The study examines the survival status of Scapharca broughtonii and Scallop Chlamys farreri under diverse seasons, sizes, and mixed breeding ratios. The objective is to explore the feasibility and economic benefits of the mixed breeding patterns of different shellfish varieties. The findings demonstrate that the overwintering mortality rate of mixed-cultured S.broughtonii ranges from 12.04% to 16.85%, which is conspicuously lower than that of individually cultured S.broughtonii. The summer mortality rate of mixed-cultured S.broughtonii with a size of 2.5 - 4.0 cm is significantly lower than that of individually cultured S.broughtonii (P < 0.05). There is no notable difference in the mortality between monoculture and polyculture of C.farreri. There is no significant disparity in the growth of C.farreri and S.broughtonii in monoculture and polyculture. The optimal polyculture size of the two scallops is 2.5 cm, and the ideal polyculture ratio is 1:1. The co-culture model of S.broughtonii and C.farreri in suspension cages has a high input-output ratio (1:1.9). It can effectively lower the winter and summer mortality rates of ark clams, representing an efficacious new methodology for marine shellfish farming.

In two laboratory trials natural products, including freshly-picked leaves from spearmint, rosemary, and tansy plants; a water extract from soybean plants; peels from a common cucumber; and 1% peppermint oil in hexane were placed in a moist harborage preferred by Argentine ants, Linepithema humile, and the number of ants entering the harborage after two and four hours was counted. None of the recommended home remedies (tansy, cucumber, or soybean extract) deterred ants from an attractive, moist harborage in either trial even when the quantity of these treatments was increased 4- to 10-fold. Freshly picked leaves from rosemary and spearmint plants deterred ants from harboring, and the 1% peppermint oil was the most deterrent of all treatments.

Motivated by the intriguing discovery of $X(6900)$ by LHCb Collaboration, we undertake a comprehensive study of the $s\bar{s}s\bar{s}$ tetraquark system in positive parity, employing the Gaussian expansion within the chiral quark model method. We consider two structures, diquark-antidiquark ($ss$-$\bar{s}\bar{s}$) structure and meson-meson ($s\bar{s}$-$s\bar{s}$)strcuture, encompassing all conceivable color and spin configurations. Despite the absence of bound states in our calculations, we have identified potential resonant states with $J^P=0^{+}$, namely $R(0,2150)$ and $R(0,2915)$, as well as a resonant state with $J^P=1^{+}$ denoted as $R(1,2950)$, and a resonant state with $J^P=2^{+}$ denoted as $R(2,2850)$, utilizing the real-scaling method. Through a comparison of their energies and widths, we propose that $R(0,2915)$ and $R(1,2950)$ may share characteristics with $X(6900)$, while $R(0,2150)$ could be a promising experimental candidate for $f_0(2100)$. We strongly advocate for experimental investigations to shed light on the existence and properties of these resonant states.

Exploring the growth and physiological response mechanisms of rice under continuous drought stress circumstances can provide a significant scientific foundation and technological assistance for meeting drought difficulties, improving drought resistance and rice (Oryza sativa L.) output, and ensuring food security. In this study, a rice field experiment was conducted under a rain shelter with five different treatments set up: P1 (drought stress from tillering stage), P2 (drought stress from jointing-booting stage), P3 (drought stress from heading-flowering stage), P4 (drought stress from grain filling stage), and CK (adequate water management throughout the growth stage). Continuous drought stress from different growth stages with four levels (mild, medium, serious, and extreme). The results showed that the effects of different drought stress treatments on rice growth varied significantly. Compared with the CK treatment, plant height was reduced by 12.10%, 8.14%, 3.83%, and 1.06% in the P1, P2, P3, and P4 treatments, respectively; and the number of tillers was reduced by 23.83%, 18.91%, 13.47%, and 8.68%, respectively. With the increase in drought stress levels, SPAD values and Rubisco activity of rice leaf continued to decrease; SOD activity showed a decreasing trend, but the decreasing trend of POD and CAT activities was not significant, while MDA content showed an increasing trend. For yield components, continuous drought stress significantly reduced spike length, effective number of spikes, thousand grain weight, grain number per spike, and fruiting rate of rice compared to CK treatments during the growth period. In general, continuous drought stress during the early growth period affected the effective spike number and the grain number per spike. Continuous drought stress after the grain filling stage had the least effect on yield and water use efficiency was much higher than other treatments. The results of these studies reveal the response of rice growth and physiology to continuous drought stress, which is important for agricultural practices.

Our results demonstrated that SWT stimulates osteoblastogenesis and increase the cell number of osteoblasts, suggesting positive regulatory effects on osteoblast differentiation. However, the effect of SWT on bone formation need further examination, since the expression of alp gene is downregulated. On the other hand, SWT appears to negatively regulate osteoclast differentiation and bone resorption, as number of osteoclasts and the expression of critical bone resorptive genes are all downregulated. Collectively, SWT might change the equilibrium of bone remodeling and increase the bone mass. Our data provided supportive evidences that this medicine formulation can be applied to treat osteoporosis or bone destructive diseases.

To characterize the fecal microbiota of lactating Bactrian camels, this study employed a random selection of camels, assigning them to three groups: the first parity group, the third parity group, and the fifth parity group. The fecal microbial community of lactating camels was assessed using 16S rRNA amplicon sequencing, and the resulting library was sequenced on an Illumina NovaSeq platform. The first parity group was characterized by Verrucomicrobiaceae as a distinctive bi-omarker, whereas Clostridiaceae exhibited a similar role to the third parity group. In terms of functional analysis, the relative abundance of the Steroid biosynthesis pathway was highest in the first parity group, whereas the fifth parity group demonstrated a higher relative abundance of the Tuberculosis pathway compared to the other groups. The first parity group exhibited the greatest presence of seven types of enzymes, whereas the fifth parity group displayed the highest levels of two specific enzymes. Additionally, a positive association was observed between the relative abundance of the Steroid biosynthesis pathway and Verrucomicrobiaceae. Furthermore, the relative abundance of the Tuberculosis pathway displayed positive correlations with 14 enzymes. In conclusion, this study revealed that different parity was associated with distinct fecal microbial ecologies in lactating Bactrian camels.

Large aluminum alloy ring forgings are the core components of heavy-duty rocket fuel storage tanks, and the large residual stress inside the rings leads to poor shape accuracy of large thin-walled parts. The initial stress of the 2219 aluminum alloy ring blank was tested using the drilling method, and the creep constitutive coefficient of the 2219 aluminum alloy was determined through stress relaxation tests. The numerical simulation processes of thermal stress relief (TSR), vibration stress relief (VSR), and thermal-vibration stress relief (TVSR) were compared and established. Through the correlation analysis between the actual measurement results of residual stress and the simulation results, it can be seen that the strong correlation in three directions at each measurement point accounts for over 37.5%, and the moderate correlation accounts for over 62.5%. This indicates that the numerical simulation model of 2219 aluminum alloy ring containing initial residual stress can accurately reflect the size and distribution of residual stress inside the actual ring. The simulation results show that the derived constitutive model can describe the stress relaxation process of TVSR by combining a single thermal time effect stress relaxation constitutive theory with a VSR plastic deformation material model. The simulation models established above were used to calculate the residual stress homogenization ability of three types of aging. The results showed that VSR, TSR, and TVSR can homogenize and reduce the residual stress field inside the ring, improve the distribution of residual stress inside the ring, and have a better overall homogenization ability of TVSR. The VSR control has a certain effect on reducing and homogenizing residual stress, but compared with TSR and TVSR, the reduction and homogenization ability of residual stress control is limited. The homogenization control effect TVSR>TSR>VSR, and the maximum equivalent stress homogenization rates of VSR, TSR, and TVSR are 52.8%, 80.6%, and 82.2%, respectively. Then, numerical simulation technology is used to study how the initial residual stress in the blank will cause the deformation of the ring during the thin-walled machining process. The roundness error theory of the minimum containment area method is applied to evaluate the deformation degree during the thin-walled numerical machining process, and the TVSR method is used for stress regulation. The deformation law of the thin-walled machining of the ring under different aging parameters is studied.

In real financial markets, the certainty equivalent rate is an important factor for investors to consider. From the value of a specific company’s certainty equivalent rate, investors can judge if this company is worth investing in. In this paper, we will explore how to obtain the value of the certainty equivalent rate so that we can evaluate a given company. First, we will introduce the theoretical support of this paper, which is put-call parity. From put-call parity, we will derive the mathematical expression for the certainty equivalent rate. Second, we will use the mathematical expression for the certainty equivalent rate to perform an empirical study. We will consider some extreme examples, including some of the best- and worst-performing stocks up to this point in 2023. Based on these stocks’ data, we will visualize the performance of these stocks and explain the meaning of the data. Finally, we will apply the results to a very popular industry—the electric vehicle industry—to explore the current electric vehicle market situation in the U.S.A.

Gender parity, is an important standard to be achieved by a society in which men and women are treated equally. The distinctions in the treatment may arise from psychology, biology, or cultural norms constructed by society. Studies show the different experiences of genders across many areas including health, education, personality, life expectancy, sports, interests, political empowerment, and careers. However, we are still far from reaching the objective, because there are conducts such as gender discrimination and expressions such as the purplewashing. In relation to feminism, purplewashing is used to define a diversity of marketing and political strategies intended at promoting people, companies, associations, and other organizations through an appeal to gender equality: they use only some of the feminist values at their convenience and in its actions, they are not really supportive of gender equality. In this opinion we aimed to address some of the reasons for inequality of opportunities based on gender; purplewashing is described as an expression that takes away the visibility of women's struggle. Additionally, we touch on some actions that promote gender equality in the family, educational, and work environments. Global leaders have an unprecedented opportunity to build gender-sensitive societies and economies. The challenges facing women today are essentially the same as they were a long time ago. It is time to break the bias.

This study presents an advanced Simulated Shearer Machine Cutting Experiment System enhanced with digital twin technology. Central to this system is a simulated shearer drum, designed based on similarity theory to mirror the operational dynamics of actual mining cutters accurately. The setup incorporates a modified machining center equipped with sophisticated sensors that monitor various parameters such as cutting states, forces, torque, vibration, temperature and sound. These sensors are crucial for precisely simulating the shearer cutting actions. The integration of digital twin technology is pivotal, featuring a real-time data management layer, a dynamic simulation mechanism model layer, and an application service layer that facilitates virtual experiments and algorithm refinement. This multifaceted approach allows for in-depth analysis of simulated coal cutting, utilizing sensor data to comprehensively evaluate the shearer's performance. The study also includes tests on simulated coal samples. The system effectively conducts experiments and captures cutting condition signals via the sensors. Through time-domain analysis of these signals, gathered while cutting materials of varying strengths, it is determined that the cutting force signal characteristics are particularly distinct. By isolating the cutting force signal as a key feature, the system can effectively distinguish between different cutting modes. This capability provides a robust experimental basis for coal-rock identification research, offering significant insights into the nuances of shearer operation.

Time-domain spectroscopy (TDS) in the Terahertz (THz) frequency range is gaining in importance in nondestructive testing of dielectric materials. One application is the layer thickness measurement of a coating layer. To determine the thickness from the measurement data, the refractive index of the coating layer must be known in the surveyed frequency range. For perpendicular incidence of the radiation, methods exist to extract the refractive index from the measurement data itself without prior knowledge. This paper extends these methods for non-perpendicular incidence, where the polarization of the radiation becomes important. Furthermore, modifications considering effects of surface roughness of the coating are introduced. The new methods are verified using measurement data of a sample of Inconel steel coated with yttria-stabilized zirconia (YSZ) and with COMSOL simulations of the measurement setup. To validate the thickness measurements, scanning electron microscopy (SEM) images of the layer structure are used. The results show good agreement with an average error of 1% for the simulation data and under 4% for the experimental data compared to reference measurements.

We changed the symmetry of the Weak Force from SU(2) to the quaternion group $Q_8$, and found that spin spacetime separates into two complementary spaces: a spin polarization spacetime of even parity states, and a spin coherence space, in the $S^3$ hypersphere, of odd parity coherent states. Under the quaternion group, spin is a boson of spin 1 in free flight and a fermion of spin $\frac{1}{2}$ when measured. It immediately follows that neutrinos are not needed to balance spin and conserve energy in beta decay. Additionally, we find the boson electrons emitted in beta decay are odd to parity, leading to parity conservation even though the observed beta distribution is asymmetrical.

The redshifted 21 cm line signal is a powerful probe of the cosmic dawn and the epoch of reionisation. The global spectrum can potentially be detected with a single antenna and spectrometer. However, this measurement requires an extremely accurate calibration of the instrument to facilitate the separation of the 21 cm signal from the much brighter foregrounds and possible variations in the instrument response. Understanding how the measurement errors propagate in a realistic instrument system and affect system calibration is the focus of this work. We simulate a 21 cm global spectrum observation based on the noise wave calibration scheme. We focus on how measurement errors in reflection coefficients affect the noise temperature, and how typical errors impact on the recovery of the 21 cm signal, especially in the frequency domain. Results show that for our example set up, a typical VNA measurement error in the magnitude of the reflection coefficients of the antenna, receiver, open cable which are 0.001, 0.001, 0.002 (linear) respectively would result in a 200 mK deviation on the detected signal, and a typical measurement error of 0.48∘, 0.78∘, 0.15∘ in the respective phases would cause a 40 mK deviation. The VNA measurement error can greatly affect the result of a 21 cm global spectrum experiment using this calibration technique, and such a feature could be mistaken for or be combined with the 21 cm signal.

In this brief review, the concepts of quantum tunneling and parity violation are introduced in the context of chiral molecules. A particle moving in a double well potential provides a good model to study the behavior of chiral molecules, where the left well and right well represent the L and R enantiomers, respectively. If the model considers the quantum behavior of matter, the concept of quantum tunneling emerges, giving place to a stereomutation dynamics between left- and right-handed chiral molecules. Parity-violating interactions, like the electroweak one, can be also considered, making possible the existence of an energy difference between the L and R enantiomers, the so-called parity-violating energy difference (PVED). Here we provide a brief account of some theoretical methods usually employed to calculate this PVED, also commenting on relevant experiments devoted to experimentally detect the aforementioned PVED in chiral molecules.

Aiming at the problems of high labor intensity and high cost of manual picking, high loss rate of mechanical picking seeds, low mechanization level and difficult to guarantee the quality of picking plates in the process of picking plates of edible sunflower. Based on the principle of manual plate taking, a plate taking control system for sunflower harvesting table was designed. Through the research and analysis of the principle of taking the plate of the edible sunflower harvesting table. According to the actual operation requirements, the overall scheme of the sunflower plate control system is determined, and the control strategy of imitating artificial low loss harvesting is designed. To reduce the grain loss in the process of taking the plate and improve the control accuracy of the system on the movement speed and displacement of the key components in the process of taking the plate, a trapezoidal acceleration and deceleration control algorithm is designed as the control algorithm of taking the plate. To verify the working performance of the plate control system, with the absolute error, relative error and total loss rate of the harvest as objectives. The bench and field verification experiments were both carried out. The bench experiment showed that the speed error of the plate parts was not more than 0.028 m/s. In the bench experiments of the device, the maximum positioning error was 1.25 mm, the average relative error is only 0.94 %, and the grain loss rate was not more than 2.26 %. It result showed that the system algorithm was reliable, the positioning accuracy was high, and the taking plate operation can be completed well. The field verification experiment showed that the forward speed of the unit was in the range of 0.4~0.8 m/s, and the total loss rate of harvest was less than 5 %. When the forward speed is 0.6 m/s, the minimum harvest loss rate is 2.32 %, and which indicated the control system meets the requirements of sunflower harvesting operation.

Background: Parity and vaginal delivery may contribute to female urinary incontinence prev-alence. The aim of this study was to evaluate the impact of parity and type of child delivery on pelvic floor muscle strength (PFMS). Material and Methods: 140 healthy women were prospectively evaluated and distributed into 4 groups: G1 (n=34) 30-40 years old; G2 (n=38) 41-50; G3 (n=35) 51-60 and G4 (n=33) over 60. De-mographic data, and body mass index (BMI) were obtained using a clinical questionnaire. Sub-jective PFMS assessments were performed using transvaginal digital palpation (TDP), and ob-jective evaluation was obtained using a portable perineometer. Results: BMI was significantly higher in G4 compared to G1. There was a positive linear rela-tionship between age and BMI. The number of pregnancies was higher in G4 compared to G2 and vaginal delivery was more frequent in G4 compared to G1 and G3. There was no statistical correlation among different groups in PFMS assessed either by TDP and perineometer. Like-wise, we did not observe any negative linear relationship between PFMS and parity or number of vaginal deliveries. Conclusion: Our data demonstrates that both the number of pregnancies and of vaginal deliv-eries had no impact on PFMS in continent women.

With the advent of Neural Machine Translation, the more the achievement of human-machine parity is claimed at WMT, the more we come to ask ourselves if their evaluation environment can be trusted. In this paper, we argue that the low quality of the source test set of the news track at WMT may lead to an overrated human parity claim. First of all, we report nine types of so-called technical contaminants in the data set, originated from an absence of meticulous inspection after web-crawling. Our empirical findings show that when they are corrected, about 5% of the segments that have previously achieved a human parity claim turn out to be statistically invalid. Such a tendency gets evident when the contaminated sentences are solely concerned. To the best of our knowledge, it is the first attempt to question the “source” side of the test set as a potential cause of the overclaim of human parity. We cast evidence for such phenomenon that according to sentence-level TER scores, those trivial errors change a good part of system translations. We conclude that to overlook it would be a mistake, especially when it comes to an NMT evaluation.

The star matter composed of nucleons deep inside the compact star like a neutron star is believed to be very dense and various new types of concepts and physical phenomena due to the nontrivial strong correlations are naturally expected. Peudo-conformality in dense star matter has been discussed recently assuming the hidden underlying scale symmetry, which is partly supported by the recent discussions of infrared conformal window of QCD. It is found that the appearance of dilaton and the dilatonic mean field calculation of nucleonic matter lead to the density independent nucleon mass at higher density regime than normal nuclear matter density. Non-vanishing constant nucleon mass can be considered as a chiral invariant mass of the parity doublet model, in which the chiral symmetry is manifested even in the massive nucleon sector provided with a parity doubling. In this paper we will discuss how the chiral and scale symmetry are correlated to lead the parity doublet symmetry inside the core of the compact star. A simple schematic model is adopted. The star matter at T=0 is basically composed of the nucleons. As a first approximation, they can be treated as free fermions with the effective mass filled up to fermi surface. There is a nontrivial feature due to the interplay between vector meson and nucleon(or equivalently dilaton, χ). The trace of energy momentum tensor approaches density independent, the pseudo-conformal phase. Local fluctuations inside the star matter will be travelling with the speed of sound which depends on the equation of state. In the pseudo-conformal phase, the speed of sound approaches to the conformal velocity for the scale symmetric matter, vc=13c. The excitations of the parity doublets in the compact star matter as an emerging phenomena in pseudo-conformal phase will be discussed in connection to the chiral symmetry. The possible implication on the corespondence of hadrons to quark degrees of freedom will be briefly discussed.

Wireless sensor networks are widely used in many applications such as environmental monitoring, health care, smart grid and surveillance. Many security protocols have been proposed and intensively studied due to the inherent nature of wireless networks. In particular, Wu et al. proposed a promising authentication scheme which is sufficiently robust against various attacks. However, according to our analysis, Wu et al.'s scheme has two serious security weaknesses against malicious outsiders. First, their scheme can lead to user impersonation attacks. Second, user anonymity is not preserved in their scheme. In this paper, we present these vulnerabilities of Wu et al.'s scheme in detail. We also propose a new scheme by fixing such vulnerabilities and improving the performance of the protocol.

Electric tractors have many advantages, including high torque, excellent controllability, energy efficiency, simple structure, and electric interface for expansion. However, a significant limitation lies in their endurance. This study presents the design of an extended-range power supply system to ensure continuous endurance of electric tractor. The objective is to provide a continuous power source for our self-developed electric tractor while preserving the benefits of electric propulsion. Extended-range power systems utilize a primary mover, typically an oil-fueled internal combustion engine, to drive the generator for electricity generation, and the generated AC form electricity is subsequently converted into stable DC bus voltage by a power electronic converter. The hardware and control design of the extended-range power supply system have been finalized and validated through experimental trials. Results demonstrate the system’s capability to sustain a stable DC bus voltage amidst disruptions such as sudden load shifts and fluctuations in prime mover speed. Even with 50% sudden load change, the voltage drop is within 12% and could recover to ±3% within 4 seconds. The range extender can be used alone without battery to power the electric tractor, or it can used in parallel with other extended-range extenders or battery thanks with the droop control ability for power sharing.

The electronic transport stability in nanodevices composed by metal/trans-polyacetylene /metal with different long length has contributed greatly for performance, homogeneity, stability, organization of the chains, reproducibility and higher conductivity. In this paper, we present an analytical study of the electronic transport characteristics from dimerized trans-polyacetylene (trans-PA) molecules containing an odd-even number of sites coupled to metal leads (left and right) in T-shaped geometry using the extended Su-Schrieffer-Heeger (SSH) model based on tight-binding Hamiltonian with the Non-Equilibrium Green´s Function (NEGF) via Heisenberg´s equation of motion and the Keldysh´s formalism. Due to the complexity of the T-shaped odd-even chain, our proposal was to test the effects on the finite-length network for three, four, five sites and furthermore foresee for 17-sites. We show how to tune dimerization strength () coupling to the parameters and T-shaped geometry of the device to which it affects the overlap integral localized at the three endpoints of the T-shaped system, making both the odd and even chains to undergo a metal-insulator transition in their electronic behavior. The results reached through control parity of the chain plane of the parameters governing () the electronic and experimental tunneling allow a better understanding of the subject.

Inspired by recent developments in wave propagation and scattering experiments with parity-time (PT) symmetric materials, we discuss reciprocity and representation theorems for 3D inhomogeneous PT-symmetric materials and indicate some applications. We start with a unified matrix-vector wave equation which accounts for acoustic, quantum-mechanical, electromagnetic, elastodynamic, poroelastodynamic, piezoelectric and seismoelectric waves. Based on the symmetry properties of the operator matrix in this equation, we derive unified reciprocity theorems for wave fields in 3D arbitrary inhomogeneous media and 3D inhomogeneous media with PT-symmetry. These theorems form the basis for deriving unified wave field representations and relations between reflection and transmission responses in such media. Among the potential applications are interferometric Green’s matrix retrieval and Marchenko-type Green’s matrix retrieval in PT-symmetric materials.

Underwater natural gas pipelines constitute critical infrastructure for energy transportation. Any damage or leakage in these pipelines poses serious security risks, directly threatening marine and lake ecosystems and potentially causing operational issues and economic losses in the energy supply chain. Due to the difficulty in detecting deterioration over time and regularly inspecting these submerged pipelines by divers, the use of unmanned underwater vehicles (UUVs) becomes crucial in this field. In this study, an underwater pipeline tracking experiment was carried out by providing autonomous features to a remote-controlled unmanned underwater vehicle. During the tracking of the underwater pipeline, damages were identified, and the locations of these damages were determined. The navigation information of the underwater vehicle, including orientation in the x, y, z axes (roll, pitch, yaw) from a gyroscope integrated with magnetic compass, speed and position information in the three axes from an accelerometer, and the distance to the water surface from a pressure sensor, was integrated into the vehicle. Pre-tests determined the necessary pulse width modulation values for the thrusters of the vehicle, enabling autonomous operation by providing these values as input to the thruster motors. In this study, the vehicle moves in 3D was achived by the vertical thruster of the vehicle was activated to maintain a specific depth, and applying equal force to the vehicle’s right and left thrusters forward movement, while differential force induced deviation angles. In pool experiments, the unmanned underwater vehicle autonomously tracked the pipeline as intended, identifying damages on the pipeline using images captured by the vehicle's camera. The images for damage assessment were processed using a convolution neural network (CNN) algorithm, which is a deep learning method. The position of the damage relative to the vehicle was estimated from the pixel dimensions of the identified damage. The location of the damage relative to its starting point was obtained by combining these two positional pieces of information from the vehicle's navigation system. The all study was performed within the Python environment.

The paper presents a new type of hydraulic clutch operating with magnetorheological (MR) fluids and the results achieved from both theoretical analysis and experimental measurement. The hy-draulic clutch system of its own design with MR working fluid and a rotating magnetic field lo-cated is designed. The principle of this clutch is to use a rotating magnetic field created by an al-ternating current electromagnet to set the MR fluid in motion. In the tests of the hydraulic clutch with a rotating magnetic field, MR fluid produced on their own, consisting of solid iron particles of various diameters mixed with a silicone oil, are used as working fluids. The rheological properties of MR fluids are assessed on the basis of tests carried out with a Brookfield DV2T rheometer equipped with a magnetic device for generating the magnetic field of its own design. The char-acteristics of the hydraulic clutch with MR working fluid and the rotating magnetic field are tested on a specially built test stand. As a result of the research, it has been found that the torque transmitted by the clutch is the greater, the higher the rotational speed of the magnetic field and the lower the rotational speed of the beaker in which the working fluid is placed, and that the greatest torque occurs for the working fluid with the highest iron content. Based on the analysis of the structure and characteristics of the clutch in which the magnetic field is used, it has been shown that the design of the developed clutch is similar to that of an induction clutch, and its characteristics correspond to the characteristics of the eddy current clutch. Therefore, the proposed new clutch working with MR fluid and the rotating magnetic field can be applied to stationary power transmission system similarly to an eddy current clutch.

In this paper, the Hafele‐Keating experiment and the geostationary orbit satellite of related physics problems of are analyzed and discussed in detail. If researchers read the paper and think about it, It will be found that the Hafele‐Keating experiment and the geostationary satellite problem prove that some of the core ideas and theories of relativity are seriously wrong. Isnʹt that a very serious problem in physics? Canʹt this cause the academic circles to pay great attention to it? Isnʹt this worthy of in‐depth analysis and research? The core of the paper is to point out that there are problems with the space concept and the reference system theory of classical physics and relativity, And that would bring up a whole host of physics problems. It takes a concerted effort from the academic community, Do furtherin‐depth analysis and research. Strive forthe further discovery and perfection of physics theory.

The membrane potential or resting potential of the neuron has been the subject of many studies. Although this theory explains the generation and maintenance of the membrane potential by direct or even facilitated diffusion, there are too many contradictions to doubt that these forces are sufficient or even at work in a process whose initial conditions are of rare complexity. The aim of this article is to show that already in the past, a competing theory has been developed whose hypothesis seems more scientifically sound. To confirm this last theory, Hirohisa Tamagawa carried out an experiment of great simplicity which makes it possible to invalidate the current theory and to question the teaching and the knowledge in Biology and Biophysics.

A non-steady state mathematical model of amino acid (phenylalanine (Phe)) and mineral salt (NaCl) solution separation by neutralization dialysis (ND) carried out in a batch mode is proposed. The model takes into account the characteristics of membranes (thickness, ion-exchange capacity and conductivity) and solutions (concentration, composition), as well as the flow rate of the solution in the dialyzer compartments. As compared to previously developed models, the new one considers the local equilibrium of Phe protolysis reactions in solutions and membranes and, also, the transport of all the phenylalanine forms (zwitterionic, positively and negatively charged) through membranes. A series of experiments on ND demineralization of NaCl and Phe mixed solution was carried out. In order to minimize Phe losses, the solution pH in the desalination compartment was controlled by changing the concentrations of the solutions in the acid and alkali compartments of the ND cell. The validity of the model was verified by comparison of simulated and experimental time dependencies of solution electric conductivity and pH, as well as the concentration of Na+, Cl– ions and Phe species in the desalination compartment. Based on the simulation results, the role of Phe transport mechanisms in the losses of this amino acid during ND was discussed.

The present study analyzed the effect of temperature, pH, retention time, pretreatment and mixing ratio on the anerobic digestion process. The parameters during the anaerobic co digestion of cow manure and food waste were then optimized using the Taguchi experimental design method. ANOVA is carried out to find the significant parameters which influence the biogas production. Experimental tests were carried out at laboratory scale reactors kept at different temperatures (28 °C, 35 °C, and 50 °C). The specific methanogenic Performance (SMP) during anerobic digestion at higher temperatures was characterized with the analysis of acetate, propionate, butyrate, hydrogen, glucose, and formate. The improvement of biogas production with different pre-treatment i.e., ultrasonic, autoclave, and microwave techniques also analysed. The results showed that reactor that maintained at 35 °C showed the highest biogas production. While the reactor that maintained at lower temperature (28 °C) produced the lower volume of biogas. As the retention time increases, the amount of biogas produced increases. Methanogenic activities of microorganisms reduced at higher temperature conditions (65 °C). Biogas production increased by 28.1%, 20.23%, and 13.27 % when the of substrates treated with ultrasonic, autoclave, and microwave, respectively, compared to the untreated substrate. The optimized condition for the highest biogas production during anaerobic co digestion of food waste and cow manure is temperature of 35 °C, pH of 7 and mixing ratio (CM: FW=1.5:0.5). ANOVA showed that temperature is the most important input parameter affecting biogas production, followed by mixing ratio.

Semantic rules link purely theoretical terms like “price” and “electron” to things we can measure. Without them, theories cannot be tested empirically. When inappropriate, they produce false rejections. Economists routinely ignore semantic rules. Empirical journal articles essentially never mention them. More to the point, the conventional tests that reject the Law of One Price and Purchasing Power Parity never consider them. As a result, those rejections are unwarranted because such tests use inappropriate semantic rules. Both theories should be restored to not rejected and then retested using the more appropriate semantic rules described here. By using appropriate semantic rules, this paper is able to combine Covered Interest Parity and Purchasing Power Parity into a single theory that links auction markets for financial assets and commodities to auction markets for exchange rates. Using appropriate semantic rules for both theories also explains several puzzles in open economy macroeconomics and opens up broad new vistas for research.

Phase transitions- both in the classical and in the quantum version- are the perfect playground for appreciating universality at work. Indeed, the fine details become unimportant and a classification in very few universality classes is possible. Very recently, a striking deviation from this picture has been discovered: some antiferromagnetic spin chains with competing interactions show a different set of phase transitions depending on the parity of number of spins in the chain. The aim of this article is to demonstrate that the same behavior also characterizes the most simple quantum spin chain: the Ising model in a transverse field. By means of an exact solution based on a Wigner-Jordan transformation, we show that a first order quantum phase transition appears at zero applied field in the odd spin case, while it is not present in the even case. A hint of a possible physical interpretation is given by the combination of two fact: at the point of the phase transition, the degeneracy of the ground state in the even and the odd case substantially differ, being respectively 2 and 2N, with N the number of spins; the spin of the most favorable kink states changes at that point.

Batch and transport experiments were used to investigate the remediation of a loamy sand soil contaminated with Cr(VI) using zero valent iron nanoparticles (nZVI) stabilized by the carboxy methyl cellulose (CMC-nZVI). The effect of pH, ionic strength (IS), and flow rate on the removal efficiency of Cr(VI) were investigated under equilibrium (uniform transport) and non-equilibrium (Two-site sorption) transport using the Hydrus-1D model. The overall removal efficiency ranged from 70 to over 90% based on the chemical characteristics of the CMC-nZVI suspension and the transport conditions. The concentration and pH of the CMC-nZVI suspension had the most significant effect on the removal efficiency and transport of Cr(VI) in the soil. The average removal efficiency of Cr(VI) was increased from 24.1 to 75.5% when the concentration of CMC-nZVI nanoparticles was increased from 10 to 250 mg L-1, mainly because of the increased total surface area at larger particle concentration. Batch experiments showed that removal efficiency of Cr(VI) was much larger under acidic conditions. The average removal efficiency of Cr(VI) reached 90.1 and 60.5 % at pH 5 and 7, respectively. The Two-site sorption model described quite well (r2 = 0.96-0.98) the transport of Cr(VI) in soil as compared to the uniform transport model (r2 = 0.81-0.98). The average retardation of Cr(VI) was 3.51 and 1.61 at pH 5 and 7, respectively, indicating earlier arrival for the breakthrough curves and shorter time to reach maximum relative concentration at lower pH. The Hydrus-1D model has proven to be an efficient tool for assessing the removal of Cr(VI) pollutants, offering innovative, cost-effective, and environmentally friendly remediation methodologies.

A two-year field experiment (2022–2023) was carried out to investigate the impact of different sowing periods (spring and winter) and nitrogen levels (0, 30, 60 kg/ha) on the phytoextraction potential of flax. The study site is characterized by high concentrations of heavy metals (Cd, Ni, Cu, Pb, Zn) and belongs to the Mediterranean climate type. Flax (var. Calista) was sown in the spring of 2022 and in the winter of 2023, following a split plot experimental design with three rep-lications, and applying low-input practices. Results showed that spring-sown flax produced short-er but thicker plants with significantly higher biomass (5.27 tn ha-1) when treated with 30 kg ha-1 N compared to winter-sown (2.30 tn ha-1) when treated with 60 kg ha-1 N. The concentration of contaminants in the aerial biomass varied according to metal type and sowing period. The higher biomass production in spring resulted in a higher quantity of heavy metals being removed from the soil, making flax a promising crop for phytoextraction purposes, especially in soils contami-nated with multiple heavy metals.

Contact tracing is one of the oldest social network health interventions used to reduce the diffusion of various infectious diseases. However, some infectious diseases like COVID-19 amass at such a great scope that traditional methods of conducting contact tracing (e.g., face-to-face interviews) remain difficult to implement, pointing the need to develop reliable and valid survey approaches. The purpose of this research is to test the effectiveness of three different egocentric survey methods for extracting contact tracing data: (1) a baseline approach, (2) a retrieval cue approach, and (3) a context-based approach. A sample of 397 college students were randomized into one of each condition and were prompted to anonymously provide contacts and populated places visited from the past four days. After controlling for various demographic, social identity, psychological, and physiological variables, participants in the context-based condition were significantly more likely recall more contacts (medium effect size) and places (large effect size) than the other two conditions. Theoretically, the research supports suggestions by field theory that assume network recall can be significantly improved by activating relevant activity foci. Practically, the research contributes to developing innovative social network data collection methods for contract tracing survey instruments.

Sustainable development advocates for an environmentally friendly and resource-saving approach, fostering a new quality of productivity that is green and sustainable, and achieving a sustainable development where the economy and the environment are in harmony. The paper is based on clarifying the effects of coordinated development between the economy and the environment, and by establishing an indicator system, applying a remote sensing ecological index, entropy weight method, gray relational degree model, and a coupling coordination model, the relationship of coordinated development of Ordos in 2016-2022 is analyzed from a spatial-temporal perspective. The results are as follows: ① The years of coordinated development between the ecological environment and the economy are in the majority, while the uncoordinated years are fewer. ② The level of coordinated development between the ecological environment and the economy in the various regions of Ordos has been increasing year by year, but it still remains at the barely coordinated and primary coordinated levels. ③ The types of coordinated development between the ecological environment and the economy in Ordos exhibit significant spatial differentiation in terms of spatial distribution and clustering.Therefore, it is necessary to formulate coordinated development policies and measures according to the constraining factors of different regions.

The water exit problem, which is ubiquitous in ocean engineering, is one of the significant research topics in the interaction between navigators and water. The study of the water exit problem can help to improve the structure design for marine ships and underwater weapons for better strength and movement status. However, the water exit problem involves complex processes such as gas-liquid-solid three-phase coupling, cavitation, water separation, liquid surface deformation and fragmentation, making it challenging to study. According to the works carried out by many researchers towards this issue, we summarize the recent developments from three aspects, i.e. theoretical research, numerical simulation and experimental results. In theoretical research, the improved von Kaman model and linearized water exit model are introduced. Several classical experimental devices, data acquisition means and cavitation are introduced in experimental development. Three methods, namely, BEM(boundary element method), FVM(finite volume method) and LES(large eddy simulation) are concluded for numerical simulation. The limitations and shortcomings of these three aspects are then analyzed. Finally, an outlook on the future research improvements and developments of the water exit problem is provided.

In the paper the experimental methodology for the single-crystal circular plate deformation measurement and subsequent procedure for mechanical properties quantitation are developed. The procedure is based on a new numerical-analytical solution of nonlinear boundary-value problem for finite deformations of a circular anisotropic plate. Using the developed method, a study of the deformation of single-crystal circular plates formed on the basis of a silicon-on-insulator structure was carried out. The values of residual stresses are determined and it is shown that the presence of these stresses increases the flexural rigidity of the plate in several times.

By combining general relativity and CPT symmetry, the theory of CPT gravity predicts gravitational repulsion between matter and CPT-transformed matter, i.e. antimatter inhabiting an inverted space-time. Such repulsive gravity turned out to be an excellent candidate for explaining the accelerated expansion of the Universe, without the need for dark energy. The recent results of the ALPHA-g experiment, which show gravitational attraction between antihydrogen atoms and the Earth, seem to undermine this success in the cosmological field. Analyzing the above theory, we find two solutions that can be consistent with the experimental results, while preserving the large-scale gravitational repulsion. The first highlights how repulsive gravity can be the result of the interaction with an inverted space-time, but occupied by matter and not antimatter, and therefore the antimatter present in our space-time has no reason to exhibit gravitational repulsion. The second retains the original CPT transformation, resulting in repulsive gravity between matter and antimatter, but with the caveat that antimatter immersed in our space-time cannot exhibit the PT transformation which is the cause of the repulsion. Finally, it is shown that, in a Newtonian approximation of the geodesic equation, time reversal is not a necessary operation for repulsive gravity, therefore opening the possibility of an expanding cosmos with a single time direction.

We all have in mind Einstein's famous thought experiment in the elevator where we observe the free fall of a body, and then the trajectory of a light ray. Simply here, in addition to the qualitative aspect, we carry out the exact calculation, and for the first time the worldlines equations are given. We consider a uniformly accelerated reference frame in rectilinear translation, and we show that the trajectories of the particles are semi-ellipses with the center on the event horizon. The frame of reference is non-inertial, the space-time is flat, and the computations are performed within the framework of special relativity. Some experimental consequences are discussed, especially the experiment with the accelerated Michelson-Morley interferometer is solved, and we described an experiment where a new relativistic paradox appears --- a particle of matter seems to go faster than light. The differences, compared to the classical case, are important at large scale and close to the horizon, but they are small in the lift where the interest is above all theoretical. The concepts of metric, coordinated velocity and horizon are discussed, and the analogy with the black hole is made.

Smartphone use has changed patterns of online and offline interaction. Phubbing (i.e., looking at one’s phone instead of paying attention to others) is an increasingly recognized phenomenon in offline interaction. We examined whether people who phub are more likely to have lower social intelligence, whether phubbing is considered more annoying than being ignored due to reading a magazine, and if people describe smartphones and magazines differently as sources of social distraction. We collected two survey samples (N = 112, N = 108) for a cartoon-based role-playing experiment (the Bystander Inaccessibility Experiment) in which a smartphone user and a person reading a magazine ignored the respondents’ conversational initiatives. Annoyance in each scenario was measured, and written accounts were collected on why the respondents rated the scenarios the way they did. Other measures used included the Generic Scale of Phubbing, Generic Scale of Being Phubbed, and Tromsø Social Intelligence Scale. The results showed that participants in both samples were more annoyed by phubbing than by being ignored due to reading a magazine. Linear regression analyses showed that phubbing was associated with lower social intelligence, even after adjusting for confounding factors. The annoyingness of phubbing was explained with negative attitudes toward smartphones, which were assumed to be used for useless endeavors, while magazines were more appreciated and seen as more cultivating. The role of bystanders’ epistemic access to the smartphone user’s activities is discussed.

Materials characterised by magnetorheological properties are non-classic engineering materials. A significant increase in the interest of scientific community in materials from this group can be observed over the recent several years. The results of research presented in this article are oriented on the examination of said materials’ mechanical properties. In order to do so, stress relaxation tests were conducted on cylindrical samples of magnetorheological elastomers loaded with compressive stress for various values of magnetic induction (B1 = 0 mT, B2 = 32 mT, B3 = 48 mT, and B4 = 64 mT) and temperature (T1 = 25° C, T2 = 30° C, and T3 = 40° C). The results of these tests indicate that the stiffness of examined samples increases along with the increase of magnetic field induction and decreases along with the increase of temperature. On this basis, it has been determined that: the biggest stress amplitude change caused by the influence of magnetic field was σ0ΔB = 12.7% and the biggest stress amplitude change caused by the influence of temperature was σ0ΔT = 11.3%. As a result of applying a mathematical model, it has been indicated that the stress relaxation in the examined magnetorheological elastomer for the adopted time range (t = 3600 s) has a hyperbolic decline nature. The collected test results point to examined materials being characterised by extensive rheological properties, which leads to a conclusion that it is necessary to conduct further tests in this scope.

The eddy current loss should be optimized to be as less as possible for the stability of permanent magnet in high speed permanent magnet synchronous motor (HSPMSM) rotor and ensure the high efficiency and low temperature of the motor. This paper analyzes the eddy current distribution in rotor, with consideration of the conflict of the thickness of sleeve and diameter of the rotor, calculating the eddy current loss (ECL) and the thermal distribution via Separation of variables method for solving Maxwell's equations with analytical hieratical model of ECL constructed. The optimization result of ECL of the HSPMSM whose power and rated speed is 30kw 48000r/min can be got by multi-objective optimization method, combined weighting coefficient method and traversal algorithm based on chaotic local search particle swarm optimization (CLSPSO), utilizing ECL analytical model and other analytical constraints. Related experiment and measurement has been implemented with new approach of loss separation.

The sPHENIX experiment is a state-of-the-art jet and heavy flavor physics detector which successfully recorded its first Au + Au collision data at 200 GeV at RHIC. sPHENIX will provide heavy flavor physics measurements covering an unexplored kinematic region and unprecedented precision at RHIC to probe the parton energy loss mechanism, parton transport coefficients in quark-gluon plasma, and the hadronization process under various medium conditions. At the center of sPHENIX, the Monolithic-Active-Pixel-Sensor (MAPS) based VerTeX detector (MVTX) is a high-precision silicon pixel detector. The MVTX provides excellent position resolution and the capability of operating in continuous streaming readout mode, allowing precise vertex determination and recording a large data sample, both of which are particularly crucial for heavy flavor physics measurements. In this work, we will show the general performance of heavy-flavor hadron reconstruction. In addition, we will discuss the commissioning experience with sPHENIX. Finally, we will provide the projection of b-hadron and jet observables and discuss the estimated constraints on theoretical models.

Bell’s correlation formula is based on a classical Kolmogorov probability theory. It is tested in experiment with an estimate correlation. The latter is the raw product moment (rpm) correlation that is classical Kolmogorov based as well. We note that the famous Bell inequalities are derived from Bell’s correlation formula. The problem is that the hypothesis: “is it possible that in experiment Bell’s correlation is equal to quantum”, can only found to be false. This is not because the data generating process does not produce the required data. Or that the inequalities sufficiently show that the data cannot violate the inequalities. It is because the statistics of the Bell experiment is flawed. The rpm correlation in experiment cannot be equal to the quantum value in principle. This is because it requires the classical Kolmogorov rpm correlation to be not Kolmogorov.

We propose a phenomenological theory of spin behavior in a magnetic field, which explains from the point of view of classical physics the two-valued result of the Stern-Gerlach experiment. The behavior of the spin and intrinsic magnetic moment of an electron wave of an atom in an external magnetic field is considered. We show that in a weak magnetic field, the intrinsic magnetic moment of an electron wave is always oriented parallel to the magnetic field strength vector, while in a strong magnetic field, depending on the initial orientation of the intrinsic magnetic moment, two orientations are realized: either parallel or antiparallel to the magnetic field strength vector. Within the framework of classical electrodynamics, the calculation of the motion of an atomic beam in an inhomogeneous magnetic field is carried out, which reproduces the results of the Stern-Gerlach experiment.

Excessive oxidative stress and exercise-induced fatigue reduce physical performance and can lead to dysfunction in antioxidant systems within muscular and hepatic tissues. Integrating natural substances with exercise may mitigate fatigue via anti-oxidant effects. This study aims to compare and evaluate the effects of exercise and supplementation with Sundarbans honey vs energy drinks on the strength, anxiety physiological profiles, and hepatic antioxidant capacity in mice undergoing extraneous exercise and fatigue. Forty-eight four-week-old Swiss albino mice were randomly assigned to one of eight groups: (1) Control, (2) Speed™ (Sp), (3) Royal Tiger™ (RT), (4) Sundarbans Honey (SH), (5) Exercise (Ex), (6) Exercise + Sundarbans Honey (Ex+SH), (7) Exercise + Speed™ (Ex+Sp), and (8) Exercise + Royal Tiger™ (Ex+RT). Supplements were administered via oral gavage: Sp (2.5 ml/kg BW), RT (2.5 ml/kg BW), and SH (1 g/kg BW), four times a week for 60 days. Mice in the Ex, Ex+SH, Ex+Sp, and Ex+RT groups underwent daily swimming and running. The strength, fatigue, anxiety levels, lipid profiles, and antioxidant biomarkers were evaluated post-treatment. The SH, Ex, and Ex+SH groups exhibited significantly enhanced physical performance (p<0.05). Plasma lipid profiles, including LDL, triglycerides, total cholesterol, and fatigue-related biomarkers (ALP, AST, ALT, LDH, CK, LA, BUN, and glucose) were markedly increased in the Sp and RT groups but decreased in the SH, Ex, and Ex+SH groups compared to control (p<0.05). Exercise-induced fatigue elevated the Nrf2/HO-1 antioxidant defense system in liver tissue. IL-6 levels were reduced in the SH, Ex, and Ex+SH groups (p<0.05). These findings indicate that regular exercise combined with SH supplementation increases strength and improves lipid profiles, reducing exercise-induced oxidative stress and fatigue via modulation of the Nrf2/HO-1 pathway in liver tissue. These results highlight SH supplementation’s potential as a complementary strategy to enhance exercise outcomes and mitigate exercise-induced stress.

Cymbidium faberi Rolfe is one of the traditional Chinese orchids with important ornamental value, and the cultivation of Cymbidium faberi Rolfe mutant strains with different appearances is essential to increase its economic value, but at present, the acquisition of Cymbidium faberi Rolfe mutant strains basically relies on natural mutation.The objectives of this research were to mutagenize Cymbidium faberi Rolfe protocorm-like bodies (PLBs) and shoots in vitro using sodium azide (NaN3), and to screen and evaluate mutants in mutagenized Cymbidium faberi Rolfe seedlings using morphological characteristics.Cymbidium faberi Rolfe PLBs and shoots were used as mutagenic materials, and co-cultivated in induced shoots growth medium with the addition of 0.0 (control), 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mg/L and 0.0 (control), 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 mg/L NaN3 to induce the mutations, and the mortality rates of the PLBs and shoots were increased with the increase of the NaN3 concentration.At 14 d of co-cultivation, PLBs and shoots were most efficiently mutagenized with 1.5 mg/L and 4.0 mg/L NaN3, respectively.After the explants were cultured for 3 months, changes in leaf and flower morphology were observed in some mutants: shorter and thicker leaves, shorter node length, reduced height, and mid-translucent leaves compared with controls; and some Cymbidium faberi Rolfe bloomed prematurely, with single flowers with large, thick petal sepals and small inflorescences, and colours include light green throughout, and a few with purple stamens.This suggests that NaN3 can effectively mutagenise Cymbidium faberi Rolfe PLBs and shoots to satisfy people's demand for Cymbidium faberi Rolfe's ornamental properties while increasing its economic value.

The increasing prevalence of obesity and sedentary lifestyles has led to an increased incidence of metabolic syndrome (MetS) worldwide. In Taiwan, middle-aged women are at a greater risk of MetS, type 2 diabetes, and cardiovascular disease than men are because they have more subcutaneous fat and larger waist circumferences compared to men with equal visceral fat levels. This study investigated the effects of calorie restriction supplemented with fish oil (CRF) in middle-aged women with MetS. For 12 weeks, 75 eligible participants were randomly assigned either calorie restriction (CR) or CRF. Both dietary intervention groups were further divided into two age groups: ≤45 and >45 years. The changes in MetS severity, inflammatory status, iron status, and red blood cell fatty acid profile were evaluated. Seventy-one participants completed the trial. Both dietary interventions significantly ameliorated MetS and improved the participants’ inflammatory status. CR significantly increased total iron binding capacity, whereas CRF increased hepcidin levels. Furthermore, CRF significantly increased the n-6/n-3 and arachidonic acid/docosahexaenoic acid ratios. In conclusion, CR and CRF improved the anthropometric and MetS characteristics of early-middle aged women, including body weight, blood glucose levels, triglyceride levels, as well as the scores for the homeostasis model assessment of insulin resistance and quantitative insulin sensitivity cheque index. Dietary intervention was more effective in >45-year-old women than ≤45-year-old women.

Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

A galvalume corrugated sheet was utilized as formwork for a reinforced concrete beam in flexure. A numerical model was validated to the experimentally obtained data, and further adopted to simulate the behavior of this composite structure under elevated temperatures. The properties and constitutive stress-strain data of the basic materials were obtained from experiments, and superimposed into the finite element model. The study concluded that the load carrying capacity of the member decreased as a direct function on temperature increase, and the cracking moment was very sensitive to the temperature fluctuation. The elevated temperatures also altered the failure mode.

We present a new vision on the double-slit experiment (DSE), that does not use any waves or the so-called wave-particle duality. It is based on particles, viewed as localized vibrations. Rather than being illogical, or mysterious, the approach reproduces logically the interference patterns observed externally, using the well-known ``amplification of stimulated emission'' (ASE). The conservation of particle number is not observed. Different particles can present ASE with in-phase or counter-phase behavior, making the patterns observed for electrons, other particles, even atoms. The Law of the Excluded Middle (LEM) is not broken illogically in two-states macroscopically, but broken naturally in three or more states, microscopically, using ASE. Any particle supporting ASE, in-phase or counter-phase, can enter a DSE, and provide an external interference pattern. Frequency plays a role, while amplitude is not considered. This work is important in quantum computing, possibly saving cost, time, and welcoming more participants.

We present an ontology log-OLOG- representation of the classical Miller-Urey experiment, usually considered as a paradigm for spontaneous generation of biomolecules on the prebiotic Earth and also, as a key in understanding the chemical evolution phenomena linked to the origins of life. Ologging The Miler-Urey experiment enables us, through the categorical notion of fibre product or pullback, to define the concept of Biogenic Space, as a space containing low complexity biogenic units subjected to appropriate physical and chemical conditions, facilitating the synthesis of highly complex organic molecules. Also, we characterize the Biogenic Space as a concrete universal object that could be associated with the preconditions for life inside various structures in the universe such as exoplanets and exomoons located in habitable zones, but also in interstellar and intergalactic organic clouds.

Coalbed Methane(CBM) production enhancement for single wells is a big problem to CBM industrialization. Low production is due to insufficient gas generation by thermogenic. Luckily, Biogenic gas was found in many areas and its supply is assumed to improve coalbed methane production. Therefore, microbial simulation experiment will demonstrate the effectiveness of the assumption. From microbial simulation experiment on different coal ranks, it is found that microbes can use coals to produce biogas under laboratory conditions. With different temperatures for different experiments, it turns out that the gas production at 35 ℃ is greater than that at 15℃,indicating that 35℃ is more suitable for microbes to produce gas. According to quantitative experiments, adding exogenous nutrients or exogenous bacteria can improve CBM production. Moreover, the production enhancement ratio can reach up to 115% under the condition of adding exogenous bacterial species, while the ratio for adding nutrients can be up to 144%.

Though the cancer research community has used mouse xenografts for decades more than zebrafish xenografts, zebrafish have much to offer: they are cheap, easy to work with, and the embryonic model is relatively easy to use in high-throughput assays. Zebrafish can be imaged live, allowing us to observe cellular and molecular processes in vivo in real time. Opponents dismiss the zebrafish model due to the evolutionary distance between zebrafish and humans, as compared to mice, but proponents argue for the zebrafish xenograft’s superiority to cell culture systems and its advantages in imaging. This review places the zebrafish xenograft in the context of current views on cancer and gives an overview of how several aspects of this evolutionary disease can be addressed in the zebrafish model. Zebrafish are missing homologs of some human proteins and (of particular interest) several members of the matrix metalloproteinase (MMP) family of proteases, which are known for their importance in tumour biology. This review draws attention to the implicit evolutionary experiment taking place when the molecular ecology of the xenograft host is significantly different than that of the donor.

The objective of this research is to establish a better understanding of the current landscape of digital learning research and sustainable development by using CiteSpace. First, we retrieved published publications from the Web of Science (2004–2022). Following that, we examined the primary research strengths and important subjects of digital learning from two perspectives: collaboration networks (including collaborative networks across countries, institutions, and authors) and co-citation networks. We examined the co-citation network from three perspectives: cluster analysis, the most active citers, top references. Furthermore, referenced journals, popular themes, and rising trends were examined. These findings indicate the primary study subjects in the field of digital learning, the most intriguing research literature, and each period's emerging research hotspots. Finally, we proposed further study ideas for future paths.

The recent availability of commercial platforms for behavioral analysis in zebrafish larvae based on video-tracking technologies has exponentially increased the number of studies analyzing different behaviors in this model organism to assess neurotoxicity. Among the most commonly used assays in zebrafish larvae are basal locomotor activity (BLA) and visual motor response (VMR). However, the effect of different intrinsic and extrinsic factors that can significantly alter the outcome of these assays is still not well understood. In this work we have analyzed in 143 larvae the influence of age (5-8 days post-fertilization), time of day (8:00, 10:00, 12:00, 14:00; 16:00, 18:00, and 20:00 h), and experiment (three experiments performed at different days) on BLA and VMR results (4,004 analyses for each behavior). Results from both behaviors were adjusted to a Random-Effects linear regression model using generalized least squares (GLS), including in the model the effect of the three variables, the second-way interactions between them and the three-way interaction. The results presented in this manuscript show a specific effect of all three intrinsic factors and their interactions on both behaviors, supporting the view that the most stable time period for performing these behavioral assays is from 10:00 am to 04:00 pm, with some differences depending on age of the larva and the behavioral test.

1,3,5-Tris-(α-naphthyl)benzene is an organic non-electrolyte with notable stability of an amorphous phase. Its glassy and supercooled liquid states were previously studied by spectroscopic and calorimetric methods. However, the thermodynamic parameters of phase transitions available from the literature are inconsistent. In this work, the heat capacities of crystalline and liquid phases, the temperature dependence of the saturated vapor pressures, fusion and vaporization enthalpies were determined using differential and fast scanning calorimetry and verified using the estimates based on solution calorimetry. The structural features of 1,3,5-tris-(α-naphthyl)benzene are discussed based on the computations performed and the data on the molecular refractivity. The consistency between the values obtained by independent techniques was demonstrated. The deviations in the previously published data were attributed to possible polymorphism.

Additive manufactured interlocking structures often face challenges in achieving suitable joinability due to thermal deformation. This issue becomes particularly interesting when fabricating structures that require high density but not fully connected layers, such as soft-magnetic materials. This study focuses on systematical investigation of the deformation as a function of finger thickness and building direction in model interlocking structure. In the perpendicular direction to the build plate, the distortions of joint part were significantly reduced due to lower thermal stress. In addition, the effect of laser power and scan speed on interlocking structure are systematically discussed. Additionally, through stress and thermal simulations of additive manufacturing process, it was confirmed that the compensated model can enhance the joinability of interlocking structures. These findings contribute to the development of optimal design for additive manufactured parts of soft magnetic materials such as stators in electric motor components, which needs insulations and density.

In this paper, the tensile behavior of unidirectional carbon/epoxy prepreg is experimentally analyzed at varying loads and temperatures, focusing on the considerable nonlinearity at the beginning of the stress-strain curve. The high viscosity of this material presented difficulties in securely holding specimens during tensile testing. As a result, modifications were made to the conventional gripping method to enable the acquisition of reliable test data. Additionally, a longer gauge length was chosen to minimize the impact of slippage on the elastic modulus measurement. To support the experiment, a micromechanical model of a prepreg tow with fiber waviness is proposed. An RVE model of periodically distributed unidirectional waved cylindrical fibers embedded within the matrix is developed to predict the effective material stiffness parameters. Numerical results are presented for different amplitude-to-wavelength ratios which indicate the fiber waviness reduces the tensile modulus of the composite. The simulation results are in good agreement with the uniaxial tensile test of the prepreg tow.

We consider the role information energy can play as a source of dark energy. Firstly, we note that, if stars and structure had not formed in the universe, elemental bits of information describing the attributes of particles would have exhibited properties similar to the cosmological constant. The Landauer equivalent energy of such elemental bits would be defined identical in form and value to the characteristic energy of the cosmological constant. But, with the formation of stars and structure, stellar heated gas and dust now provides the dominant contribution to information energy with the characteristics of a dynamic, transitional, dark energy. At low redshift, z<~1.35, this dark energy emulates the cosmological constant with a near constant energy density, w=−1.03±0.05, and an energy total similar to the mc² of the universe's ∼10⁵³ kg of baryons. At earlier times, z>~1.35, information energy was phantom, differing from the cosmological constant, Λ, by a CPL parameter difference of ∆w_o=−0.03±0.05 and ∆w_a=−0.79±0.08, values sufficient to account for the H₀ Tension. Information dark energy agrees with most phenomena as well as Λ, while exhibiting characteristics that resolve many tensions and problems of ΛCDM: the cosmological constant problem; the cosmological coincidence problem; the H₀ and σ₈ tensions. As this proposed dark energy source is not usually considered, we identify the expected signature in H(a) that will enable the role of information dark energy to be falsified by experimental observation.

Laminate structures composed of stiff plates and thin soft interlayers are widely used in aerospace, automotive and civil engineering encouraging the development of reliable non-destructive strategies for their condition assessment. In the paper, elastodynamic behaviour of such laminate structures is investigated with emphasis on its application in ultrasonic based NDT and SHM for the identification of interlayer mechanical and interfacial contact properties. A particular attention is given to the practically important frequency range, in which the wavelength considerably exceeds the thickness of the film. Three layer model with spring-type boundary conditions employed for imperfect contact simulation is used for numerical investigation. Novel effective boundary conditions are derived via asymptotic expansion technique and used for analysis of the peculiar properties of elastic guided waves in considered laminates. It is revealed that the thin and soft film influences the behaviour of the laminate mainly via the effective stiffnesses being a combination of the elastic moduli of the film, its thickness and interface stiffnesses. To evaluate each of these parameters separately (or to figure out that the available experimental data are insufficient), a step-wise procedure employing the effective boundary conditions is proposed and tested versus the laser Doppler vibrometry data for Lamb waves in Aluminium/Polymer film/Alumunium structure. The possibility of using film-related thickness resonance frequencies to estimate the film properties and contact quality is also demonstrated. Additionally, the rich family of edge waves is also investigated, and the splitting of fundamental edge waves into pairs is revealed.

With the burgeoning growth of online retail, the issue of counterfeit products has become a significant threat to both consumer trust and brand integrity, posing challenges to sustainable market practices. Online retail platforms are promoted to redesign their channel structures and enhance brand traceability to tackle counterfeits using blockchain technology. To investigate the interactions between blockchain technology and the channel structures of online retail platforms, we design a game theory model incorporating a manufacturer with(out) blockchain participation selling products via an online retail platform that operates an agency channel and/or a reselling channel. We show that the critical trade-off of blockchain participation comprises the brand assurance effect of the blockchain, the channel competition intensification effect, and the blockchain adoption cost. The platform is capable of strategically designing the channel structure to encourage (while discouraging) blockchain participation by the manufacturer. Our analysis highlights the complementarity between blockchain participation and the channel structure. Furthermore, the effect of the consumer’s belief in the reselling channel, the commission fee in the agency channel, and the substitutability between channels are investigated in depth. The research provides valuable insights for online retail platforms and policymakers seeking to foster a sustainable and trustworthy e-commerce ecosystem.

With new discoveries and insights in atomic and optical physics, the field of spectroscopy is advancing to a new level with applications ranging from material science to astronomy. We here propose a theoretical description of a potential new phenomenon resulting from the extension of Compton's experiment on the scattering of high energy photons through atomic electrons. How the proposed phenomenon can be tested experimentally is discussed in the paper as well.

The paper examines the various uncertainties encountered in high-frequency trading (HFT) environments and delves into the multiple challenges faced by HFT firms in navigating the Dodd-Frank Wall Street Reform and Consumer Protection Act (referred to as the "Dodd-Frank Act"), particularly during the initial stages of its enactment. These challenges include the ambiguity surrounding the definition of HFT, the lack of clarity regarding regulatory requirements and boundaries, inconsistencies in enforcement resulting from deviations in understanding the content, and the absence of detailed descriptions of the Act’s provisions. These hurdles significantly impact not only the daily operations of HFT firms but also pose higher demands on their long-term strategic planning and risk management. Drawing upon the Data, Information, Knowledge, Wisdom, and Purpose (DIKWP) model, this study employs an innovative analytical framework. Through the comprehensive application of conceptual space, cognitive space, and semantic space, it provides a systematic methodology for identifying and analyzing the aforementioned issues. This approach not only aids firms in better comprehending and adhering to complex regulatory requirements but also enables them to explore new business opportunities and competitive advantages while ensuring compliance.

End-to-end learned image compression codecs have notably emerged in recent years. These codecs have demonstrated superiority over conventional methods, showcasing remarkable flexibility and adaptability across diverse data domains while supporting new distortion losses. Despite challenges such as computational complexity, learned image compression methods inherently align with learning-based data processing and analytic pipelines due to their well-suited internal representations. The concept of Video Coding for Machines has garnered significant attention from both academic researchers and industry practitioners. This concept reflects the growing need to integrate data compression with computer vision applications. In light of these developments, we present a comprehensive survey and review of lossy image compression methods. Additionally, we provide a concise overview of two prominent international standards, MPEG Video Coding for Machines and JPEG AI. These standards are designed to bridge the gap between data compression and computer vision, catering to practical industry use cases.

This project designed a set of network security mechanisms for cloud applications in VANETs. At present, cloud computing is one of the government’s development priorities in the industry. We divide cloud into public, private, and hybrid clouds in this project. Vehicles or passengers can access road conditions or public transport information through the public cloud; public transportation can access current driving records and users can access relevant enterprise information on the private cloud and hybrid cloud is a combination of public and private clouds. Both cloud computing or VANETs require network and information security. At present, many researches on VANETs security only focus on message communication, and neglect information storage. Researches on cloud computing security only focus on information protection, and neglect user privacy and anonymity. This project designed a set of network and information security mechanisms in line with the requirements of Confidentiality, Authentication, Non-repudiation, Conditional Anonymity, and Conditional Untraceability. This project primarily needs to achieve the following: 1.an authentication mechanism to verify the identity of each other between the passenger and the vehicle and to verify the identity with Single Sign-On; 2. vehicle or user privacy and anonymity, which need to be able to replace the anonymous ID and related parameters for the vehicle or the user; 3. a private communication mechanism, which enables any vehicle or user to communicate privately; and 4. an information security encryption method, which can encrypt the information on a cloud server to avoid unauthorized access by internal personnel or hackers.

The paper presents the results of experimental studies and mathematical modeling of the effect of stress accumulation in thermosetting epoxy polymer "hot" curing on anhydride hardener. Stress accumulation occurs under cyclic thermomechanical action in a locked rod, similar effects are observed, for example, in thermoplastic elements subjected to the combined effect of mechanical loads and variable temperatures. Experimental results have shown that under cyclic thermomechanical loading during exploitation it is possible to accumulate residual stresses in the thermosetting polymer. A multi-element structural mathematical model with memory for thermomechanical load, which allows to consider the accumulation of residual thermal stresses, has been proposed. The results of modeling and experiment are compared. Based on the results, corrections are made in the approach to the application of this model to thermosetting polymers such as the epoxy resin under study. Considering the corrections, a good agreement (the difference is from 1 to 6%) with the results of experimental determination of stresses under complex cyclic thermomechanical load was obtained.

The steel grid structure with bolted ball joints is gaining popularity in offshore platforms and aquaculture cages, but the corrosion resistance of these joints is a critical safety concern. This article introduces an innovative method to enhance the sealing performance of bolted ball joints, preventing seawater ingress and corrosion. The approach involves creating a sealed surface within the contact gap between the sleeve and connecting components. Circular grooves and sealing washers are added to both ends of the sleeve. A two-dimensional finite element analysis model of the bolted ball joint with the sealing structure was created using SOLIDWORKS and ANSYS. The study analyzes the sealing gasket's contact pressure at various compression levels and evaluates its performance with bubble tests for air tightness. Research results show a linear relationship between contact pressure and compression rate, with a sealing pressure of 5.95MPa achieved at a 14% compression rate. This simple, cost-effective sealing method effectively prevents corrosion from seawater, making it ideal for marine environments.

It is known that ammonium has a higher permeability through anion-exchange and bipolar membranes compared to K+ cation that has the same mobility in water. However, the mechanism of this high permeability is not clear enough. We develop a mathematical model based of the Nernst-Planck and Poisson equations for diffusion of ammonium chloride through an anion-exchange membrane; proton exchange reactions between ammonium, water and ammonia are taken into account. It is assumed that ammonium, chloride and OH− ions can only pass through membrane hydrophilic pores, while ammonia can also dissolve in membrane matrix fragments not containing water and diffuse through these fragments. It is found that due to the Donnan exclusion of H+ ions as coions, the pH in the membrane internal solution increases when approaching the membrane side facing distilled water. Consequently, there is a change in the principal nitrogen-atom carrier in the membrane: in the part close to the side facing the feed NH4Cl solution (pH&lt;8.8), it is the NH4+ cation, and in the part close to distilled water, NH3 molecules. The concentration of NH4+ reaches almost zero at a point close to the middle of the membrane cross-section, which approximately halves the effective thickness of the diffusion layer for the transport of this ion. When NH3 takes over the nitrogen transport, it only needs to pass through the other half of the membrane. Leaving the membrane, it captures an H+ ion from water, and the released OH− goes towards the membrane side facing the feed solution to meet the NH4+ ions. The comparison of the simulation with experiment shows a satisfactory agreement.

Empirically based modeling is an essential aspect of design for a wave energy converter. These models are used in structural, mechanical and control design processes, as well as for performance prediction. The design of experiments and methods used to produce models from collected data have a strong impact on the quality of the model. This study considers the system identification and model validation process based on data collected from a wave tank test of a model-scale wave energy converter. Experimental design and data processing techniques based on general system identification procedures are discussed and compared with the practices often followed for wave tank testing. The general system identification processes are shown to have a number of advantages. The experimental data is then used to produce multiple models for the dynamics of the device. These models are validated and their performance is compared against one and other. While most models of wave energy converters use a formulation with wave elevation as an input, this study shows that a model using a hull pressure sensor to incorporate the wave excitation phenomenon has better accuracy.

The continuous casting process of helical fiber reinforced metal matrix composites was proposed, and the experimental equipment was designed and manufactured. The relationship model be-tween the process parameters and the helical shape of the fibers in the metal matrix is analyzed by differential geometry. Helical carbon fiber reinforced lead matrix composites were prepared under different conditions. When the melting temperature and cooling intensity were increased, the helical radius of helical carbon fiber in lead matrix was increased. When the fiber rotation speed was increased, the helical radius was decreased, and the helical pitch was de-creased proportionally. The experimental results are consistent with the process model. Carbon fiber rein-forced aluminum composites were prepared. Scanning electron microscopy showed that the infiltration between the aluminum matrix and the carbon fiber was not complete. As the volume fraction of carbon fiber which was added in composites is too small, the mechanical properties of the composites have not been significantly improved.

This paper systematically discusses the application of reinforcement learning in automatic driving system. Reinforcement learning frameworks show significant advantages in optimizing decision making, predictive perception, path planning, and controller design, exceeding the limitations of traditional supervised learning methods. The paper highlights the critical role of components such as scene understanding, positioning, and map making in autonomous driving systems, which provide reliable environmental awareness through deep learning and sensor fusion technologies to support intelligent decision-making in complex urban environments. In addition, the paper discusses innovative approaches to safety reinforcement learning to reduce risk in autonomous driving and ensure that systems adhere strictly to safety constraints while maximizing expected rewards. These findings provide an important theoretical and practical basis for further improving algorithm robustness, managing multi-agent interactions, and integrating ethical considerations in the future.

Vibration problems have become one of the most important factors affecting robot performance. To this end, a terminal residual vibration suppression method based on joint trajectory optimization is proposed to improve the accuracy and stability of robot motion. Firstly, based on the characteristics of the friction nonlinearity due to joint coupling and physical feasibility of dynamic parameters, a semidefinite programming method is used to identify dynamic parameters with actual physical meaning, thereby obtaining an accurate dynamic model. Then, based on the result of the residual vibration time domain analysis, a joint trajectory optimization model with the goal of minimizing joint tracking error is established. The Chebyshev collocation method is used to discretize the optimization model. The dynamic model is used as the optimization constraint, and barycentric interpolation is used to obtain the optimized joint motion trajectory. Finally, industrial robot experiments prove that the vibration suppression method proposed in this article can reduce the maximum acceleration amplitude of residual vibration by 62% and the vibration duration by 71%. Compared with the input shaping method, the method proposed in this paper can reduce the terminal residual vibration more effectively and ensure the consistency of running time and trajectory.

The impact of antecedent soil moisture content on soil erosion is a complicated phenomenon, which is still under argument with contradictions in research results. Hence, the objective of this study is to investigate the impact of antecedent soil moisture content to soil loss on clay soil by conducting two-year field experiments under natural rainfall on runoff plots with length of 10 meters, width of 3 meters, and uniform slope of 9%. Volumetric soil moisture sensors were used to log soil moisture changes, and soil moisture readings were used along with rainfall records to quantify the antecedent soil moisture conditions for each rainfall event. Results of this study show duration of the effective erosion event outranks the antecedent volumetric soil moisture content. Field study also suggests that accumulative rain falling within 48 hours (Pp48) prior to an effective erosion event strongly correlated with soil loss per Rainfall-Runoff Erosivity Index (Soil Loss / EI30), particularly when the duration of an effective erosion event is either between 3 ~ 7 hours or 10~ 30 hours. Hence, Pp48 can be considered as an alternative to replace antecedent soil moisture content in RUSLE 2’s cover and management factor.

Based on the dynamic strength variation mechanism of concrete under complex loading conditions, two approaches were devised: numerical testing and CT scanning, guided by the principle of minimizing energy dissipation. A methodology for calculating concrete's failure area and measuring its strength was developed. The analysis delves into the mechanisms behind failure patterns and variations in concrete specimen strength, focusing on crack initiation, development, and the resultant failure surface formed by crack propagation, along with the stress distribution in concrete specimens subjected to diverse loading conditions. Through evaluating the strength and computed failure area of concrete specimens, it is evident that the loading method influences both the strength and failure area of concrete specimens. In general, a larger failure area correlates with a higher measured strength.

The increasing complexity of the space flight program and the increase in the duration of missions require improvement of psychological monitoring tools for astronauts in orbit. The article summarizes the experience of using quantitative content analysis of communication between the crews and the Mission control center (MCC). This method allows to assess dynamics of astronaut’s psycho-emotional state, to identify the communicative style, and to detect the communication phenomena of board-MCC communication. The method is based on a combination of coping strategies approach by Lazarus and Folkman as well as B.F. Lomov’s concept about the three functions of communication. We found influence of workload on the structure and volume of communication, defined the main stable communication styles of crewmembers, and confirmed presence of the emotional transfer phenomenon. We detected that astronauts successfully solve problems that arise in orbit using the capabilities of their communication style. An ineffective MCC communication style the leads to the psycho-emotional ill-being manifesting in emotional transfer phenomenon. The presence of “third quarter” phenomenon was not confirmed by materials from six-month space flights.

The well-known coupling between the magnetic and electric fields in electromagnetic radiation is revisited in light of the recent introduction of a microscopic theory for the Ørsted magnetic field induction. I argue that, if the Ørsted magnetic field induction does indeed have a microscopic origin rather than the continuum solution offered by the Maxwell-Ampere equation, the "electromagnetic wave"' propagating in vacuum will not have a magnetic component.

Background: Recently some photon models of a Wigner's friend experiment have led investigators to suggest objective reality does not exist, and to publish non-academic articles with such claims. The public is not equipped to evaluate the severe limitations of these experiments. The separation of Wigner from the experiment and use of only reversible coherent processes for the friend allow operations that are not possible in ordinary reality according to the latest quantum research. Methods: We suggest directly testing the implied claim that objective reality, including incoherent objects with irreversible non-destructive memory, can be held in superposition. We suspect it will fail, but provide for a graduated approach that may discover something about the conditions for superposition collapse. To this end we design a thought experiment to model the objective world, investigating under what conditions experimenters in the same world (ensemble member) will be able to record a result and find it does not appear to change. An observer has a viewing apparatus and a memory apparatus. A second uncorrelated viewer of the same recorded result is employed to obtain objectivity. By hypothesis the uncorrelated second viewer obtains the same view of the measurement record as the first observer. There are not two measurements. This is not an investigation of hidden variables. Results: To model the objective world, incoherent and irreversible processes must be included. To test for superposition, coherence has to be established. These seem to present a contradiction. Conclusions: The thought experiment has suggested new places to look other than size for the origin of objective reality from the quantum world, casts doubt on the Many-Worlds interpretation, and provides a method of testing it.

The realization of a perfect absorber A = 1 with transmittance and reflectance T=R=0 by a thin metasurface is one of the hot topics in recent nanophotonics prompted by energy harvesting and sensor applications (A + R + T =1 is the energy conservation). Here we tested optical properties of over 400 structures of metal-insulator-metal (MIM) metasurfaces for a range of variation in thickness of insulator, the diameter of a disc and intra-disc distance experimentally and numerically. Conditions of a near-perfect absorption A > 95% with simultaneously occurring anti-reflection property (R < 5%) were experimentally determined. Differences between the bulk vs. nano-thin film properties at mid-IR of the used materials can be of interest for plasmonic multi-metal alloys and high entropy metals.

We introduce and analyse a simple formal thought experiment designed to reflect a qualitative decision dilemma humanity might currently face in view of climate change. In it, each generation can choose between just two options, either setting humanity on a pathway to certain high wellbeing after one generation of suffering, or leaving the next generation in the same state as this one with the same options, but facing a continuous risk of permanent collapse. We analyse this abstract setup regarding the question of what the right choice would be both in a rationality-based framework including optimal control, welfare economics and game theory, and by means of other approaches based on the notions of responsibility, safe operating spaces, and sustainability paradigms. Despite the simplicity of the setup, we find a large diversity and disagreement of assessments both between and within these different approaches.

Contaminants of Emerging Concern (CECs), a new category of contaminants in limelight, is a major issue of global concern. The pervasive nature of CECs and its harmful effects, such as cancer, reproductive disorders, neurotoxicity etc., make the situation alarming. The perilous nature of CECs lies in the fact that even very small concentration of CECs can cause great impacts on living beings. It also has a nature of bioaccumulation. Thus, it is the ultimate need to have efficient sensors for detection of CECs to ensure safe living environment. Electrochemical sensors are an efficient platform for CEC detection as they are highly selective, sensitive, stable, reproducible, and prompt, and can detect very low concentrations of analyte. Major classes of CECs are pharmaceuticals, illicit drugs, personal care products, endocrine disruptors, newly registered pesticides, and disinfection by-products. This review focusses on CECs, including their sources and pathways, health effects caused by them, and electrochemical sensors as reported in literatures under each category for the detection of major CECs.

In this note, I analyze the data generated by M. Fodje's (2013) simulation programs "epr-simple" and "epr-clocked". They were written in Python and published on Github. Inspection of the program descriptions shows that they make use of the detection-loophole and the coincidence-loophole respectively. I evaluate them with appropriate modified Bell-CHSH type inequalities: the Larsson detection-loophole adjusted CHSH, and the Larsson-Gill coincidence-loophole adjusted CHSH (NB: its correctness is conjecture, we do not have proof). The experimental efficiencies turn out to be approximately eta = 81% (close to optimal) and gamma = 55% (far from optimal). The observed values of CHSH are, as they should be, within the appropriately adjusted bounds. Fodjes' detection-loophole model turns out to be very, very close to Pearle's famous 1970 model, so the efficiency is close to optimal. The model has the same defect as Pearle's: the joint detection rates exhibit signaling. Fodje's coincidence-loophole model is actually a clever modification of his detection-loophole model. Because of this, however, it cannot lead to optimal efficiency.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Accurate measurement of systemic financial risk is critical to maintaining the stability of financial markets. Taking China as the subject of investigation, the Chinese Financial Stress Index (CFSI) indicator system was con-structed by integrating six dimensions and employing Gray Relation Analysis (GRA) for dimensionality reduction of the indicators. The CFSI was derived using the Attribute Hierarchy Model (AHM) method with the Criteria Importance Through the Intercriteria Correlation (CRITIC) method, and an Improved Gravitational Search Algorithm (IGSA) optimized Radial Basis Function Neural Network (RBFNN) was proposed for out-of-sample prediction of CFSI trends from 2024 to 2026. By analyzing the trend of financial pressure indicators, the relationship between financial pressure and economic activity can be effectively identified. The research findings indicate that: (1) The CFSI is capable of accurately reflecting the current financial stress situation in China; (2) The IGSA-RBFNN demonstrates good robustness and generalization capabilities, predicting that the CFSI index will reach a peak value of 0.543 by the end of 2024, and there exists a regular pattern of stress rebound towards the end of each year. The novel methodology benefits policymakers and regulatory authorities to formulate preventive measures and risk management by identifying potential risks and vulnerabilities in advance.

This paper presents three approaches to estimating battery parameters of the electrical equivalent circuit model (ECM) based on electrochemical impedance spectroscopy (EIS); these approaches are referred to as (a) least squares (LS), (b) exhaustive search (ES), and (c) nonlinear least squares (NLS). The ES approach is assisted with the LS method for the rough determination of the lower and upper bound of the ECM parameters, and the NLS approach is incorporated with the Monte Carlo run such that different initial guesses can be assigned to improve the goodness of EIS fitting. The proposed approaches are validated using both simulated and real EIS data. Compared to LS approach, the ES and NLS approaches show better fitting accuracy at various noise levels; whereas both in the validation using simulated EIS data and actual EIS data collected from LG 18650 and Molicel 21700 batteries, the NLS approach shows better fitting accuracy than that of LS and ES approaches. In all cases, compared with the ES approach, the computational time of the NLS approach is significantly faster, and compared with the LS approach, the NLS approach shows a minimal difference in computational time and considerably better fitting performance.

This study investigates the effects of Zinc (4wt.%) and severe plastic deformation on the mechanical properties of AZ61 magnesium alloy through the stir-casting process. The severe plastic deformation (equal channel angular pressing (ECAP)) has been done followed by T4 heat treatment. The microstructural examinations revealed that the addition of 4wt.%Zn enhances the uniform distribution of β-phase, contributing to a more uniformly corroded surface in corrosive environments. Additionally, dynamic recrystallization (DRX) significantly reduces the grain size of as-cast alloys after undergoing ECAP. The attained mechanical properties demonstrate that after a single ECAP pass, AZ61 + 4wt.%Zn alloy exhibits optimal yield strength (YS), ultimate compression strength (UCS), and hardness. This research highlights the promising potential of AZ61 + 4wt.%Zn alloy for enhanced mechanical and corrosion-resistant properties, offering valuable insights for applications in diverse engineering fields.

In 2020 the world experienced the threat of the COVID-19 epidemic, as seniors and chronic disease patients typically try to reduce their exercise and social activities to avoid increasing the risk of infection, which could lead to increased loneliness and even many diseases. This research combining golf croquet games with AIoT companion robots constructs a home-based intelligent exercise system thus uses the Technology Acceptance Model (TAM), deduces users’ intention to use this system based on perceived usefulness and perceived ease of use, and adds the needs of love and belonging, esteem, cognitive, aesthetic, and self-actualization in Maslow’s needs theory to conduct system needs analysis. The analysis results show that participants have a high level of acceptance of this system, believing that it is easy to learn and operate, can increase interaction with others, also found that this system can improve self-confirmation, satisfying the third for knowledge, feeling happy, and self-actualization needs are easier to fulfill. In the future, we shall collect and record the seniors in the process of use, so as to find out their health problems as soon as possible, expand their daily life through this exercise, and achieve the goal of happy living and health care.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

(1) Background: Ectopic pregnancy (EP) is when fertilized ovum implanted outside of uterine cavity. The incidence was 1.5% to 2.0% of all pregnancies [1, 2]. EP decreases fertility ability [3]. This study focused on the pregnancy rate after EP and various parameters influencing pregnancy. (2) Methods: The data was extracted from National Health Insurance Research Database (NHIRD) during 2000-2013. The study group enrolled women with one EP history. Those who did not have EP was put into the control group. Chi-square/Fisher exact test was performed on category variable and t-test was used on continue variables. (3) Results: The EP group had a higher cumulative rate of conceive, 41.55% than control group, 37.14% and 1.16 times higher risk in developing pregnancy (P&lt;0.001). The conceiving rate was lower than the control group in the first 5 years, but higher than the control group in the 10th to 14th years. (4) Conclusions: The fecundability after EP is lower at the beginning, but regained after long term follow.

Spacecraft recovery technology is crucial in the field of aerospace, in which the parachute plays a key role in slowing down the descent speed of the spacecraft and realizing a smooth landing. In order to construct a dynamically adjustable parachute deployment strategy, it is necessary to measure the parachute dynamic load accurately in real time. However, the existing sensor measurement scheme is difficult to meet the measurement requirements due to its large structure and complex wiring. In order to meet the current demand for real-time measurement of parachute cords dynamic load, a miniature measuring instrument is designed.According to the function and technical requirements of the miniature measuring instrument, the hardware modules of the acquisition system are selected and designed, and the integration debugging and performance optimization of the microcontroller module, A/D sampling module, signal acquisition circuit and power supply module are carried out. The software of the parachute cords tension acquisition system based on the miniature measuring instrument is developed. The elastomer is modeled by using SolidWorks and statically analyzed by using AnsysWorkbench finite element analysis software. Then the final structure of the elastomer and the pasting position of the strain gage are determined through the results analysis as well as experimental verification. The hardware module of the signal acquisition system for the miniature measuring instrument is then encapsulated. The force value of the miniature measuring instrument is calibrated and tested many times by using the microcomputer-controlled electronic universal testing machine. The experimental results show that the designed miniature measuring instrument has accurate data, strong stability and good real-time performance, which meets the demand for real-time accurate measurement of miniature measuring instrument, and can provide reliable data for parachute cords parameter validation and stepless unfolding design.

The major goal of this paper is to use image enhancement techniques for enhancing and extracting data in FANET applications to improve the efficiency of surveillance. The proposed conceptual system design can improve the likelihood of FANET operations in oil pipeline surveillance, and sports and media coverage with the ultimate goal of providing efficient services to those who are interested. The system architecture model is based on current scientific principles and developing technologies. A FANET, which is capable of gathering image data from video-enabled drones, and an image processing system that permits data collection and analysis are the two primary components of the system. Based on the image processing technique, a proof of concept for efficient data extraction and enhancement in FANET situations and possible services is illustrated

A ducted photovoltaic façade (DPV) unit Studied using experimental Prototype and simulated in a full scale Computational Fluid Dynamics CFD Model. The Study comes in two parts; This is Part I with the title detailed above and Part II titled ‘A Ducted Photovoltaic Façade Unit with Buoyancy Cooling: Part II CFD Simulation’.. The process adopted in the experimental study is replicated in the simulation Part. The aim was to optimize the duct width behind the solar cells to allow for maximum buoyancy-driven cooling for the cells during operation. Duct widths from 5 to 50 cm were tested in a Proto-type. A duct width of 45 cm had the maximum calculated heat removed from the duct; however, the lowest cell-operating temperature was reported for duct width of 50 cm. It was found that the DT between ducts' inlets and outlets range from 5.47 °C to 12.32 °C for duct widths of 5–50 cm, respectively. The ducted system enhanced module efficiency by 12.69% by reducing PV temperature by 27 °C from 100°C to 73 °C. The maximum calculated heat recovered from the ducted PV system is 422 W. This is 47.98% from the incident radiation in the test. Total summation of heat recovered and power enhanced by the ducted system is 61.67%.

In this paper we study a class of impulsive delayed neural networks with parameter uncertainties and reaction-diffusion terms. Using the properties of M-matrices and some inequality techniques, some sufficient conditions are derived to guarantee the global exponential stability of the given system. The results obtained are presented by simple algebraic inequalities, which are certainly more concise than previous methods. Finally, the validity and usefulness of our results are illustrated by arithmetic examples.

Recommender Systems (RecSys) are crucial in managing information overload and enhancing user satisfaction across various digital platforms, including e-commerce and entertainment. Evolving from traditional models to Deep Neural Networks (DNNs) and, more recently, Large Language Models (LLMs), these systems leverage sophisticated algorithms to analyze user behaviors and preferences. LLMs, such as GPT-4, are trained on extensive datasets to comprehend and generate natural language, significantly advancing their ability to deliver personalized recommendations. This tutorial explores the transformative impact of LLMs on RecSys, discussing their development, application in handling complex datasets, and the integration of contextual insights. Real-world examples illustrate how LLMs enhance recommendation accuracy and user experience, highlighting challenges and future directions in the field.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

Over the past couple of decades, Global positioning system (GPS) technology has been utilized to collect large-scale data from travel surveys. As the precise spatiotemporal characteristics of travel could be provided by GPS devices, the issues of traditional travel survey, such as misreporting and non-response, could be addressed. Considering the defects of dedicated GPS devices (e.g., need much money to buy devices, forget to take devices to collect data, limit the simple size because of the number of devices, etc.), and the phenomenon that the smartphone is becoming one of necessities of life, there is a great chance for the smartphone to replace dedicated GPS devices. Although, several general reviews have been done about smartphone-based GPS travel survey in the literature review section in some articles, a systematic review from smartphone-based GPS data collection to travel mode detection has none. The included studies were searched from six databases. The purpose of this review is to critically assess the current literature on the existing methodologies of travel mode detection based on GPS raw data collected by smartphones. Meanwhile, according to the systematic comparison among different methods from data-preprocessing to travel mode detection, this paper could carefully provide the Strengths and Weaknesses of existing methods. Furthermore, it is the crucial step to develop the methodologies and applications of GPS raw data collected by smartphones.

This paper proposed emotion recognition methods for consecutive facial images, and implements the inference of neural network model on a field-programmable gate array (FPGA). The proposed emotion recognition methods are based on a neural network model architecture that combines convolution neural networks (CNNs), long short-term memory (LSTM), and fully connected neural networks (FCNNs), called CLDNN or ConvLSTM-FCN. This type of neural network mod-el can analyze the local feature sequences obtained through convolution of data, making it suita-ble for processing time-series data such as consecutive facial images. In this paper, sequences of facial images are sampled from videos corresponding to various emotional state of subjects. The sampled images are then pre-processed with the processes includes facial detection, greyscale conversion, resize, and data augmentation if necessary. The 2-D CNN in ConvLSTM-FCN is used for feature extraction for these pre-processed facial images. These sequences of facial im-age features are time sequences with dependent properties between the elements within them. The LSTM is then used to model these time sequences followed by fully connected neural net-works (FCNNs) for classification. The proposed consecutive facial emotion recognition method achieves an average recognition rate of 99.51% on RAVDESS dataset, 87.80% on BAUM-1s dataset and 96.82% on eNTERFACE’05 data set, using 10-fold cross-validation on the PC. Some com-parisons of recognition accuracies between the proposed method and the other existing related works are conducted in this paper. According to the comparisons, the proposed emotion recog-nition methods outperform the existing related researches. The proposed emotion recognition methods are then implemented on an FPGA chip using the neural network model inference algo-rithms in this paper, and the accuracies of the experiments conducted on the FPGA chip are iden-tical to those obtained on the PC. This verifies that the proposed neural network model imple-mented on the FPGA chip performs well.

Antibiotic resistance (ABR) is concerning issue due to its direct and indirect repercusions on public health, since decreased therapeutic effect of certain antibiotic to treatment complications that can cause death. There are several mechanism as to how ABR can be transferred from one microoorganisms to another, and many of them are dependant many environmental factors. The food supply chain is a environment in which ABR gene transfer can occur is multiple pathways, which generate concerns regarding food safety. Here, we summarize relevant mechanisms which are implied in ABR in food supply chain but also we are addressing routes of transmission and prevalence of ABR, implications on public health, and the application of new alternatives to antibiotics such as antimicrobial peptides, mainly bacteriocins, in order to countermeasure ABR.

The foot-mounted inertial navigation system is an important application of pedestrian navigation as it in principle does not rely any external assistance. A real-time range decomposition constraint method is proposed in this paper to combine the information of dual foot-mounted inertial navigation systems. It is well known that low-cost inertial sensors with ZUPT (zero-velocity update) and range decomposition constraint perform better than in either single way. This paper recommends that the distance of separation between the position estimates of feet-mounted inertial navigation systems be restricted in the ellipsoidal constraint which relates to the maximum step and leg height. The performance of the proposed method is studied utilizing experimental data. The results indicate that the method can effectively correct the dual navigation systems’ position over the existing spherical constraint.