper emphasizes the importance of resource optimization through AI-based automation tools, exploring the possibilities of resolving real-world application performance issues in cloud environments, reducing unnecessary resource usage costs, and cutting down on labor risks and operational expenses. Through this, it presents strategic directions on how AI technology can offer financial and operational advantages in managing cloud resources.

Korea Atomic Energy Research Institute (KAERI) established a multi-dimensional hydrogen analysis system to evaluate a hydrogen release, distribution, and combustion in the containment of a nuclear power plant using MAAP, GASFLOW, and COM3D. KAERI developed the COM3D analysis methodology on the basis of the COM3D validation results against the experiments of ENACCEF and THAI. The proposed analysis methodology accurately predicts the peak overpressure with an error range of approximately ±10% using the Kawanabe turbulent flame speed model. KAERI performed a hydrogen flame acceleration analysis using the multi-dimensional hydrogen analysis system for a severe accident initiated by a station blackout (SBO) under the assumption of 100% metal-water reaction in the reactor pressure vessel for evaluating an overpressure buildup in the Advanced Power Reactor 1400 MWe (APR1400). The COM3D calculation results using the established analysis methodology showed that the calculated peak pressure in the containment was much lower than the fracture pressure of the APR1400 containment. This calculation result may have resulted from a large air volume of the containment, a reduced hydrogen concentration owing to passive auto-catalytic recombiners installed in the containment, and a lot of stem presence during the hydrogen flame acceleration in the containment. Therefore, we can know that the current design of the APR1400 containment maintains its integrity when the flame acceleration occurs during the severe accident initiated by the SBO accident.

In this research, catalytic steam reforming acetic acid derived from the aqueous portion of bio-oil for hydrogen production was investigated by using different Ni/ATC (Attapulgite Clay) catalysts prepared by precipitation, impregnation and mechanical blending methods. The fresh and reduced catalysts were characterized by XRD, N₂ adsorption-desorption, TEM and H₂-TPR. The comprehensive results demonstrated that the interaction between active metallic Ni and ATC carrier was significantly improved in Ni/ATC catalyst prepared by precipitation method, and in which the mean Ni particle size was the smallest (~13 nm) resulted in the highest metal dispersion (7.5%). The catalytic performance of the three catalysts was evaluated through the process of steam reforming of acetic acid in a fixed-bed reactor under atmospheric pressure at two different temperatures, such as 550 ℃ and 650 ℃. Results showed that the Ni/ATC (PM-N/ATC) prepared by precipitation method, achieved the highest H₂ yield of ~82% and little lower acetic acid conversion efficiency of ~85% than that (~95%) of Ni/ATC (IM-NATC) prepared by impregnation method. In addition, the deactivation catalysts after reaction for 4 h were analyzed by XRD, TGA-DTG and TEM, which demonstrated that the catalyst deactivation was not caused by the amount of carbon deposition, but owed to the significant agglomeration and sintering of Ni particles in the carrier.

The dysregulation of cellular metabolism is a hallmark of ageing. To understand the metabolic changes that occur as a consequence of the ageing process and to find biomarkers for age-related diseases, we conducted a metabolomic analysis of brain, heart, kidney, liver, lung and spleen in young (9-10 weeks) and old (96-104 weeks) wild type (mixed genetic background of 129/J and C57BL/6) mice using NMR spectroscopy. We found differences in metabolic fingerprints of all tissues and identified several metabolites to be altered in most tissues, suggesting that they may be universal biomarkers of ageing. In addition, we found distinct tissue-clustered sets of metabolites throughout the organism. The associated metabolic changes may reveal novel therapeutic targets for the treatment of ageing and age-related diseases. Moreover, the identified metabolite biomarkers could provide a sensitive molecular read-out to age determine the age of biologic tissues and to validate the effectiveness and potential off-target effects of senolytic drug candidates on both a systemic and tissue-specific level.

Obtaining a genetic diagnosis of a primary mitochondrial disease (PMD) is often framed as a diagnostic odyssey. Yet, even after receiving a diagnosis, parents of affected children experience ongoing therapeutic and prognostic uncertainty, and considerable psychosocial challenges. Semi-structured interviews (N= 24) were conducted with parents of 13 children (aged 2-19 years) with a genetically confirmed PMD. Paternal (N=11) and maternal (N=13) perspectives were obtained, and thematic analysis performed on all interviews. A genetic diagnosis was valuable and empowering for parents, despite eliciting varied emotional responses. While the diagnosis helped focus management decisions, families often felt overwhelmed and unsupported in navigating the healthcare system. Most parents reported a serious impact on their romantic relationship. The sources of social support varied with a preference for established friendship and family support networks over disease-specific community support groups. Most parents favored prenatal genetic testing in the event of a future pregnancy. This study provides insight into the lived experiences of parents after a genetic diagnosis of PMD in their children. The findings draw awareness to supportive care needs and highlight important gaps that should be addressed to ensure that parents feel supported within a holistic framework of management for PMDs.

L-Theanine, a unique non-protein amino acid, is an important bioactive component of green tea. Previous studies have shown that L-theanine has many potent health benefits, such as anti-anxiety effect, regulation of immune response, relaxing neural tension, reducing oxidative damage. However, little is known concerning whether L-theanine can improve the clearance of mitochondrial DNA (mtDNA) damage in organisms. Here, we reported that L-theanine treatment increased ATP production and improved mitochondrial morphology to extend the lifespan of UVC-exposed nematodes. Mechanistic investigations showed that L-theanine treatment enhanced the removal of mtDNA damage and extended lifespan by activating autophagy, mitophagy, mitochondrial dynamics, and mitochondrial unfolded protein response (UPRmt) in UVC-exposed nematodes. In addition, L-theanine treatment also up-regulated the expression of genes related to mitochondrial energy metabolism in UVC-exposed nematodes. Our study provided a theoretical basis for the possibility that tea drinking may prevent mitochondrial related diseases.

As the number of ships for marine transportation increases with the advancement of global trade, encountering multiple ships in marine traffic becomes common. This situation raises the risk of collision of the ships; hence this paper proposes a novel Fuzzy-logic based intelligent conflict detection and resolution algorithm, where the collision courses and possible avoiding actions are analyzed by considering ship motion dynamics and the input and output fuzzy membership functions are derived. As a conflict detection module, the Collision Risk (CR) is measured for each ship by using a scaled nondimensional Distance to the Closest Point of Approach (DCPA) and Time to the Closest Point of Approach (TCPA) as inputs. Afterwards, the decisions for collision avoidance are made based on the calculated CR, encountering angle and relative angle of each ship measured from others. In this regard, the rules for the Fuzzy interface system are defined in accordance with the COLREGs, and the whole system is implemented on the MATLAB Simulink platform. In addition, to deal with the multiple ship encounters, the paper proposes a unique maximum-course and minimum-speed change approach for decision making, which has been found to be efficient to solve Imazu problems, and other complicated multiple-ship encounters.

Textile and clothing is one of the most important industrial sectors, not only due to the significant number of jobs generated, but also because it addresses one of the people’s fundamental needs (clothing). It is, however, a sector with a huge environmental impact, all over the world, and also an important social impact, especially in developing countries. Sustainability in the Textile &amp; Clothing value chain is a known issue, concerning both environmental, and economical-social facets of sustainability. One way to improve sustainability in this sector is by measuring the environmental, economic and social impacts of value chain activities and, ultimately, computing an Environmental and Circular score for each batch of textile and clothing product, and an Economical and Social score for each involved firm, reflected in their products. The consumer will then have the opportunity and responsibility for selecting products with the least negative environmental, economical and social impact. This article presents the results of STVgoDigital project - PPS1, developed in Portugal with the aim of implementing the traceability of textile and clothing products, boosting sustainability in this sector, and preparing the ground for the implementation of the circular economy. More exactly, a blockchain-based textile and clothing value-chain traceability platform is presented, for tracing textile product lots and activities, along the value chain, classifying them with a score, which measures their environmental and social impact. The environmental, economic and social impact scores are based on a set of proposed indicators. The results are assessed through the presentation of a case study of a face towel (home textile) and a case study of a T-shirt (clothing).

MRI shows in-vivo the three archetypal patterns of CNS volume loss underlying progressive ataxias, namely spinal atrophy (SA), cortical cerebellar atrophy (CCA) and olivopontocerebellar atrophy (OPCA). The MRI-based CNS atrophy pattern was reviewed in 128 progressive ataxias. A CNS atrophy pattern was identified in 91 conditions: SA in Freidreich’s ataxia, CCA in 5 acquired and 72 (24 dominant, 47 recessive,1 X-linked) inherited ataxias, OPCA in Multi-System Atrophy and 12 (9 dominant, 2 recessive,1 X-linked) inherited ataxias. The MRI-based CNS atrophy pattern may be useful for genetic assessment, identification of shared cellular targets, and repurposing therapies or enlargement of drugs indications in progressive ataxias.

The objective of this study is to design an optimal model predictive control (MPC) strategy using manipulated variables to control the production of a sufficient amount of hydrogen through low temperature autothermal reforming of dimethyl ether (DME), a reforming reaction performed using PdO/ZnO/γ-Al2O3 catalysts coated on honeycomb cordierite ceramics. Experiments and simulation have verified that the optimal activity temperature of the catalyst is 400 °C, and the hydrogen volume fraction in syngas is over 43%. In the implementation of the hydrogen production system, the MPC controller can precisely determine the feed rates of DME, high-purity air, and water based on the space state equation of the reformer, to achieve the anti-disturbance of the reformer temperature. Thus, the reduction of hydrogen yield and sintering of the catalyst as a result of overheating are prevented. As the static and dynamic performance of hydrogen production exhibits excellent tracking of the setpoints, an autonomous, automated, and reliable continuous system was designed to meet the desired hydrogen demand situation. This study shows that an autonomous, automated, and reliable continuous hydrogen production reforming system can be designed to actively respond to the on-board hydrogen usage situation.

this review summarizes current knowledge of the hydrogen sulfide role in cardiovascular system, the proposed mechanisms of its action and the prospects for its applicability in the treatment of cardiovascular diseases. Hydrogen sulfide was recently recognized as gasotransmitter – simple signaling molecule which freely penetrates the cell membrane and regulates a number of biological functions. In humans endogenous H2S is generated via enzymatic and non-enzymatic pathways and its content varies in different tissues and is strictly regulated. In cardiovascular system H2S is produced by myocardial, vascular and blood cells and regulates a number of vital functions. Numerous experimental data prove that endogenously generated as well as exogenously administered H2S exerts a wide range of actions in cardiovascular system, including vasodilator/vasoconstrictor effects, regulation of blood pressure, pro-apoptotic and anti-proliferative effects in the vascular smooth muscle cells, influence on angiogenesis and erythropoiesis, myocardial cytoprotection in ischemia-reperfusion injury, oxygen sensing, inhibition of platelet aggregation and blood coagulation, modification of erythrocyte microrheological properties (aggregability and deformability). Understanding of molecular mechanisms of H2S action and molecular crosstalk between H2S, NO, and CO is essential for the development of its diagnostic and therapeutic potential.

The rapid adoption of hydrogen as an eco-friendly energy source has necessitated the development of intelligent power management systems capable of efficiently utilizing hydrogen resources. However, guaranteeing the security and integrity of hydrogen-related data has become a significant challenge. This paper proposes a pioneering approach to ensure secure hydrogen data analysis through the integration of blockchain technology, enhancing trust, transparency, and privacy in handling hydrogen-related information. By combining blockchain with intelligent power management systems, the efficient utilization of hydrogen resources becomes feasible. The utilization of smart contracts and distributed ledger technology facilitates secure data analysis, real-time monitoring, prediction, and optimization of hydrogen-based power systems. The effectiveness and performance of the proposed approach are demonstrated through comprehensive case studies and simulations. Notably, our prediction models, including ABiLSTM, ALSTM, and ARNN, consistently delivered high accuracy with MAE values of approximately 0.154, 0.151, and 0.151, respectively, enhancing the security and efficiency of hydrogen consumption forecasts. The blockchain-based solution offers enhanced security, integrity, and privacy for hydrogen data analysis, thus contributing to the advancement of clean and sustainable energy systems. Additionally, the research identifies existing challenges and outlines potential future directions for further enhancing the proposed system. This study adds to the growing body of research on blockchain applications in the energy sector, with a specific focus on secure hydrogen data analysis and intelligent power management systems.

The COVID-19 pandemic cost 7-8 million deaths worldwide, creating an unprecedented health and economic crisis. Affecting 700 million people globally, the magnitude of this pandemic is far from anything that humanity has encountered in recent times. A detailed investigation revealed that more than the SARS-CoV2 virus, the hyperactive immune system mediated injury as the real cause of mortality. Cytokine storm following viral infection leads to the surge of proinflammatory cytokines resulting in ARDS and lung injury. Anti-inflammatory intervention with anti-IL6 (anti-IL-6 receptor monoclonal antibodies (mAbs) (e.g., sarilumab, tocilizumab) and anti-IL-6 mAbs (i.e., siltuximab) and /or steroid-based approach lead to substantial protection and prevent death thereby implying the role of inflammation in COVID-19. In this short review, we summarized the dysregulated immune system in COVID-19 infection, investigating in detail the virus–host immune cross talks and presenting the possibilities of therapeutic intervention.

Epicatechin has been described as a polyphenol compound that promotes skeletal muscle restructuring, by expressing muscle regulation factors, activation of satellite cells and modulation of the main pathways associated with catabolism. However, the literature shows contrasting results of therapeutic effects and treatment protocols. Thus, the aim of this systematic review was to analyze the current literature addressing the molecular mechanism and clinical protocol of epicatechin on skeletal muscular atrophy in humans and animals. A search was conducted in PubMed/MEDLINE, Embase, Web of Science, and Cochrane Library databases. The qualitative analysis showed a prevalence of the inhibitory action of epicatechin in myostatin expression and atrogenes FOXO, MAFbx and MuRF1. Epicatechin showed positive effects on increased follistatin and on the activation of the myogenic regulatory factors (Myf5, MyoD and myogenin). In addition, the studies evidenced the impact of epicatechin on the mitochondrias' biosynthesis in muscle fibers, activation of the signaling pathway of AKT/mTOR protein synthesis, and improvement of skeletal musculature performance, particularly when associated with physical training. Epicatechin showed promising clinical applicability through beneficial results under conditions that negatively affect the skeletal musculature. However, there is no protocol standardization allowing to draw more specific conclusions on its therapeutic use.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Neuronal lesions in Parkinson’s disease (PD) are commonly associated with α-synuclein (α-Syn)-induced cell damage that are present both in the central and peripheral nervous systems of patients, with the enteric nervous system also being especially vulnerable. Here we bring together evidence that the development and presence of PD depends on specific sets of interlinking factors that include neuro-inflammation, systemic inflammation, α-Syn-induced cell damage, vascular dysfunction, iron dysregulation, gut and periodontal dysbiosis. We argue that there is significant evidence that bacterial inflammagens fuel this systemic inflammation, and might be central to the development of PD. We also discuss the processes whereby lipopolysaccharides may be involved in causing nucleation of proteins, including of α-Syn. Lastly, we review evidence that pre-and probiotics, as well as antibiotics and faecal transplant treatment might be valuable treatments in PD. A most important consideration, however, is that these therapeutic options need to be validated and tested in randomized controlled clinical trials. However, targeting underlying mechanisms of PD, including gut dysbiosis and iron toxicity, have potentially opened up possibilities of a wide variety of novel treatments which may relieve the characteristic non-motor deficits of PD, and may even slow the progression and/or accompanying gut-related conditions of the disease.

Although most cases of COVID-19 are paucisymptomatic, severe disease is characterized by immune dysregulation, with a decreased type I interferon response, increased inflammatory indicators, surging IL-6, IL-10 and TNFα suggestive of cytokine storm, progressive lymphopenia, and abnormal blood clotting. Factors determining susceptibility to severe disease are poorly understood, although mortality correlates with increasing age and co-morbidities including diabetes and cardiovascular disease (CVD). Pyridoxal 5'-phosphate (PLP) tends to be insufficient in populations particularly vulnerable to COVID-19, including the elderly, the institutionalized, and people with diabetes and CVD, and PLP becomes further depleted during infection and inflammation. In turn, low PLP results in immune imbalance, as PLP is an essential cofactor in pathways regulating cytokine production, in particular type I interferons and IL-6, and in lymphocyte trafficking and endothelial integrity. Furthermore, normalizing PLP levels attenuates abnormalities in platelet aggregation and clot formation. Finally, PLP insufficiency induces excess secretion of renin and angiotensin, and hypertension. In inflammatory disease, pharmacological doses of PLP decrease circulating TNFα, IL-6 and D-dimer, and animal studies demonstrate that supplemental PLP shortens the duration and severity of viral pneumonia. Severe COVID-19 manifests as an imbalance in the immune response and the clotting system. Pharmacological PLP supplementation may therefore mitigate COVID-19 symptoms by alleviating both the immune suppression underlying viral spread and the pathological hypersecretion of inflammatory cytokines, as well as directly bolstering endothelial integrity and preventing hypercoagulability.

Despite the remarkable success of SARS CoV-2 vaccines, the rise of variants, some of which are more resistant to the effects of vaccination, highlights the potential need for additional COVID-19 vaccines. We used the Multiple Antigen Presenting System (MAPS) technology, in which proteins are presented on a polysaccharide polymer to induce antibody, Th1, Th17 and CD8+ T cell responses, to engineer a novel vaccine targeting SARS CoV-2. This vaccine contains a fragment of the spike (S) protein receptor-binding domain (RBD) sequence of the original D614G strain and was used to immunize nonhuman primates (NHP) for assessment of immunological responses and protection against SARS CoV-2 challenge. The SARS CoV-2 MAPS vaccine generated robust neutralizing antibodies as well as Th1, Th17 and cytotoxic CD8 T-cell responses in NHPs. Furthermore, MAPS-immunized NHPs had significantly lower viral loads in the nasopharynx and lung compared to control animals. Taken together, these findings support the use of the MAPS platform to make a SARS CoV-2 vaccine. The nature of the platform also could enable its use for the inclusion of different variants in a single vaccine.

For many disciplines of science, all conceivable collisional cross sections and reactions must be precisely known. Although the recent decades were a trial of large-scale research to give these data, many essential atomic and molecular cross section data still missing, and the reliability of the existing cross sections has to be validated. In this paper, we present electron stripping, electron capture, and system breakdown cross sections in carbon (C5+) ions and lithium (Li2+) ions collisions with atomic hydrogen based on the Monte Carlo models of classical and quasi-classical trajectories. According to our expectation, the QCTMC results show higher results in comparison to standard CTMC data, emphasizing the role of Heisenberg correction constraint, especially in the low energy regime. On the Other hand, at high energy, the Heisenberg correction term has less influence as a projectile momentum increase. We present the total cross sections of electron stripping, electron capture, and system breakdown in C5+ ions and Li2+ ions collisions with atomic hydrogen in the impact energy range from 10 keV to 160 keV, which is of interest in astrophysical plasmas, atmospheric sciences, plasma laboratories, and fusion research.

At 100% penetration, intermittent renewable energy causes outages. To flatten the leaping supply and demand curves of renewable energy, an energy storage medium and carrier are required. The Hydrogen energy stotrage system (HydESS), which combines a proton exchange membrane (PEM)-based water electrolysis (WE) system and a fuel cell (FC), has the quickest response time, the longest duration, and the greatest storage capacity. HOMER tools for techno-economic analysis are used to evaluate the HydESS hybrid system. Kyiv, Ukraine, is appealing due to its spatial-temporal wind speed, solar irradiance, and energy security. With an LCOE of $0.245 kWh−1 and 9.3% fuel cell power output, the most feasible solution is onshore wind turbine-coupled PEMFC HydESS. As a result 1,000-kW wind power, 250-kW PEMFC, 250-kW PEMWE, and 441-kW BESS are optimized to serve a 3,900 kWh day academic residence load. When compared to a diesel generator and a BESS, the hybrid HydESS reduces CO2 emissions by 4,132 tons over a 25-year period. The LCOE of a hybrid HydESS system is determined by the SOFC lifetime rather than the PEMFC's 2% difference between 40,000 and 50,000 h with the same rated power. This study recommends accelerating PEMFC development with fluctuation-endurable materials and design.

In light of the latest trends in global installed capacities, the importance of variable renewable energy sources (VRES) to future energy supply systems is evident. Despite this, the inherent intermittency of VRES remains an obstacle to their widespread adoption. Green hydrogen is often suggested as an energy carrier that can account for this in a sustainable manner. In the analysis, a robust European energy system in the context of 2050 and with 100% VRES energy supply is designed through an iterative minimal cost-optimization approach that ensures robust security of supply over 38 weather-year scenarios (1980-2017). The impact of spatial VRES variability is factored in by defining exclusive VRES groups within each optimization region and, from this, it can be seen that higher numbers of groups in each region offer cheap electricity generation locations to the optimizer and thus decrease the total annual cost of the system. Beyond this, the robust system design and impact of inter-annual variability is identified by iteratively combining the installed capacities of different system designs obtained by applying 38 historical weather years. The robust system design outlined here has significantly lower capacities in comparison to the maximum regional capacities obtained in the first round of optimization.

The North Sea Offshore Grid concept has been envisioned as a promising alternative to: 1) ease the integration of offshore wind and onshore energy systems, and 2) increase the cross-border capacity between the North Sea region countries at low cost. In this paper we explore the techno-economic benefits of the North Sea Offshore Grid using two case studies: a power-based offshore grid, where only investments in power assets are allowed (i.e. offshore wind, HVDC/HVAC interconnectors); and a power-and-hydrogen offshore grid, where investments in offshore hydrogen assets are also permitted (i.e. offshore electrolysers, new hydrogen pipelines and retrofitted natural gas pipelines). We compare these scenario results with a business as usual scenario, in which offshore wind is connected radially to the shore and no offshore grid is deployed. All scenarios are run with the IESA-NS model, without any specific technology ban and under open optimization. This paper also presents a novel methodology, combining Geographic Information Systems and Energy System Models, to cluster offshore spatial data and define meaningful offshore regions and offshore hub locations. This novel methodology is applied to the North Sea region to define nine offshore clusters taking into account offshore spatial claims, and identifying suitable areas for single-use and multi-use of space for renewable energy purposes. The scenario results show that the deployment of an offshore grid provides relevant cost savings, ranging from 1% to 4.1% of relative cost decrease (2.3 bn € to 8.7 bn €) in the power-based, and ranging from 2.8% to 7% of relative cost decrease (6 bn € to 14.9 bn €) in the power-and-hydrogen based. In the most extreme scenario (H2) an offshore grid permits to integrate 283 GW of HVDC connected offshore wind and 196 GW of HVDC meshed interconnectors. Even in the most conservative scenario (P1) the offshore grid integrates 59 GW of HVDC connected offshore wind capacity and 92 GW of HVDC meshed interconnectors. When allowed, the deployment of offshore electrolysis is considerable, ranging from 61 GW to 96 GW, with capacity factors of around 30%. Finally, we also find that, when imported hydrogen is available at 2 €/kg (including production and transport costs), large investments in an offshore grid are not optimal anymore. In contrast, at import costs over 4 €/kg imported hydrogen is not competitive.

Road cracks significantly affect the serviceability and safety of roadways, especially in mountainous terrain. Traditional inspection methods, such as manual detection, are excessively time-consuming, labor-intensive, and inefficient. Additionally, multi-function detection vehicles equipped with various sensors are expensive and not suitable for mountainous roads due to poor conditions. To address these challenges, this study proposes a customized Unmanned Aerial Vehicles (UAV) inspection system designed for automatic crack detection. The system focuses on enhancing autonomous capabilities in mountainous terrains by incorporating embedded algorithms for route planning, autonomous navigation, and automatic crack detection. The slide window method is proposed to enhance the autonomous navigation of UAV flights by generating path planning in mountainous roads. This method compensates for GPS/IMU positioning errors, particularly in GPS-denied or GPS-drift scenarios. Moreover, the YOLOv8 algorithm is introduced to conduct autonomous crack detection from UAV imagery in the offboard module. To validate our UAV inspection system's performance, we conducted several experiments to assess its accuracy, robustness, and efficiency. The experimental results demonstrate that our UAS inspection system accurately estimates the flight trajectory along the mountainous road for autonomous navigation. Furthermore, the experimental detection results also demonstrate that the YOLOv8 algorithm achieves higher recognition accuracy compared to the YOLOv5, and YOLOv7-tiny algorithms, exceeding 3.1%,and 6.8% of mAP, respectively. In summary, the UAV inspection system proposed in this study can provide a useful tool and technological guidance for the regular inspection of mountainous roads.

In recent years, autonomous robots have proven capable of solving tasks in complex environments. In particular, robot manipulations in activities of daily living (ADL) for service robots have been in wide use. However, manipulations such as loading a dishwasher or folding laundry are difficult to automate robustly. In addition, manipulations of grasping multiple objects in domestic environments present difficulty. To perform those applications better, we developed robotic systems based on shared autonomy by combining the cognitive skills of a human operator with autonomous robot behaviors. In this work, we present techniques for integration of a shared autonomy system for assistive mobile manipulation and new strategies to support users in the domestic environment. We demonstrate that the robot can grasp multiple objects with random size at known and unknown table heights. Specifically, we developed three strategies for manipulation. From experimental results, we observed that the first strategy has the highest success rate (70% for random objects) up to 70 cm table height. Two other strategies perform better for 80 cm to 100 cm table height. The success rate of the second and third strategies shows an average 63.3% and 73.3%, respectively, for grasping random objects. We also demonstrated these strategies using two intuitive interfaces, a visual interface in rviz and a voice user interface with speech recognition, which are suitable for elderly people. In addition, the robot can select strategies automatically in random scenarios, which make the robot intelligent and able to make decisions independently in the environment. We obtained interesting results showing that the robot adapts to the environmental variation automatically. After these experimental demonstrations, our robot shows the capabilities for employment in domestic environments to perform actual tasks.

When dealing with limited sample sizes or missing values in time series data, achieving high accuracy in forecasting becomes challenging. This challenge is particularly common in wind energy forecasting, where many wind farms lack complete data. In this paper, we employ the widely-used ARIMA (Autoregressive Integrated Moving Average) model for time series forecasting. To address the difficulties posed by limited sample sizes and missing values, we adopt a unique approach by utilizing multiple ARIMA models for different datasets. A key distinction from other multiple models methods for time series forecasting lies in each model within our approach using its own dataset, making the fusion process more intricate. To overcome this, we incorporate neural networks and two techniques for model fusion: direct fusion with a learning mechanism and compensation for missing data through training. For each ARIMA model, we introduce a noise estimation method to circumvent the white noise assumptions inherent in ARIMA models. Finally, we apply these methods to wind energy prediction, and our experimental results showcase a significant enhancement in forecasting accuracy.

Schizophrenia continues to be an illness with poor outcome. Most mechanistic changes occur many years before the first episode of schizophrenia; these are not reversible after the illness onset. A developmental mechanism that is still modifiable in adult life may center on intracortical glutathione (GSH). A large body of pre-clinical data has suggested the possibility of notable GSH-deficit in a subgroup of patients with schizophrenia. Nevertheless, studies of intracortical GSH are not conclusive in this regard. In this review, we highlight the recent ultra-high field magnetic resonance spectroscopic studies linking GSH to critical outcome measures across various stages of schizophrenia. We discuss the methodological steps required to conclusively establish or refute the persistence of GSH-deficit subtype and clarify the role of the central antioxidant system in disrupting the brain structure and connectivity in the early stages of schizophrenia. We propose in-vivo GSH quantification for patient selection in forthcoming antioxidant trials in psychosis. This review offers directions for a promising non-dopaminergic early intervention approach in schizophrenia.

For decades, sepsis research has been motivated by the idea of a dangerous overreaction of the immune system in sepsis. But is it true that the response to sepsis is dysregulated? This review surveys the history of sepsis trials and found that evidence for dysregulation does not exist in many of the physiologic mechanisms of sepsis. It is time to consider the alternative hypothesis, that sepsis traits are often functional, and do more harm than good. This review discusses the implications of this perspective for the future of sepsis research

Accurately estimating shrub biomass in arid and semi-arid regions is critical for understanding ecosystem productivity and carbon stocks at both local and global scales. However, capturing the shrub biomass accurately by satellite observations is challenging due to the short and sparse features of shrubs. In this study, we presented a framework to estimate shrub biomass at a 10m spatial resolution by integrating ground in-situ data, unmanned aerial vehicle (UAV), Sentinel-2, and Sentinel-1 observations. The pilot study was conducted in the Helan mountains of Ningxia province, China. First, the spatial distribution map of shrubland and other land cover types was generated in 2023. Then, a prediction model of shrub biomass was developed in a Random Forest Regression (RFR) approach driven by different predicted variable datasets based on in-situ measurements, UAV, and satellite images. Finally, the developed model was used to produce the biomass map of shrubland in 2023. The uncertainty was characterized by creating a standard deviation (SD) map using the Leave-One-Out Cross-Validation (LOOCV) method in the shrub biomass estimates. The resultant shrubland distribution map in 2023 has an F1 score of 0.92. The shrub biomass model driven by spectral bands and vegetation indices (R2= 0.62) demonstrated superior performance than that only driven by spectral bands (R2=0.33) or vegetation indices (R2=0.55). The uncertainty of the estimated biomass was lower than 4%, with the lowest values (<2%) happening in the high shrub coverage (>30%) and biomass production (>30kg/m2) regions. Furthermore, the findings show that the magnitude of shrub biomass was affected by the aridity and precipitation significantly in the study region. This study provides a workflow to accurately monitor the biomass of shrublands in a complicated environment based on remote sensing images from multi-platform observations.

Histone demethylases, enzymes responsible for removing methyl groups from histone proteins, have emerged as critical players in regulating gene expression and chromatin dynamics, thereby influencing various cellular processes. LSD2 and LSD1 have attracted considerable interest among these demethylases because of their associations with cancer. However, while LSD1 has received significant attention, LSD2 has not been recognized to the same extent. In this study, we conduct a comprehensive comparison between LSD2 and LSD1, with a focus on exploring LSD2's implications. While both share structural similarities, LSD2 possesses unique features. Functionally, LSD2 shows diverse roles, particularly in cancer, with tissue-dependent roles. Additionally, LSD2 extends beyond histone demethylation, impacting DNA methylation and DNA damage repair pathways. This study underscores the distinct roles of LSD2, providing insights into their contributions to cancer and other cellular processes.

A single mode waveguide grating coupler based on multiple Si-SiO₂ pairs onto Si substrate has been designed. Numerical analysis has been carried out to calculate optimum thickness of the layers of Si-SiO₂ that ensures the constructive interference between reflected waves and actual guided wave for high coupling efficiency. Based on the results, an optimal design is developed and modeled by using a 2-D finite difference time domain (2-D FDTD) simulator that dictates a coupling efficiency of as much as 78% (-1.07 dB) at the wavelength of 1550 nm, and a 1-dB bandwidth of 77 nm. The numerical method will be useful to calculate the optimum thicknesses of the layers for any reflector based grating coupler of different materials.

Modern power systems are confronted with a spread concern on the frequency stability issue due to the widespread integration of randomly fluctuating renewable resources. To address the above concern, this work introduces a load frequency control (LFC) scheme based on a hydrogen based energy-storage unit and a parameter tuning strategy for fractional-order proportional-integral-derivative (FOPID) controller. Firstly, a two-area interconnected power system (IPS) model, including thermal, hydro, solar, wind, gas power generator, and hydrogen based energy-storage unit, is established. Then, a FOPID controller is designed for this IPS model, and an improved gradient-based optimizer (IGBO) is developed to adaptively regulate the parameters of the FOPID controllers. Finally, the effectiveness of the offered LFC scheme are tested through load disturbance and renewable energy fluctuations test scenarios, and provides comparison and robustness analysis among different schemes. The test results validated that the offered LFC scheme can effectively suppress the frequency fluctuations of IPS and has excellent robustness.

The present review revisits representative studies addressed to develop efficient carbon-based heterogeneous catalysts for two important reactions, namely, the production of hydrogen from formic acid and the hydrogenation of carbon dioxide to formic acid. The HCOOH-CO2 system is considered a promising couple for a hydrogen storage system that would be involved in an ideal carbon-neutral cycle. Significant advancements have been achieved in those catalysts designed to catalyze the dehydrogenation of formic acid under mild reaction conditions, while much effort is still needed to catalyze the challenging CO2 hydrogenation reaction. The design of carbon-based heterogeneous catalysts for these reactions encompasses both the modulation of the properties of the active phase (particle size, composition, and electronic properties), as well as the modification of the supports by means of incorporation of nitrogen functional groups. These approaches are herein summarized to provide a compilation of the strategies followed in recent studies to set the basis for a hydrogen storage system attained by the HCOOH-CO2 couple.