Improvement of agronomic traits in crops through gene editing (GE) relies on efficient trans-formation protocols for delivering the CRISPR/Cas9-coded transgenes. Recently, a few embryo-genesis-related genes have been described, the co-delivery of which significantly increases the transformation efficiency with reduced genotype dependency. Here we characterized the trans-genic and GE events in wheat (cv. Fielder) when transformed with the GROWTH-REGULATING FACTOR 4 (GRF4) and its cofactor GRF-INTERACTING FACTOR 1 (GIF1) chimeric gene. Trans-formation efficiency in our experiments ranged from 22% to 68%, and the editing events were faithfully propagated into the following generation. Both low and high copy number integration events were recovered in the T0 population with the various level of integrity of the left and right T-DNA borders. We also generated a population of wheat plants with ten different gRNAs targeting 30 loci in the genome. Comparison of the epigenetic profiles at the target sites and editing efficiency revealed a significant positive correlation between chromatin accessibility and muta-genesis rate. Overall, preliminary screening of the transgene quality and GE events in the T0 population of plants regenerated through the co-delivery of GRF-GIF can allow for the propagation of the best candidates for further phenotypic analysis.

Abiotic stresses, including drought, salinity, cold, heat, and heavy metals, extensively reduce global agricultural production. Approaches such as conventional breeding and transgenic breeding have been widely used to cope with these environmental stresses. The clustered regularly interspaced short palindromic repeat- Cas (CRISPR/Cas) based gene-editing tool has revolutionized due to its simplicity, accessibility, adaptability, flexibility, and wide applicability. This system has a great potential to build up crop varieties with enhanced tolerance against abiotic stresses. In this review, we summarize the most recent findings on understanding the mechanism of abiotic stress response in plants and the application of CRISPR/Cas mediated gene-editing system towards enhanced tolerance to drought, salinity, cold, heat, and heavy metals stresses. Furthermore, in this review, we highlighted the recent advancements in prime editing and base editing tools for crop improvement.

Wheat gluten contains epitopes that trigger celiac disease (CD). A life-long strict gluten-free diet is the only treatment accepted for CD. However, very low-gluten wheat may provide an alternative treatment to CD. Conventional plant breeding methods are not sufficient to produce celiac-safe wheat. RNA interference technology, to some extent, succeeded in the development of safer wheat varieties. However, these varieties had multiple challenges in their implementation. Clustered Regularly Interspaced Short Palindromic Repeats-associated nuclease 9 (CRISPR/Cas9) is a versatile gene-editing tool that has the ability to edit the immunogenic gluten genes. So far, only a few studies have applied CRISPR/Cas9 to modify the wheat genome. In this article, we reviewed published literature that applied CRISPR/Cas9 in wheat genome editing to investigate the current status of the CRISPR/Cas9 system to produce a low-immunogenic wheat variety. We found that in recent years, the CRISPR/Cas9 system has been continuously improved to edit the complex hexaploid wheat genome. Although some reduced immunogenic wheat varieties have been reported, CRISPR/Cas9 has still not been fully explored in editing the wheat genome. We conclude that further studies are required to apply the CRISPR/Cas9 gene-editing system efficiently for the development of celiac-safe wheat variety and to establish it as a “tool to celiac safe wheat.”

CRISPR-Cas9 technology allows the modification of DNA sequences in vivo at the location of interest. Although CRISPR-Cas9 can produce genomic changes that do not require DNA vector carriers, the use of transgenesis for stable integration of DNA coding for gene-editing tools into plant genomes is still the most used approach and it can generate unintended transgenic integrations, while Cas9 prolonged expression can increase cleavage at off-target sites. In addition, the selection of genetically modified cells from millions of treated cells, especially plant cells, is still challenging. These downfalls can be avoided with the delivery of preassembled ribonucleoprotein complexes (RNPs) composed of purified recombinant enzyme Cas9 and in vitro- transcribed guide RNA (gRNA) molecules in a protoplast system. We therefore aimed to develop the first DNA-free protocol for gene-editing in maize and introduced RNPs into their protoplasts with PEG 4000. We performed effective transformation of maize protoplasts using different gRNAs sequences targeting the inositol phosphate kinase gene and applying two different exposure times to RNPs. Using low-cost Sanger sequencing protocol, we observed an efficiency rate of 0.85 up to 5.85%, which is equivalent to DNA-free protocols used in other plant species. A positive correlation was displayed between exposure time and mutation frequency. Mutation frequency was gRNA sequence- and exposure time-dependent. In summary, we demonstrated the suitability of RNP transfection as an effective screening platform for gene-editing in maize. This efficient and relatively easy assay method for selection of gRNA suitable for editing of gene of interest will be highly useful for genome editing in maize, since genome size and GC-content are large and high in maize genome, respectively. Nevertheless, the large amplitude of mutations at target site requires scrutiny when checking mutations at off-target sites and potential safety concerns.

Biotechnological application of the green microalga Chlamydomonas reinhardtii hinges on the availability of selectable markers for effective expression of multiple transgenes. However, biological safety concerns limit the establishment of new antibiotic resistance genes and until today, only few auxotrophic markers exist for C. reinhardtii. The recent improvements in gene editing via CRISPR/Cas9 allows directed exploration of new endogenous selectable markers. Since editing frequencies with CRISPR/Cas9 techniques are often low, the Cas9-sgRNA ribonucleoprotein (RNP) delivery protocol was strategically optimized by applying nitrogen starvation to the pre-culture, increasing editing frequencies from 10% to 66% after pre-selection. Probing the essential polyamine biosynthesis pathway, the spermidine synthase gene (SPD1) is shown to be a potent selectable marker with versatile biotechnological applicability. Very low levels of spermidine (0.75 mg/L) were required to maintain normal mixotrophic and phototrophic growth in newly designed spermidine auxotrophic strains. Complementation of these strains with a synthetic SPD1 gene was achieved when the mature protein was targeted to either the cytosol or the chloroplast. This work highlights the potential of new selectable markers for biotechnology as well as basic research and proposes an effective pipeline for the identification of new auxotrophies in C. reinhardtii.

Although several protocols for genetic transformation of citrus have been published, it is highly desirable to further improve its efficiency. Here we report treatments of Agrobacterium cells and citrus explants prior to and during co-cultivation process to enhance transformation efficiency using a commercially used rootstock 'Carrizo' Citrange as a model plant. We pre-cultured Agrobacterium cells in a 1/10 MS, 0.5 g/L 2-(N-morpholino) ethanesulfonic acid (MES) and 100 µM acetosyringone liquid medium for 6 hours at 25 ℃ before used to infect citrus explants. We incubated epicotyl segments in an MS liquid medium containing 13.2 µM 6-BA, 4.5 µM 2,4-D, 0.5 µM NAA for 3 hours at 25℃ prior to Agrobacterium infection. In the co-cultivation medium, we added 30 µM paclobutrazol and 10 µM lipoic acid. Each of these three treatments significantly increased the efficiencies of transformation. When the three treatments were combined, we observed that the transformation efficiency was enhanced from 11.5% to 52.3%. The improvement of genetic transformation efficiency mediated by these three simple treatments may facilitate more efficient applications of transgenic and gene editing technologies for functional characterization of citrus genes and for genetic improvement of cultivated citrus varieties.

UPF3B is a constituent of the classical nonsense-mediated mRNA decay (NMD) pathway that degrades both the aberrant transcripts and a set of physiological transcripts. In higher eukaryotes, UPF3B have significant biochemical functions in diverse cellular processes including NMD and translation. UPF3B plays a crucial role in neuronal development and differentiation. Next-generation sequencing technologies identified several loss-of-function mutations in the UPF3B gene that results in neuro-developmental disorders in humans. To uncover the mechanistic role of UPF3B in neuronal functions, we have generated the UPF3B-knockout mammalian cell line model system using CRISPR-Cas9 gene editing method. RNA-Sequencing Analysis of cellular transcriptome from UPF3B-KO cells identified specific genes involved in cell growth and neuronal functions. Altered expression of genes related to the axon guidance pathway delineated the UPF3B function to regulate the neuron-specific genes. Functional enrichment analysis identified the genes involved in the disorders related to mental health and intellectual disability. Our study has the potential to identify the direct players of intellectual disability and will have broader implications.

With the continuous update of gene editing technology, great progress has been made in livestock breeding, researchers have produced gene edited pigs, cattle, sheep and other improved livestock. Gene editing technology is a genetic means to knock in, knock out, delete, inhibit, activate or replace specific bases of DNA or RNA sequences at the genome level to achieve accurate modification, and can edit genes at a fixed point without the need for DNA templates. In recent years, although regular clusters of interspaced short palindromic repeats (CRISPR)/Cas9 system mediated gene editing technology has been widely used in animal genetic breeding research, but so far, the system's precise insertion efficiency of foreign genes is not high enough, and there are certain off-target effects, and it is not enough to be used in genome editing of large livestock such as cashmere goats. In this paper, the development status, challenges, application prospects and look into the distance of CRISPR/ Cas9-mediated precisiongene editing technology in livestock breeding were reviewed, in order to provide theoretical reference for livestock gene function analysis, genetic improvement and livestock breeding with local economic characteristics.

Tyrosyl-DNA phosphodiesterase 1 (TDP1) is a human DNA repair protein. It is a member of the phospholipase D family based on the structure similarity. TDP1 is a key enzyme involved in repairing stalled topoisomerase 1 (TOP1)-DNA complexes. Previously we obtained with the CRISPR/Cas9 method HEK293A cells with the homozygous knockout of the Tdp1 gene and used knockout cells as a cellular model for studying the mechanisms of anticancer therapy. In this work we studied for the first time by transcriptomic analysis the effect of Tdp1 gene knockout on genes expression changes in human HEK293A cell line. We received original data that may indicate a role of TDP1 in other process besides repair of DNA-TOP1 complex. The differentially expressed genes (DEGs) analysis revealed that TDP1 could be involved in different processes such as cell adhesion and communication, spermatogenesis, mitochondrial function, neurodegeneration, cytokine response, and MAPK pathway signaling.

Clustered regularly interspaced short palindromic repeats or CRISPR, one of the major technological tools from nature's toolbox, has revolutionized the scientific world with its potential use in humans and plants. CRISPR Cas9 was first known as an adaptive immune system of bacteria. It is a system that cleaves foreign DNA. It has been exploited to be used as a genome editing tool for correcting genetic diseases in humans, for plants to create stress-resistant plants, and for a variety of different purposes. This review provides a basic overview of its applications in different areas of biological research. It has immense potential for a variety of researches, but it's still a mystery for science. It feels like scientists just know a tip of an iceberg.

Phialemonium inflatum is a useful fungus known for its ability to mineralise lignin during primary metabolism and decompose polycyclic aromatic hydrocarbons (PAHs). However, no functional genetic analysis techniques have been developed yet for this fungus, specifically in terms of transformation. In this study, we applied an Agrobacterium tumefaciens-mediated transformation (ATMT) system to P. inflatum for functional gene analysis. We generated 3,689 transformants using the binary vector pSK1044, which carried either the hygromycin B phosphotransferase (hph) gene or the enhanced green fluorescent protein (eGFP) gene to label the transformants. Southern blot analysis showed that the probability of a single copy of T-DNA insertion was approximately 50% when the co-cultivation time of fungal spores and Agrobacterium tumefaciens cells was performed at 24–36 h, whereas at 48 h, it was approximately 35.5%. Therefore, when performing gene knockout using ATMT, co-cultivation was reduced to ≤ 36 h. The resulting transformants were mitotically stable, and PCR analysis confirmed gene integration into the transformant genome. Additionally, hph and eGFP gene expressions were confirmed by PCR amplification and fluorescence microscopy. This optimised transformation system will enable functional gene analysis to study genes of interest in P. inflatum.

HIV-1 is a complicated and perplexing virus. It infects T cells, reverse transcribes its RNA into DNA, utilizes its host DNA machinery to replicate its HIV-DNA, translates the HIV-DNA into proteins, assembles itself for a budding escape from the T cell, and rapidly mutates its conformation. Partially, due to its complexity, there remains no cure for HIV or AIDs. However, recently with the discovery of TALENs, the use of zinc fingers, and most of all the applications of CRISPR-Cas9 technology, has given researchers new hope in finding alternative gene therapies and treatments for diseases. With more focus on CRISPR-Cas9, this new and novel technology uses a guiding RNA, sgRNA, to lead a Cas9 nuclease to its target for deletion or to change that DNA site. CRISPR-Cas9 can delete point mutations and multiple DNA sites. Because CRISPR can alter DNA sequences, several scientists have conducted research into CRISPR, possibly treating more diseases such as cancer, diabetes, and even HIV. HIV-1 drew the focus of a researcher named Dr. Ebina in 2013 when he was the first to design and apply CRISPR-Cas9 to genes found in the binding sites of HIV-1, inhibiting HIV-1 gene expression. Since 2013, several other researchers have blocked HIV replication and infection through CRISPR-Cas9 targeting the receptors of T cells called the CC chemokine receptor 5 or CCR5. HIV-1 binds to the CD4 receptor of T cells, which consists of co-receptors CCR5 and CXCR4. If CCR5 expression can be removed, the HIV virus cannot bind to T-cells, blocking the initial attachment stage, and discontinuing the infection. However, there remain obstacles and issues for the CRISPR deletion of CCR5 for treating HIV-1. The issues include: 1) finding new and safe methods of CRISPR-Cas9 delivery, 2) clearing the latent HIV reservoirs, 3) improving the sgRNA design to avoid off-target mutations or deletions, and 4) effectively analyze the viral escape of HIV from CRISPR-Cas9 modifications. Therefore, the purpose of this review is to discuss possible techniques for removing the obstacles that can lessen the potential of CRISPR to delete CCR5, repressing HIV-1 into long-term remission or a functional cure.

Adaptive T cell immunotherapy holds great promise for the successful treatment of leukemia as well as other types of cancers. More recently, it was also shown to be an effective treatment option for chronic virus infections in immunosuppressed patients. Autologous or allogeneic T cells used for immunotherapy are usually genetically modified to express novel T cell or chimeric antigen receptors. The production of such cells was significantly simplified with the CRISPR/Cas system allowing deletion or insertion of novel genes at specific locations within the genome. In this review, we describe recent methodological breakthroughs important for the conduction of these genetic modifications, summarize crucial points to be considered when conducting such experiments, and highlight the potential pitfalls of these approaches.

In "genome editing," a type of genetic engineering, DNA is added, taken away, or changed in an organism's genome. Biomedicine, biotechnology, and synthetic biology, just to name a few, have all gained a lot from how often this method is used. Before the editing process can start, a Double-Strand Breaks (DSB) must be made in the DNA at a specific gene. Researchers have made nucleases, which are sometimes called "molecular scissors," to fix this DSB. Transcription activator-like effector nucleases (TALENs), Zinc-finger nucleases (ZFNs), and homing endonucleases are all examples of protein targets that have been studied and changed. The last part gave an overview of these study projects and explained how to make Cas12a for specific uses. The applications of Cas12a have been extensively studied in recent years, but the protein still holds a lot of promise as a treatment and screening tool. In order to give a quick review of CRISPR-Cas12a and its uses, we will briefly talk about the structure and function of the different parts of the reaction pathway that lead up to the catalysis of the target DNA. Cas12a uses a multistep process to make sure that it is selecting the right DNA. This is a good trait for a device that changes the DNA because it makes it less likely that something bad will happen. Even though data shows that a new CRISPR RNAs (crRNA) molecule can stop Cas12a from randomly destroying ssDNA, it may still hurt the host cell while trying to change the genome. The action of Cas12a catalysis, which is a powerful tool for changing the genome, needs to be changed so that it can be more easily controlled and managed. Using what we know about how Cas12a works, we have made mutants that are less active on ssDNA and more active on dsDNA. So far, only Cas9 and Cas12a, which are both part of the CRISPR family, have been used to change the genome. Because of how similar and different these two endonucleases are, CRISPR can now be used for multiple scientific purposes. Cas12a is better than Cas9 because it makes double-strand breaks (DSBs) that favor Homology-Directed Repair (HDR) over Non-homologous end joining (NHEJ) and can change more than one copy of the genome at the same time. Both Cas9 and Cas12a are being changed to make them better at detecting Protospacer Adjacent Motif (PAM) than they are in their natural state. This will make it possible to start focusing on more genes.

Scientists can use the Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) protein 9 system, which is a powerful and flexible tool for changing the genome, to change only certain parts of the genome. This has helped researchers figure out how target genes work in biology and disease. CRISPR/Cas9 is made up of a sequence-specific CRISPR RNA (crRNA) set and a generic Cas9 nuclease. The crRNA set tells Cas9 where to cut DNA and cause double-strand breaks. In the next step of cellular DNA repair, insertions, deletions, and swaps are made at specific spots. For CRISPR/Cas9-mediated DNA cleavage to be specific, the target sequences must match the crRNA, and a protospacer nearby motif must be placed after the target sequences. In this article, we talk about how CRISPR/Cas9 works at the molecular level, what it can be used for, what it can't do, and what its future clinical treatment promise might be.

The CRISPR/Cas9 gene editing system has enormous potential in the treatment of multiple genetic disorders. To fully harness this potential, it is essential to deliver CRISPR-Cas9 components safely and effectively into the nuclei of target cells. In this study, we tested the amphipathic cell-penetrating peptide LAH5, previously used for DNA delivery, to intracellularly deliver spCas9: sgRNA ribonucleoprotein (RNP) and RNP/single-stranded homology-directed repair (HDR) template. We discovered that the LAH5 peptide effectively formed nanocomplexes with both RNP and RNP/HDR cargo, and that these nanocomplexes were taken up by cells effectively. Peptide/RNP nanocomplexes were characterized for size and charge, and nanocomplexation with RNP and RNP/HDR cargo was demonstrated via an electrophoretic mobility shift assay. Various ratios of peptide/RNP nanocomplexes were functionally screened on fluorescent reporter cell lines for gene editing and HDR-mediated gene correction. Additionally, targeted gene editing of the CCR5 gene was demonstrated in various cell lines. This LAH5-based delivery strategy paves the way for the development of therapeutic delivery systems for CRISPR/Cas-based genomic engineering.

With the rapid population growth, there is an urgent need for innovative crop improvement approaches to meet the increasing demand for food. Classical crop improvement approaches involve, however, a backbreaking process that cannot equipoise with increasing crop demand. RNA based approaches i.e. RNAi-mediated gene regulation and site-specific nuclease based CRISPR/Cas9 system for gene editing has made advances in the efficient targeted modification in many crops for the higher yield and resistance to diseases and different stresses. In functional genomics, RNA interference (RNAi) is a propitious gene regulatory approach that plays a significant role in crop improvement by permitting down-regulation of gene expression by small molecules of interfering RNA without affecting the expression of other genes. Gene editing technologies viz. clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein (CRISPR/Cas) have appeared prominently as a powerful tool for precise targeted modification of nearly all crops genome sequence to generate variation and accelerate breeding efforts. In this regard, the review highlights the diverse roles and applications of RNAi and CRISPR/Cas9 system as powerful technologies to improve agronomically important plants to enhance crop yields and increase tolerance to environmental stress (biotic or abiotic). Ultimately, these technologies can prove to be important in view of global food security and sustainable agriculture.

Powdery mildew is a severe disease causing substantial yield losses in wheat production worldwide. The Chinese wheat landrace Changanhongmai (CAHM) exhibits high resistance to the physiological race E09 of powdery mildew. This study aims to characterize the powdery mildew resistance gene in CAHM, and develop molecular markers for marker-assisted selection of wheat. To investigate the genetic characteristics of this resistant gene, we developed F1 plants, F2 generation population, and F2:3 families from a cross between CAHM and SY225. Genetic analysis demonstrated that all F1 plants were resistant to the disease, while the ratio of resistant to susceptible plants was 3: 1 in both the F2 population and F2:3 families, indicating that CAHM is inherited in a manner of single dominant powdery mildew resistance gene, which was tentatively designated as PmCAHM. By using bulk segregation analysis, we constructed a genetic map encompassing Xgwm273, Xwmc626, Xgwm11, Xgwm18, Xgdm28, Xgpw7812, Xgpw5195, Xwmc694 and PmCAHM. Among these markers, Xgpw7812 and Xgpw5195 were flanking markers tightly linked to PmCAHM at a genetic distance of 2.5 cM and 8.4 cM, respectively. Furthermore, nullisomic-tetrasomic analysis revealed that PmCAHM is located on chromosome 1B. These results indicate that PmCAHM differs from the internationally recognized powdery mildew resistance genes in both location and source. In addition, a new germplasm/line NW1748 with large seeds and powdery mildew resistance was developed from the cross and back cross populations of Fengyou 1718 (FY1718)/CAHM//FY 1718. Therefore, PmCAHM can serve as a novel powdery mildew resistance source for breeding of wheat by using NW1748 as the donor in the future.

Rapid progress in gene editing based on clustered regularly interspaced short palindromic repeats/CRISPR-associated protein (CRISPR/Cas) has revolutionized the study of gene and genome function and genetic disease correction. While numerous genetically modified cellular and animal models have been created to understand biological processes, the clinical application of CRISPR/Cas tools has been impeded by off-targeting and delivery problems. It is generally accepted that the delivery of CRISPR in the form of a ribonucleoprotein complex (RNP) substantially reduces the time of DNA exposure to the effector nuclease, minimizing off-target effects and facilitating clinical usage. This review focuses on CRISPR/Cas RNP delivery with retro/lentiviral particles and exosomes, whose parallel production by cells transfected with viral vectors is underestimated. We critically evaluate specific mechanisms of extracellular particle formation and loading with CRISPR/Cas for each system. Additionally, the details of Cas-nanoparticle entry and uncoating, previously unappreciated in the context of gene editing efficiency, are discussed. Based on existing knowledge about the consequences of intervention in retroviral assembly, entry, or exosome formation, we outline the potential problems with CRISPR/Cas delivery using extracellular nanoparticles and ways to address them.

Chronic myeloid leukaemia (CML) is a haematological neoplasm driven by the BCR/ABL fusion oncogene. The monogenic aspect of the disease and the feasibility of ex vivo therapies in haematological disorders make CML an excellent candidate for gene therapy strategies. The ability to abolish any coding sequence by CRISPR-Cas9 nucleases offers a powerful therapeutic opportunity to CML patients. However, a definitive cure can only be achieved when only CRISPR-edited cells are selected. A gene-trapping approach combined with CRISPR technology would be an ideal approach to ensure this. Here, we have developed a CRISPR-Trap strategy that efficiently inserts a donor gene trap (SA-CMV-Venus) cassette into the BCR-ABL1-specific fusion point in the CML K562 human cell line. The trapping cassette interrupts the on-cogene coding sequence and expresses a reporter gene that enables the selection of edited cells. Quantitative expression analyses showed significantly higher level of expression of the BCR-Venus allele coupled with a drastically lower level of BCR/ABL expression in Venus+ cell fractions. Functional in vitro experiments showed cell proliferation arrest and apoptosis in selected Venus+ cells. Finally, xenograft experiments with the selected Venus+ cells showed a large reduction in tumour growth, thereby demonstrating a therapeutic benefit in vivo. This study is a proof of concept for the therapeutic potential of a CRISPR-Trap system as a novel strategy for gene elimination in haematological neoplasms.

Cystic Fibrosis is a rare genetic disease that affects the transmission of chloride ions due to mutations in the CFTR (cystic fibrosis transmembrane conductance regulator) gene. Even though there are nearly 2000 mutations identified to be related to the condition, the most common mutation is F508del; deletion of a phenylalanine residue at 508. On the other hand, G542X which is a Class I mutation is also found very commonly and there are no modulator treatments available for it. Furthermore, it was investigated that R553X mutation can as well be corrected simultaneously with G542X mutation. Therefore, the main focus is on designing a gene therapy project that can correct all these three mutations at once by utilizing the prime editing technique via lipid-based delivery. In this way, the mutations can be edited through plasmids that were designed containing 2 pegRNAs and the Cas enzyme. To implement such an approach efficiently, both ex vivo, an animal model, and in vivo steps are to be designed. For the cell line, fibroblasts are selected due to their simplicity and low cost. The animal model of the experiment is determined to be a ferret concerning the high similarity to the human's CFTR protein and finally, the procedure will follow on a direct application in human Cystic Fibrosis patients. The plasmids are thought to be delivered through a cationic liposome that will reach the lungs with the aid of a nebulizer. At the last stage of the experimental procedure, Sanger Sequencing will be done to see if the desired edit within the CFTR has been performed successfully, and Next Generation Sequencing will be executed to see if there has been an off-target mutation in the remainder of the genome. Whereas for detecting the presence and expression of CFTR protein in humans, immunodetection with flow cytometry will be conducted.

Novel Cellular Immunotherapy with engineered T cells has improved cancer treatment and established therapeutic promises to prevent tumor formation in clinical studies. Due to certain restrictions and difficulties, CAR and TCR T cells therapies were inadequate at points. CRISPR Cas9 genome-editing tool has a significant potential for these two cell-based therapies. As a specialized gene-editing technique, CRISPR Cas9 is used to repair genetic alternation with minimum damage. It is used as an adjunct to Immunotherapy to stimulate a more robust immune response. CRISPR has long outpaced other target-specific genome editing methods such as ZFNs and TALEN due to its high efficiency, competence in targeting, and stable operating condition. CRISPR can overcome the two major drawbacks of universal CAR T cells: allorejection and graft-vs-host disease. TCR-based T cell treatment can reduce inappropriate binding between endogenous and transgenic TCR, resulting in a reduction of severe toxicity. The CAR and TCR T based cell therapies uphold an excellent future for tumor malignancies This article has elucidated the administration of CRISPR Cas9 in Novel Cellular Immunotherapy, CAR, and TCR T cell therapy. However, this article did not fail to observe this technology's ethical concerns, limitations, and challenges. Furthermore, the article compares CRISPR-mediated allogeneic CAR T cell to TCR-T cell therapy.

Genetic engineering has become an essential element in developing climate-resilient crops and environmental sustainable solutions to respond to the increasing need for global food security. Genome editing using CRISPR/Cas [Clustered regulatory interspaced short palindromic repeat (CRISPR)-associated protein (Cas)] technology is being applied to a variety of organisms, including plants. This technique has become popular because of its high specificity, effectiveness, and low production cost. Therefore, this technology has the potential to revolutionize agriculture and contribute to global food security. Over the past few years, increasing efforts have been seen in its application in developing higher-yielding, nutrition rich, disease resistant, stress-tolerant “crops” fruits and vegetables. Cas proteins such as Cas9, Cas12, Cas13, and Cas14, among others, have distinct architectures and have been used to create new genetic tools that improve features that are important for agriculture. The versatility of Cas has accelerated genomic analysis and facilitated the use of CRISPR/Cas to manipulate and alter nucleic acid sequences in cells of different organisms. This review provides the evolution of CRISPR technology exploring its mechanisms and contrasting it with traditional breeding and transgenic approaches to improve different stress tolerance. We have also discussed the CRISPR/Cas system and explored three Cas proteins that are currently known to exist: Cas12, Cas13, and Cas14 and their potential to generate foreign DNA free or non-transgenic crops that could be easily regulated for commercialization in most countries.

The growing population meet the challenge for agricultural production. CRISPR/Cas9 technology is based on plant research for the development of the new varieties as well as disease resistance crops. In addition the deletion of significant characters makes the new alleles from the CRISPR/Cas9. Recent and reliable molecular scissor for genetic engineering. The review is focused on the various application of the CRISPR/Cas9 technology in plant enhancement of plant disease resistance, stress burden in plant, nutritional improvement, and quality of crops from the CRISPR/Cas9 system. The clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein9 (cas9) is adopted from the prokaryotic type II system. CRISPR/Cas9 is simplicity and efficiency than ZENs and TALENs for the genome engineering. Due to rapid growing of the CRISPR/Cas9 system has been formulate the adaptation of many plant species. The current advancement of plants and future schemes of improve of CRISPR technology has been presented in contest of multiplex editing, knowledge on induced mutation whether the factor effect in CRISPR/Cas9 technology in plant. Remarkable perspective and challenges of CRISPR/Cas9 technology in significance of plant genetic modification.

The methods used to introduce CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas-mediated genome editing into fruit species, as well as the impacts of the application of this technology to activate and knock out of target genes in different fruit trees species including tree development, yield, fruit quality, and tolerance to biotic and abiotic stresses have been firstly described in this review. The application of this gene editing technology could allow the development of new generations of fruit crops with improved traits by targeting different genetic segments or even could facilitate the introduction of traits in elite cultivars without changing other traits. However, at this moment, the scarcity of efficient regeneration and transformation protocols in some species, the fact that many of those procedures are the genotype-dependent or the convenience of segregating the transgenic parts of the CRISPR system represent the main handicaps limiting the potential of genetic editing techniques for fruit trees. Finally, latest news on the legislation and regulations about the use of plants modified through CRISPR/Cas systems has been also discussed.

Duchenne muscular dystrophy (DMD) is a fatal X-linked recessive neuromuscular disease prevalent in 1 in 3500 to 5000 males worldwide. As a result of mutations that interrupt the reading frame of the dystrophin gene (DMD), DMD is characterized by a loss of dystrophin protein which leads to decreased muscle membrane integrity, which increases susceptibility to degeneration. CRISPR/Cas9 technology has garnered interest as an avenue for DMD therapy due to its potential for permanent exon skipping, which can restore the disrupted DMD reading frame in DMD and lead to dystrophin restoration. An RNA-guided DNA endonuclease system, CRISPR/Cas9 allows for the targeted editing of specific sequences in the genome. The efficacy and safety of CRISPR/Cas9 as a therapy for DMD has been evaluated by numerous studies in vitro and in vivo, with varying rates of success. Despite the potential of CRISPR/Cas9-mediated gene editing for the long-term treatment of DMD, its translation into the clinic is currently challenged by issues such as off-targeting, immune response activation, and sub-optimal in vivo delivery. Its nature as being mostly a personalized form of therapy also limits applicability to DMD patients, who exhibit a wide spectrum of mutations. This review summarizes the various CRISPR/Cas9 strategies that have been tested in vitro and in vivo for the treatment of DMD. Perspectives on the approach will be provided, and the challenges faced by CRISPR/Cas9 in its road to the clinic will be briefly discussed.

Antisocial behavior is a behavior disorder inherited according to the inheritance of X-linked chromosome. This disorder derives from mutations in the MAOA gene. One of the mutations results in the MAOA-L allele activity. The MAOA-L allele activity can cause antisocial behavior in both healthy and unhealthy people. Antisocial behavior from healthy males can originate from maltreatment during childhood. Currently, MAOA inhibitor can reverse antisocial behavior to normal behavior in animal models. However, this disorder cannot be treated permanently; to treat it permanently in the future, technologies such as CRISPR/Cas9, iPSCs and ssODN are required. These technologies have succeeded to correct erroneous segments in the F8 gene and F9 gene. Both genes occupy the X chromosome. The MAOA gene also occupies the X chromosome. Therefore, it is reasonable to state that CRISPR/Cas9 and iPSCs technique for instance can be beneficial tools to edit the MAOA gene to treat antisocial behavior. CRISPR/Cas9 can be used in combination with iPSCs or ssODN for instance. This combination can greatly help the permanent healing of antisocial behavioral disorders.

BACKGROUND: Chronic hepatitis B infected with Hepatitis B virus remains a major health concern worldwide. Despite standard interferon-α and nucleotide analogues have been shown to reduce the deterioration of liver disease among chronic hepatitis B patients, covalently closed circular DNA was still difficult to eradicate. METHODS: A literature search of Pubmed and Web of science was performed with the following key words: ‘CRISPR’, ‘CRISPR/Cas9’, ‘hepatitis B’, ‘HBV’, ‘chronic hepatitis B’ and ‘HBV cccDNA’. The information about CRISPR/Cas9 for the treatment of HBV cccDNA or hepatitis B was reviewed. RESULTS: CRISPR/Cas9 could treat hepatitis B through suppressing or clearing HBV cccDNA with different gRNAs. CONCLUSION: With the emergence of CRISPR/Cas9 (the RNA-guided clustered regulatory interspaced short palindromic repeats, CRISPR) editing technology, clearance of hepatitis B virus and better prevention of liver carcinoma seemed to be possible.

Clustered regularly interspaced short palindromic repeats (CRISPR) based gene-editing has begun to transform the treatment landscape of genetic diseases. The history of the discovery of CRISPR/CRISPR-associated (Cas) proteins/single guide RNA (sgRNA)-based gene-editing since the first report of repetitive sequences of unknown significance in 1987 is fascinating, instructive, and inspiring for future advances. The recent approval of CRISPR-Cas9-based gene therapy to treat patients with severe sickle cell anemia and transfusion-dependent beta thalassemia has renewed hope for treating other hematologic diseases, including patients with germline predisposition to hematologic malignancies, who would benefit greatly from the development of CRISPR-based gene therapies. The purpose of this manuscript is three-fold: first, a chronological description of the history of CRISPR-Cas9-sgRNA-based gene editing; second, a brief description of the current state of clinical research in hematologic diseases, including selected applications in treating hematologic diseases with CRISPR-based gene therapy; and third, the current progress in gene therapies in inherited hematologic diseases and bone marrow failure syndromes, to hopefully stimulate efforts towards developing these therapies for patients with inherited bone marrow failure syndromes and other inherited conditions with germline predisposition to hematologic malignancies.

IgE-mediated wheat allergy is a gluten-related disorder. Wheat is one of the five most common food allergens in children. However, the natural history of IgE-mediated wheat allergy has seldom been described in the research literature. This study presents the current state of knowledge about the IgE-mediated wheat allergy in children.

Gene or genome editing (GE) revises, removes, or replaces a mutated gene at the DNA level; it is a tool. Gene therapy (GT) offsets mutations by introducing a "normal" version of the gene into the body while the diseased gene remains in the genome; it is a medicine. So far, no GE product has been approved, as opposed to 22 GT products that cost up to millions of dollars per dose. The FDA has recently added a guideline specific to gene editing that should be understood to enable faster development of GE products; at the same time, the FDA also needs to bring more clarification and make several amendments to this guideline to make it more rational.

In the last decade, the genetic engineering world has been shaken up by a relatively new genetic editing tool based on RNA-guided Nucleases (RGNs): the CRISPR/Cas9 system. Since the first report in 1987 and its characterization in 2007 as a bacterial defense mechanism, the interest and research on this system have grown exponentially. CRISPR systems provide immunity to bacteria against invading genetic material; however, with specific modifications in sequence and structure, it becomes a precise editing system that makes it possible to genetically modify almost any organism. There are diverse approaches regarding the refinement of these modifications, such as constructing more accurate nucleases, understanding the cellular context and facing the epigenetic conditions, or re-designing guide RNAs (gRNAs). Considering the critical importance for the correct CRISPR/Cas9 systems performance, our scope will emphasize in the latter approach. Hence, we present an overview of the past and the most recent guide RNA web-based design tools, highlighting their computational architecture and gRNA characteristics evolution through the years. Our study concisely explains the computational approaches that use machine learning techniques, deep neural networks, and large datasets of gRNA/target interactions to make possible both predictions and classifications directed to design, optimize, and create promising gRNAs suitable for future gene therapies.

The RNA-guided endonuclease system CRISPR-Cas9 has been extensively modified since its discovery, allowing its capabilities to be extending far beyond double-stranded cleavage to high fidelity insertions, deletions, and single base edits. Such innovations have been possible due to the modular architecture of CRISPR-Cas9 and the robustness of its component parts to modifications and the fusion of new functional elements. Here, we review the broad toolkit of CRISPR-Cas9-based systems now available for diverse genome editing tasks. We provide an overview of their core molecular structure and mechanism and distil the design principles used to engineer their diverse functionalities. We end by looking beyond the biochemistry and towards the societal and ethical challenges that these CRISPR-Cas9 systems face if their transformative capabilities are to be deployed in a safe and acceptable manner.

CRISPR-Cas allows us to introduce desired genome editing, including mutations, epitopes, and deletions with unprecedented efficiency. The development of CRISPR-Cas has progressed to such an extent that it is now applicable in various fields with the help of model organisms. C. elegans is one of the pioneering animals in which numerous CRISPR-Cas strategies have been rapidly es-tablished over the past decade. Ironically, the emergence of numerous methods makes the right choice of method difficult. Choosing an appropriate selection or screening approach is the first step in planning a genome modification. This report summarizes the key features and applications of CRISPR-Cas methods using C. elegans and illustrates key strategies. Our overview of significant advances in CRISPR-Cas will help readers to understand current advances in genome editing and navigate various methods of CRISPR-Cas genome editing.

CRISPR/Cas9 has emerged as the predominant method for genome editing due to its cost-effectiveness and broad applicability, playing a crucial role in advancing sustainable practices across various sectors. This systematic review leverages the PRISMA methodology to explore CRISPR/Cas9's impact on environmental protection, thereby supporting the Sustainable Development Goals (SDGs). Analyzing data from the Web of Science, the review found significant growth in related publications, with a 30% increase since 2014, predominantly from the US, China, Germany, and the UK. The study categorizes the scientific developments into three trends: advancements in agriculture, gene editing techniques, and biofuel production. Key discussions include the use of CRISPR/Cas9 in developing fourth-generation biofuels and environmental biosensors, as well as its applications in enhancing genetic resilience and controlling invasive species. These innovations highlight CRISPR/Cas9's potential in promoting sustainable resource management and energy generation, marking a pivotal contribution to ecological conservation and sustainability efforts.

With rapid advances in gene editing and gene therapy technologies, the development of genetic, cell, or protein-based cures to disease are no longer the realm of science fiction but that of today’s practice. The impact of these technologies are rapidly bringing them to the veterinary market as both enhanced therapeutics and towards modeling their outcomes for translational application. Simply put, gene editing enables scientists to modify an organism’s DNA a priori through the use of site-specific DNA targeting tools like clustered regularly interspaced short palindromic repeats and CRISPR-associated protein 9 (CRISPR/Cas9). Gene therapy is a broader definition that encompasses the addition of exogenous genetic materials into specific cells to correct a genetic defect. More precisely, the U.S Food and Drug Administration (FDA) defines gene therapy as “a technique that modifies a person’s genes to treat or cure disease” by either (i) replacing a disease-causing gene with a healthy copy of the gene; (ii) inactivating a disease-causing gene that was not functioning properly; or (iii) introducing a new or modified gene into the body to help treat a disease. In some instances, this can be accomplished through direct transfer of DNA or RNA into target cells of interest or more broadly through gene editing. While gene therapy is possible through the simple addition of genetic information into cells of interest, gene editing allows the genome to be reprogrammed intentionally through the deletion of diseased alleles, reconstitution of wild type sequence, or targeted integration of exogenous DNA to impart new function. Cells can be removed from the body, altered, and reinfused, or edited in vivo. Indeed, manufacturing and production efficiencies in gene editing and gene therapy in the 21^st century has brought the therapeutic potential of in vitro and in vivo reprogrammed cells, to the front lines of therapeutic intervention (Brooks et al., 2016). For example, CAR-T cell therapy is revolutionizing hematologic cancer care in humans and is being translated to canines by us and others, and gene therapy trials are ongoing for mitral valve disease in dogs.

Clustered regularly interspaced short palindromic repeats/associated protein 9 nuclease (CRISPR/Cas9) technology guided by a single-guide RNA (sgRNA) has recently opened a new avenue for antiviral therapy. A unique capability of the CRISPR/Cas9 system is multiple genome engineering. However, there are few applications in insect viruses by a single Cas9 enzyme targeting two or more sgRNA at different genomic sites for simultaneous production of multiple DNA breaks. To address the need for multi-gene editing and sustained delivery of multiplex CRISPR/Cas9-based genome engineering tools, we developed a one-vector (pSL1180-Cas9-U6-sgRNA) system to express multiple sgRNA and Cas9 protein to excise Bombyx mori nucleopolyhedrovirus (BmNPV) in insect cells. Here, ie-1, gp64, lef-11, and dnapol genes were screened and identified as multiple sgRNA editing sites according to the BmNPV system infection and DNA replication mechanism. Furthermore, we constructed a multiplex editing vector sgMultiple to efficiently regulate multiplex gene editing steps and inhibit BmNPV replication after viral infection. This is the first report that describes the application of multiplex CRISPR/Cas9 system inhibiting insect virus replication. This multiplex system can significant enable the potential of CRISPR/Cas9-based multiplex genome engineering in transgenic silkworms.

Gene editing is now easy to make new disease models through in-vivo and in vitro tests. It can potentially be used to make animals with single-gene or multiple-gene changes. The mutant strains with changed germlines are no longer needed with in vivo gene editing, which uses the CRISPR-Cas9 system to target cells of interest in their normal tissues. Whereas, the AAVs and other viral vectors have made it possible to change cells selectively. Gene editing hade made it possible to use human induced pluripotent stem cells (iPSC) to model diseases that run in families. Researchers can compare and contrast the human genomes of many different ethnic and racial groups using this method. Scientists may be able to make a disease in a lab dish using iPSCs from a patient. Using CRISPR, iPSCs made from patient cells can be fixed if they have certain problems. This shows that gene therapy is possible and shows what happens when cells aren't working right. The fact that CRISPR-Cas9 can change the DNA by just one nucleotide has had a huge effect on biological studies. CRISPR is becoming more and more popular, which shows how useful, easy, and effective it is. With the broad use of CRISPR-based apps, the tool is now used for much more than just changing genes. This method can be used to screen the whole genome, control the translation of genes based on their sequence, and edit several genes at the same time. Scientists can now model diseases in different species and learn more about how genes work because of these advances. Genome-wide association studies and genome-editing tools like CRISPR are giving us a good look at the future of personalized medicine.

Fanconi anemia (FA) develops due to a mutation in one of the FANC genes that are involved in repair of interstrand crosslinks (ICLs). FANCG, a member of the FA core complex, is essential for ICL repair. Previous FANCG-deficient mouse models were generated with drug-based selection cassettes in mixed mice backgrounds, leading to a disparity in interpretation of genotype-related phenotype. To exclude these confounders, we created a Fancg-KO (KO) mouse model using CRISPR/Cas9. The entire Fancg locus was targeted and maintained on the immunological well-characterized C57BL/6J background. Intercrossing of heterozygous mice resulted in sub-Mendelian numbers of homozygous mice, suggesting loss of FANCG can be embryonic lethal. KO mice displayed infertility, hypogonadism but no other developmental problems. Bone marrow analysis revealed a defect in various hematopoietic stem and progenitor subsets with a bias towards myelopoiesis. Cell lines derived from Fancg-KO mice were hypersensitive to crosslinking agents-cisplatin and Mitomycin C, and Fancg-KO mouse embryonic fibroblasts (MEFs) displayed increased γ-H2AX upon cisplatin treatment. Reconstitution of these MEFs with Fancg cDNA corrected for the ICL hypersensitivity. Collectively, this project provides a new, genetically and immunologically well-defined Fancg-KO mouse model for further in vivo and in vitro studies on FANCG and ICL repair.

Global crop yield and food security are being threatened by phytophagous insects. Innovative methods are required to increase agricultural output while reducing reliance on hazardous synthetic insecticides. It appears to be quite effective at reducing production costs and boosting farm profitability to use the ground-breaking CRISPR-Cas technology to create plants that are insect resistant. In contrast, this new technique can modify an insect's genome to either produce gene drive or get beyond an insect's tolerance to various insecticides. This paper reviews and critically discusses the use of CRISPR-Cas genome editing technology in long-term insect pest management. The emphasis of this review is on the prospective uses of the CRISPR-Cas system for insect stress management in crop production by creating genome-edited crops and insects. The potential and difficulties of using CRISPR-Cas technology to reduce pest stress in crop plants are critically examined and discussed.

Multiplex genome editing may induce genotoxicity and chromosomal rearrangements due to double-strand DNA breaks at multiple loci simultaneously induced by programmable nucleases, including CRISPR/Cas9. However, recently developed base-editing systems can directly substitute target sequences without double-strand breaks. Thus, the base-editing system is expected to be a safer method for multiplex genome-editing platforms for livestock. Target-AID is a base editing system composed of PmCDA1, a cytidine deaminase from sea lampreys, fused to Cas9 nickase. It can be used to substitute cytosine for thymine in 3-5 base editing windows, 18 bases upstream of the protospacer-adjacent motif site. In the current study, we demonstrated Target-AID-mediated base editing in porcine cells for the first time. We targeted multiple loci in the porcine genome using the Target-AID system and successfully induced target-specific base substitutions with up to 63.15% efficiency. This system can be used for the further production of various genome-engineered pigs.

Phenotypic complementation of gene knock-outs is an essential step in establishing function. Here we describe a simple strategy for ‘gold standard’ complementation in which the mutant allele is replaced in situ with a wild type (WT) allele in a procedure that exploits CRISPR/Cas9. The method relies on the prior incorporation of a unique 24 nucleotide (nt) ‘bookmark’ sequence into the mutant allele to act as a guide RNA target during its Cas9-mediated replacement with the WT allele. The bookmark comprises a 23 nt Cas9 target sequence plus an additional nt to ensure the deletion is in-frame. Here, bookmarks are tailored to Streptococcus pyogenes CRISPR/Cas9, but could be designed for any CRISPR/Cas system. For proof of concept, 9 bookmarks were tested in Clostridium autoethanogenum. Complementation efficiencies reached 91%. As complemented strains are indistinguishable from their progenitors, concerns over contamination may be satisfied by incorporation of ‘watermark’ sequences into the complementing genes.

Adeno-associated viral (AAV) vectors can be used for gene delivery. AAV.CAP-Mac was recently developed; it can cross the blood-brain barrier and transduce cells throughout the CNS. However, some brain regions were not transduced in adult rhesus monkeys. Additionally, AAV vectors can only package 5 kb of DNA. Also, AAV vectors may be genotoxic and cytotoxic, especially at high doses. Finally, AAV vectors are very expensive to produce at sufficiently high titers for treatment. Off-the-shelf cell-based delivery systems wherein the cells can infiltrate the target tissue and be hyper-motile would be ideal. Also, mRNA-based gene editing would be a transient treatment, and thus be much safer.

CRISPR/Cas genome editing is a widely used research technology. Its simplest variant is gene knockout resulting from reparation errors after introduction of dsDNA breaks by Cas nuclease. We compared the outcomes of the break repair by two commonly used nucleases (SpCas9 and LbCas12a) in zebrafish embryos to reveal if application of one nuclease is advantageous in comparison to the other. To address this question, we injected ribonucleoprotein complexes of nucleases and corresponding guide RNAs in zebrafish zygotes and three days later sequenced the target gene regions. We found that LbCas12a breaks resulted in longer deletions and more rare inserts, in comparison to those generated by SpCas9, while the editing efficiencies of both nucleases were the same. On the other hand, overlapping protospacers were shown to lead to similarities in repair outcome, although they were cut by two different nucleases. Thus, our results indicate that the repair outcome depends both on the nuclease mode of action and on protospacer sequence.

Cystic Fibrosis (CF) is an inherited monogenic disorder, amenable to gene based therapies. Because CF lung disease is currently the major cause of mortality and morbidity, and lung airway is readily accessible to gene delivery, the major CF gene therapy effort at present is directed to the lung. Although airway epithelial cells are renewed slowly, permanent gene correction through gene editing or targeting in airway stem cells is needed to perpetuate the therapeutic effect. Transcription activator-like effector nuclease (TALEN) has been utilized widely for a variety of gene editing applications. The stringent requirement for nuclease binding target sites allows for gene editing with precision. In this study, we engineered helper-dependent adenoviral (HD-Ad) vectors to deliver a pair of TALENs together with donor DNA targeting the human AAVS1 locus. With homology arms of 4 kb in length, we demonstrated precise insertion of either a LacZ reporter gene or a human CFTR minigene into the target site. Using the LacZ reporter, we determined the efficiency of gene integration to be about 5%. In the CFTR vector transduced cells, we have detected both CFTR mRNA and protein expression by qPCR and Wetern analysis, respectively. We have also confirmed CFTR function correction by flurometric Image Plate Reader (FLIPR) and iodide efflux assays. Taking together, these findings suggest a new direction for future in vitro and in vivo studies in CF gene editing.

The rapid advancements in gene therapy have opened up new possibilities for the treatment of genetic disorders, including Duchenne muscular dystrophy, Thalassemia, cystic fibrosis, Hemophilia, and Familial hypercholesterolemia. The utilization of the clustered regularly interspaced short palindromic repeats (CRISPR) - CRISPR-associated protein (Cas) system has revolutionized the field of gene therapy by enabling precise targeting of genes. In recent years, CRISPR/Cas9 has demonstrated remarkable efficacy in treating cancer and genetic diseases. However, the susceptibility of nucleic acid drugs to degradation by nucleic acid endonucleases, necessitates the development of functional vectors capable of protecting the nucleic acids from enzymatic degradation, while ensuring safety and effectiveness. This review aims to explore the biomedical potential of non-viral vector-explore CRISPR/Cas9 systems for the treatment of genetic diseases. Furthermore, it provides a comprehensive overview of recent research advances in viral and non-viral vector-based gene therapy for genetic disorders, including insights from preclinical and clinical studies. Additionally, the review analyzes the current limitations of these delivery systems and proposes avenues for the development of novel nano-delivery platforms.

Fruit production is an important part of the gross domestic product for many countries around the world especially to those who have a strong focus on agriculture. However, long-term maintenance and yield stability of fruit production may be threatened by the ongoing climate change and its consequences like extended drought periods, heavy rain events, and floodings. Genome editing, with its progressive technological developments, offers opportunities to adapt relevant fruit plant species to new climatic conditions. Among modern genome editing techniques, CRISPR/Cas, in particular, has the potential to support breeding for those fruit plant species with extended breeding cycles, e.g., perennial fruits. In this review, we discuss CRISPR/Cas and other genome editing techniques in detail and how these techniques can be applied to support the breeding of fruit plant species for adaptation to changing climates. The chronological history of CRISPR/Cas9 systems, their associated computational tools, genomic data sources, transformation methods along with their delivery vehicles, quality improvement, environmental-stress resiliency, limitations, and future perspectives will also be discussed with respect to securing future global fruit production.

Gene or genome editing (GE) revises, removes, or replaces a mutated gene at the DNA level; it is a tool. Gene therapy (GT) offsets mutations by introducing a "normal" version of the gene into the body while the diseased gene remains in the genome; it is a medicine. So far, no in vivo GE product has been approved, as opposed to 22 GT products approved by the FDA. However, several are under development, and the FDA anticipates their fast entry, as evidenced by the FDA's actions of issuing GE-specific guidelines. The potential of GE in treating diseases far supersedes any other modality due to the recognized role of genes in most human diseases. While GT products add missing genes, GE tools can overcome many aberrations. However, GE presents many safety challenges, including off-target impact, delivery consistency, and long-term effects of gene-fixing. However, most of these concerns will be resolved once the FDA begins approving them, leading to hundreds of products capable of treating untreatable diseases.

The human angiotensin-converting enzyme 2 (ACE2) has a crucial role on blood pressure control; however, ACE2 is also the primary SARS-CoV-2 (S domain) virus receptor. Inhibiting or even reducing the expression of the native ACE2 might diminish the viral entry into the cells, but may cause a failure of ACE2 biological activity, primarily in patients with comorbidities, including diabetes mellitus or hypertension. Since the ACE2 catalytic site and the SARS-Cov-2 receptor are distinct, we designed a Crispr-Cas9 model system, predicting the respective sequences for a guide RNA (gRNA) and a single-stranded oligo dideoxy nucleotide (ssODN), to introduce point mutations into the exon 1 of the human ACE2 gene, which encodes the alpha-helix, implicated on the binding of the SARS-CoV-2 envelope S protein. Protein modeling predicted that the specific substitutions of residues Phe28, Lys31, and Tyr41 for Ala at the ACE2 alpha-helix do not significantly alter ACE2 native conformation. The analysis of the impact of these mutations on ACE2 receptor function predicted a weakening of the binding of the SARS-CoV-2 protein S. An experimental genome editing of cells based on these Crispr-Cas9 elements might reduce the SARS-CoV-2 ability to enter the epithelial cell, preserving the biological activity of ACE2 enzyme.

This work explores state-of-the-art approaches for stabilizing an inverted pendulum on a cart system, which has been used for over a century to demonstrate ideas in nonlinear and linear control theory, owing to its simple practical implementation yet complex system dynamics. We introduce energy-based control methods and propose a simple linear controller to quickly force the system to the downward equilibrium before swing-up. By constraining the system to start from a stable equilibrium configuration, the problem of global stability is reduced to ensuring that the system can follow all heteroclinic orbits that start very close to the downward equilibrium. Multiple Lyapunov functions are employed to ensure non-zero tracking, increasing the system's domain of attraction than is achieved by traditional controllers based on a single Lyapunov function. We stabilize our inverted pendulum system in the upright configuration through pole placement using a linear quadratic regulator known for fast settling times and smooth system response and through sliding mode controllers known for their robustness to disturbances and model uncertainties. While sliding mode controllers exhibit faster stabilization of the pendulum angle, they fail to stabilize the cart position in a reasonable amount of time. The paper concludes by suggesting various controller techniques that can enhance the swing-up and stabilization controller architectures, leaving room for future exploration. To facilitate further research and education, an open-source MATLAB simulation code is provided, encapsulating the system dynamics and controller designs. This resource offers flexibility for customization, making it a valuable tool for both researchers and educators working with inverted pendulum systems.

Despite the high quality of soybean protein, raw soybeans and soybean meal cannot be directly included into animal feed mixtures due to the presence of Kunitz (KTi) and Bowman Birk protease inhibitors (BBi) which reduces animal performance. Heat treatment can substantially inactivate trypsin and chymotrypsin inhibitors (BBi) but such treatment is energy intensive, adds expense, and negatively impact the quality of seed proteins. As an alternative approach we have employed CRISPR/Cas9 gene editing to create mutations in BBi genes to drastically lower the protease inhibitor content in soybean seed. Agrobacterium-mediated transformation was used to generate several stable transgenic soybean events. These independent CRISPR/Cas9 events were examined in comparison to wild type plants using Sanger sequencing, proteomic analysis, trypsin/chymotrypsin inhibitor activity assays and q15RT-PCR. Collectively, our results demonstrate the creation of an allelic series of loss of function mutations affecting the major BBi gene in soybean. Mutations in two of the highly expressed seed specific BBi genes lead to substantial reductions in both trypsin and chymotrypsin inhibitor activities.

Global population is predicted to approach 10 billion by 2050, an increase of over 2 billion from today. To meet the demands of growing, geographically and socio-economically diversified nations, we need to diversity and expand agricultural production. This expansion of agricultural productivity will need to occur under increasing biotic, and environmental constraints driven by climate change. Clustered regularly interspaced short palindromic repeats-site directed nucleases (CRISPR-SDN) and similar genome editing technologies will likely be key enablers to meet future agricultural needs. While the application of CRISPR-Cas9 mediated genome editing has led the way, the use of CRISPR-Cas12a is also increasing significantly for genome engineering of plants. The popularity of the CRISPR-Cas12a, the type V (class-II) system, is gaining momentum because of its versatility and simplified features. These include the use of a small guide RNA devoid of trans-activating crispr RNA (tracrRNA), targeting of T-rich regions of the genome where Cas9 is not suitable for use, RNA processing capability facilitating simpler multiplexing, and its ability to generate double strand breaks (DSB) with staggered ends. Many monocot and dicot species have been successfully edited using this Cas12a system and further research is ongoing to improve its efficiency in plants, including improving the temperature stability of the Cas12a enzyme, identifying new variants of Cas12a or synthetically producing Cas12a with flexible PAM sequences. In this review we provide a comparative survey of CRISPR-Cas12a and Cas9, and provide a perspective on applications of CRISPR-Cas12 in agriculture.

The advent of CRISPR/Cas9 technology has revolutionized genome editing, enabling the attainment of once-unimaginable goals. CRISPR/Cas's groundbreaking attributes lie in its simplicity, versatility, universality, and its independence from customized DNA-protein systems, erasing the need for specialized expertise and broadening its scope of applications. Beyond its editing prowess, the discovery of novel Cas-based systems has spawned an array of additional biotechnological tools, empowering both fundamental and applied research. Researchers have harnessed CRISPR/Cas for gene regulation, deepening insights into gene expression and epigenetic changes. Precisely targeting DNA or RNA sequences, CRISPR/Cas effectively identifies and counters pathogens. Furthermore, it aids in genome imaging and sequencing, revealing genome spatial organization and chromatin dynamics. The non-editing applications of CRISPR/Cas exhibit tremendous potential across diverse domains, including diagnostics, biotechnology, and fundamental research. This article reviews and critically evaluates the primary CRISPR/Cas-based tools developed for plants and animals, underlining their transformative impact.

Glioblastoma (GBM) is the most common malignant brain tumor in adults. Despite advancements in treatment, the prognosis for patients with GBM remains poor due to its aggressive nature and resistance to therapy. CRISPR-based genetic screening has emerged as a powerful tool for identifying genes crucial for tumor progression and treatment resistance, offering promising targets for tumor therapy. In this review, we provide an overview of the recent advancements in CRISPR-based genetic screening approaches and their applications in GBM. We highlight how these approaches have been used to uncover genetic determinants of GBM progression and susceptibility to various therapies. Furthermore, we discuss ongoing challenges and future directions of CRISPR-based screening methods in advancing GBM research.

Abiotic stresses extensively reduce agricultural crop production globally. Traditional breeding approaches have been widely used to mitigate the risks of abiotic stresses. The discovery of gene editing technology for modifying stress-responsive genes and associated molecular networks has paved the foundation for sustainable crop management against environmental stress. Integrated approaches based on functional genomics and transcriptomics are now expanding the opportunities to elucidate the molecular mechanisms underlying abiotic stress responses. This review summarizes some of the features and weblinks of plant genome databases related to abiotic stress genes utilized for crop improvement. Clustered, regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas) based gene-editing tool has revolutionized stress tolerance research due to its simplicity, versatility, adaptability, flexibility, and broader applications. However, off-target and low cleavage efficiency hinder the successful application of CRISPR/Cas systems. Computational tools have been developed for designing highly competent gRNA with better cleavage efficiency. This powerful genome editing tool offers tremendous crop improvement opportunities, overcoming conventional breeding techniques' shortcomings. Furthermore, we also discuss the mechanistic insights of the CRISPR/Cas9-based genome editing technology. This review summarizes the current advances in understanding plant species' abiotic stress response mechanism and applying the CRISPR/Cas system genome editing technology to develop crop resilience against drought, salinity, temperature, heavy metals, and herbicides.

Gene editing tools such as CRISPR-Cas9 have created unprecedented opportunities for genetic studies in plants and animals. We designed a course-based undergraduate research experience (CURE) to train introductory biology students in the concepts and implementation of gene editing technology as well as develop their soft skills in data management and scientific communication. We present two versions of the course that can be implemented with twice-weekly meetings over a five-week period. In the remote-learning version, students perform homology searches, design guide RNAs and primers, and learn the principles of molecular cloning. This version is appropriate when access to laboratory equipment or in-person instruction is limited, such as closures that have occurred in response to the Covid-19 pandemic. In the in-person version, students design guide RNAs, clone CRISPR-Cas9 constructs, and perform genetic transformation of the model plant Arabidopsis thaliana. The highly parallel nature of the CURE makes it possible to target dozens to hundreds of genes, depending on the number of course sections available. Applying this approach in a sensitized mutant background enables focused reverse genetic screens for genetic suppressors or enhancers. The course can be readily adapted to other organisms or projects that employ gene editing.

Pardosa pseudoannulata is one of the most common wandering spiders in agricultural fields and a potentially good bioindicator for heavy metal contamination. However, little is known about the mechanism by which spiders respond to heavy metals at the molecular level. In this study, high-throughput transcriptome sequencing was employed to characterize the de novo transcriptome of the spiders and to identify differentially expressed genes (DEGs) after cadmium exposure. We obtained 60,489 assembled unigenes, 18,773 of which were annotated in the public databases. Ultimately, 3450 cDNA simple sequence repeats were identified and validated as potential molecular markers in the unigenes. A total of 2939, 2491 and 3759 DEGs were detected among the three libraries of two Cd-treated groups and the control. Functional enrichment analysis revealed that metabolism processes and digestive system function were predominately enriched in response to Cd stress. At the cellular and molecular levels, significantly enriched pathways in lysosomes and phagosomes as well as replication, recombination and repair demonstrated that oxidative damage resulted from Cd exposure. Based on the selected DEGs, certain critical genes involved in defence and detoxification were analysed. These results may elucidate the molecular mechanism underlying spiders' responses to heavy metal stress.

Trauma in childhood and adolescence has long-term negative consequences in brain development and behavior and increases the risk for psychiatric disorders. Among them, post-traumatic stress disorder (PTSD) during adolescence illustrates the connection between trauma and substance misuse, as adolescents may utilize substances to cope with PTSD. Drug misuse may in turn lead to neuroadaptations in learning processes that facilitate the consolidation of traumatic memories that perpetuate PTSD. This reflects, apart from common genetic and epigenetic modifications, overlapping neurocircuitry engagement triggered by stress and drug misuse that includes structural and functional changes in limbic brain regions and the salience, default-mode, and frontoparietal networks. Effective strategies to prevent PTSD are needed to limit the negative consequences associated with the later development of a substance use disorder (SUD). In this review, we will examine the link between PTSD and SUDs, along with the resulting effects on memory, focusing on the connection between the development of a SUD in individuals who struggled with PTSD in adolescence. Neuroimaging has emerged as a powerful tool to provide insight into the brain mechanisms underlying the connection of PTSD in adolescence and the development of SUDs.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The pro-protein convertase FURIN (PCSK3) is implicated in a wide range of normal and pathological biological processes such as infectious disease, cancer and cardiovascular disease. Previously, we performed a systemic inhibition of FURIN in a mouse model of atherosclerosis and demonstrated significant plaque reduction and alterations in macrophage function. To understand the cellular mechanisms affected by FURIN inhibition in myeloid cells, we optimized a CRISPR-mediated gene deletion protocol for successfully deriving hemizygous (HZ) and nullizygous (NZ) FURIN knockout clones in U937 monocytic cells using lipotransfection based procedures and a dual guide RNA delivery strategy. We observed differences in monocyte and macrophage functions involving phagocytosis, lipid accumulation, cell migration, inflammatory gene expression, cytokine release patterns, secreted proteomics (cytokines) and whole-genome transcriptomics between wild-type, HZ and NZ FURIN clones. These studies provide a mechanistic basis on the possible roles of myeloid cell FURIN in cardiovascular disorders.

This study aimed to identify miRNA editing sites during adipose tissue development in Ningxiang pigs and analyze their characteristics and functions. Based on the small RNA-seq data from subcutaneous adipose tissue samples of Ningxiang pigs at four stages (30, 90, 150 and 210 days), we constructed a developmental atlas of the miRNA editome in adipose tissue of Ningxiang pigs. The characteristics and functions of this editome were further explored through bioinformatics analysis. The findings revealed that a total of 505 miRNA editing sites were identified with C-to-U editing types being the most prevalent, followed by U-to-C, A-to-G and G-to-U. Importantly, these four types of miRNA editing exhibited a base preference. The number of editing sites showed obvious differences among age groups, with the highest occurrence of miRNA editing events observed at 90 days of age and the lowest at 150 days of age. In the miRNA seed region, a total of 9 miRNA editing sites were identified with significant differences in editing levels (P < 0.05), and located in ssc-miR-23a, ssc-miR-27a, ssc-miR-30b-5p, ssc-miR-15a, ssc-miR-497, ssc-miR-15b, and ssc-miR-425-5p, respectively. Target gene prediction and enrichment analysis revealed that the editing of miR-497 may potentially regulate fat deposition by inhibiting adipose synthesis via influencing target binding. These results provide new insights into the regulatory mechanism of pig fat deposition.

Copper, the highly toxicity micronutrient, plays two essential roles: it is a catalytic and structural cofactor for Cu-dependent enzymes, and it acts as a secondary messenger. In the cells, copper is imported by CTR1, a transmembrane high-affinity copper importer, and DMT1 (divalent metal transporter). In cytosol, enzyme-specific chaperones receive copper from CTR1 C-terminus and deliver it to their apoenzymes. DMT1 cannot be a donor of catalytic copper because it does not have cytosol domain which is required for copper transfer to the Cu-chaperons and following to cuproenzymes. Here we assume that DMT1 can mediate copper way required for regulatory copper pool. To verify this thought, we used CRISPR/Cas9 to generate H1299 cell line with CTR1 or DMT1 single knockout (KO) and CTR1/DMT1 double knockout (DKO). To confirm KOs of the genes qRT-PCR were used. Two independent clones for each gene were selected for further studies. In CTR1-KO cells, expression of the DMT1 gene was significantly increased. In subcellular compartments, copper concentration decreased dramatically in DKO cells. CTR1-KO cells, but not DMT1-KO, demonstrated reduced sensitivity to cisplatin and silver ions, agents that enter the cell through CTR1. The expression of genes, whose protein products require copper: HIF1α, XIAP, COMMD1, CCS, Cp, but not SOD1 and NF-kB, changed their level. Perhaps these data will help to understand how the disturbances of copper homeodynamics lead to the development of neurodegenerative and oncological disorders. Possibility of using CTR1 KO and DMT1 KO cells to study homeodynamics of catalytic and signaling copper selectively is discussed.

Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is a significant challenge to global wheat production. Common wheat landraces AUS27507 and AUS27894 displayed stripe rust resistance against several commercially prevailing Pst pathotypes. These genotypes were crossed with a stripe rust susceptible landrace AUS27229 to understand inheritance of resistance and to determine genomic location(s) of underlying gene(s). F3 generations of crosses AUS27507/AUS27229 and AUS27894/AUS27229 showed monogenic segregation for stripe rust resistance under greenhouse conditions. The absence of segregation for stripe rust response among the AUS27507/AUS27894-derived F3 population suggested that both genotypes carry the same gene. The stripe rust resistance gene carried by AUS27507 and AUS27894 was tentatively named YrAW4. Bulked segregant analysis placed YrAW4 in the long arm of chromosome 2B. The AUS27507/AUS27229 F3 population was enhanced to develop an F6 recombinant inbred line (RIL) population for detailed mapping of chromosome 2BL. DArT-based SSR, STS and KASP markers were employed to enrich the 2BL map. DArT-based STS markers sun481 and SNP marker IWB12294 flanked YrAW4 proximally (1.8 cM) and distally (1.2 cM), respectively. Deletion mapping placed sun481 in the deletion bin 2BL-5. All stripe rust resistance genes, previously located on chromosome 2BL, neither express infection type like YrAW4, nor are mapped in the deletion bin 2BL-5. Hence YrAW4 represented a new locus and was formally named Yr72. The robustness of IWB12294 marker in marker-assisted selection was demonstrated by amplification of and alternative allele to that linked Yr72 in 21 common wheat background.

We report the first correction by Prime editing of a mutation in the RYR1 gene, paving the way to gene therapies for RYR1-related myopathies. The RYR1 gene codes for a calcium channel named Ryanodine receptor 1, which is expressed in skeletal muscle fibers. The failure of this channel causes muscle weakness in patients, which degenerates into motor disabilities. Currently, there are no effective treatments for these diseases, which are mainly caused by point mutations. Prime editing allows the modification of precise nucleotides in the DNA. Our results showed a 59% correction rate of the T4709M mutation in the RYR1 gene in human myoblasts by RNA delivery of the Prime editing components. It is to be noted that the T4709M is recessive, and thus, persons having a heterozygous mutation are healthy. These results are the first demonstration that it is possible to correct mutations in the RYR1 gene.

The indigenous communities across the globe especially in the rural areas consume locally available plants known as Traditional Food Plants (TFPs) for their nutritional and health-related needs. Recent research shows that many of the traditional food plants are highly nutritious as they contain health beneficial metabolites, vitamins, mineral elements and other nutrients. Excessive reliance on the mainstream staple crops has its own disadvantages. TFPs are nowadays considered important crops of the future and can act as supplementary foods for the burgeoning global population. They can also act as emergency foods in times of pandemics and other situations like COVID-19. The current situation necessitates locally available alternative nutritious TFPs for sustainable food production. To increase the cultivation or improve the traits in TFPs, it is essential to understand the molecular basis of the genes that regulate some important traits such as nutritional components and resilience to biotic and abiotic stresses. The integrated use of modern omics and gene editing technologies provide great opportunities to better understand the genetic and molecular basis of superior nutrient content, climate-resilient traits and adaptation to local agroclimatic zones. Recently, realising the importance and benefits of TFPs, scientists have shown interest in the prospection and sequencing of traditional food plants for their improvements, further cultivation and mainstreaming. Integrated omics such as genomics, transcriptomics, proteomics, metabolomics and ionomics are successfully used in plants and have provided a comprehensive understanding of gene-protein-metabolite networks. Combined use of omics and editing tools has led to successful editing of beneficial traits in few TFPs. This suggests that there is ample scope of integrated use of modern omics and editing tools/techniques for improvement of TFPs and their use for sustainable food production. In this article, we highlight the importance, scope and progress towards improvement of TFPs for valuable traits by integrated use of omics and gene editing techniques.

Centromeres, the chromosomal loci where spindle fibers attach during cell division to segregate chromosomes, are typically found within satellite arrays in plants and animals. Satellite arrays have been difficult to analyze because they comprise megabases of tandem head-to-tail highly repeated DNA sequences. Much evidence suggests that centromeres are epigenetically defined by the location of nucleosomes containing the centromere-specific histone H3 variant cenH3, independently of the DNA sequences where they are located; however, the reason that cenH3 nucleosomes are generally found on rapidly evolving satellite arrays has remained unclear. Recently, long read sequencing technology has clarified the structures of satellite arrays and sparked rethinking of how they evolve, while new experiments and analyses have helped bring both understanding and further speculation about the role these highly repeated sequences play in centromere identification.

The CRISPR-Cas9 system is an emerging therapeutic tool with the potential to correct diverse ge-netic disorders. However, for gene therapy applications an efficient delivery vehicle is required, capable of delivering the CRISPR-Cas9 components into the cytosol of the intended target cell population. Once there, the ribonucleoprotein complex (RNP) can be transported into the nucleus. Lipid nanoparticles (LNP) serve as promising candidates for delivery of CRISPR-Cas9 RNP. These delivery vehicles have been optimized for the delivery of nucleic acids, such as mRNA. Co-delivery of Cas9 encoding mRNA with the accompanying sgRNA leads to translation of the Cas9 protein and formation of the Cas9 RNP inside the cell. Only recently, direct delivery of the CRISPR-Cas9 RNP complexes has been explored, which requires adjustments to the LNP formulation. In this study, the importance of buffer composition and cationic charge during RNP and ssDNA en-trapment in LNP are demonstrated. After optimizing several formulation parameters, LNP were prepared that were colloidally stable in human plasma and efficiently deliver the SpCas9 RNP and ssDNA for HDR-correction in reporter cells. Under optimal formulation conditions, gene knock-out and gene correction efficiencies as high as 80% and 20%, respectively were achieved at nanomolar CRISPR-Cas9 RNP concentrations.

Panax notoginseng is a traditional Chinese medicine, and saponins are its main active ingredients. The content of saponins in flower of P. notoginseng is the highest in the whole plant. Minor ginsenosides have stronger pharmacological activity than main ginsenosides, but its content in nature is very low. We can use extracted total saponins from P. notoginseng flower as the substrate to produce minor ginsenosides by biotransformation method. In this study, we used the fungus Talaromyces flavus and its crude enzymes to transform the extracted total saponins of P. notoginseng flower. Through the qualitative and quantitative analysis of the transformation substrates and products, it was found that minor ginsenosides Gyp-XVII, ginsenosides C-Mc1, C-Mx1, F2, Rg3, 20(R)-Rg3, Rk1 and Rg5 were found in the products and the conversion rate of the major saponins in P. notoginseng flower ranged from 44.16 to 55.22%, the yields of the minor ginsenosides ranged from 0.05 to 3.24%. This study provided a good experimental idea, greatly increased the utilization rate of total saponins in P. notoginseng flower, and laid a foundation for promoting the wide application of minor saponins.

Modified mRNAs (modRNAs) are an emerging delivery method for gene therapy. In particular, the modRNA-based COVID-19 vaccines have proven that modRNA is a safe and effective therapeutic tool. Moreover, modRNA has the potential to treat various human diseases including cardiac dysfunction. Acute myocardial infarction (MI) is a major cardiac disorder that currently lacks curative treatment options. MI is commonly accompanied by fibrosis and impaired cardiac function. Our group previously demonstrated that the matricellular protein CCN5 inhibits cardiac fibrosis (CF) and improves cardiac dysfunction. However, it remains elusive whether the early intervention of CF under stress conditions is beneficial or more detrimental due to potential adverse effects such as left ventricular (LV) rupture. To obtain acute CCN5 expression, we used modRNA-mediated gene transfer in a mouse MI model. To evaluate CCN5 activity, we established two independent experimental schemes: 1) preventive intervention and 2) therapeutic intervention. Cardiac function and structural changes were measured by echocardiography and magnetic resonance imaging. Finally, fibrosis and the underlying molecular pathway were analyzed by western blotting, quantitative real-time polymerase chain reaction, and immunohistochemistry. The modRNA-CCN5 gene transfer successfully ameliorated CF and enhanced cardiac function in both preventive and therapeutic interventions without LV rupture or any adverse cardiac remodeling. Conclusively, early intervention in CF by modRNA-CCN5 gene transfer is an efficient and safe therapeutic modality for treating MI-induced heart failure without adverse structural remodeling.

Fetal Alcohol Spectrum Disorders (FASD) represent a continuum of lifelong impairments resulting from prenatal exposure to alcohol, with significant global impact. The “spectrum” of disorders includes a continuum of physical, cognitive, behavioral, and developmental impairments, which can have profound and lasting effects on individuals throughout their lives impacting their health, social interactions, psychological well-being and every aspect of their lives. This narrative paper explores the intricate relationship between oxidative stress and epigenetics in FASD pathogenesis and its therapeutic implications. Oxidative stress, induced by alcohol metabolism, disrupts cellular components, particularly in the vulnerable fetal brain, leading to aberrant development. Furthermore, oxidative stress is implicated in epigenetic changes, including alterations in DNA methylation, histone modifications, and microRNA expression, which influence gene regulation in FASD patients. Moreover, mitochondrial dysfunction and neuroinflammation contribute to epigenetic changes associated with FASD. Understanding these mechanisms holds promise for targeted therapeutic interventions. This includes antioxidant supplementation and lifestyle modifications to mitigate FASD-related impairments. While preclinical studies show promise, further clinical trials are needed to validate these interventions' efficacy in improving clinical outcomes for individuals affected by FASD. This comprehensive understanding of the role of oxidative stress on epigenetics in FASD underscores the importance of multidisciplinary approaches for diagnosis, management, and prevention strategies. Continued research in this field is crucial for advancing our knowledge and developing effective interventions to address this significant public health concern.

In this study the effects of three different main preparatory tillage operations [ploughing at 0.4 m (P40) and 0.20 m (P20) depth and minimum tillage at 0.20 m depth (MT) each of them carried out at two different soil water contents (WC) [low, 58% (LH) and high, 80% (HH) of field capacity] were investigated. The results obtained in this research show high values of soil strength in term of Penetration resistance (CI) and shear strength (SS) particularly in deeper soil layers at lower water content. Fossil-fuel energy requirements both for P40 LH and P20 LH were 25 and 35% higher with respect to the HH treatments and tractor slip were very high (P40 LH = 32.4%) with respect to the P40 HH treatment (16%). Therefore soil water content had significantly influenced tractor performance during soil ploughing, particularly at 0.40 m depth while MT was not influenced at all. A significant correlation between grain yield and soil penetration resistance was found highlighting how soil strength may be good indicator of its productivity. Obtained results during these field tests allowed considering MT and P20 treatments more suitable for this type of soil in climate change scenarios.

The existence of multiple copies of genes is a well-known phenomenon. A gene family is a set of sufficiently similar genes, formed by gene duplication. In earlier works conducted on limited number of completely sequenced and annotated genomes it was found that size of gene family and size of genome are positively correlated. Additionally, it was found that several atypical microbes deviated from the observed general trend. In this study, we reexamined these associations on a larger dataset consisting of 1484 prokaryotic genomes and using several ranking approaches. We applied ranking methods in such a way that genomes with lower number of paralogs would have lower rank. Until now only simple ranking methods were used; we applied the Kemeny optimal aggregation approach as well. Regression and correlation analysis were utilized in order to accurately quantify and characterize the relationships between measures of paralog indices and genome size. In addition, boxplot analysis was employed as a method for outlier detection. We found that, in general, all paralog indexes positively correlate with an increase of genome size. As expected, different groups of atypical prokaryotic genomes were found for different types of paralog quantities.

Memory and emotion are highly vulnerable to psychiatric disorders like post-traumatic stress disorder (PTSD), which has been linked to serotonin (5-HT) metabolism disruptions. In fact, over 90% of the 5-HT precursor tryptophan (Trp) is metabolized via the Trp-kynurenine (KYN) meta-bolic pathway, producing a variety of bioactive molecules. The aadat (kat2) gene encodes mito-chondrial kynurenine aminotransferase (KAT) isotype 2, responsible for kynurenic acid (KYNA) production. Little is known about its role in behavior. In CRISPR/Cas9-induced aadat knockout (kat2−/−) mice, we examined the effects on emotion, memory, motor function, Trp and its metabolite levels, enzyme activities in the plasma and the urine of 8-week-old males compared to wild-type mice. Transgenic mice showed more depressive-like behaviors in the forced swim test, but not in the tail suspension, anxiety, or memory tests. They also had fewer center field and corner entries, shorter walking distances, and fewer jumping counts in the open field test. Plasma metabolite levels are generally consistent with those of urine: KYN, antioxidant KYNs, 5-hydroxyindolacetic acid, and indole-3-acetic acid levels are lower; enzyme activities in KATs, kynureninase, and monoamine oxidase/aldehyde dehydrogenase are lower, but kynurenine 3-monooxygenase is higher; and ox-idative stress and excitotoxicity indices are higher. Transgenic mice show depression-like behavior in a learned helplessness model, emotional indifference, and motor deficits, coupled with a decrease in KYNA, a shift of Trp metabolism toward the KYN-3-HK pathway, and a partial decrease in the gut microbial Trp-indole pathway metabolite. This is the first evidence that deleting the aadat gene causes depression-like behaviors that are unique to despair experience, which appears to be linked to excitatory neurotoxic and oxidative stresses. This may lead to the development of a double-hit preclinical model in experience-based depression, better understanding of these complex condi-tions, and more effective therapeutic strategies by elucidating the relationship between Trp me-tabolism and PTSD pathogenesis.

Heterometallic rare-earth clusters have garnered much attention because of their interest-ing solid-state structures and versatile applications in catalysis and material and polymer chemistry over the last four decades. Particular interest is rare earth–transition metal co-ordination compounds that behave as single-molecule magnets (SMMs) because of their potential use in information storage, spintronic devices, and magnetic refrigeration sys-tems. Another implementation involves using lanthanide clusters in luminescent-based sensing for environmental protection and security screening or in photocatalytic energy conversion reactions. Heterometallic rare earth complexes offer the promise of catalytic performance of many organic reactions due to their high oxygenophilicity, Lewis acidity, high coordination numbers, and ability to change the coordination environment quickly. Therefore, they are commonly applied as catalysts in asymmetric synthesis, oxidation re-actions, and CO2 conversions or as initiators in ring-opening polymerization and copoly-merization of cyclic monomers. They are also attractive single-source molecular precur-sors for functional inorganic materials. This review focused on the unique features and properties of the heterometallic rare earth complexes, which are closely correlated with their molecular structure. Our summary is a valuable resource, providing researchers with an insightful exploration of the heterometallic rare-earth complexes that demonstrated multimetallic synergy and cooperativity effects in various applications.

Nanoparticles have been used as a novel drug delivery system. Drug-incorporated nanoparticles for local delivery might optimize the efficacy and minimize the side effects of drugs. The efficacy and safety of intratracheal administration of prostacyclin analog (beraprost)-incorporated nanoparticles and imatinib, a PDGF-receptor tyrosine kinase inhibitor, -incorporated nanoparticles in Sugen-hypoxia-normoxia or monocrotaline rat models of PAH and in human PAH-pulmonary arterial smooth muscle cells have been reported. The use of inhaled drug-incorporated nanoparticles might be a novel approach for treatment of PAH.

Elevated carbon dioxide (eCO₂) stimulates wheat grain yield, but simultaneously reduces protein (N) concentration. Also other essential nutrients are subject to change. This study is a comprehensive synthesis of wheat experiments with eCO₂, estimating effects on N, minerals (B, Ca, Cd, Fe, K, Mg, Mn, Na, P, S, Zn), and starch. Analysis was made by i) deriving response functions for the relative effect on element concentration in relation to CO₂ concentration, ii) meta-analysis to test the magnitude and significance of observed effects, and iii) relating CO₂ effects on minerals to effects on N and grain yield. Responses range from zero to strong negative effects of eCO₂ on mineral concentration, with largest reductions for the nutritionally important elements N, Fe, S, Zn and Mg. Together with the positive but small and non-significant effect on starch concentration, the large variation in effects suggests that CO₂-induced responses cannot be explained by a simple dilution model. To explain the observed pattern, uptake and transport mechanisms may have to be considered, along with the link of different elements to N uptake. Our study shows that eCO₂ has a significant effect on wheat grain stoichiometry, with implications for human nutrition in a world of rising CO₂.

The most widely distributed bla_CTX-M gene on a global scale is bla_CTX-M-15. The dissemination has been associated with clonal spread and different types of mobile genetic elements. This study aimed to review and describe the genetic environments of bla_CTX-M-15 gene detected from Enterobacteriaceae in published literature from Africa. A literature search for relevant articles was done through PubMed, and Google Scholars electronic databases, 43 articles from 17 African countries were included in the review based on the eligibility criteria. Insertion sequences were reported as part of the genetic environment of bla_CTX-M-15 gene in 32 studies, integrons in 13 studies, and plasmids in 23 studies. In this review, five insertion sequences including ISEcp1, IS26, orf447, IS903, and IS3 have been detected associated with the genetic environment of bla_CTX-M-15 in Africa. Seven different genetic patterns were seen in bla_CTX-M-15 genetic environment. Insertion sequence ISEcp1 was commonly located upstream of the end of the bla_CTX-M-15 gene while insertion sequence orf477 was located downstream. In some studies, ISEcp1 was truncated upstream of bla_CTX-M-15 by insertion sequences IS26 and IS3. Class 1 integron (Intl1) was most reported to be associated with bla_CTX-M-15 (13 studies), with Intl1/dfrA17–aadA5 being the most common gene cassette array. IncFIA-FIB-FII multi-replicons and IncHI2 replicon types were the most common plasmid replicon types that horizontally transfer bla_CTX-M-15 gene. Aminoglycoside modifying enzymes, and plasmid-mediated quinolone resistance genes were commonly collocated with bla_CTX-M-15 gene on plasmids. This review revealed the predominant role of ISEcp1, Intl1and IncF plasmid in the mobilization and continental dissemination of the bla_CTX-M-15 gene in Africa.

Complex interactions between gene variants and environmental risk factors underlie the pathophysiological pathways in major psychiatric disorders. Autism Spectrum Disorder is a psychiatric condition in which susceptible alleles along with epigenetic memories contribute to the mutational landscape of the ailing brain. The present work reviews recent evolutionary, molecular, and epigenetic mechanisms potentially linked to the etiology of autism. First, we present a clinical vignette to describe clusters of maladaptive behaviors frequently diagnosed in autistic patients. Next, we microdissect brain regions pertinent to the nosology of autism as well as cell networks from the bilateral body plan. Lastly, we catalog a number of pathogenic environments associated with disease risk factors. This set of perspectives provides emerging insights into the dynamic interplay between epigenetic and environmental variation in the development of Autism Spectrum Disorders.

Green synthesis of silver nanoparticles (AgNPs) using raw Whey has never been reported. Silver nanoparticle formation involves a reduction reaction of silver salt solution with Whey extract. Extract and metal salt concentrations, and temperature can control this reaction. In this work, incubation period, extract, AgNO3, and NaOH concentrations were used as the independent factors using central composite design under response surface methodology. The aim was to elucidate the influence these factors have on the measured UV-Vis absorption spectra fitted with a Voigt function, and to optimize the conditions for nanoparticle formation. The fitting parameters, peak wavelength (λ0), peak area (A), and Full Width at Half Maximum (FWHM), were the responses. Silver nanoparticle formation was only possible in an alkaline environment (pH 10). The peak wavelength and the FWHM are influenced mainly by extract and AgNO3 concentrations. In contrast, the peak area is influenced by a total of 33.54 % from the interaction terms of AgNO3 and extract concentrations with NaOH. Metallic AgNPs were formed for the following parameter ranges: a) Whey (0.4 – 1.6 % v/v), b) AgNO3 (0.15 – 0.6 mM), c) NaOH (10 – 50 mM), and d) Time (20 – 60 min). Silver oxide nanoparticles were also observed.

Oligopeptide transporters (OPTs) are a group of membrane localized proteins that have a broad range of substrate transport capabilities and contribute to numerous biological processes. However, limited information has been reported on OPTs in higher plants. In this study, a comprehensive analysis of the OPT gene family in Medicago truncatula was performed. A total of 26 OPT genes (MtOPT01-MtOPT26) have been identified in the Medicago truncatula genome. Phylogenetic analyses indicated that MtOPTs consisted of two distinct subgroups, 12 MtOPTs belonged to the peptide transport subgroup (PT-OPT) based on their predicted amino acid sequences containing the two highly conserved motifs (NPG and KIPPR) and 14 MtOPTs belonged to yellow stripe subgroup (YS-OPT). The MtOPTs distributed on each of 8 chromosomes in Medicago truncatula. Sequence analysis verified that MtOPTs significant similar to those in other plants. The copy number of MtOPTs was low and the multiply of MtOPTs was simple relatively. Gene structure analysis showed that most of the MtOPTs have various numbers of introns. The multiple of MtOPTs might play different biological roles which were supported by the fact that MtOPTs have a distinct tissue-specific expression pattern. The data obtained in this study will help to better understand the complexity of the MtOPTs gene family and provide new evidence for the function and evolution of the OPT gene family in higher plants.

Lodging is one of the important factors affecting the high and stable yield of wheat worldwide. Solid-stemmed wheat has higher stem strength and lodging resistance than hollow-stemmed wheat. There are many solid stemmed varieties, landraces and old varieties of durum wheat. However, the transfer of solid stem genes from durum wheat is suppressed by the suppressor gene located on chromosome 3D in common wheat, and only hollow-stemmed lines have been created. However, synthetic hexaploid wheat can serve as a bridge to transfer solid stem genes from tetraploid wheat to common wheat. In this study, the F1, F2, and F2:3 generations of the cross between solid-stemmed Syn-SAU-119 and semisolid-stemmed Syn-SAU-117 were developed. A single dominant gene, tentatively designated Su-TdDof, was identified in synthetic hexaploid wheat Syn-SAU-117 by genetic analysis, which suppresses stem solidity. Using bulked segregant RNA-seq (BSR-seq) analysis, Su-TdDof was mapped to chromosome 7DS and flanked by markers KASP-669 and KASP-1055 within a 4.53 cM genetic interval corresponding to 3.86 Mb and 2.29Mb physical region in the Chinese Spring (IWGSC RefSeq v1.1) and Ae. tauschii (AL8/78 v4.0) genome, respectively, in which three genes related to solid stem development were annotated. Su-TdDof differed from a previously reported solid stem suppressor gene based on its origin and position. Su-TdDof would provide a valuable example for research on the suppression phenomenon. The flanking markers developed in this study would be useful for screening Ae. tauschii accessions with no suppressor gene (Su-TdDof) to develop more synthetic hexaploid wheat lines for wheat lodging resistance breeding and further cloning the suppressor gene Su-TdDof.

Angiogenesis is a critical physiological response to ischemia but becomes pathological when dysregulated and driven excessively by inflammation. We recently identified a novel angiogenic role for tripartite-motif-containing protein 2 (TRIM2) whereby lentiviral shRNA-mediated TRIM2 knockdown impaired endothelial angiogenic functions in vitro. This study sought to determine whether these effects could be translated in vivo and to determine the molecular mechanisms involved. CRISPR/Cas9-generated Trim2–/– mice that underwent a periarterial collar model of inflammation-induced angiogenesis exhibited significantly less adventitial macrophage infiltration relative to wildtype (WT) littermates, concomitant with decreased mRNA expression of macrophage marker Cd68 and reduced adventitial proliferating neovessels. Mechanistically, TRIM2 knockdown in endothelial cells in vitro attenuated inflammation-driven induction of critical angiogenic mediators, including nuclear HIF-1α, and curbed the phosphorylation of downstream effector eNOS. Conversely, in a hindlimb ischemia model of hypoxia-mediated angiogenesis, there were no differences in blood flow reperfusion to the ischemic hindlimbs of Trim2–/– and WT mice despite a decrease in proliferating neovessels and arterioles. TRIM2 knockdown in vitro attenuated hypoxia-driven induction of nuclear HIF-1α but had no further downstream effects on other angiogenic proteins. Our study has implications for understanding the role of TRIM2 in the regulation of angiogenesis in both pathophysiological contexts.

Tomato (Solanum lycopersicum) is one of the most cultivated vegetables in the world due to its consumption in a large variety of raw, cooked, or processed foods. Tomato breeding and productivity highly depend on the use of hybrid seeds and their higher yield, environmental adaption, and disease tolerance. However, the emasculation procedure during hybridization raises tomato seed production costs and labor expenses. Using male sterility is an effective way to reduce the cost of hybrid seeds and ensure cultivar purity. Recent developments in CRISPR genome editing technology enabled tomato breeders to investigate the male sterility genes and to develop male-sterile tomato lines. In the current study, the tomato Acotinase (SlACO) gene family was investigated via in-silico tools and functionally characterized with CRISPR/Cas9-mediated gene disruption. Genome-wide blast and HMM search represented two SlACO genes located on different tomato chromosomes. Both genes were estimated to have a segmental duplication in the tomato genome due to their identical motif and domain structure. One of these genes, SlACO2, showed a high expression profile in all generative cells of tomato. Therefore, the SlACO2 gene was targeted with two different gRNA/Cas9 construct to identify their functional role in tomato. The gene was mutated in a total of 6 genome-edited tomato lines, 2 of which were homozygous. Surprisingly, pollen viability was found to be extremely low in mutant plants compared to their wild-type (WT) counterparts. Likewise, the number of seeds per fruit also sharply decreased more than fivefold in mutant lines (10-12 seed) compared to that in WT (67 seed). The pollen shape, anther structures, and flower colors/shapes were not significantly varied between the mutant and WT tomatoes. The mutated lines were also subjected to salt and mannitol-mediated drought stress to test the effect of SlACO2 on abiotic stress tolerance. The results of the study indicated that mutant tomatoes have higher tolerance with significantly lower MDA content under stress conditions. This is the first CRISPR-mediated characterization of ACO genes on pollen viability, seed formation, and abiotic stress tolerance in tomato.

Ostreococcus tauri is a simple unicellular green alga representing an ecologically important group of phytoplankton in oceans worldwide. Modern molecular techniques must be developed in order to understand the mechanisms that permit adaptation of microalgae to their environment. We present for the first time in O. tauri a detailed characterization of individual genomic integration events of foreign DNA of plasmid origin after PEG-mediated transformation. Vector integration appears to be random, occurring mainly at a single locus, and thus confirming the utility of this technique for insertional mutagenesis. While the mechanism of double-stranded DNA repair in the O. tauri model remains to be elucidated, we clearly demonstrate by genome resequencing that the integration of the vector leads to frequent structural variations (deletions/insertions and duplications) and some chromosomal rearrangements in the genome at the insertion loci, and often within the vector sequence itself. From these observations, we speculate that a non-homologous end joining-like mechanism is required during random insertion events, as described in plants and other freshwater algal models. PEG-mediated transformation is therefore a promising molecular biology tool, not only for functional genomic studies, but also for biotechnological research in ecologically important marine algae.

Histones display a wide variety of post-translational modifications, including acetylation, methylation, and phosphorylation. These epigenetic modifications can influence chromatin structure and function without altering the DNA sequence. Histones can also undergo post-translational O-GlcNAcylation, a rather understudied modification that plays critical roles in almost all biological processes and is added and removed by O-linked N-acetylglucosamine transferase and O-GlcNAcase, respectively. This review provides a current overview of our knowledge of how O-GlcNAcylation impacts the histone code both directly and by regulating other chromatin modifying enzymes. This highlights the pivotal emerging role of O-GlcNAcylation as an essential epigenetic marker.

Human cytomegalovirus (HCMV) tegument protein pp150 is essential for the completion of final steps in virion maturation. Earlier studies indicated that three pp150nt (N terminal one-third of pp150) conformers cluster on each triplex (Tri1, Tri2A and Tri2B) and extend towards small capsid proteins atop nearby major capsid proteins forming a net-like layer of tegument densities that enmesh and stabilize HCMV capsids. Based on this atomic detail, we designed several peptides targeting pp150nt. Our data show significant reduction in virus growth upon treatment with one of these peptides (pep-CR2) with an IC50 of 1.33 μM. Based on 3D modeling, pep-CR2 specifically interferes with the pp150-capsid binding interface. Cells pre-treated with pep-CR2 and infected with HCMV sequester pp150 in the nucleus indicating a mechanistic disruption of pp150 loading onto capsids and subsequent nuclear egress. To enhance the in-vivo inhibitory potential and bioavailability of pep-CR2, we conjugated it with a carrier molecule (elastin like polypeptide (ELP)). The ELP-pep-CR2 conjugate was expressed in E.coli and purified. Upon treatment with ELP-pep-CR2, HCMV showed significant titer reductions with no significant impact on cell viability. These results indicate that CR2 of pp150 is amenable to targeting by a peptide inhibitor and can be developed into an effective antiviral.

The criteria of “Distinctness, Uniformity and Stability” as well as a high "overall quality index” are used to register the Italian modern varieties to the national register. Differently, local conservation varieties can be certified under different EU Directives having, as overall objective, the preservation of biodiversity and the containment of genetic erosion. In recent years, products derived from an-cient grains are perceived to be healthier and more sustainable by consumer, especially in Italy, with consequent higher market prices. Ancient tetraploid wheat varieties registered in the national reg-ister of conservation varieties are 28, 24 of which are Sicilian. They are supposed to have a wide genetic variability compared to modern ones, making them vulnerable of fraud because they are difficult to trace. It is therefore important to have tools able to discriminate the autochthonous Si-cilian varieties. This can be done by gluten proteins composition, which also gives information on the technological properties of derived products. Fifty-one accessions belonging to 22 ancient va-rieties of Sicilian tetraploid (mostly durum) wheat were analyzed. Although a wide intra-accession and intra-varietal variability was assessed, the gliadin pattern of bulks of seeds belonging to each variety was discriminatory. Moreover, differences in technological attitudes were found between landraces. This paves the way to use gluten protein patterns for traceability allowing local farmers and producers to valorize their products and assure consumers about the transparency of the entire supply chain.

African swine fever virus (ASFV) is a large double stranded DNA arbovirus that is highly contagious and seriously endangers the lives of domestic and wild pigs. In the past decade, African swine fever (ASF) has spread in many countries in the Caucasus, Russian Federation, Eastern Europe and Asia, causing significant losses to the pig industry. At present, there is a lack of effective vaccine and treatment for ASF. Therefore, the rapid and accurate detection is crucial for ASF prevention and control. In this study, we have developed a portable lateral flow strip (LFS) detection method mediated by recombinase polymerase amplification (RPA) and DNA enzyme (LwCas13a), which is performed at 37 ℃ and visualized by eyes without the need for complex instruments. This RPA-LwCas13a-LFS is based on the ASFV structural protein p17 gene (D117L), with a detection sensitivity up to 2 gene copies. This method is highly specific and has no cross reactivity to 7 other pig viruses. In the detection of 33 clinical samples, the p17 (D117L) RPA-LwCas13a-LFS had 100% coincidence with conventional quantitative PCR (qPCR). These findings demonstrate the potential of this simple, rapid, sensitive, and specific ASFV detection method for on-site ASFV detection.

Epidemiological data highlight prostate cancer as a significant global health issue, with high incidence and substantial impact on patients' quality of life. The prevalence of this disease is associated with various factors, including age, heredity, and race. Recent research in prostate cancer genetics has identified several genetic variants that may be associated with an increased risk of developing the disease. However, despite the significance of these findings, genetic markers for prostate cancer are not currently utilized in clinical practice as reliable indicators of the disease. In addition to genetics, epigenetic alterations also play a crucial role in prostate cancer development. Aberrant DNA methylation, changes in chromatin structure, and microRNA (miRNA) expression are major epigenetic events that influence oncogenesis. Existing markers for prostate cancer, such as prostate-specific antigen (PSA), have limitations in terms of sensitivity and specificity. The cost of testing, follow-up procedures, and treatment for false-positive results and overdiagnosis contributes to the overall healthcare expenditure. Improving the effectiveness of prostate cancer diagnosis and prognosis requires either narrowing the risk group by identifying new genetic factors or enhancing the sensitivity and specificity of existing markers. Immunological biomarkers (both circulating and intra-tumoral), including markers of immune response and immune dysfunction, represent a potentially useful area of research for enhancing the diagnosis and prognosis of prostate cancer. Our review emphasizes the need for developing novel immunological biomarkers to improve the diagnosis, prognosis, and management of prostate cancer. We highlight the most recent achievements in the identification of biomarkers provided by circulating monocytes and tumor-associated macrophages (TAMs). We highlight that monocytes-derived and TAMs-derived biomarkers can enable to establish the missing links between genetic predisposition, hormonal metabolism and immune responses in prostate cancer.

This research investigates the complex transformation of the Baltic Clean and Dirty Tankers markets from 1998 to 2023. Our study quantifies the market multifractality in two distinct periods, from 1998 to 2010 and 2010 to 2023. We compare multifractal measures of the original, surrogated, and shuffled data, which indicate high multifractality and a complex market structure influenced by temporal organization and inherent volatility. Shuffled data analysis emphasizes the critical role of temporal sequences within market behaviour. Additionally, the study delves into external factors such as regulatory changes, economic disturbances, technological innovation, and environmental concerns contributing to market complexity. A distinct shift in multifractal values between the two periods suggests an evolution from crisis-induced complexities to a market influenced by diversified and modern dynamics. Our findings offer a concise understanding of the multifractal nature of the tanker markets and how global crises can impact the markets, emphasizing the importance of considering systemic risks in freight market analysis.

Background and Objectives: High job strain is worsening the outcome in coronary artery disease, CAD. Severe dissatisfaction on workplace, imbalance between high demands , and low rewards, are affecting the quality of life, and diminishing the duration of life, especially in CAD patients. Our study included two samples : CAD patients (experimental group), and without CAD patients, but with traditional risk factors (control group). The main objective of the study was the role played by high sensitivity C reactive protein, hs CRP, and microalbuminuria, as mediators of job strain and CAD relationship. Secondary objectives were the following: identification of the most vulnerable patients( with significant job strain) and intervention towards this category, for cardiovascular events prevention (primary or secondary). Materials and Methods: The utilized methods were the following : clinical exam; electrocardiogram; echocardiogram; non contrast enhanced computed chest tomography; laboratory findings ( lipid profile, glycemia, hs CRP, microalbuminuria); type D scale, DS 14; depression questionnaire, PHQ-9; and satisfaction with work scale, SWWS. Results: The highest values for hs CRP and microalbuminuria were noticed in patients with the lowest Likert score, for both samples CAD, and without CAD patients. The highest job strain was noticed in females. More than half of CAD patients ,with low Likert scores, revealed myocardial infarction. Conclusions: Microalbuminuria and hs CRP were statistical significant in the study as intercessors, in job strain and CAD relationship. The most vulnerable patients for vascular events were females, in both groups : CAD and “CAD waiting desk”. In CAD sample, the vascular vulnerability was also increased by high job strain.

The positional cloning of single nucleotide polymorphisms (SNPs) of the neutrophil cytosolic factor 1 (Ncf1) gene, advocating that a low oxidative burst drives autoimmune disease, demands an understanding of the underlying molecular causes. A cellular target could be T cells, which have been shown to be regulated by reactive oxygen species (ROS). However, the pathways by which ROS mediate T cell signaling remain unclear. The adaptor molecule linker for activation of T cells (LAT) is essential for coupling T cell receptor-mediated antigen recognition to downstream responses, and it contains several cysteine residues that have previously been suggested to be involved in redox regulation. To address the possibility that ROS regulate T cell-dependent inflammation through LAT, we established a mouse strain with cysteine-to-serine mutations at positions 120 and 172 (LATSS). We found that redox regulation of LAT through C120 and C172 mediate its localization and phosphorylation. LATSS mice had reduced numbers of double-positive thymocytes and naïve peripheral T cells. Importantly, redox insensitivity of LAT enhanced T cell-dependent autoimmune inflammation in collagen-induced arthritis (CIA), a mouse model of rheumatoid arthritis (RA). This effect was reversed on an NCF1-mutated (NCF1m1j), ROS-deficient, background. Overall, our data shows that LAT is redox-regulated, acts to repress T cell activation, and is targeted by ROS induced by NCF1 in antigen-presenting cells (APCs).

RNA interference is a highly conserved process in which non-coding small RNAs (sRNA) modulate gene expression at the post-transcriptional level influencing plant growth and development. Dicer-like (DCL), Argonaute (AGO) and RNA-dependent RNA polymerase (RDR) are the core elements involved in gene silencing and their gene families have been explored in many plants. However, these genes and their response to abiotic stresses have not yet been well in wheat. In this study, 82 AGO, 31 DCL, and 31 RDR genes were identified and phylogenetic analysis of these proteins showed that clustered into ten, four and four clades respectively. RNA-seq analysis revealed constitutive expression of AGO1, AGO9, and DCL2 family expression analysis in tissues under normal and stress conditions, whereas RDR1 which is known to engage in siRNA biogenesis showed higher expression levels in wheat leaf tissues. Our findings build the foundation for comparative genomics analyses of RNA silencing elements in cereal crops, as well as new insights into the functional complexity of RNA silencing in wheat stress responses, which is critical for understanding the processes underlying wheat stress responses.

Hox gene clusters are crucial in Embryogenesis. It was observed that some Hox genes are located in order along the telomeric to centromeric direction of the DNA sequence: Hox1, Hox2, Hox3…. These genes are expressed in the same order in the ontogenetic units of the Drosophila embryo along the Anterior-Posterior axis. The two entities (genome and embryo) differ significantly in linear size and in-between distance. This strange phenomenon was named Spatial Collinearity (SP). Later, it was observed that, particularly in the Vertebrates, a Temporal Collinearity (TC) coexists: first is Hox1 expressed, later Hox2 and even later Hox3,…,. According to a Biophysical Model (BM), pulling forces act at the anterior end of the cluster while a cluster fastening applies at the posterior end. Hox clusters are irreversibly elongated along the force direction. During Evolution, the elongated Hox clusters are broken at variable lengths thus split clusters may be created. An Empirical Rule was formulated distinguishing development due to a complete Hox cluster from development due to split Hox clusters. BM can ‘explain’ this Empirical Rule. In a spontaneous mutation where the cluster fastening is dismantled, a weak pulling force automatically shifts the cluster inside the Hox activation domain. This cluster translocation can probably explain the absence of Temporal Collinearity in Drosophila.

Plant breeding conventionally depends on genetic variability available in a species to improve a particular trait in the crop. However, epigenetic diversity may provide an additional tier of variation. The recent advent of epigenome technologies has elucidated the role of epigenetic variation in shaping phenotype. Further, the development of epigenetic recombinant inbred lines (epi-RILs) in the model species such as Arabidopsis has enabled accurate genetic analysis of epigenetic variation. Subsequently, mapping of epigenetic quantitative trait loci (epiQTL) allowed association between epialleles and phenotypic traits. Thus, quantitative epigenetics provides ample opportunities to dissect the role of epigenetic variation in trait regulation, which can be eventually utilized in crop improvement programs. Moreover, locus-specific manipulation of DNA methylation by epigenome-editing tools such as clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) can facilitate epigenetic based molecular breeding of important crop plants.

The changing of banking customer preferences after Covid-19 pandemic encourages banking transformation. Neobanks emerges as innovation in banking that enter the market to compete with the incumbent banks by offering new digital experience for customer. This paper analyzes the neobanks which transformed from traditional bank, specifically its efficiency after they implement digital transformation. Efficiency is measured by using Stochastic Frontier Analysis (SFA). This study also uses Pooled Mean Group (PMG) of Panel ARDL (Autoregressive Distributed Lagged) to investigate digital transformation as one of determinants neobank’s efficiency, as well as to examine the existence of short-term and long-term relationship between digital transformation and efficiency. The SFA results show that the efficiency of the neobanks increase after they carry out digital transformation. Furthermore, from PMG Panel ARDL, it can be concluded that digital transformation is one of determinant of efficiency and there is longevity relationship between digital transformation and efficiency. In the short run, digital transformation has a significant and negative correlation with efficiency and in the long run, it has a significant positive relationship because initially digital transformation cost for operational and risk management innovation decreases the profit efficiency, but afterwards it increases the profit efficiency.

The search of DNA polymorphisms useful for the genetic improvement of dairy farm animals lasts more than 40 years with relevant findings in cattle for milk traits, where the best combination of alleles for dairy processing have been found in casein genes and in the DGAT1. Nowadays, similar results are not reached yet in river buffaloes despite advanced genomic technologies and accurate phenotype records are available. The aim of the present study was to investigate and validate in a larger buffalo population the effect on six milk traits of four single nucleotide polymorphisms (SNP) in the CSN1S1, CSN3, SCD and LPL genes, previously reported to be associated with or affect dairy traits in smaller populations often belonging to one farm. A total of 800 buffaloes were genotyped. Daily milk yield (dMY, kg), protein yield (dPY, kg) and fat yields (dFY, kg), fat and protein contents (dFP, % and dPP, %), somatic cell count (SCC, 103cell/ml) and urea (mg/dl) were individually recorded in each month for the whole lactation from 2010 to 2021. A total of 15,742 individual milk test day records (2,496 lactations) were available on 680 buffalo cows with 3.6±1.7 parity (from 1 to 13) and 6.1±1.2 test day records per lactation on average. Three out four SNP in CSN1S1, CSN3 and LPL were associated with at least one of analyzed traits. In particular, the CSN1S1 (AJ005430:c.578C>T) gave favorable associations with all yield traits (dMY, p=0.022; dPY, p=0.014 ; dFY, p=0.029) and SCS (p=0.032), whereas the CSN3 (HQ677596: c.536C>T) positively associated with SCS (p=0.005) and milk urea (p=0.04). Favorable effect on dMY (p=0.028), dFP (p=0.027) and dPP (p=0.050) were observed for the LPL. Conversely, SCD did not show any association with milk traits. This is the first example of confirmation study carried out in the Mediterranean river buffalo for genes of economic interest in dairy field and it represents a very important indication for the preselection of young bulls destined to breeding programs in the view of a more sustainable dairy production.

KLHL genes and the related KBTBD genes encode components of the Cullin-E3 ubiquitin ligase complex and typically target tissue-specific proteins for degradation, thereby affecting differentiation, homeostasis, metabolism, cell signaling, and the oxidative stress response. Despite their importance in normal cell function and in disease (KLHL40, KLHL41, KBTBD13, KEAP1, and ENC1), previous studies that examined epigenetic factors affecting transcription were predominantly limited to promoter DNA methylation. Using diverse tissue and cell culture whole-genome profiles, we examined 17 KLHL or KBTBD genes preferentially expressed in skeletal muscle or brain to identify tissue-specific enhancer and promoter chromatin, open chromatin (DNaseI hypersensitivity), and DNA hypomethylation. Sixteen of the 17 genes displayed muscle- or brain-specific enhancer chromatin in their gene bodies, and most exhibited specific intergenic enhancer chromatin as well. Seven genes were embedded in a super-enhancer. The enhancer chromatin regions typically displayed foci of DNA hypomethylation at peaks of open chromatin. In addition, we found evidence that gene neighbors (HHATL and FBXO32) of KLHL40 and KLHL38 harbor enhancer chromatin that likely upregulates the adjacent KLHL gene. Many KLHL/KBTBD genes had tissue-specific promoter chromatin at their 5’ ends, but surprisingly, two (KBTBD11 and KLHL31) had constitutively unmethylated promoter chromatin in their 3’ exons that overlaps a retrotransposed KLHL gene. Our findings demonstrate the importance of expanding epigenetic analyses beyond the 5’ ends of genes in studies of normal and abnormal gene regulation.

Video editing is a high-required job, for it requires skilled artists or workers equipped with plentiful physical strength and multidisciplinary knowledge, such as cinematography, aesthetics. Thus gradually, more and more researches focus on proposing semi-automatical and even fully automatical solutions to reduce workloads. Since those conventional methods are usually designed to follow some simple guidelines, they lack flexibility and capability to learn complex ones. Fortunately, the advances of computer vision and machine learning make up the shortages of traditional approaches and make AI editing feasible. There is no survey to conclude those emerging researches yet. This paper summaries the development history of automatic video editing, and especially the applications of AI in partial and full workflows. We emphasizes video editing and discuss related works from multiple aspects: modality, type of input videos, methology, optimization, dataset, and evaluation metric. Besides, we also summarize the progresses in image editing domain, i.e., style transferring, retargeting, and colorization, and seek for the possibility to transfer those techniques to video domain. Finally, we give a brief conclusion about this survey and explore some open problems.

The adulteration of goat milk powder occurs frequently, cattle-derived and soybean-derived ingredients are common adulterants in goat milk powder. However, simultaneously and rapidly detecting cattle-derived and soybean-derived components is still a challenge. high throughput and efficient screening method for adulteration detection is need. In this study, a rapid method was developed to detect the adulteration of common cattle-derived and soybean-derived components simultaneously in goat milk powder by combining the CRISPR/ Cas12a system with recombinant polymerase amplification (RPA). A dual DNA extraction method was employed, primers and crRNA for dual detection were designed and screened, and a series of condition optimizations were carried out in this experiment. The optimized assay can rapidly detect cattle-derived and soybean-derived components in 40 min. The detection limits of both cattle-derived and soybean-derived components were 1% (w/w) for the mixed adulteration models. The established method was applied into a blind survey of 55 commercially available goat milk powder products. The results showed that 36.36% of the samples contained cattle-derived or soybean-derived ingredients, which revealed the noticeable adulteration situation in the goat milk powder market. This study realizes a fast flow of dual extraction, dual amplification and dual detection of cattle-derived and soybean-derived components in goat milk powder for the first time. It can be used for high-throughput and high-efficiency on-site primary screening of goat milk powder adulterants, and provide a technical reference for combating with food adulteration.