The positional cloning of single nucleotide polymorphisms (SNPs) of the neutrophil cytosolic factor 1 (Ncf1) gene, advocating that a low oxidative burst drives autoimmune disease, demands an understanding of the underlying molecular causes. A cellular target could be T cells, which have been shown to be regulated by reactive oxygen species (ROS). However, the pathways by which ROS mediate T cell signaling remain unclear. The adaptor molecule linker for activation of T cells (LAT) is essential for coupling T cell receptor-mediated antigen recognition to downstream responses, and it contains several cysteine residues that have previously been suggested to be involved in redox regulation. To address the possibility that ROS regulate T cell-dependent inflammation through LAT, we established a mouse strain with cysteine-to-serine mutations at positions 120 and 172 (LATSS). We found that redox regulation of LAT through C120 and C172 mediate its localization and phosphorylation. LATSS mice had reduced numbers of double-positive thymocytes and naïve peripheral T cells. Importantly, redox insensitivity of LAT enhanced T cell-dependent autoimmune inflammation in collagen-induced arthritis (CIA), a mouse model of rheumatoid arthritis (RA). This effect was reversed on an NCF1-mutated (NCF1m1j), ROS-deficient, background. Overall, our data shows that LAT is redox-regulated, acts to repress T cell activation, and is targeted by ROS induced by NCF1 in antigen-presenting cells (APCs).

Dendritic cells (DCs) are the professional antigen-presenting cells that recognize and present antigens to naïve T cells to induce antigen-specific adaptive immunity. Among the T-cell subsets, T helper type 2 (Th2) cells produce the humoral immune responses required for protection against helminthic disease by activating B cells. DCs induce a Th2 immune response at a certain immune environment. Basophil, eosinophil, mast cells, and type 2 innate lymphoid cells also induce Th2 immunity. However, in the case of DCs, controversy remains regarding which subsets of DCs induce Th2 immunity, which genes in DCs are directly or indirectly involved in inducing Th2 immunity, and the detailed mechanisms underlying induction, regulation, or maintenance of the DC-mediated Th2 immunity against allergic environments and parasite infection. A recent study has shown that a genetic defect in DCs causes an enhanced Th2 immunity leading to a severe atopic dermatitis. We summarize the Th2 immune-inducing DC subsets, the genetic and environmental factors which involved in DC-mediated Th2 immunity, and current therapeutic approaches for Th2-mediated immune disorders. This review is to provide an improved understanding of DC-mediated Th2 immunity and Th1/Th2 immune balancing, leading to control over their adverse consequences.

The microenvironment of most tumors is complex, comprising numerous aspects of immunosuppression. Several studies have indicated that the adrenergic system is vital for controlling immunological responses. In the context of tumor microenvironment, Nor-Adrenaline (NA) is poured-in by innervating nerves and tumor tissues itself. The receptors for nor-adrenaline are present on the surface of cancer and immune cells and are often involved in activation of pro-tumoral signaling pathways. β2-adrenergic receptor (β2-AR) is an emerging class of receptors that are capable of modulating the functioning of immune cells. β2-AR is reported to activate the regulatory immune cells and inhibit the effector immune cells. Blocking β2-AR increases activation, proliferation and cytokine release of T lymphocytes. Moreover β2-AR deficiency during metabolic reprograming of T cells increases mitochondrial membrane potential and biogenesis. In the view of available research data, immunosuppressive role of β2-AR in T cells presents it a targetable checkpoint in CAR-T cell therapies. In this review, we have abridged contemporary knowledge about adrenergic stress mediated β2-AR activation on T lymphocytes inside tumor milieu.

Multiple Myeloma (MM) is one of the incurable types of cancer in plasma cells. While immense progress has been made in the treatment of this malignancy, a large percentage of patients were unable to adapt to such therapy. Additionally, these therapies might be associated with significant diseases and are not always tolerated well in all patients. Since cancer in plasma cells has no cure, patients develop resistance to treatments, resulting in R/R MM. BCMA is primarily produced on mature B cells. Its up-regulation and activation are associated with multiple myeloma in both murine and human models, indicating that this might be an effective therapeutic target for this type of malignancy. Additionally, BCMA's predictive value, association with effective clinical trials, and capacity to be utilized in previously difficult to observe patient populations, imply that it might be used as a biomarker for multiple myeloma. Numerous kinds of BCMA-targeting medicines have demonstrated antimyeloma efficacy in individuals with refractory/relapsed MM, including CAR T-cell treatments, ADCs, bispecific antibody constructs. Among these medications, CART cell-mediated BCMA therapy has shown significant outcomes in multiple myeloma clinical trials. This review article outlines CAR T cell mediated BCMA medicines have the efficiency to change the therapeutic pattern for multiple myeloma significantly.

Visceral Leishmaniasis is a neglected tropical disease affecting 12 million people annually. Even in the second decade of the 21st century, it has remained without an effective vaccine for human use. In the current study, we have designed three multiepitope vaccine candidates by the selection of multiple IFN-γ inducing MHC-I and MHC-II binder T-cell specific epitopes from 3 previously identified antigen genes of Leishmania donovani from our lab, by immune-informatic approach using IFNepiotpe, NET-MHC-1 and NET MHC-2 webservers. We have tested the protective potential of these three multiepitope proteins as vaccine in a hamster model of visceral leishmaniasis. The immunization data revealed that the vaccine candidates induced a very high level of Th-1 biased protective immune response in-vivo in a hamster model of experimental visceral Leishmaniasis, with one of the candidates inducing a sterile immunity. The vaccinated animals displayed highly activated monocyte macrophages with the capability of clearing intracellular parasites due to increased respiratory burst. Additionally, these proteins induced activation of polyfunctional T cells secreting INF-γ, TNF-α, and IL-2 in ex-vivo stimulation of human peripheral blood mononuclear cells, further supporting the protective nature of designed candidates.

γδT have functions of innate and adaptive immunity, with the potential to induce durable responses while being well-tolerated, with limited adverse effects, making it attractive as a tool for immunotherapy. γδT faces challenges as a frontline tool in clinical oncology, with limited response rates due to difficulties in reaching tumor sites with consistent cytotoxic activity and strength. Modulated Electro-hyperthermia (mEHT) is a loco-regional treatment, whereby energy-transmission from an electromagnetic field selectively targets the plasma membrane of tumor cells, inducing apoptosis and activating immune cells. We hypothesized that mEHT could enhance therapeutic effects by drawing γδT to tumor cells, while also rendering tumor cells to be more susceptible to cytotoxic effects. In this study, NOD/SCID mice harboring subcutaneous human HepG2 tumors were treated with intravenous injections of γδT after mEHT treatment. This method increased infiltration of γδT into the tumor site, significantly inhibiting tumor growth as compared to monotherapy with either modality. These data suggest that γδT could mediate a potent anti-tumor effect when combined with mEHT, and provide a strong rationale for combining these modalities in clinical application for cancer treatment.

Buruli ulcer is a chronic ulcerative disease of skin and subcutaneous tissues caused by infection with Mycobacterium ulcerans. Although Australian possums are known to be susceptible to Buruli ulcer, many aspects of the disease in possums, including welfare impacts, remain largely unreported. Severe clinical Buruli ulcer was identified in four common ringtail possums (Pseudocheirus peregrinus) from Melbourne, Victoria. All four possums were euthanised due to welfare concerns and poor prognosis, based on the presence of deep ulcerative lesions to paws, some of which exposed carpal or tarsal bones. These lesions were considered likely to cause partial or complete loss of limb function, which would severely affect the welfare and survival of these wild arboreal animals. Histologically, there was severe ulcerative necrotising pyogranulomatous dermatitis, panniculitis, and myositis, with intralesional acid-fast bacteria. M. ulcerans was detected by real-time PCR in all swabs and biological tissues collected from all four cases. Buruli ulcer may be an important and under-recognised cause of poor possum welfare in endemic areas. In addition to severe cutaneous lesions, infection extends to underlying bones and joints, and the systemic distribution of M. ulcerans throughout all major tissues and internal organs, as observed in these four cases, may further impact the health and fitness of infected possums. Further research is needed to investigate the epidemiology, pathogenesis and impacts of Buruli ulcer in possums, and to inform the design of interventions that may protect the health and welfare of possums and other affected animal species.

T-cell mediated immune responses should be regulated to avoid the development of autoimmune or chronic inflammation diseases. Several mechanisms have been described to regulate this process, namely death of overactivated T cells by cytokine deprivation, suppression by T regulatory cells (Treg), induction of expression of immune checkpoint molecules such as CTLA-4 and PD-1, or activation-induced cell death (AICD). In addition, activated T cells release membrane microvesicles called exosomes during these regulatory processes. In this review, we revise the role of exosome secretion in the different pathways of immune regulation described to date and its importance in the prevention of autoinmune disease. Expression of membrane-bound death ligands on the surface of exosomes during AICD, or the more recently described transfer of miRNA or even DNA inside T-cell exosomes are molecular mechanisms that will be analyzed.

ccJE+Advax is an inactivated cell culture Japanese encephalitis (JE) vaccine formulated with Advax™, a novel polysaccharide adjuvant based on delta inulin. This vaccine has previously shown promise in murine and equine studies and the current study sought to better understand its mechanism of action and assess the feasibility of single dose vaccine protection. Mice immunised with ccJE-Advax had higher serum neutralisation titres than those immunised with ccJE alone or with alum adjuvant. ccJE+Advax induced extraordinarily broad cross-neutralising antibodies against multiple flaviviruses including West Nile virus (WNV), Murray Valley Encephalitis Virus (MVEV), St Louis Encephalitis virus (SLE) and Dengue-1 and -2 viruses. Notably, the DENV-2 cross-neutralising antibodies from ccJE+Advax immunised mice uniquely had no DENV-2 antibody dependent enhancement (ADE) activity, by contrast to high ADE activity seen with DENV-1 cross-reactive antibodies induced by mbJE or ccJE alone or with alum adjuvant. JEV-stimulated splenocytes from ccJE+Advax immunised mice showed increased IL-17 and IFN-γ production, consistent with a mixed Th1 and Th17 response, whereas ccJE-alum was associated with production of mainly Th2 cytokines. There is an ongoing lack of human vaccines against particular flaviviruses, including WNV, SLE and MVEV. Given its ability to provide single-dose JEV protection as well as to induce broadly neutralising antibodies free of ADE activity, ccJE+Advax vaccine could be highly useful in all situations where rapid protection is desirable but ADE needs to be avoided, e.g. during a local outbreak or for use in travellers or the military requiring rapid travel to JEV endemic regions.

For monitoring of chimeric antigen receptor (CAR) T-cell therapies antigen-based CAR detection methods are usually applied. However, for each target-antigen a separate detection system is required. Furthermore, when monitoring CAR T-cells in the blood of patients treated with bispecific antibodies or T-cell engagers (bsAbs/BiTEs) recognize the same antigen, these methods producing false-positive results in clinical diagnostics. Anti-CAR-linker monoclonal antibodies (mAbs) targeting the linker sequence between the variable domains of the antigen binding CAR fragment, promise an universal and unbiased CAR detection. To test this, we analyzed clinical specimens of all BCMA- and CD19 targeting CAR T-cell products currently approved for clinical use. We found a highly specific and sensitive CAR detection by using anti-CAR-linker mAb in blood cells from patients treated with Ide-cel, Tisa-cel, Axi-cel, Brexu-cel, and Liso-cel. For Ide-cel and Tisa-cel the sensitivity was significant lower compared to antigen-based CAR detection assays. Strikingly, the specificity of anti-CAR linker mAb was not affected by the simultaneous presence of bispecific blinatumomab or teclistamab for Axi-cel, Brexu-cel, Liso-cel or Ide-cel, respectively. Cilta-cel (containing an monomeric G4S-CAR linker) could not be detected by anti-CAR linker mAb. In conclusion, anti-CAR-linker mAbs are highly specific and useful for CAR T-cell monitoring but not universal applicable.

To elucidate the cellular immune response to coronavirus disease (COVID-19) among children, we assessed cellular immunity in 8 children post-vaccination for COVID-19 and 11 children after severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection, using the T-SPOT®.COVID assay for both the spike (S) and nucleocapsid (N) proteins. In the vaccinated group, the T-SPOT®.COVID assay for the S protein yielded positive results in all eight children. In contrast, in the post-infection group, the assay for the N protein was positive in 5 of 11 children, with 3 of these 5 children requiring hospital admission, including 2 who needed mechanical ventilation. Therefore, the T-SPOT®.COVID assay is valuable for assessing cellular immunity against COVID-19, and most children infected with COVID-19 may not develop such immunity unless the disease severity is significant.

CD147/Basigin, a transmembrane glycoprotein belonging to the immunoglobulin super family, is a multifunctional molecule with various binding partners. CD147 binds to monocarboxylate transporters (MCTs) and supports their expression on plasma membranes. MCTs play an important role in glycolysis, the enzymatic conversion of glucose to pyruvate and adenosine triphosphate (ATP). Pyruvate is further converted to lactic acid which is exported from the cytoplasm by MTC-1 and MCT-4 to maintain intracellular pH and a stable metabolic state. Under physiological conditions, cellular energy production is induced by mitochondrial oxidative phosphorylation. Glycolysis usually occurs under anaerobic conditions, whereas cancer cells depend on glycolysis under aerobic conditions. T cells also require glycolysis for differentiation, proliferation, and activation. Human malignant melanoma cells expressed higher levels of MCT-1 and MCT-4, co-localized with CD147 on the plasma membrane and showed an increased glycolysis rate compared to normal human melanocytes. Silencing of CD147 by siRNA abrogated the membrane expression of MCT-1 and MCT-4 and disrupted glycolysis, inhibiting cancer cell activity. The differentiation of CD4+ T cells into Th17 cells is a pivotal process in the development of various immune disorders, including psoriasis. Studies using CD147-deficient mice demonstrated the involvement of CD147 in psoriasis. MCT-1 was absent on CD4+ T cells in CD147-deficient mice. Naïve CD4+ T-cells from CD147-deficient mice show low potential for differentiation into Th17 cells. Imiquimod-induced skin inflammation was significantly milder in CD147-deficient mice than in wild-type mice. These findings indicate that CD147/Basigin is involved in the development of malignant tumors and T cell mediated immunological disorders via regulation of glycolysis.

We analyze the humoral and B-cell mediated immunogenic response induced by GP5 lineal epitopes from porcine reproductive and respiratory syndrome virus (PRRSV) to explore the role of this protein in the protective response. For inoculation, pigs aged twenty-one days were allocated into six groups (seven pigs per group): control (PBS), vehicle (carrier), vaccinated (Ingelvac-PRRSV, MLV®), non-vaccinated and naturally infected, GP5-B and GP5-B3. Subsequently blood samples were collected and analyzed. Cytokine were measured by ProcartaPlex kit. Peptide-specific IgGs and cross-reactivity against peptides were analyzed by ELISA and B-cell subpopulations were analyzed by flow cytometry. At 2 days post-immunization (dpi), the GP5-B3 peptide increased the serum concentrations of cytokines associated to activate adaptive cellular immunity (IL-1β and IL-12). The concentration of IgGs anti-GP5-B increased in both cases at 21 and 42 dpi, while IgGs anti-GP5-B3 increased at 21 dpi and remained at the same level until 42 dpi. Also, antibody-forming/Plasma B cells (CD2+/CD21-) and primed B cells (CD2-/CD21+) from immunized pigs showed an increase at 42 dpi. Conversely the naïve B cells from immunized pigs decreased compared with the controls. Importantly, Both GP5-B and GP5-B3 peptides exhibited immunoreactivity against serum antibodies from vaccinated group, as well as non-vaccinated and naturally infected group. In conclusion, GP5-B and GP5-B3 peptides elicited immunogenicity mediated by antigen specific IgG´s and B-cell activation.

Acute and chronic graft versus host disease (a/cGVHD) are major complications of allogeneic stem cell transplantation and a frequent cause of non relapse-mortality. The treatment of a/cGVHD consists of steroid administration at full dose. In the case of aGVHD, around 60 % of patients with grade III/IV fails to respond (steroid-resistant, SR), requiring a second line therapy. Extracorporeal photopheresis (ECP) represents a good option for second line treatment, leading to multiorgan response in several patients. Here, we have evaluated the performances of a cytofluorimetric quality control of the first ECP procedure in 29 patients with severe SR aGVHD who underwent ECP. The quality control represents a check control of in vitro cell apoptosis/death induction in collected and irradiated CD3+ cells by ECP. Our analysis shows that in more than 70 % quality controls a relevant apoptotosis/death of CD3+ cells was observed after cell irradiation, as compared to non-irradiated controls. Albeit observed in a small patients’ series, the occurrence of relevant in vitro effect after ECP relates to less procedures and/or to a better survival on ECP. Age, disease, gender, aGVHD grade and time from transplant to the first ECP had not impact on ECP efficacy in this patients’ series.

Shigella and Salmonella have been implicated in neonatal sepsis, food poisoning, and bacteremia. Their increasing resistance to antibiotics has undermined treatment options, constituting a public health crisis. Also, the scarcity of new antibiotics in the development pipeline compounds multidrug-resistance (MDR). Hence, there is a need to potentiate antibiotics to mitigate resistance. This study leveraged riboflavin to re-sensitize fluoroquinolones and carbapenems against MDR Shigella and Salmonella spp. Disk diffusion, microbroth-dilution, chequerboard, and time-kill assays were used to determine resistance profiles and riboflavin-antibiotic activity. Biofilm-formation and bacterial viability (after riboflavin-antibiotic challenge) was determined with crystal-violet and Macrophage infection assays, respectively. Strains exhibited >80% resistance to fluoroquinolones and carbapenems, with 160–320 µg MIC ranges and 0.5–2 FIC, indicating no synergy. At 40–80 µg riboflavin, there was two-fold reduction in bacterial survival, with meropenem-riboflavin exhibiting significant reduction and FIC of 0.075 indicating high synergistic activity. Biofilm-formation was altered (from strong to weak phenotype) with 40 µg riboflavin-antibiotic treatment. There was a 40–70% reduction in bacterial survival in THP-1 cells treated with meropenem-riboflavin after 3 hours, and complete clearance between 24-48 hpi. Riboflavin potentiated fluoroquinolones and meropenem, leading to modulation of the host immune response for the clearance of the strains.

Background/methods: For mechanistic studies, in vitro human B cell differentiation and generation of plasma cells are invaluable techniques. However, the heterogeneity of both T cell-dependent (TD) and T cell-independent (TI) stimuli and the disparity of culture conditions used in existing protocols makes interpretation of results challenging. The aim of the present study was to achieve the most optimal B cell differentiation conditions using isolated CD19⁺ B cells and PBMC cultures. We addressed multiple seeding densities, different durations of culturing and various combinations of TD stimuli and TI stimuli including B cell receptor (BCR) triggering. B cell expansion, proliferation and differentiation was analyzed after 6 and 9 days by measuring B cell proliferation and expansion, plasmablast and plasma cell formation and immunoglobulin (Ig) secretion. In addition, these conditions were extrapolated using cryopreserved cells and differentiation potential was compared. Results: This study demonstrates improved differentiation efficiency after 9 days of culturing for both B cell and PBMC cultures using CD40L and IL-21 as TD stimuli and 6 days for CpG and IL-2 as TI stimuli. We arrived at optimized protocols requiring 2500 and 25.000 B cells per culture well for TD and TI assays, respectively. The results of the PBMC cultures were highly comparable to the B cell cultures, which allows dismissal of additional B cell isolation steps prior to culturing. In these optimized TD conditions, the addition of anti-BCR showed little effect on phenotypic B cell differentiation, however it interferes with Ig secretion measurements. Addition of IL-4 to the TD stimuli showed significantly lower Ig secretion. The addition of BAFF to optimized TI conditions showed enhanced B cell differentiation and Ig secretion in B cell but not in PBMC cultures. With this approach, efficient B cell differentiation and Ig secretion was accomplished when starting from fresh or cryopreserved samples. Conclusion: Our methodology demonstrates optimized TD and TI stimulation protocols for more indepth analysis of B cell differentiation in primary human B cell and PBMC cultures while requiring low amounts of B cells, making them ideally suited for future clinical and research studies on B cell differentiation of patient samples from different cohorts of B cell-mediated diseases.

Plant cells' ability to withstand abiotic stress is strongly linked to modifications in their mechanical characteristics. Nevertheless, the lack of a workable method for consistently tracking plant cell mechanical properties severely restricts our comprehension of the mechanical alterations in plant cells under stress. With Polyethylene Glycol (PEG6000), we created a drought-like environment, and we used the Double Resonator Piezoelectric Cytometry (DRPC) method to dynamically and non-invasively track changes in the stress (ΔS) created and viscoelasticity (storage modulus G' and loss modulus G") of protoplasts and suspension cells of rice during drought stress. The findings demonstrate that, rice suspension cells and protoplasts react mechanically differently to 5%–15% PEG6000 stress, implying distinct resistance mechanisms. However, neither of them can withstand 25% PEG6000 stress, they respond mechanically similarly to 25% PEG6000 stress. The results of DRPC are further corroborated by the morphological alterations of rice cells and protoplasts observed under an optical microscope. To sum up, the DRPC technique functions as a precise cellular mechanical sensor and offers novel research tools for the evaluation of plant cell adversity and differentiating between the mechanical reactions of cells and protoplasts under abiotic stress.

Immune cells such as T cells and macrophages express α7 nicotinic acetylcholine receptors (α7 nAChRs), which contribute to the regulation of immune and inflammatory responses. Earlier findings suggest α7 nAChR activation promotes the development of regulatory T cells (Tregs) in mice. Using human CD4+ T cells, we investigated the mRNA expression of the α7 subunit and the human-specific dupα7 nAChR subunit, which functions as a dominant-negative regulator of ion channel function, under resting conditions and T cell receptor (TCR)-activation. We then explored the effects of the selective α7 nAChR agonist GTS-21 on proliferation of TCR-activated T cells and Treg development. Varied levels of mRNA for both the α7 and dupα7 nAChR subunits were detected in resting human CD+ T cells. mRNA expression of the α7 nAChR subunit was profoundly suppressed on days 4 and 7 of TCR-activation as compared to day 1, whereas mRNA expression of the dupα7 nAChR subunit remained nearly constant. GTS-21 did not alter CD4+ T cell proliferation but significantly promoted Treg development. These results suggest the potential ex vivo utility of GTS-21 for preparing Tregs for adoptive immunotherapy, even with high expression of the dupα7 subunit.

Dengue virus is a global health problem most prevalent in tropical and subtropical regions. However, after the approval of two vaccines, Dengvaxia, TV003/TV005 of Takeda, for its prevention, problems were reported, like enhanced risks of infection or less efficiency of protection. Since then, more struggles have been in demand for the development of better vaccines. Here, we conducted a new design through an in-silico strategy. Initially, epitopes were chosen based on their antigenicity, immunogenicity, and binding affinity with MHC molecule, while excluded with allergenicity, toxicity and potential risk of antibody dependent enhancement. Subsequently, a core antigen was constructed with selected epitopes and linked with distinct adjuvant proteins to achieve three candidate vaccines, PSDV-1~3. PSDV-2 was chosen for further validation based on their advantage in physicochemical and structural properties. With a panel of simulations, this artificial protein showed tight binding with pattern recognition receptors, good stability, robust immune induction, and ultimately was confirmed as a high quality vaccine candidate. The plasmid for its recombinant expression was then designed accordingly. With our new design, one more choice was obtained for the effective protection from Dengue virus. Further experimental validations are still require to confirm it protection capacity and safety.

Cell-culture meat is a novel concept to replace traditional meat produced from animals, and to satisfy rising food demands due to the world population growth. It is still a young field and requires to solve technical issues including cell sources and types, efficient culture for large scale production, taste and texture for customer satisfaction. The current review summarized traditional beef meat production and evaluation methods for customer satisfaction. In particular, serum biomarkers for beef meat evaluation are discussed, which can be applicated for cell-culture meat production.

French Guiana, located in the Guiana Shield, is a natural reservoir for many zoonotic pathogens that are of considerable medical or veterinary importance. Until now, there are few data available on the description of parasites circulating in this area, especially on protozoan belonging to the phy-lum Apicomplexa; conversely, the neighbouring countries describe a high parasitic prevalence in animals and humans. Epidemiological surveillance is necessary, as new potentially virulent strains may emerge from these forest ecosystems, such as Amazonian toxoplasmosis. However, there is no standard tool for detecting protozoa in wildlife. In this study, we developed Meat-Borne-Parasite, a high-throughput meta-barcoding workflow for detecting Apicomplexa based on Oxford Nanopore Technologies sequencing platform using the 18S gene of fourteen Apicomplexa-positive samples collected in French Guiana. Sequencing reads were then analysed with MetONTIIME pipeline. Thanks to a scoring rule, we were able to classify as Apicom-plexa-positive 10 samples out of 14 and reveal the presence of co-carriages. The same samples were also sequenced with Illumina platform, for validation purposes. On samples identified as Apicomplexa-positive by both platforms, a strong positive correlation at up to genus level was reported. Overall, the presented workflow represents a reliable method for Apicomplexa detec-tion, which may pave the way for more comprehensive biomonitoring of zoonotic pathogens.

Maternal-derived immunity is a critical component for survival and success of offspring in pigs to protect from circulating pathogens like Type 2 Porcine Reproductive and Respiratory Syndrome Virus (PRRSV-2). The purpose of this study was to investigate the transfer of anti-PRRSV immunity to piglets from gilts that received modified-live virus (MLV) alone (TRT 0), or in combination with one of two autogenous inactivated vaccines (AIVs, TRT 1+2). Piglets from these gilts were challenged with the autogenous PRRSV-2 strain at two weeks of age and their adaptive immune response (IR) was evaluated until 4 weeks post inoculation (wpi). The systemic humoral and cellular IR was analyzed in the pre-farrow gilts, and in piglets, pre-inoculation, and at 2- and 4-wpi. Both AIVs partially protected the piglets with reduced lung pathology and increased weight gain; TRT 1 also lowered piglet viremia best explained by the AIV-induced production of neutralizing antibodies in gilts and their transfer to the piglets. In piglets, pre-inoculation, the main systemic IFN-γ producers were CD21α+ B cells. From 0 to 4 wpi, the role of these B cells declined and CD4 T cells became the primary systemic IFN-γ producers. In lungs, CD8 T cells were the primary and CD4 T cells the secondary IFN-γ producers including a novel subset of porcine CD8α-CCR7- CD4 T cells, potentially terminally differentiated CD4 TEMRA cells. In summary, this study demonstrates that maternal AIV vaccination can improve protection of pre-weaning piglets against PRRSV-2; it shows the importance of transferring neutralizing antibodies to piglets; and it introduces two novel immune cell subsets in pigs – IFN-γ producing CD21α+ B cells and CD8α-CCR7- CD4 T cells.

Reconstructing the Tree of Life remains a central goal in biology. Early methods, relying on small numbers of morphological or genetic characters, often yielded conflicting evolutionary histories, undermining confidence in the results. Investigations based on phylogenomics, which use hundreds to thousands of loci for phylogenetic inquiry, have provided a clearer picture of life's history, but certain branches remain problematic. To resolve difficult nodes on the Tree of Life, two recent studies tested the utility of synteny, the conserved collinearity of orthologous genetic loci in two or more organisms, for phylogenetics. Synteny exhibits compelling phylogenomic potential while also raising new challenges. We identify and discuss specific opportunities and challenges that bear on the value of synteny data and other rare genomic changes for phylogenomic studies. Synteny-based analyses of highly contiguous genome assemblies mark a new chapter in the phylogenomic era and the quest to reconstruct the Tree of Life.

Uterine leiomyosarcoma (LMS) is a rare and aggressive form of uterine cancer, with a poor prognosis and high number of uterine cancer-related deaths. Chimeric Antigen Receptor (CAR) T-cell therapy is an immunotherapy approach to antigen specific of cancer cell, thereby enhancing the immune system's ability to target and destroy cancer cells. This study aims to investigate the potential of targeting differentially expressed genes (DEGs) as a novel therapeutic strategy using CAR T-cell technology in LMS. Genome datasets were obtained from NCBI-GEO database, Of the five datasets, genes that experienced significant overexpression in at least three datasets were categorized as DEGs, and DEGs were evaluated for protein localization, Gene Ontology, bioactivity, interaction, and overexpression. The results identified 25 DEGs, with ten of them expressed on the plasma membrane; four of them—HMMR, KIF20A, PRC1, and ZWINT—were part of the main protein network derived from the 25 DEGs. The dominant bioactivity of these PMGs involves influencing the cell cycle, particularly processes related to chromosome segregation. In conclusion, HMMR, KIF20A, PRC1, and ZWINT are high-potential DEGs as candidates for tumor-associated antigen CAR T-cell therapy. Further research, both in vitro and in vivo, is needed to enhance the validity of these findings.

In spite of prevalence gaps in several micronutrients supporting immune function, significance of their deficits/supplementation for efficacy of vaccines is underinvestigated. Thus, influence of supplementation combining vitamins C and D, zinc, selenium and manganese, and N-acetyl-cysteine on mouse IgG responses and underlying mechanisms to seasonal quadrivalent influenza vaccine (QIV) was investigated. QIV was given in two doses (28 days apart). The supplementation starting 5 days before the first injection increased the total serum IgG titre, through stimulation of germinal centre (GC) reaction in secondary lymphoid organs (SLOs), as indicated by increase in the frequency of GC B cells and follicular CD4+ T helper (Th) cells, and IL-21-producing Th cells. Additionally, the supplementation “optimized” IgG response following the second QIV injection by supporting more favorable (in respect to virus clearance) IgG2a response through favoring Th1 differentiation as indicating by Th1 (INF-γ) /Th2 (IL-4) signature cytokine level ratio upon QIV restimulation in SLO cell cultures. This most likely reflected partly their antioxidant action (as indicated by redox status analyses) on Th cell differentiation. Thus, the study forms solid base for further research aimed at repurposing use this safe and inexpensive micronutrient combination as an adjuvant for virus influenza vaccine.

Cutaneous T-cell lymphomas (CTCLs) are a heterogeneous group of T-cell lymphomas characterised by high relapse rates and no curative treatments unless the allogeneic stem cell transplantation. The main complication in the management of this kind of malignancy is the variability that characterises the genetic and clinical features among the CTCL subtypes. JAK/STAT, MAPK/ERK, PI3K/Akt, and NF-kB are those signalling pathways that are found altered in CTCL and that are responsible for promoting both T-cell malignancy and the pro-tumorigenic microenvironment. Thus, targeting key players of these pathways can be an advantageous therapeutic option for CTCL. In this review, we aim to summarise the different approaches that precisely inhibit the kinases of each cited signalling. JAK inhibitors seem to be the most promising kinase inhibitors for CTCL. However, adverse events have been reported especially in patients with immunosuppression or an underlying autoimmune disease. More studies are needed, especially clinical trials, to investigate the benefits of these drugs for the treatment of cutaneous T-cell lymphomas.

The principal barrier to an HIV-1 cure is the persistence of infected cells harboring replication-competent proviruses despite antiretroviral therapy (ART). HIV-1 transcriptional suppression, referred to as viral latency, is foremost among persistence determinants, as it allows infected cells to evade the cytopathic effects of virion production and killing by cytotoxic T lymphocytes (CTL) and other immune factors. HIV-1 persistence is also governed by cellular proliferation, an innate and essential capacity of CD4+ T cells that both sustains cell populations over time and enables a robust directed response to immunological threats. Yet when HIV-1 infects CD4+ T cells, this capacity for proliferation can counterproductively enable surreptitious HIV-1 propagation without the deleterious effects of viral gene expression in latently infected cells. Over time on ART, the HIV1 reservoir is shaped by both persistence determinants, with selective forces most often favoring clonally expanded infected cell populations harboring transcriptionally quiescent proviruses. Moreover, if HIV latency is incomplete or sporadically reversed in clonal infected cell populations that are replenished faster than they are depleted, such populations could both persist indefinitely and contribute to low-level persistent viremia during ART and viremic rebound if treatment is withdrawn. In this review, select genetic, epigenetic, cellular, and immunological determinants of viral transcriptional suppression and clonal expansion of HIV-1 reservoir T cells, interdependencies among these determinants, and implications for HIV-1 persistence will be presented and discussed.

Cutaneous T cell lymphomas (CTCLs) are caused by malignant clonal proliferation of skin-tropic T cells. Most patients have an indolent disease course managed with skin-directed therapies, while some entities, or in advanced stages of disease, have aggressive progression and poor survival. To efficiently treat CTCL consistent entity markers are needed to prevent the delay in diagnosis and to provide disease specific treatment to patients. Recently, the introduction of high throughput parallel sequencing methods resulted in identification of numerous genetic and ep-igenetic alterations affecting the transcriptome of CTCL cells. In this review, most relevant genes, including TOX, CADM1, PLS3, DNM3, CXCL13, PD-1, BCL11B and TMEM244 are reported that are specifically expressed in CTCL. Upon verification their specificity and sensitivity in larger studies, their altered expression will be able to be recognized as novel biomarkers, that can im-prove the early diagnosis of CTCL.

Pulmonary hypertension (PH) is a progressive and potentially fatal complication of sickle cell disease (SCD) affecting 6-10% of adult SCD patients. Various mechanisms and theories have been evaluated to explain the pathophysiology of the disease. However, questions remain, particularly regarding the clinical heterogeneity of the disease in terms of symptoms, complications, and survival. Beyond the classical mechanisms that have been thoroughly investigated and include hemolysis, nitric oxide availability, endothelial disorders, thrombosis, and left heart failure, attention is focused nowadays on the potential role of the genes involved in such processes. Potential candidate genes are investigated through next-generation sequencing, with the TGF-β pathway being the initial target. This field of research may also provide novel targets for pharmacologic agents in the future as is already the case with idiopathic PH. The collection and processing of data and samples from multiple centers can yield safe results that will allow a better understanding of SCD-related PH as a part of the disease’s clinical spectrum. The following review attempts to capture the most recent findings of studies on gene polymorphisms that have been associated with PH in SCD patients.

Music has the innate potential to reach all parts of the brain, stimulates certain brain areas which are not achievable through other modalities. Music Therapy (MT) is being used for more than a century to treat individuals who needs personalized care. MT optimizes motor, speech and language responsibilities of the brain and improves cognitive performance. Pervasive developmentdisorder (PDD) is a multifaceted, neuro developmental disorder and autism spectrum disorder (ASD) comes under PDD, which is defined by deficiencies in three principal spheres: social connection with others, communicative and normal movement skills. The conventional imaging studies illustrate reduced brain area connectivity in people with ASD, involving selected parts of the brain cortex. People with ASD express much interest in musical activities which engages the brain network areas and improves communication and social skills.The main objective of this review is to analyze the potential role of MT in treating the neurological conditions, particularly ASD. Evidence based studies have reported the extensive therapeutic application of music on various part of the brain in a nonverbal child with autism through hearing or making music.Hence we hypothesized that MT intervention can improve the communication capacity in people with ASD, than customary neurorestoration therapy alone.

The observation that certain therapeutic strategies for targeting inflammation benefit patients with distinct immune-mediated inflammatory diseases (IMIDs) is exemplified by the success of TNF blockade in conditions including rheumatoid arthritis, ulcerative colitis and skin psoriasis, albeit only for subsets of individuals with each condition. This suggests intersecting "nodes" in inflammatory networks at a molecular and cellular level may drive and/or maintain IMIDs, being “shared” between traditionally distinct diagnoses without mapping neatly to a single clinical phenotype. In line with this proposition, integrative tumour tissue analyses in oncology have highlighted novel cell states acting across diverse cancers, with important implications for precision medicine. Drawing upon advances in the oncology field, this narrative review will first summarise learnings from the Human Cell Atlas in health as a platform for interrogating IMID tissues. It will then review cross-disease studies to date that inform this endeavour, before considering future directions in the field.

Although Mast cells are known as key drivers of type I allergic reactions, there is increasing evidence for their critical role in host defense. MCs do not only play an important role in initiating innate immune responses, but also influence the onset, kinetic and amplitude of the adaptive arm of immunity, or fine-tune the mode of the adaptive reaction. Intriguingly, MCs have been shown to affect T cell activation by direct interaction or indirectly by modifying properties of antigen-presenting cells, and can even modulate lymph node-borne adaptive responses remotely from the periphery. In this review, we provide a summary of recent findings that explain how MCs act as a link between the innate and the adaptive immunity, all the way from sensing inflammatory insult to orchestrating the final outcome of the immune response.

We have designed cell penetrating peptides that target the leucine zipper transcription factors ATF5, CE-BPB and CEBPD and that promote apoptotic death of a wide range of cancer cell types, but not normal cells, in vitro and in vivo. While such peptides have the potential for clinical application, their mechanisms of action are not fully understood. Here, we show that one such peptide, Dpep, compromises glucose uptake and glycolysis in a cell-context-dependent manner (in about 2/3 of cancer lines assessed). These actions are dependent on induction of tumor suppressor TXNIP (thioredoxin interacting protein) mRNA and protein. Knockdown studies show that TXNIP significantly contributes to apoptotic death in those cancer cells in which it is induced by Dpep. The metabolic actions of Dpep on glycolysis led us to explore combinations of Dpep with clinically approved drugs metformin and atovaquone that inhibit oxidative phosphorylation and that are in trials for cancer treatment. Dpep showed additive to synergistic activities in all lines tested. In summary, we find that Dpep induces TXNIP in a cell-context-dependent manner that in turn sup-presses glucose uptake and glycolysis and contributes to apoptotic death of a range of cancer cells.

The prospect of drinking water serving as a conduit for gut bacteria, artificially selected by disinfection strategies and lack of monitoring at the point of use, is concerning. Certain opportunistic pathogens, notably some nontuberculous mycobacteria (NTM), often exceed coliform bacteria levels in drinking water, posing safety risks. NTM and other microbiota resist chlorination and thrive in plumbing systems. When inhaled, opportunistic NTM can infect the lungs of immunocompromised or chronically ill patients, and the elderly, primarily postmenopausal women. When ingested with drinking water, NTM often survive stomach acidity, reach the intestines, migrate to other organs using immune cells as vehicles, potentially colonizing tumor tissue, including in breast cancer. The link between the microbiome and cancer is not new, yet the recognition of intratumoral microbiomes is a recent development. Breast cancer risk rises with age, and NTM infections emerged as a concern among breast cancer patients. In addition to studies hinting at a potential association between chronic NTM infections and lung cancer, NTM have also been detected in breast tumors at levels higher than normal adjacent tissue. Evaluating the risks of continued ingestion of contaminated drinking water is paramount, especially given the ability of various bacteria to migrate from the gut to breast tissue via entero-mammary pathways. This underscores a pressing need to revise water safety monitoring guidelines and delve into hormonal factors, which includes addressing the disproportionate impact of NTM infections and breast cancer on women and examining the potential health risks posed by the cryptic and unchecked microbiota from drinking water.

Background: Recently we demonstrated that Astragalus polysaccharide (PG2), the active ingredient in dried roots of astragalus membranaceus, ameliorates cancer symptom clusters and improve quality of life (QoL) in patients with metastatic disease by modulating inflammatory cascade, against the background that inflammatory cells including macrophages, dendritic cells (DCs), and cytotoxic T lymphocytes (CTLs) in tumor initiation, metastasis, and progression. Nevertheless, the role of PG2 in the modulation of anticancer immunogenicity and therapeutic response remains relatively underexplored and unclear. Purpose: The present study investigates how and to what extent PG2 modulates cellular and biochemical components of the inflammatory cascade, enhance anticancer immunity, and the therapeutic implication of same in patients with lung cancer. Methods and Results: Herein, we demonstrated that PG2 significantly increased the M1/M2 macrophage polarization ratio in non-small cell carcinoma (NSCLC) H441 and H1299 cells. This PG2-induced preferential pharmacologic up-regulation of tumoral M1 population in vitro, positively correlated with the downregulation of tumor-promoting IL-6 and IL-10 expression in NSCLC cell-conditioned medium, with concomitant marked inhibition of cell proliferation, clonogenicity and tumorsphere formation. Our ex vivo results, using clinical sample from our NSCLC cohort, demonstrated that PG2 also promoted the functional maturation of DCs with consequent enhancement of T cell-mediated anticancer immune responses. Consistent with the in vitro and ex vivo results, our in vivo studies showed that mice treated with PG2 exhibited significant time-dependent depletion of the tumor-associated M2 population, synergistically enhanced the anti-M2-based anticancer effect of cisplatin, and inhibition of xenograft tumor growth in the NSCLC mice models. Moreover, in the presence of PG2, cisplatin-associated dyscresia and weight-loss was markedly suppressed. Conclusion: These results do indicate a therapeutically-relevant role for PG2 in modulating the M1/M2 macrophage pool, facilitating DC maturation, and synergistically enhancing the anticancer effect of conventional chemotherapeutic agent, cisplatin; thus laying the foundation for further exploration of the curative relevance of PG2 as surrogate immunotherapy and/or clinical feasibility of its use for maintenance therapy in patients with lung cancer.

Over the last decades, cellular immunotherapy has revealed its curative potential. However, the inherent physiological characteristics of immune cells can limit the potency of this approach. Best defined in T cells, dysfunction associated with terminal differentiation, exhaustion, senescence, and activation-induced cell death undermine adoptive cell therapies. In this review, we concentrate on how the multiple mechanisms that articulate the various forms of immune dysfunction impact cellular therapies primarily involving conventional T cells, but also other lymphoid subtypes, in addition to the various strategies put in place to circumvent these effects. The repercussions of immune cell dysfunction across the full life cycle of cell therapy, from the source material, during manufacturing, and after adoptive transfer are discussed. Applicable to cellular products prepared from native and unmodified immune cells, as well as genetically engineered therapeutics, the understanding and potential modulation of dysfunctional features is key to the development of improved cellular immunotherapies.

Background: Despite advances in the treatment of hepatocellular carcinoma (HCC) over the last few decades, treatment opportunities for patients with HCC remain limited. HCC is the most common form of liver cancer, accounting for approximately 90% of all cases worldwide. Moreover, apart from the current pharmacological interventions, hepatic resection and liver transplantation are the mainstay curative approaches for patients with HCC. Methods: This systematic review included phase I, II, III, and IV clinical trials (CTs) and randomized controlled trials (RCTs) on current treatments for patients with HCC in an Asian population (2013–2023). A total of 427 articles were screened, and 184 non-duplicate publications were identified. After screening titles and abstracts, 96 publications were excluded, and another 28 were excluded after full-text screening. The remaining 60 eligible RCTs/CTs were finally included. Results: Sixty clinical trials fulfilled our inclusion criteria and screened 36 drugs as monotherapy or combination therapy for HCC. Most studies used sorafenib alone or in combination with any of the treatment regimens. Lenvatinib or atezolizumab with bevacizumab was used for HCC after initial sorafenib treatment. Eighteen studies compared the efficacy of sorafenib with that of other drugs, including lenvatinib, cabozantinib, tepotinib, tigatuzumab, linifanib, erlotinib, resminostat, brivanib, tislelizumab, selumetinib, and refametinib. Conclusion: This study provides comprehensive insights into effective treatment interventions for HCC in Asian populations. The overall assessment indicated that sorafenib alone or in combination with atezolizumab and bevacizumab has been the first treatment choice in the past decade to achieve better outcomes in patients with HCC in an Asian population

The emergence of bispecific antibodies has transformed cancer immunotherapy, highlighting increased clinical efficacy, especially in hematological malignancies. These innovative molecules uniquely target two distinct tumor antigens or separate epitopes simultaneously, demonstrating potent antitumor activity across various cancers. Despite their promise, challenges like rapid drug clearance, off-target effects, and cytokine release syndrome hinder their widespread therapeutic application. Recent engineering advancements in bispecific antibody systems aim to overcome these challenges, broadening therapeutic coverage. This review offers insights into the latest clinical and preclinical progress in bispecific immunotherapy, outlining key challenges faced by the technique, and exploring emerging strategies to address these obstacles.

Immune surveillance and adaptive immune responses, involving continuously circulating and tissue-resident T-lymphocytes, provide host defense against infectious agents and possible malignant transformation while avoiding autoimmune tissue damage. Activation, migration, and deployment of T-cells to affected tissue sites are crucial for mounting an adaptive immune response. An effective adaptive immune defense depends on the ability of T-cells to dynamically reprogram their metabolic requirements in response to environmental cues. Inability of the T-cells to adapt to specific metabolic demands may skew cells to become either hyporesponsive creating immunocompromised conditions or hyperactive causing autoimmune tissue destruction. Here, we review maladaptive T-cell metabolic fitness that can cause autoimmune diseases and discuss how T-cell metabolic programs can potentially be modulated to achieve therapeutic benefits.

Lupus nephritis (LN) is a severe complication of systemic lupus erythematosus (SLE) and is considered one of the leading causes of mortality. Multiple immunological pathways are involved in the pathogenesis of SLE, which makes it imperative to deepen our knowledge about this disease's immunopathological complexity and explore new therapeutic targets. Since an altered redox state contributes to immune system dysregulation, this document briefly addresses the role of oxidative stress (OS), oxidative DNA damage, antioxidant enzymes, mitochondrial function, and mitophagy in SLE and LN. Although adaptive immunity's participation in the development of autoimmunity is undeniable, increasing data emphasize the importance of innate immunity elements, particularly the Toll-like receptors (TLRs) that recognize nucleic acid ligands, in inflammatory and autoimmune diseases. Here, we discuss the intriguing role of TLR7 and TLR9 in developing SLE and LN. Also included are the essential characteristics of conventional treatments and some other novel and little-explored alternatives that offer options to improve renal function in LN.

Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a promising chemotherapeutic agent because of its selective apoptotic action on cancer cells. However, resistance to TRAIL-induced apoptosis remains a challenge in many cancers. The gintonin-enriched Panax ginseng extract fraction (GEF) has diverse pharmacological benefits. We explored the combined efficacy of GEF and TRAIL in inducing apoptosis in human renal cell carcinoma (RCC) cells. The effect of GEF treatment on viability, clonogenic potential, wound healing, and TRAIL-induced apoptotic signaling of RCC cells was studied in vitro. Our investigation revealed that GEF pre-treatment sensitized RCC cells to TRAIL-induced apoptosis, as evidenced by DNA fragmentation and cell proliferation, colony formation, and migration inhibition. This sensitization was linked to the upregulation of death receptors 4 and 5 and alterations in apoptotic protein expression; notably, decreased expression of Mu-2-related death-inducing gene, a novel anti-apoptotic protein. Our findings underscore the necessity of caspase activation for GEF/TRAIL-induced apoptosis using the pan-caspase inhibitor Z-VAD-FMK. It demonstrates that GEF sensitizes human RCC cells to TRAIL-induced apoptosis by upregulating DR4/5 and modulating apoptotic protein expression. These findings suggest a promising strategy for overcoming TRAIL resistance in cancer therapy and highlight the potential of GEF as a valuable adjunct to TRAIL-based treatments.

The anatomy of mature vertebrate hearts is marked by a looped design, which is roughly characterized by two components: (1), s-shaped (sigmoid) routing of the cardiac flow path(s), and (2,) bilaterally asymmetric (chiral) routing of the cardiac flow path(s). The looped heart design is regarded as a phylogenetically conserved feature among vertebrates and is thought to represent a significant determinant of the cardiac pumping function. It evolves during the embryonic period of development by a morphogenetic process called “cardiac looping”. During the past decades, remarkable progress has been made in the uncovering of the genetic, molecular, and biophysical factors contributing to cardiac looping. Thereby, a special focus was directed on the evolution of a bilaterally asymmetric (chiral) heart configuration, which is said to play a central role in the determination of the alignments and separations of the pulmonary and systemic flow paths in the multi-chambered hearts of tetrapods. In contrast to the recent progress made in uncovering of the biological driver of cardiac looping, our present knowledge about the functional consequences of cardiac looping is at an immature state. This article provides an overview and discussion of the currently available information about the looped design of vertebrate hearts and its functional implications.

MALT1 (mucosa-associated lymphoid tissue lymphoma translocation protein 1) serves as a pivotal mediator for NF-κB activation in response to a wide spectrum of transmembrane receptor stimuli. In the present study, a homolog of MALT1 is cloned from the Pacific white shrimp (Litopenaeus vannamei) named LvMALT1, and its potential function in shrimp innate immunity are explored. The open reading frame of LvMALT1 is 2364 bp that encodes 787 amino acids. The predicted LvMALT1 protein structure comprises a death domain, three immunoglobulin domains, and a caspase-like domain, exhibiting remarkable similarity to other homologs. LvMALT1 is a cytoplasmic-localized protein and could interact with LvTRAF6. Overexpression of LvMALT1 induces the activation of promoter elements governing the expression of several key antimicrobial peptides (AMPs), including Penaeidins (PENs) and Crustins (CRUs). Conversely, silencing of LvMALT1 leads to a reduction in the phosphorylation levels of Dorsal and Relish, along with a concomitant decline in the in vivo expression levels of multiple AMPs. Furthermore, LvMALT1 is prominently upregulated in response to a challenge by the white spot syndrome virus (WSSV), facilitating the NF-κB-mediated expression of AMPs as a defense against viral infection. Taken together, we identified a MALT1 homolog from shrimp L. vannamei, which plays a positive role in the TRAF6/NF-κB/AMPs axis mediated innate immunity.

CD4+ T cells orchestrate and regulate immunity within jawed vertebrates, yet our understanding of their evolution, development, and cellular physiology has only begun to be unearthed in the past few decades. Discoveries of genetic diseases that ablate this cellular population have provided insight into their critical functions while transcriptomics, proteomics, and highresolution microscopy have recently revealed new insights into CD4+ T cell anatomy and physiology. This article compiles historical, microscopic, and multi omics data which can be used as a reference atlas to dissect cellular physiology within these influential cells and further understand pathologies like HIV infection that inflict human CD4+ T cells.

Adult T-cell leukemia (ATL) is an aggressive hematologic disease caused by human T-cell leukemia virus type 1 (HTLV-1) infection. Various animal models of HTLV-1 infection/ATL have been established to elucidate the pathogenesis of ATL and develop appropriate treatments. For analyses employing murine models, transgenic and immunodeficient mice are used because of the low infectivity of HTLV-1 in mice. HTLV-1 Tax and HBZ transgenic mice spontaneously develop tumors, and roles for both Tax and HBZ in cell transformation and tumor growth have been established. Severely immunodeficient mice were able to engraft ATL cell lines and have been used in preclinical studies of candidate molecules for the treatment of ATL. HTLV-1-infected humanized mice with an established human immune system are a suitable model to characterize cells in the early stages of HTLV-1 infection. This review outlines the characteristics of mouse models of HTLV-1 infection/ATL and describes progress made in elucidating the pathogenesis of ATL and developing related therapies using these mice.

Human Rhinovirus (HRV) is the most common cause of upper respiratory infections and exacerbations of asthma. In this work, we selected 14 peptides (6 from HRV A and 8 from HRV C) encompassing potential CD4 T cell epitopes. Peptides were selected for being highly conserved in HRV A and C serotypes and predicted to bind to multiple HLA II molecules. We found positive T cell recall responses by IFNγ-ELISPOT assays to 8 peptides, validating 7 of them (3 from HRV A and 4 from HRV C) as CD4 T cell epitopes through intracellular cytokine staining assays. Additionally, we verified their promiscuous binding to multiple HLA II molecules by quantitative binding assays. According to their experimental HLA II binding profile, the combination of all these 7 epitopes could be presented and recognized by > 95 % of the world population. We actually determined IFNγ responses to a pool encompassing these CD4 T cell epitopes by intracellular cytokine staining, finding positive responses in 29 out of 30 donors. The CD4 T cell epitopes identified in this study could be key to monitor HRV infections and to develop peptide-based vaccines against most HRV A and C serotypes.

High pathogenicity avian influenza (HPAI) H5N1 clade 2.3.4.4b continues to have a substantial impact on wildlife, globally. A recent study has described the putative detection of HPAI in clinically healthy penguins, and those which were fitted with satellite tags reportedly engaged in apparently normal foraging behaviour in the months following sample collection. Herein we investigate the diagnostic approach utilised, and reveal that while the authors likely did detect subtype H5 influenza A virus, the most parsimonious conclusion is that they detected low pathogenicity H5 rather than HPAI H5N1. In response, we have provided an overview key considerations when selecting a diagnostic and outline published diagnostic assays that should be considered for future studies.

T cells follow a triphasic distinct pathway of activation, proliferation and differentiation before becoming functionally and phenotypically ‘exhausted’ in settings of chronic infection, autoimmunity and in cancer. Exhausted T cells progressively lose canonical effector functions, exhibit altered transcriptional networks and epigenetic signatures and gain constitutive expression of a broad coinhibitory receptor suite. This review outlines recent advances in our understanding of exhausted T cell biology and examines cellular and molecular mechanisms by which a state of dysfunction or exhaustion is established, and mechanisms by which exhausted T cells may still contribute to pathogen or tumour control. Further, this review describes our understanding of exhausted T cell heterogeneity and outlines the mechanisms by which checkpoint blockade differentially engages exhausted T cell subsets to overcome exhaustion and recover T cell function.

Despite exhaustive studies, researchers have made little progress in the field of adoptive cellular therapies for relapsed-refractory acute myeloid leukemia (AML), unlike the notable uptake for B cell malignancies. Various single antigen targeting chimeric antigen receptor (CAR) T cell Phase I trials have been established worldwide and have recruited approximately 100 patients. The high heterogeneity at the genetic and molecular levels within and between AML patients resembles a black hole: a great gravitational field that sucks in everything, considering only around 30% of patients show a response but with consequential off-tumor effects. It is obvious that a new point of view is needed to achieve more promising results. This review first introduces the unique therapeutic challenges of not only CAR T cells but also other adoptive cellular therapies in AML. Next, recent single cell sequencing data for AML to assess somatically acquired alterations at the DNA, epigenetic, RNA and protein levels are discussed to give a perspective on cellular heterogeneity, intercellular hierarchies, and the cellular ecosystem. Finally, promising novel strategies are summarized, including more sophisticated next-generation CAR T, TCR-T and CAR-NK therapies; approaches to tailor the microenvironment and target neoantigens; and allogeneic approaches.

Coccomyxa subellipsoidea KJ (C-KJ) is a green alga with unique immunoregulatory characteristics. Here, we investigated the mechanism underlying the modification of T cell function by C-KJ components. The water-soluble extract of C-KJ was fractionated into protein (P) and sugar (S) fractions [acidic (AS), basic (BS), and neutral (NS)]. These fractions were used for the treatment of peripheral blood mononuclear cells stimulated with toxic shock syndrome toxin-1. Transcriptome analysis revealed that both P and AS enhanced the expression of the genes encoding metallothionein (MT) family proteins, inflammatory factors, and T helper (Th) 17 cytokine and suppressed that of those encoding Th2 cytokines in stimulated T cells. The kinetics of MT1 and MT2A gene expression showed a transient increase in MT1 and maintenance of MT2A mRNA after T cell stimulation in the presence of AS. The kinetics of Th17-related cytokine secretion in the early period were comparable to those of MT2A mRNA. Furthermore, our findings revealed that static, a STAT-3 inhibitor, significantly suppressed MT2A gene expression. These findings suggest that the expression of MTs is involved in the immune regulatory function of C-KJ components, which is partially regulated by Th17 responses, and may help develop innovative immunoregulatory drugs or functional foods.

Cell-penetrating peptides (CPPs), a group of small peptides capable of promoting the transport of molecular cargo across the plasma membrane, have become important tools in promoting the cellular uptake of exogenously delivered macromolecules. GV1001, a peptide derived from a reverse-transcriptase subunit of telomerase (hTERT) and developed as a vaccine against various cancers, reportedly has unexpected CPP properties. Unlike typical CPPs, such as the HIV-1 TAT peptide, GV1001 enabled the cytosolic delivery of macromolecules such as proteins, DNA and siRNA via extracellular heat shock protein 90 (eHSP90) and 70 (eHSP70) complexes. The eHSP-GV1001 interaction may have biological effects in addition to its cytosolic delivery function. GV1001 was originally designed as a MHC class II-binding cancer epitope, but its CPP properties may contribute to its strong anti-cancer immune response relative to other telomerase peptide-based vaccines. Cell signaling via eHSP-GV1001 binding may lead to unexpected biological effects, such as direct anticancer or antiviral effects. In this review, we focus on the CPP effects of GV1001 bound to eHSP90 and ehsp70.

Antler is the fastest growing tissue. Because is based on proto-oncogenes, to avoid the risk of cancer, antlers evolved strong anticancer mechanisms, and thus its extract (DVA) is effective also against the few human tumours studied so far. We assessed whether DVA is a general anticancer compound testing direct effects in cells of different tumours: glioblastoma (GBM), colorectal and breast cancer, and leukaemia. DVA reduced viability of tumour but not healthy cells. Mobility decreased at least at the longest test (72 h). Intraperitoneal/oral 200 mg DVA/kg administration in GBM xenograft mice for 28 d reduced tumour weight 66.3% and 61.4% respectively, and also spleen weight. In addition, tumours treated with DVA showed symptoms of liquefactive necrosis. Serum cytokines showed DVA up-regulated factors related with tumour fighting and down-regulated those related with inducing immune tolerance to the tumour. DVA shows general anticancer effects in the lines tested and, in GBM mice, also strong indirect effects apparently mediated by the immune system.

Splenic micronodular T-cell/histiocyte-rich large B-cell lymphoma is possibly derived from nodal T-cell/histiocyte-rich large B-cell lymphoma; however, a transition between the nodal and splenic micronodular forms has not been described to date. Of note, the only lymph nodes to be involved in association with the splenic micronodular pattern of the disease are the splenic hilar lymph nodes, and that, with partial involvement only. Kan et al, in their series of articles, have raised the possibility that corticosteroids, when prescribed prior to splenectomy, cause histopathological and functional modulations (apoptosis, necrosis, tissue shrinkage), which modify or even obscure the diagnostic morphological features. The indications for glucocorticoid therapy are either related to the suspected lymphoma, or else to other comorbidities, like asthma and autoimmune disorders. We propose that patients with the splenic, rather than nodal subset of the disease are likely to have been prescribed corticosteroids prior to histopathologic examination of the involved tissue, causing disparate morphologies in the spleen. Apoptosis, as induced by corticosteroids, is hypothesized as the major mechanism initiating the histopa-thological and functional changes in the splenic micronodular variant of our patients.

A flavonoid Astragalin (kaempferol-3-O-β-D-glucopyranoside, Ast) has several biological activities including anti-oxidant, anti-HIV, and anti-allergic effects. Nonetheless, its insolubility in hydrophilic solvents imposes restrictions on its therapeutic applications. In this study, we investigated the effects of water-soluble astragalin-galactoside (kaempferol-3-O- β-D-isomaltotrioside, Ast-Gal) on dendritic cell (DC) maturation and T helper (Th) cell-mediated immune responses. Ast-Gal significantly increased maturation and activation of DCs through up-regulation of surface markers, such as CD80, CD86, and MHC II in a dose-dependent manner, while Ast had little effects. Also, Ast-Gal-treated DCs markedly secreted immune-stimulating cytokines such as IL-1β, IL-6, and IL-12. Importantly, Ast-Gal strongly increased expression of IL-12, a polarizing cytokine of Th1 cells. In a co-culture system of DCs and CD4+ T cells, Ast-Gal-treated DCs preferentially differentiates naïve CD4+ T cells into Th1 cells. The addition of neutralizing IL-12 mAb to cultures of Ast-Gal-treated DCs and CD4+ T cells significantly increased IFN- γ production, thereby indicating that Ast-Gal-stimulated DCs enhance the Th1 response through IL-12 production by DCs. Injection with Ast-Gal-treated DCs in mice increased IFN-γ-secreting Th1 cell population. Collectively, these findings indicate that hydrophilically modified astragalin can enhance Th1-mediated immune responses via DCs, and point to a possible application of water-soluble astragalin-galactoside as an immune adjuvant.

Background: Cell-free DNA (cfDNA) analysis has become a promising tool for diagnosis, prognosis and monitoring of lymphoma cases. Until now, research in this area has mainly focused in aggressive lymphomas with scanty information from other lymphoma subtypes. Methods: We selected 256 patients diagnosed with lymphomas including a large variety of B-cell and T-cell non-Hodgkin and Hodgkin lymphomas and quantified cfDNA from plasma at the time of diagnosis. We further selected 49 large B cell lymphomas (LBCL) and analyzed cfDNA levels at diagnosis (pre-therapy) and after therapy. In addition, we performed NGS in cfDNA and tissue in this cohort of LBCL. Results: Lymphoma patients showed a statistically significant higher cfDNA concentration than healthy controls (mean 53.0 ng/mL vs 5.6 ng/mL, p <0.001). The cfDNA concentration correlated with lymphoma subtype, lactate dehydrogenase, International Prognostic Index (IPI) score, Ann Arbor (AA) and B-symptoms. In 49 LBCL cases, the cfDNA concentration decreased after therapy in cases who achieved complete response (CR), and increased in non-responders. The median cfDNA at diagnosis of patients who achieved CR and later relapsed was higher (81.5 ng/mL) compared with levels of those who did not (38.6 ng/mL). A concordance of 84% was observed between NGS results in tumor and cfDNA samples. Higher VAF in cfDNA correlated with advanced stage and bulky disease. Conclusions: cfDNA analysis can be easily performed in almost all lymphoma cases. The cfDNA concentration correlated with the characteristics of aggressiveness of the lymphomas and in LBCL with the response achieved after therapy. These results support the utility of cfDNA analysis as a complementary tool in the management of lymphoma patients.

The ongoing SARS-CoV-2 pandemic has raised concerns surrounding immunological protection against the virus, particularly for people with inborn errors of immunity (IEI). While COVID-19 vaccination induces robust antibody, memory B-cell, and T-cell responses in healthy individuals, how well vaccination protects people with IEI against infection and severe disease remains unclear – especially in the context of new viral variants and vaccine formulations – leading to anxiety, ongoing self-isolation, and repeated vaccination with limited evidence of increased efficacy. Whilst most people with IEI generate some level of cellular and/or humoral immunity to COVID-19 vaccination, the level of protection and durability of the response are unclear. Alongside vaccination, antibody-based therapeutics are aimed at limiting infection and severe disease in this cohort. Immunoglobulin replacement therapy (IgRT) provides passive immunity in antibody-deficient individuals. However, to successfully prevent SARS-CoV-2 infection, a sufficient number of neutralizing antibodies must be present in product. While antibodies against circulating variants are eventually present in IgRT products (both from natural infection and vaccination of the donors), evidence of their capacity to recognize new variants is limited. Furthermore, while antibody-based pre- and post-exposure prophylaxis can be effective, they are susceptible to decreased efficacy in the context of variant evolution. This review provides an in-depth overview of current knowledge about COVID-19 vaccine efficacy in IEIs, the efficacy of SARS-CoV-2-specific antibody products, and knowledge and technological advances required for continued protection of people with IEI.

Clinical, pathological, and imaging evidence in multiple sclerosis (MS) shows that inflammation starts early and progresses with age. B cells play a central role in this process, contributing to cytokine production, defective regulatory functions, and abnormal immunoglobulin production, even in the central nervous system. Anti-CD20 (aCD20) therapies, which deplete CD20+ B cells, are effective for both relapsing-remitting (RR) and progressive-relapsing (PR) MS. While effective against MS symptoms and lesions detectable by magnetic resonance imaging, aCD20 therapies can reduce the immune response to COVID-19 vaccination. By using high-parameter flow cytometry, we examined the antigen-specific (Ag+) immune response six months post-third COVID-19 mRNA-vaccination in MS patients with RR and PR forms on aCD20 therapy. Despite lower Ag+ B cell responses and lower levels of anti-SARS-CoV2, both total and neutralizing antibodies, RR and PR patients developed strong Ag+ T cell responses. We observed similar percentages and numbers of Ag+ CD4+ T cells and high proportion of Ag+ CD8+ T cells, with slight differences in T cell phenotype and functionality, that however suggested the presence of differences in immune responses driven by age and disease severity.

The thymus hosts the development of a specific type of adaptive immune cells called T cells. T cells orchestrate the adaptive immune response through recognition of antigen by the highly variable T-cell receptor (TCR). T-cell development is a tightly coordinated process comprising lineage commitment, somatic recombination of Tcr gene loci and selection for functional, but non-self-reactive TCRs, all interspersed with massive proliferation and cell death. Thus, the thymus produces a pool of T cells throughout life capable of responding to virtually any exogenous attack while preserving the body through self-tolerance. The thymus has been of considerable interest to both immunologists and theoretical biologists due to its multiscale quantitative properties, bridging molecular binding, population dynamics and polyclonal repertoire specificity. Here, we review mathematical modelling strategies that were reported to help understand the flexible dynamics of the highly dividing and dying thymic cell populations. Furthermore, we summarize the current challenges to estimating in vivo cellular dynamics and to reaching a next-generation multiscale picture of T-cell development.

Abstract Octreotide is the first synthetic peptide hormone, consisted of eight amino acids, that mimics the activity of somatostatin, a natural hormone in the body. During the past decades, advanced instrumentation and crystallographic software established X-ray Powder Diffraction (XRPD) as a valuable tool for extracting structural information of biological macromolecules. The latter was demonstrated by the successful structural determination of octreotide at a remarkably high d-spacing resolution (1.87 Å) (PDB code: 6vc1). This study focuses on the response of octreotide to different humidity levels and temperatures, with a particular focus on the stability of the polycrystalline sample. XRPD measurements were accomplished employing an Anton Paar MHC-trans humidity-temperature chamber installed within a laboratory X’Pert Pro diffractometer (Malvern Panalytical). The chamber is employed to control and maintain precise humidity and temperature levels of samples during XRPD data collection. Pawley analysis of the collected data sets revealed that the octreotide polycrystalline sample is remarkably stable and no structural transitions were observed. The compound retains its orthorhombic symmetry (space group: P212121, a = 18.57744(4) Å, b = 30.17338(6) Å, c = 39.70590(9) Å, d~ 2.35 Å). However, a characteristic structural evolution in terms of lattice parameters and volume of the unit-cell is reported mainly upon controlled relative humidity variation. In addition, an improvement of signal-to-noise ratio in the XRPD data under a cycle of dehydration/rehydration is reported. These results underline the importance of considering the impact of environmental factors, as humidity and temperature, in the context of structure-based drug design, thereby contributing to the development of more effective and stable pharmaceutical products.

Programmed death ligand 1 (PD-L1) is a co-inhibitory molecule expressed on the surface of various cell types, known for its suppressive effect on T cells through interaction with PD-1. Neutrophils also express PD-L1, and its expression is elevated in specific situations; however, the immunobiological role of PD-L1+ neutrophil has not been fully characterized. Here, we report that PD-L1-expressing neutrophils increased in methicillin-resistant Staphylococcus aureus (MRSA) infection are highly functional in bacterial elimination and supporting inflammatory resolution. The frequency of PD-L1+ neutrophils was dramatically increased in MRSA-infected mice, and this population exhibited enhanced activity in bacterial elimination compared to PD-L1- neutrophils. An administration of PD-L1 monoclonal antibody did not impair PD-L1+ neutrophil function suggesting that PD-L1 expression itself does not influence neutrophil activity. However, PD-1/PD-L1 blockade significantly delayed liver inflammation resolution in MRSA-infected mice, as indicated by increased plasma alanine transaminase (ALT) level and frequencies of inflammatory leukocytes in the liver implying that neutrophil PD-L1 suppresses the inflammatory response of these cells during the acute phase of MRSA infection. Our results reveal that elevated PD-L1 expression can be a marker for enhanced anti-bacterial function of neutrophils. Moreover, PD-L1+ neutrophils are an indispensable population attenuating inflammatory leukocyte activities assisting in a smooth transition into the resolution phase in MRSA infection.

Several vaccines against COVID -19 have been developed and licenced to enhance the immune response against SARS-CoV-2. Similarly, infection with SARS-CoV-2 before vaccination has been shown to provide significant protection against severe infection and hospitalisation. The aim of this study was to investigate the effect of three doses of Sinopharm vaccine and SARS-CoV-2 infection on the specific immune response in 103 volunteers, measuring neutralizing antibodies, anti-S1 IgG, anti-RBD IgM, anti-N IgM, anti-N IgG antibodies and interferon γ. Our results showed that the presence of cardiovascular diseases increased the level of anti-N-IgG antibodies, while endocrinological diseases decreased the level of neutralizing antibodies and anti-N-IgG antibodies, suggesting that these diseases alter the effect of vaccine immunity. In addition, there was a significant decrease in anti-S1 IgG levels 6 months and in anti-N IgG levels 18 months post-infection, while neutralizing antibody and interferon γ levels were constant at 3, 6 and 18 months post-infection. Therefore, our results confirm the importance of hybrid immunity as the strongest and most durable compared to exclusively natural or vaccine-induced immunity. Significant positive correlations were found between humoral and cellular immunity markers: neutralizing antibodies, anti-S1 IgG, anti-N IgG and interferon γ, indicating a unique coordinated response specific to COVID-19.

In this study, the microbial strain was isolated from the humus soil to ferment Sophora flavescens and Eleutherococcus sessiliflorus extracts. The isolated microbial was identified as Bacillus genus by 16S rRNA sequence analysis. The fermented plant extracts exhibited the antifungal effects against four types of the plant pathogens such as P. carotorum, B. cinerea, C. fructicola Sau-3, and C. gloeosporioides according to incubation time. Especially, the fermented plant extracts showed the most active activities for Colletotrichum genus to inhibit mycelium growth. Metabolite changes in fermented S. flavescens and E. sessiliflorus extracts were confirmed through LC-Q-TOF/MS. Flavonoid and peptide derivatives were improved in fermented S. flavescens and E. sessiliflorus extracts compared to their unfermented one, respectively. This study suggested that the isolated Bacillus microbial fermentation could be a valuable tool in improving the bioactivity of S. flavescens and E. sessiliflorus extracts to have potential with more environmentally-friendly antifungal agents.

Here we explore the emerging role of NKG2D CAR-T cell therapy in the realm of solid tumor treatment. Unique capabilities of NKG2D CAR-T cells to recognize stress-induced ligands on cancer cells are discussed, highlighting the therapy's potential for targeted and precise antitumor responses. We also examine the challenges and opportunities associated with NKG2D CAR-T cell therapy, emphasizing the ongoing advancements and clinical trial progress shaping its future. Ultimately, the discussion underscores the transformative promise of NKG2D CAR-T cell therapy in revolutionizing the landscape of solid tumor treatment and enhancing the prospects for improved patient outcomes.

Every individual at some point encounters the progressive biological process of aging which is considered one of the major risk factors for common diseases. The main drivers of aging are oxi-dative stress, senescence, and Reactive oxygen species (ROS). The renin-angiotensin-aldosterone system (RAAS) includes several systematic processes for the regulation of blood pressure which is caused by an imbalance of electrolytes. During activation of RAAS, binding of angiotensin II (ANG II) to angiotensin II type I receptor (AGTR1) activates intracellular NADPH oxidase to generate superoxide anions and promote uncoupling of endothelial NO synthase, which in turn decreases NO availability and increases ROS production. Promoting oxidative stress and DNA damage mediated by ANG II is tightly regulated. Individuals with sodium deficiency-associated diseases such as Gitelman syndrome (GS) and Bartter syndrome (BS) show down-regulation of inflammation-related processes and have reduced oxidative stress and ROS. Additionally, the histone deacetylase-Sirtuin-1(SIRT1) has a significant impact on the aging process with reduced activity with age. However, GS/BS patients generally sustain higher levels of SIRT1 activity than aged-matched healthy individuals. In this review, we highlight the importance of the hallmarks of aging, inflammation, and the RAAS system in GS/BS patients and how this might impact healthy aging. We further propose fu-ture research directions for studying the etiology of GS/BS at the molecular level using pa-tient-derived renal stem cells and induced pluripotent stem cells.

Chemical pollution poses a significant threat to human health, with detrimental effects on various physiological systems, including the respiratory, cardiovascular, mental, and perinatal domains. While the impact of pollution on these systems has been extensively studied, the intricate relationship between chemical pollution and immunity remains a critical area of investigation. The focus of this study is to elucidate the relationship between chemical pollution and human immunity. To accomplish this task, this study presents a comprehensive review that encompasses in vitro, ex vivo, and in vivo studies, shedding light on the ways in which chemical pollution can modulate human immunity. Our aim is to unveil the complex mechanisms by which environmental contaminants compromise the delicate balance of the body's defence systems going beyond the well-established associations with defence system delving into the less-explored link between chemical exposure and various immune disorders, adding urgency to our understanding of the underlying mechanisms and their implications for public health.

Diabetes mellitus is one of the most common endocrinopathies, estimated to affect about 5.4% of the world's population around 2025. It is thought that nearly a third of diabetic patients have some type of skin condition. Frequently, the cutaneous effects of this heterogeneous syndrome are ac-curately detected late in the progressive form of the disease. The main objective of the present study was to identify the main cellular characteristics of the cutaneous microenvironment in exper- imentally induced diabetes mellitus. Skin fragments were harvested from adult white Wistar rats of both sexes, with the weight of 200 g, 12 weeks after streptozotocin diabetes was induced. In parallel with histopathological diagnosis by using hematoxylin and eosine staining, samples were processed by transmission electron microscopy technique and examined with a Philips CM100 microscope. In the apparently macroscopically unchanged tegument, photon microscopy revealed both progres ive thinning of the epidermis in the early stages of diabetes and a significant process of fibrosis and collagen hyalinization in the dermis. In addition, in the early stages, the electron microscopic study provided ultrastructural details characteristic of a senescent phenotype with reduced cell proliferation. The morphological changes in the skin may be the first signs of disruption of carbohydrate metabolism and in the case of established diabetes may reflect its progression and the efficacy of therapy.

Regulatory T cells (Tregs) are major drivers behind immunosuppressive mechanisms and present a major hurdle for cancer therapy. Tregs are characterized by high expression of CD25, which is a potentially valuable target for Treg depletion to alleviate immune suppression. The preclinical anti-CD25 (αCD25) antibody, clone PC-61, has met with modest anti-tumor activity, due to its capacity to clear Tregs from circulation and lymph nodes but not those that reside in the tumor. Optimization of the Fc domain of this antibody clone has been shown to enhance intratumoral Treg depletion capacity. Here, we generated a stable cell line that produces optimized recombinant Treg depleting antibodies. A genome engineering strategy in which CRISPR-Cas9 was combined with homology directed repair (CRISPR-HDR) was utilized to optimize the Fc domain of the hybridoma PC-61 for effector functions by switching it from the original rat IgG1 to a mouse IgG2a isotype. In a syngeneic tumor mouse model the resulting αCD25-m2a antibody mediated effective depletion of tumor resident Tregs leading to a high effector T cell (Teff) to Treg ratio. Moreover, combination of the αCD25-m2a with αPD-L1 treatment augmented tumor eradication in mice, demonstrating the potential for αCD25 as a cancer immunotherapy.

Given the accelerating scientific, clinical and consumer interest in highly-prevalent functional gastrointestinal disorders, appropriate therapeutic strategies are needed to address the many aspects of digestive dysfunction. Accumulating evidence for the crucifer-derived bioactive molecule, sulforaphane in upstream cellular defence mechanisms highlights its potential as a therapeutic candidate in targeting functional gastrointestinal conditions together with systemic disorders. This article catalogues the evolution of and rationale for a hypothesis that utilises multifunctional sulforaphane as the initial step in restoring the ecology of the gut ecosystem; it does this primarily by targeting the functions of intestinal epithelial cells. A growing body of work has identified the colonocyte as the driver of dysbiosis, so that targeting gut epithelial function could provide an alternative to targeting the microbes themselves for remediation of microbial dysbiosis. The hypothesis discussed herein has evolved over several years and is supported by case studies showing the application of sulforaphane in gastrointestinal disorders, related food intolerance and several systemic conditions. To our knowledge, this is the first time the effects of sulforaphane have been reported in a clinical environment where several of its key properties within the gut ecosystem appear to be related to its nutrigenomic effects on gene expression.

Background: Cord blood represents a link between intrauterine and early extrauterine development. Cord blood cells map an important time frame in human immune imprinting processes. It is unknown whether sex of the newborn affects the lymphocyte subpopulations in cord blood. Methods: 9 B and 21 T cell subpopulations were characterized by flow cytometry in human cord blood from 16 male and 21 female newborns, respectively. Results: Except for marginal zone B cells and transitional B cells, B cell count in all subsets was higher in cord blood of male newborns than in female newborns. Frequency of naive thymus negative Th cells was significantly higher in male cord blood whereas the remaining T cell subpopulations showed a higher count in cord blood of female newborns. Conclusion: Our study is the first revealing sex differences in B and T cell subpopulations of human cord blood. These results indicate that sex might have a higher impact for the developing immune system urging the need to expand research in this area.

The mechanisms involved in immune responses to cancer have been extensively studied for several decades and, considerable attention has been paid to harnessing the immune system's therapeutic potential. Cancer immunotherapy has established itself as a promising new treatment option for a variety of cancer types. Various strategies including cancer vaccines, monoclonal antibodies (mAbs), adoptive T-cell-cancer therapy and immune test therapy have gained prominence through immunotherapy. However, it remains to be accomplished the full potential of cancer immunotherapy. In spite of having startling aspects, the cancer immunotherapies have some difficulties including the inability to effectively targeting the cancer antigens and the abnormalities in patient response. With the advancement of technology, this system has changed the genome-based immunotherapy process in the human body including generation of engineered T cells. Due to its high specificity, CRISPR-Cas9 has become a simple and flexible genome-editing tool to target nearly any genomic locus. Recently, the CD19-mediated CAR-T cell (chimeric antigen receptor T cell) therapy has opened a new avenue for the treatment of human cancer, though low efficiency is a major drawback of this process. Thus, increasing the efficiency of the CAR-T cell (engineered T cells that induce the chimeric antigen receptor) by using CRISPR-Cas9 technology could be a better weapon to fight against the cancer. In this review, we have broadly focused on the use of CRISPR-Cas9 technology for the modification of the T-cell, which can specifically recognize cancer cells and be used as immune therapeutics against cancer. We have also demonstrated the other potential strategies for the treatment of cancer.

The MAP kinase ERK5 contains an N-terminal kinase domain and a unique C-terminal tail including a nuclear localization signal and a transcriptional activation domain. ERK5 is activated in response to growth factors and stresses, and regulates transcription at the nucleus by either phosphorylation or interaction with transcription factors. MEK5-ERK5 pathway plays an important role regulating cancer cell proliferation and survival. Therefore, it is important to define the precise molecular mechanisms implicated in ERK5 nucleo-cytoplasmic shuttling. We previously described that the molecular chaperone Hsp90 stabilizes and anchors ERK5 at the cytosol, and that ERK5 nuclear shuttling requires Hsp90 dissociation. Here, we show that MEK5 or Cdc37 overexpression -mechanisms that induce nuclear ERK5- induced ERK5 SUMO-2 modification at residues Lys6/Lys22 in cancer cells. We also show that overexpression of the SUMO protease SENP2 completely abolished endogenous ERK5 nuclear localization in response to EGF stimulation. Furthermore, mutation of these SUMO sites abolished the ability of ERK5 to translocate to the nucleus and to promote prostatic cancer PC-3 cell proliferation. These results allow us to propose a more precise mechanism: in response to MEK5 activation, ERK5 SUMOylation favors the dissociation of Hsp90 from the complex, allowing ERK5 nuclear shuttling and activation of transcription.

PG9, PG16, PGT121, and PGT145 antibodies were identified from culture media of activated memory B-cells of an infected donor and shown to neutralize many HIV-1 strains. Since HIV-1 spreads via both free virions and cell-cell fusion, we examined the effect of the antibodies on HIV-1 Env-mediated cell-cell fusion. Clone69TRevEnv cells that express Env in the absence of tetracycline were labeled with Calcein-AM Green, and incubated with CD4+ SupT1 cells labeled with CellTrace™ Calcein Red-Orange, with or without antibodies. Monoclonal antibodies PG9, PG16, 2G12, PGT121, and PGT145 (at up to 50 µg/mL) had little or no inhibitory effect on fusion between HIV-Env and SupT1 cells. By contrast, Hippeastrum hybrid agglutinin completely inhibited fusion. Our results indicate that transmission of the virus or viral genetic material would not be inhibited by these broadly neutralizing antibodies. Thus, antibodies generated by HIV-1 vaccines should be screened for their inhibitory effect on Env-mediated cell-cell fusion.

Background: Emerging data indicate that radiotherapy can modulate antitumour immune responses. Regulatory T cells (Tregs) are a key immunosuppressive subpopulation of interest. We aimed to evaluate the impact of conventional fractionated radiotherapy on circulating Treg levels in melanoma patients and to determine the correlation between these changes and survival. Understanding radiotherapy–immunity interactions may facilitate personalized combination therapies. Methods: Peripheral blood samples from 32 melanoma patients were analysed to quantify Tregs before and 1-3 months after regional lymph node radiotherapy using flow cytometry. Tregs were characterized as CD4+/CD25+/CD127-. Total CD4+ T cells were also evaluated. Changes were compared to those in a control group of 30 tumor-free patients. Overall survival was correlated with T-cell subset dynamics induced by radiotherapy. Results: At baseline, the median percentage of Tregs was not significantly lower in melanoma patients than in controls (7.4% vs 8.32%, p=0.17). Radiotherapy markedly increased the median Treg count to 10.01% (p=0.0008), with a concomitant increase in total CD4+ cells (to 11.71%, p=0.001), indicating systemic expansion. Patients exhibiting coordinated increases in Treg and CD4+ T cells after treatment had a significantly improved prognosis compared with nonresponders (median OS 27.8 vs 13.1 months, p=0.001). Conclusions: Our study demonstrated the significant effects of standard fractionated radiotherapy on systemic Treg levels in melanoma patients. Radiation-induced changes in T-cell subset proportions hold prognostic value. Monitoring of circulating lymphocyte subsets could facilitate personalized combination therapies.

Chimeric Antigen Receptor (CAR)-T cell immunotherapy revolutionized cancer treatment and consists of the genetic modification of T lymphocytes with a CAR gene, aiming to increase their ability to recognize and kill antigen-specific tumor cells. The dynamics of CAR-T cell responses in patients presents a multiphasic kinetics with distribution, expansion, contraction, and persistence phases. The characteristics and duration of each phase depend on the tumor type, the infused product, and on patient-specific characteristics. We present a mathematical model which describes the multiphasic CAR-T cell dynamics resulting from the interplay between CAR-T and tumor cells, considering patient and product heterogeneities. The CAR-T cell population is divided into functional (distributed and effector), memory, and exhausted CAR-T cell phenotypes. The model is able to describe the diversity of CAR-T cell dynamic behaviors in different patients and hematological cancers as well as their therapy outcomes. Our results indicate that the joint assessment of the area under the concentration-time curve in the first 28 days and the corresponding fraction of non-exhausted CAR-T cells may be considered as potential markers to classify therapy responses. Overall, the analysis of different CAR-T cell phenotypes can be a key aspect for a better understanding of the whole CAR-T cell dynamics.

Findings of new targeted treatments with adequate safety evaluations is essential for better cancer cures and mortality rates. Immunotherapy holds promise for patients with relapsed disease, with the ability to elicit long-term remissions. Emerging promising clinical results in B-cell malignancy using gene-altered T-lymphocytes uttering chimeric antigen receptors have sparked a lot of interest. This treatment could open the path for a major difference in the way we treat tumors that are resistant or recurring. Genetically altered T cells used to produce tumor-specific chimeric antigen receptors are resurrected field of adoptive cell therapy by demonstrating remarkable success in the treatment of malignant tumors. Because of the molecular complexity of chimeric antigen receptors -T cells, a variety of engineering approaches to improve safety and effectiveness are necessary to realize larger therapeutic uses. In this study, we investigate at new strategies for enhancing chimeric antigen receptors-T cell therapy by altering chimeric antigen receptors proteins, T lymphocytes, and their relations with other solid tumor microenvironment (TME) aspects.

A mathematical model, composed of two non-linear differential equations that describe the population dynamics of CD4 T cells in the human immune system, as well as viral HIV particles, is proposed. The invariance region is determined, classical equilibria stability analysis is performed using the basic reproduction number, and numerical simulations are carried out, in order to illustrate stability results. Later, the model is modified with a delay term, which describes the time that cells require for immunological activation. This generates a two-dimensional integro-differential system, which is transformed into a system with three ordinary differential equations, via auxiliary variable use. For the new model, equilibrium points are determined, their local stability is examined, and results are studied by way of numerical simulation.

Multimedia resources, such as instructional videos, are currently enjoying a certain popularity in training programmes for medical and dental students. The major challenge is to create such resources that have quality content and are acceptable to students. We investigated the opinions of a sample of 551 students from 4 medical universities in Romania in order to identify the characteristics of the instructional videos that students prefer and we comparatively analysed these characteristics according to gender, age group, but also according to their general preferences for using Internet services. We used univariate (hypothesis testing) and multivariate (Two-Step Clustering) data analysis techniques and revealed three clusters of students, primarily determined by perceptions of the visual appearance of instructional videos. The structure of the clusters by gender and age group is relatively similar, but we recorded differences between them associated with students' expressed preferences for certain Internet services compared to others. Students who prefer instructional videos to contain images used only for aesthetic purposes, to fill in breaks, use Internet services mainly for communication, while students who prefer in videos the use of already drawn explanatory diagrams are slightly younger than the others and use Internet services mainly for information and communication.

Diffuse large B-cell lymphoma (DLBCL) is the most common subtype of non-Hodgkin lymphoma and a heterogeneous disease characterized by mature B-cell neoplasms. The standard immunochemotherapy for DLBCL is R-CHOP, which includes rituximab, cyclophosphamide, doxoru-bicin, vincristine, and prednisone. Up to 30-40% of patients with DLBCL either exhibit primary refractory disease to standard treatment or experience relapse after the initial response. A 72-year-old man diagnosed with DLBCL involving chromosomal translocations t(1;22)(q21;q11.2) and t(6;18)(p25;q21) showed primary refractory disease after the fourth cycle of R-CHOP. The patient ultimately experienced cardiac involvement by the lymphoma and received salvage chemotherapy. He passed away about 15 months away after the diagnosis of DLBCL. We conducted fluorescence in situ hybridization (FISH) for further analysis of the chromosomal translocations. The breakpoint of chromosome 1q21 was located at a distance of around 151 Mb from the telomeric end of chromosome 1p. The breakpoint in chromosome 22q11 contains the immunoglobulin lambda locus. Furthermore, the breakpoint of chromosome 6p was in the telomeric region of chromosome 6p21. The breakpoint of chromosome 18q21 contains BCL2. This case report presents the first documented co-occurrence of chromosomal translocations t(1;22)(q21;q11.2) and t(6;18)(p25;q21) in a patient with DLBCL. These chromosomal translocations may indicate a worse clinical outcome.

We investigated the potential genetic variants using whole exome sequencing (WES) and evalu-ated the disease course using T cell receptor (TCR) repertoire analysis in rheumatoid arthritis (RA). Fourteen patients with RA and five healthy controls (HCs) were enrolled. For patients with RA, only naïve patients were recruited before treatment, and data were collected at baseline and 6 and 12 months after the initiation of disease-modifying antirheumatic drug (DMARD) treatment. Laboratory data and disease parameters were also collected. Genetic variants were detected using WES, and the diversity of the TCR repertoire was assessed using Shannon-Weiner diversity. Some variants were detected by WES, but their clinical significance should be confirmed by further studies. The diversity of the TCR repertoire in patients with RA was lower than that in HCs; however, after DMARD treatment, it increased significantly. The diversity was negatively cor-related with laboratory findings and disease measures with statistical significance. Variants with a potential for RA pathogenesis were identified and the clinical significance of TCR repertoire was evaluated in Korean patients with RA. Further studies are required to confirm the findings of the present study.

Targeted radionuclide therapy (TRT) has recently seen a surge in popularity, with the use of radionuclides conjugated to small molecules and antibodies. Similarly, immunotherapy also has shown promising results – an example being chimeric antigen receptor (CAR) T-cells therapy in hematologic malignancies. Moreover, TRT and CAR T therapies possess unique features that require special consideration when determining how to dose, time, and sequence combination treatments, including the distribution of TRT dose in the body, the decay rate of the radionuclide, and the proliferation and persistence of the CAR-T cells. These characteristics complicate additive or synergistic effects of combination therapies and warrant a mathematical treatment which includes these dynamics in relation to the proliferation and clearance rates of the target tumor cells. Here we combine two previously published mathematical models in a multiple myeloma setting to explore the effects of dose, timing, and sequencing of TRT and CAR-T cell based therapies. We find that for a fixed TRT and CAR-T cell dose, the tumor proliferation rate is the most important parameter in determining the best timing of TRT and CAR T therapies.

The advent of the genome editing era brings forth the promise of adoptive cell transfer using engineered chimeric antigen receptor (CAR) T-cells for targeted cancer therapy. CAR T-cell immunotherapy is probably one of the most encouraging developments for the treatment of hematological malignancies. In 2017, two CAR T-cell therapies were approved by the U. S Food and Drug Administration; one for the treatment of pediatric Acute Lymphoblastic Leukemia (ALL), the other for adult patients with advanced lymphomas. However, despite significant progress in the area, CAR T-cell therapy is still in its early days and faces significant challenges, including the complexity and costs associated with the technology. B-cell lymphoma is the most common hematopoietic cancer in dogs, with an incidence approaching 0.1% and a total of 20-100 cases per 100,000 individuals. It is a widely accepted naturally occurring model for human non-Hodgkin’s lymphoma. Current treatment is with combination chemotherapy protocols, which prolong life for less than a year in canines and are associated with severe dose-limiting side effects, such as gastrointestinal and bone marrow toxicity. To date, one canine study generated CAR T-cells by transfection of mRNA for CAR domain expression. While this was shown to provide a transient anti-tumor activity, results were modest, indicating that stable, genomic integration of CAR modules is required in order to achieve lasting therapeutic benefit. This Commentary summarizes the current state of knowledge on CAR T-cell immunotherapy in human medicine and its potential applications in animal health, while discussing the potential of the canine model as a translational system for immuno-oncology research.

Progression of oral squamous cell carcinoma (OSCC) has been associated with an escape of tumor cells from the host immune surveillance with growing evidence of its underlying molecular mechanisms and its interaction with the immune cell control. In this study the expression of HLA class I (HLA-I) antigens and of components of the antigen processing machinery (APM) was analyzed in 160 consecutive human papilloma virus (HPV)-negative OSCC lesions and correlated to tumor specific parameters, the intratumoral immune cell response and to the patients outcome. A heterogeneous, but predominantly lower constitutive protein expression of HLA-I APM components was seen in OSCC sections when compared to non-neoplastic cells. Based on the expression levels of HLA-I APM components three main OSCC subgroups were detected and categorized into HLA-Ihigh/APMhigh, HLA-Ilow/APMlow and HLA-Idiscordant high/low/APMhigh phenotypes. In the HLA-Ihigh/APMhigh group, the highest frequency of intratumoral CD8+ T cells and lowest number of CD8+ T cells close to FoxP3 cells was found. Despite being associated with the highest T cell infiltration, patients within this group presented the most unfavorable survival, which was most evident in stage T2 tumors. Thus, the presented findings strongly indicate the presence of additional factors involved in the immunomodulatory process of HPV-negative OSCC with a possible tumor-burden-dependent complex network of immune escape mechanisms beyond HLA-I/APM components and T cell infiltration in this tumor entity.

Epigenetic alterations are heritable and enduring modifications in gene expression that play a pivotal role in immune evasion. These include alterations to noncoding RNA, DNA methylation, and histone modifications. DNA methylation plays a crucial role in normal cell growth and development but alterations in methylation patterns such as hypermethylation or hypomethylation can enable tumor and viral cells to evade host immune responses. Histone modifications can also inhibit immune responses by promoting the expression of genes involved in suppressing normal immune function. In the case of T-cell lymphoma, adult T-cell Lymphomas (ALT) also undergo immune evasion through the exceptional function of its accessory and regulatory genes. Epigenetic therapies are emerging as a promising adjunct to traditional immunotherapy and chemotherapy regimens. Clinical trials are currently investigating the use of epigenetic therapies in combination with immunotherapies and chemotherapies for more effective treatment of ATL and other cancers. This review highlights epigenetic alterations that are widely found in T cell malignancies.

Multiple lines of evidence indicate that CD8$^+$ T cells are important in the control of HIV-1 (HIV) replication. However, CD8$^+$ T cells induced by natural infection cannot eliminate the virus or reduce viral loads to acceptably low levels in most infected individuals. Understanding the basic quantitative features of CD8$^+$ T-cell responses induced during the course of HIV infection may therefore inform us about the limits that HIV vaccines, which aim to induce protective CD8$^+$ T-cell responses, must exceed. Using previously published experimental data from a cohort of HIV-infected individuals with sampling times from acute to chronic infection we defined the quantitative properties of CD8$^+$ T-cell responses to the whole HIV proteome. In contrast with a commonly held view, we found that the relative number of HIV-specific CD8$^+$ T-cell responses (response breadth) changed little over the course of infection (first 400 days post-infection), with moderate but statistically significant changes occurring only during the first 35 symptomatic days. This challenges the idea that a change in the T-cell response breadth over time is responsible for the slow speed of viral escape from CD8$^+$ T cells in the chronic infection. The breadth of HIV-specific CD8$^+$ T-cell responses was not correlated with the average viral load for our small cohort of patients. Metrics of relative immunodominance of HIV-specific CD8$^+$ T-cell responses such as Shannon entropy or the Evenness index were also not significantly correlated with the average viral load. Our mathematical-model-driven analysis suggested extremely slow expansion kinetics for the majority of HIV-specific CD8$^+$ T-cell responses and the presence of intra- and interclonal competition between multiple CD8$^+$ T-cell responses; such competition may limit the magnitude of CD8$^+$ T-cell responses, specific to different epitopes, and the overall number of T-cell responses induced by vaccination. Further understanding of mechanisms underlying interactions between the virus and virus-specific CD8$^+$ T-cell response will be instrumental in determining which T-cell-based vaccines will induce T-cell responses providing durable protection against HIV infection.

1) Background- Coronary artery bypass grafting (CABG) is a common surgical intervention for patients with severe coronary artery disease. The Model for End-Stage Liver Disease (MELD) score has been widely used to predict mortality risk in patients with end-stage liver disease, but its utility in predicting postoperative outcomes in cardiac surgery patients is less well-established. 2) Methods-This retrospective study aims to investigate the association between preoperative MELD score and post-operative complications, length of hospital stay, and mortality in patients under-going coronary artery bypass grafting. This is a single-center, retrospective cohort study conducted at a tertiary care academic medical center. The study includes all adult patients who underwent elective coronary artery bypass grafting between January 2011 and December 2020. Preoperative MELD scores were calculated for each patient, and postoperative outcomes including major ad-verse cardiac events, length of hospital stay, and 30-day mortality was assessed. To ensure a homogeneous study cohort, we excluded patients who underwent emergent cardiac procedures or had incomplete data necessary for the calculation of MELD scores and assessment of postoperative outcomes. Data was extracted from the electronic medical records, including patient de-mographics, comorbidities, preoperative laboratory values, operative details, and postoperative outcomes. The study protocol was approved by the Institutional Review Board, and the require-ment for informed consent was waived due to the retrospective nature of the study.3) Results- This study reveals a statistical association between the MELD score calculated at admission and the length of hospital stay, duration in the ICU, patient age, and the duration of aortic clamping and extracorporeal circulation. Specifically, there is an exponential increase in the MELD score corre-lating with the rise in these factors, both collectively and individually, highlighting a significant relationship between the duration of extracorporeal circulation and aortic clamping time. 4) Conclusion-Patients with a high MELD score had an increased risk of postoperative complications and mortality compared to those with a low MELD score. Careful preoperative patient selection and optimization of the patient's clinical condition may improve outcomes in patients with advanced liver disease undergoing cardiac surgery.

Hepatitis C virus (HCV) represents a challenging global health threat in ~200 million infected individuals. Clinical data suggests that only ~10-15% of acutely HCV-infected individuals will achieve spontaneous viral clearance despite exuberant virus-specific immune responses, which is largely attributed to difficulties in recognizing the pathognomonic symptoms during the initial stages of exposure to the virus. Given the paucity of a suitable small animal model, it is also equally challenging to study the early phases of viral establishment. Further, the host factors contributing to HCV chronicity in a vast majority of acutely HCV-infected individuals largely remain unexplored. The last few years have witnessed a surge in studies showing that HCV adopts a myriad mechanisms to disconcert virus-specific immune responses in the host to establish persistence that includes, but not limited to viral escape mutations, viral growth at privileged sites, and antagonism. Here, we discussed a few hitherto poorly explained mechanisms employed by HCV that are believed to lead to chronicity in infected individuals. A better understanding of these mechanisms would aid the design of improved therapeutic targets against viral establishment in susceptible individuals.

The use of chimeric antigen receptors (CAR-T cells) for the treatment of patients with malignant haematological diseases has become a well-established application, for conditions such as refractory or relapsed B cell acute lymphoblastic leukaemia (B-ALL), B cell lymphomas (BCL), and multiple myeloma (MM). Nearly 35,000 patients have received autologous CAR-T cells for the treatment of these conditions only in the USA. Since their approval by the Food and Drug Administration (FDA) in 2017, over 1200 clinical trials have been initiated globally and there are at least 10 different CAR-T cells with approval by different regulatory agencies around the globe. In the USA the Food and Drug Administration (FDA) has approved 6 commercial CAR-T cells that are widely distributed worldwide. At the time of this writing, several clinical trials have been performed in patients with solid tumours such as glioblastoma, renal and pancreatic cancer, as well as in patients with autoimmune conditions such as systemic lupus erythematosus (SLE), idiopathic inflammatory myositis (IIM), and systemic sclerosis (SS). There are also several studies showing the potential benefit of CAR-T cells for other non-malignant diseases such as asthma and even fungal infections. In this review, without pretending to cover all the current areas of treatments with CAR-T cells, we offer a brief summary of some of the most relevant aspects of the use of CAR-T cells for some of these conditions.

Chimeric antigen receptor (CAR) T-cell therapy has greatly improved outcomes for patients with relapsed or refractory hematological malignancies. However, challenges such as treatment resistance, relapse, and severe toxicity still hinder its widespread clinical application. Traditional transcriptome analysis has provided limited insights into the complex transcriptional landscape of both leukemia cells and engineered CAR-T cells, as well as their interactions within the tumor microenvironment. However, with the advent of single-cell sequencing techniques, a paradigm shift has occurred, providing robust tools to unravel the complexities of these factors. These techniques enable unbiased analysis of cellular heterogeneity and molecular patterns. These insights are invaluable for precise receptor design, guiding gene-based T cell modification, and optimizing manufacturing conditions. Consequently, this review utilizes modern single-cell sequencing techniques to clarify the transcriptional intricacies of leukemia cells and CAR-Ts. The aim of this manuscript is to discuss the potential mechanisms that contribute to the clinical failures of CAR-T immunotherapy. We will examine the biological characteristics of CAR-Ts, the mechanisms that govern clinical responses, and the intricacies of adverse events. By exploring these aspects, we hope to gain a deeper understanding of CAR-T therapy, which will ultimately lead to improved clinical outcomes and broader therapeutic applications.

To the best of the author’s knowledge, studies of mature plasmacytoid dendritic cell proliferation associated with T lymphoblastic lymphoma were extremely rare in the literature. Here, we report a patient who underwent both mature plasmacytoid dendritic cell proliferation and T lymphoblastic lymphoma. With the findings of lymph node biopsy taken from the right cervical and inguinal regions, we identified eye-catching mature plasmacytoid dendritic cells that were considered to be responsible for this lesion at the beginning, until the immunostaining of Ki67 and TDT showed a small group of positive cells hiding in these plasmacytoid dendritic cells. Bone marrow biopsy was also performed in this patient. Microscopically, the hematopoietic tissue was almost completely replaced by lymphoblastoid cells with condensed chromatin, inconspicuous nucleoli and scanty cytoplasm, which were basically the same as those seen in the lymph nodes in morphology. However, there was no sign of plasmacytoid dendritic cells or Langerhans cells in the bone marrow biopsy. With the help of bone marrow biopsy, our final diagnosis of the lymph node was T lymphoblastic lymphoma coexisting with mature plasmacytoid dendritic cell proliferation . Although accumulations of plasmacytoid dendritic cells may occur in some infections or reactive lymphadenopathy, the presence of extensive nodules or infiltration of plasmacytoid dendritic cells strongly reminds the pathologist to carefully evaluate the bone marrow or peripheral blood status of the patient to exclude a hidden myeloid or other neoplasm.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Ageing is associated with a decline in both Nrf2 activity and DNA repair efficiency, leading to the accumulation of DNA damage and an increased risk of cancer. Understanding the mechanisms behind the increased level of damaged DNA during ageing is crucial for developing interventions to mitigate age-related cancer risk and improve overall health in older individuals. (Poly)phenols are plant-derived bioactive compounds that undergo metabolism into simpler phenolic catabolites following ingestion. While these compounds have been associated with various health benefits, further analysis of their bioavailable catabolites is necessary. To this end, four phenolic catabolites derived from colonic microbiota were investigated for their ability to reduce DNA damage in response to oxidative challenge and modulate the Nrf2-Antixoidant Response Element pathway. Normal and adenocarcinoma colonocyte cell lines (CCD 841 CoN, & HT29 respectively) were exposed to sub cytotoxic concentrations (>10 µM,) of hydroxylated (4-hydroxybenzoic acid, 3-(3’-hydroxyphenyl) propionic acid) and non-hydroxylated (benzoic acid or 3-phenylpropionic acid) phenolic acids. Using the COMET assay, each catabolite demonstrated significant (p<0.001) geno-protective activity, albeit with varying potency. They also significantly modulated expression of key genes in the Nrf2-ARE pathway, including Nrf2, Heme oxygenase-1 (HO-1), and NAD(P)H dehydrogenase quinone 1 (NQO1). Hydroxylation of the phenolic acids appeared to have a limited effect with respect to bioactivity. Overall, the colon derived phenolic metabolites, when assessed at physiologically relevant concentrations, reduced DNA damage in both normal and adenocarcinoma colonic cells in response to oxidative challenge, mediated – at least in part via upregulation of the Nrf2-ARE pathway.

Aflatoxins, which have been classified as a group-1 carcinogen are the well-known mycotoxins produced by Aspergillus flavus. Aflatoxins have been linked to liver diseases, acute hepatic necrosis, resulting in cirrhosis or hepatocellular carcinomas due to which it incurs a loss of value in international trade for peanuts contaminated with it. The four main aflatoxins are B1, B2, G1, and G2 of which B1 is predominant. In plants, the cell wall is the primary barrier against pathogen invasion. Cell wall fortifications such as deposition of callose, cellulose, lignin, phenolic compounds and structural proteins help to prevent the pathogen infection. Further, the host cell’s ability to rapidly repair and reinforce its cell walls will result in a reduction of the penetration efficiency of the pathogen. Peanut seed coat acts as a physical and biochemical cell wall barrier against both pre and post-harvest pathogen infection. The structure of seed coat and the presence of polyphenol compounds have been reported to inhibit the growth of A. flavus, however, not successfully employed to develop A. flavus resistance in peanut. A comprehensive understanding of peanut seed coat development and biochemistry will provide information to design efficient strategies for the seed coat mediated A. flavus resistance and Aflatoxin contamination.

(1) Background: The RDW-CV has predictive value in many pregnancy-related conditions. Re-search question: Can the RDW-CV be utilized predictively in pregnant patients with thrombo-philia? Aim of the study: To carry out a detailed analysis of the RDW-CV in pregnant patients with treated thrombophilia as compared with pregnant patients without thrombophilia who de-livered via cesarean section at term. (2) Methods: We studied 160 pregnant patients, including 80 pregnant patients with treated thrombophilia in the study group, and another 80 patients of a similar age and parity. The patients were referred to our hospital for delivery at term by means of a cesarean section between 1/10/2017 and 1/12/2021. Every patient received a sonogram during the first 1–2 days after the cesarean section, and their uterine evaluation was interpreted using the PUUS (Postpartum Uterine Ultrasonographic Scale). (3) Results: Our PUUS≥1 pregnant and postpartum patients with treated thrombophilia were the only group with an RDW-CV value over 14. No deep vein thrombosis was observed during hospitalization, showing that the antico-agulant treatment was necessary and effective. An RDW-CV of 14.5 was the highest value in the Rh-negative group of pregnant patients with treated thrombophilia. An RDW-CV of 14.48 was the highest level in the Rh-negative postpartum patients with treated thrombophilia. (4) Conclu-sion: An RDW-CV of ≥14 can predict uterine hematometra (PUUS≥1). The RDW-CV values were higher in Rh-negative patients.

Chimeric Antigen Receptor (CAR) T-cell therapy has demonstrated high rates of response in recurrent B-cell Acute Lymphoblastic Leukemia in children and young adults. Despite this success, a fraction of patients experience relapse after treatment. Relapse is often preceded by recovery of healthy B cells, which suggests loss or dysfunction of CAR T cells in bone marrow. This site is harder to access, and thus is not monitored as frequently as peripheral blood. Understanding the interplay between B cells, leukemic cells and CAR T cells in bone marrow is paramount in ascertaining the causes of lack of response. In this paper, we put forward a mathematical model representing the interaction between constantly renewing B cells, CAR T cells and leukemic cells in the bone marrow. Our model accounts for the maturation dynamics of B cells and incorporates effector and memory CAR T cells. The model provides a plausible description of the dynamics of the various cellular compartments in bone marrow after CAR T infusion. After exploration of the parameter space, we found that the dynamics of CAR T product and disease were independent of the dose injected, initial B-cell load and tumor burden. We also show theoretically the importance of CAR T product attributes in determining therapy outcome, and have studied a variety of possible response scenarios, including second dosage schemes. We conclude by setting out ideas for the refinement of the model.

Survival of Medulloblastoma (MB) depends on various factors, including the gene expression profiles of MB tumor tissues. In this study, we identified 967 MB survival related genes (SRBs) using the gene expression dataset of Cavalli et al. (2017) and the Cox proportional hazards regression model. Notably, the SRGs were over-represented on chromosomes 6 and 17, known for the abnormalities monosomy 6 and isochromosome 17 in MB. The most significant SRG was HMGA1 (high mobility group AT-hook 1), which is a known oncogene and a histone H1 competitor. High expression of HMGA1 was associated with worse survival, primarily in the Group 3γ subtype. The high expression of HMGA1 was unrelated to any known somatic copy number alteration. Most SRGs on chromosome 17p were associated with low expression in Group 4β, the MB subtype with 93% deletion of 17p and 98% copy gain of 17q. Pathway analysis showed that both chromosomes 6 and 17 included SRGs related to telomere maintenance and provide a rationale for testing telomerase inhibitors in Group 3 MBs. We conclude that HMGA1, along with other SRGs on chromosome 6 and 17 warrant further investigation as potential therapeutic targets in selected subgroups or subtypes of MB.

Abstract: Congenital hyperinsulinism (CHI) is a rare disorder of glucose metabolism and is the most common cause of severe and persistent hypoglycemia (hyperinsulinemic hypoglycemia, HH) in the neonatal period and childhood. Most cases are caused by mutations in the ABCC8 and KCNJ11 genes that encode the ATP-sensitive potassium channel (KATP). We present the correlation between genetic heterogeneity and the variable phenotype in patients with early-onset hyperinsulinemic hypoglycemia caused by ABCC8 gene mutations. In the first patients, which presented persistent severe hypoglycemia since the first day of life, molecular genetic testing revealed the presence of a homozygous mutation in the ABCC8 gene [deletion in the ABCC8 gene c.(2390+1_2391-1)_(3329+1_3330- 1)del] correlated with a diffuse form of hyperinsulinism (the parents being healthy heterozygous carriers). In the second patient, the onset was on the third day of life with severe hypoglycemia, and genetic testing identified a heterozygous mutation in the ABCC8 gene c.1792C&gt;T (p.Arg598*) inherited on the paternal line, which led to the diagnosis of focal form of hyperinsulinism. To locate the focal lesions, (18)F-DOPA (3,4-dihydroxy-6-[18F]fluoro-L-phenylalanine) PET/CT was recommended (an investigation that cannot be carried out in the country), but the parents refused to carry out the investigation abroad. In this case, early surgical treatment could have been curative. In addition, the second child also presented secondary adrenal insufficiency requiring replacement therapy. At the same time, she developed early recurrent seizures that required antiepileptic treatment. We emphasize the importance and of molecular genetic testing for diagnosis, management and genetic counseling in patients with HH.

We study L_2-approximation problems in the weighted Hilbert spaces in the worst case setting. Three interesting weighted Hilbert spaces appear in this paper, whose weights are equipped with two positive parameters $\ga_j$ and $\az_j$ for $j=1,\,2,\dots,\,d$. We consider the worst case error of algorithms that use finitely many arbitrary continuous linear functionals. We discuss the exponential convergence-(t,s)-weak tractability (EC-(t,s)-WT) of these L_2-approximation problems under the absolute or normalized error criterion. In particular, we obtain the sufficient and necessary conditions for EC-(1,1)-WT and EC-(t,1)-WT with t

Ulcerative colitis is a chronic immune-mediated disease of unclear etiology, affecting people of different ages and significantly reducing the quality of life. Modern methods of therapy are mainly represented by anti-inflammatory drugs and are not aimed at a specific pathogenetic factor. In this study, we investigated the effect of transplantation of sterile stool filtrate from healthy donors on the induction of anti-inflammatory immune mechanisms. It was shown that performing such a procedure in patients with ulcerative colitis caused the appearance of T helper cells in the blood, which reacted to the content of sterile stool filtrates in an antigen-specific manner and produced IL10. At the same time, cells of the same patients before therapy in response to the addition of sterile stool filtrates were less reactive and predominantly produced IL4, indicating its pro-inflammatory skewing. The obtained data demonstrated the effect of an anti-inflammatory shift in the T-helper response after transplantation of sterile stool filtrate, which increased and persisted for at least three months after the procedure.

Anti-CD19 chimeric antigen receptor (CAR) T-cells represent a novel immunotherapy that has shown remarkable success in the treatment of adult relapsed or refractory (R/R) B-cell non-Hodgkin's lymphoma, adult R/R mantle cell lymphoma, and R/R acute paediatric lymphoblastic leukaemia. One barrier to the widespread use of CAR T-cell therapy is toxicity, primarily cytokine release syndrome (CRS) with a variable grade of severity. The main manifestations of CRS are fever, hypotension, cytopenia, organ dysfunction among others. Neurological toxicities vary widely and range from headaches to encephalopathy. In addition, anti-CD19 CAR T-cell therapy provokes an array of less frequent events, such as coagulopathies, delayed cytopenia, and cardiovascular toxicities. In general, toxicities are usually reversible and resolve on their own in most cases, though severe cases may require intensive care and immunosuppressive therapy. Deaths due to CRS, neurologic toxicity and infectious complications have been reported, which highlights the gravity of these syndromes and the critical nature of appropriate intervention. In this paper, we look at all available FDA- and EMA-approved information about the pathophysiology, clinical manifestations, risk factor reviews of existing toxicity grading systems, current management strategies, and guidelines for anti-CD19 CAR T-cell toxicities. We also present new approaches, which are under investigation, to mitigate these adverse events.

Background: As cancer progresses, cells acquire traits that allow them to disperse and disseminate to distant locations in the body – a process known as metastasis. While in the vasculature, these cells are referred to as circulating tumour cells (CTCs) and can manifest either as single cells or clusters of cells (i.e., CTC clusters), with the latter being the most aggressive. The increased metastatic potential of CTC clusters is generally associated with cooperative group benefits in terms of survival, such as increased resistance to shear stress, anoikis, immune attacks and drugs. However, the adoption of a group phenotype poses a challenge when exiting the vasculature (extravasation) as the large size can hinder the passage through vessel walls. Despite their significant role in the metastatic process, the mechanisms through which CTC clusters extravasate remain largely unknown. Based on the observed in vivo association between CTC clusters and platelets, we hypothesized that cancer cells take advantage of the platelet-derived Transforming Growth Factor Beta 1 (TGF-β1) – a signalling factor that has been widely implicated in many aspects of cancer, to facilitate their own dissemination. To address this possibility, we evaluated the effect of exogenous TGF-β1 on an experimentally evolved non-small lung cancer cell line that we previously developed and used to investigate the biology of CTC clusters. Results: We found that exogenous TGF-β1 induced the dissociation of clusters into adherent single cells. Once adhered, cells released their own TGF-β1 and were able to individually migrate and invade in the absence of exogenous TGF-β1. Based on these findings we developed a model that involves a TGF-β1-mediated plastic switch between a cooperative phenotype and a single-celled stage that enables the extravasation of CTC clusters. Conclusions: This model allows for the possibility that therapies can be developed against TGF-β1 signalling components and/or TGF-β1 target genes to suppress the metastatic potential of CTC clusters. Considering the negative impact that metastasis has on cancer prognosis and the lack of therapies against this process, interfering with the ability of CTC clusters to switch between cooperative and individual behaviours could provide new strategies to improve patient survival.